Salt tolerance related protein gmxth32, and related biomaterial and use thereof

Abstract

Provided are a salt tolerance related protein GmXTH32 having an amino acid sequence as shown in sequence 2, and a related biomaterial and use thereof. The use comprises: improving salt tolerance of plants and / or preparing products for improving salt tolerance of plants; and improving the survival rate of plants under salt stress and / or preparing products for improving the survival rate of plants under salt stress. The salt tolerance of plants can be changed by regulating and controlling the expression level of a coding gene of the protein in the plants, and the salt tolerance of the plants can be improved by reducing the expression level of the coding gene of the protein.

Description

Salt tolerance-related protein GmXTH32 and its related biomaterials and applications Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a salt-tolerance-related protein GmXTH32 and related biomaterials and applications thereof. Background Art

[0002] Changes in physical and chemical environmental factors, such as drought, salinity, cold damage, frost damage, and waterlogging, contribute significantly to crop yield declines. Statistics from the US insurance industry covering crop yield losses over the 40-year period from 1939 to 1978 show that salt and drought accounted for approximately 40.8% of claims, higher than waterlogging (16.4%), low temperatures (13.8%), hail (11.3%), and wind (7.0%), and far exceeding insect infestations (4.5%), disease (2.7%), and other factors. Therefore, cultivating salt- and drought-tolerant crops is a primary goal of the agricultural industry. In addition to traditional breeding methods, molecular genetics and breeding have become a key area of ​​focus for improving crop salt and drought tolerance.

[0003] Research on plant responses to abiotic stresses has made great progress, and stress tolerance-related genes and networks have been analyzed, laying the foundation for molecular breeding to improve plant tolerance to abiotic stresses.

[0004] Xyloglucan is the primary hemicellulose in the secondary cell walls of dicots and non-gramineous monocots. Xyloglucan endotransglycosylase / hydrolase (XTH) is widely present in various plant tissues and cells. It catalyzes the breakage and reconnection of xyloglucan, thereby modifying the cell wall cellulose-xyloglucan complex and achieving cell wall reconstruction. It is one of the key enzymes in the cell wall reconstruction process. During plant growth, XTH proteins not only relax the cell wall but also participate in cell wall synthesis and strengthen it. They also have the function of degrading the cell wall. Higher plants typically contain 20-60 XTHs, which can be divided into three major categories: I, II, and III based on their sequence characteristics. Different families also have different functions.

[0005] Hormones can regulate the expression of XTHs, and different XTHs have significant differences in their responses to hormones. Gibberellic acid upregulates the expression of rice OsXTH8, which plays a role in cell elongation. Treating soybean hypocotyls with brassinosteroid BR for 2 hours resulted in increased cell wall plasticity, accompanied by increased expression of BRU1. The product of this gene has XTH activity and participates in cell expansion and elongation. The expression of some XTH genes is related to environmental stress, and their overexpression or deletion can increase the plant's tolerance to environmental stress. Arabidopsis AtXTH31 is sensitive to aluminum ions, and its mutant xth31 mutant has reduced xyloglucan content and is resistant to Al. 3+ The Arabidopsis mutants xth17 and xth15 exhibit similar phenotypes. Overexpression of pepper CaXTH3 in Arabidopsis and tomatoes improves drought and salt tolerance in transgenic plants. Overexpression of Populus euphratica PeXTH23 in tobacco promotes leaf fleshiness and improves salt tolerance. Currently, there are no reports of XTH genes negatively regulating salt tolerance. Finding an XTH gene that can regulate plant salt tolerance is a challenge facing researchers in this field.

[0006] Invention Disclosure

[0007] The technical problem to be solved by the present invention is how to regulate the salt tolerance of plants, especially to improve the salt tolerance of plants, especially in soybeans.

[0008] In order to solve the above technical problems, this application provides the following applications.

[0009] Use of GmXTH32, a substance that regulates the expression of a gene encoding GmXTH32, or a substance that regulates the content of the GmXTH32 protein in any of the following;

[0010] A1) application in improving plant salt tolerance and / or application in preparing a product for improving plant salt tolerance;

[0011] A2) application in improving the survival rate of plants under salt stress and / or application in preparing a product for improving the survival rate of plants under salt stress;

[0012] A3) application in improving the survival rate of plants under salt stress and / or application in preparing a product for improving the survival rate of plants under salt stress;

[0013] The GmXTH32 is any of the following proteins:

[0014] B1) The amino acid sequence is the protein shown in SEQ ID NO: 2;

[0015] B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1) and having an identity of 80% or more to the protein described in B1) and having the same function;

[0016] B3) A fusion protein obtained by linking the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

[0017] Sequence 2 is as follows:

[0018] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0019] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0020] In the above proteins, the above 80% or greater identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0021] In the above protein, sequence 2 (SEQ ID No. 2) consists of 302 amino acid residues. It is named GmXTH32 protein. Its encoding gene is GmXTH32 gene.

[0022] In the present application, the regulation may be upregulation, enhancement, or increase, and / or knockout, reduction, or decrease.

[0023] In the present application, the substance that upregulates, enhances, or increases the expression of the gene encoding the protein, or the activity or content of the protein, can reduce plant salt tolerance. Knocking out, reducing, or decreasing the expression of the gene encoding the protein, or the activity or content of the protein, can enhance plant salt tolerance.

[0024] In the above application, the protein is derived from soybeans.

[0025] In the above, the soybean may be Kefeng No. 1 or Nannong 1138-2.

[0026] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0027] In the above application, the substance that regulates the expression of the gene encoding the protein is any one of the following:

[0028] B1), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of the gene encoding the above protein or inhibits, reduces or down-regulates the activity or content of the protein;

[0029] B2), expressing the gene encoding the nucleic acid molecule described in B1);

[0030] B3), an expression cassette containing the gene described in B2);

[0031] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);

[0032] B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4);

[0033] B6) a transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4);

[0034] B7) transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4);

[0035] B8) a transgenic plant organ containing the gene described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4);

[0036] B9), a nucleic acid molecule encoding the protein according to claim 1 or 2;

[0037] B10), an expression cassette containing the nucleic acid molecule described in B9);

[0038] B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10);

[0039] B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11);

[0040] B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11);

[0041] B14), transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11);

[0042] B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

[0043] B9) In the nucleic acid molecule, those skilled in the art can readily mutate the nucleotide sequence encoding the GmXTH32 protein of the present invention using known methods, such as directed evolution or point mutagenesis. Artificially modified nucleotide sequences that are 80% or more identical to the nucleotide sequence of the isolated GmXTH32 protein of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the GmXTH32 protein and possess the function of the GmXTH32 protein.

[0044] The aforementioned 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0045] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search to calculate the identity of the amino acid sequence, the value (%) of identity can then be obtained.

[0046] Herein, the vector is well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be pROKII vector;

[0047] In the above-mentioned biological material, the expression cassette described in B10) refers to DNA capable of expressing the gene in the host cell. This DNA may include not only a promoter for initiating gene transcription but also a terminator for terminating gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP," Chao et al. (1999) Plant Physiol 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); heat shock promoters ( U.S. Pat. No. 5,187,267 ); tetracycline-inducible promoters ( U.S. Pat. No. 5,057,422 ); seed-specific promoters, such as the millet seed-specific promoter pF128 ( CN101063139B ( China Patent No. 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., phaseolin, napin, oleosin, and soybean beta-conglycin promoters (Beachy et al. (1985) EMBO J. 4: 3047-3053). These can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0048] In B11) above, the recombinant vector may be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector may be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When using GmXTH32 to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene. As a specific embodiment, the present application uses the pROKII vector as an expression vector.

[0049] As a specific embodiment, the microbial strain in the recombinant microorganism may be Agrobacterium K599.

[0050] In the above application, the nucleic acid molecule described in B9) is a DNA molecule whose nucleotide sequence is shown in Sequence 1.

[0051] Sequence 1 is as follows:

[0052] In the above application, the nucleic acid molecule in B1) is an RNA transcribed from a DNA molecule as shown in formula (I):

[0053] SEQ forward-X-SEQ reverse (I);

[0054] The SEQ forward is a partial fragment of sequence 1; the SEQ reverse sequence is reverse complementary to the SEQ forward sequence; the X is a spacer sequence between the SEQ forward and the SEQ reverse sequence, so that the RNA molecule transcribed from the DNA molecule shown in formula (I) forms a stem-loop structure;

[0055] In the above text, SEQ refers to the nucleic acid fragment No. 91-353 of Sequence 1 in the sequence listing.

[0056] In the above, the X is not complementary to the SEQ forward and the SEQ reverse.

[0057] The expression vector described in B3) is the recombinant vector pZH01-GmXTH32 RNAi. The recombinant plasmid pZH01-GmXTH32 RNAi was obtained by using primers XTH32Ri-F1 between KpnI and restriction endonuclease recognition sites XbaI and SalI, while maintaining the remaining nucleotide sequences of the pZH01 vector unchanged.

[0058] Specifically, the recombinant vector pZH01-GmXTH32 RNAi is prepared by replacing the fragment between the restriction endonuclease recognition sites SacI and KpnI of the pZH01 vector with DNA fragment 2 (nucleotide sequence is SEQ ID NO4), and replacing the fragment between the restriction endonuclease recognition sites XbaI and SalI of the pZH01 vector with DNA fragment 3 (nucleotide sequence is SEQ ID NO5), while keeping the other nucleotide sequences of the pZH01 vector unchanged, to obtain the recombinant plasmid pZH01-GmXTH32 RNAi.

[0059] DNA fragment 2:

[0060] DNA fragment 3:

[0061] In order to solve the above problems, the present application also provides a method for cultivating plants with high salt tolerance.

[0062] The method comprises down-regulating or weakening or reducing the expression level of the gene encoding the above-mentioned protein in the target plant, and / or the activity and / or content of the protein to obtain a high salt-tolerant plant, wherein the salt tolerance of the high salt-tolerant plant is higher than that of the target plant.

[0063] In order to solve the above problems, the present application also provides a method for improving plant salt tolerance.

[0064] The method comprises improving the salt tolerance of plants by down-regulating, weakening or reducing the expression of the gene encoding the above protein in the plant, and / or the activity and / or content of the above protein.

[0065] In the present application, the plant may be soybean. The soybean may be soybean strain Nannong 1138-2.

[0066] In the above method, downregulating, weakening or reducing the expression of the gene encoding the above protein in the plant comprises introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into the target plant.

[0067] Any of the above uses or any of the above methods is characterized in that the plant is any of the following:

[0068] J1) dicotyledons;

[0069] J2) Leguminosae;

[0070] J3) Glycine max;

[0071] J4) Soybean.

[0072] In the present application, the soybean may be soybean variety Nannong 1138-2. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 shows the salt tolerance test of soybean varieties Kefeng 1 and Nannong 1138-2.

[0074] FIG2 is a diagram showing the transcription pattern of the GmXTH32 encoding gene under 120 mM NaCl treatment.

[0075] Figure 3 is a schematic diagram of ProkII-GmXTH32 and GmXTH32-RNAi vectors.

[0076] FIG4 is the expression level identification of transgenic soybean hairy root chimeras carrying the GmXTH32 gene.

[0077] Figure 5 shows the salt tolerance phenotype of the GmXTH32 gene transgenic hairy root chimera.

[0078] Figure 6 shows the statistics of survival rate and relative conductivity of GmXTH32 transgenic chimeras and controls under salt stress.

[0079] Best Mode for Carrying Out the Invention

[0080] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0081] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0082] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0083] The primers used in the following examples were synthesized by Sanbo Biotechnology Co., Ltd.

[0084] The soybean variety Glycine max L. Merr. Kefeng 1 used in the following examples is described in WK Zhang, YJ Wang, GZ Luo, JS Zhang, CY He, XL Wu, JY Gai, SY Chen, QTL mapping often agronomic traits on the soybean (Glycine max L. Merr.) genetic map and their association with EST markers, Theor. Appl. Genet, 2004, 108: 1131-1139. It is referred to as Kefeng No. 1 in this document and is publicly available from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is also known as Kefeng No. 1 soybean.

[0085] Soybean [Glycine max (L.) Merr] Nannong 1138-2 (germplasm bank of the National Soybean Improvement Center of Nanjing Agricultural University, provided by the National Soybean Improvement Center of Nanjing Agricultural University).

[0086] The expression vector pROKII vector (binary expression vector) in the following examples is described in DC Baulcombe, GR Saunders, MW Bevan, MA Mayo and BD Harrison, Expression of biologically active viral satellite RNA from the nuclear genome of transformed plants. Nature 321 (1986), pp. 446–449. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, or purchase it through conventional commercial channels.

[0087] The pZH01 vector is described in the literature Hua-Lin Zhou, et al., Roles of ethylene receptor NTHK1domains in plant growth, stress response and protein phosphorylation, FEBS Letters 580 (2006) 1239–1250. and the literature Han Xiao, et al. Functional analysis of the rice AP3homologue OsMADS16by RNA interference, Plant Molecular Biology, 2003, 52, 957-966. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0088] Agrobacterium rhizogenes K599 is described in Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of root biology, Nature Protocols, 2007, 2(4), 549-552. The public can obtain it from Professor Peter M Gressnon, The University of Queensland, St Lucia, Queensland 4072, Australia, or from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences with the consent of Professor Peter M Gressnon (written consent). It can also be purchased through conventional commercial channels.

[0089] Example 1. Screening of the soybean transcription factor GmXTH32 encoding gene GmXTH32 and its cDNA cloning

[0090] The present invention tested the salt tolerance of Kefeng 1 and Nannong 1138-2. The salt treatment method involved irrigating seedlings grown at 26°C under 14-hour light conditions for 12 days after sowing with a final concentration of 150 mM NaCl solution to induce salt stress. Phenotypes were observed and photographed 14 days after treatment. Figure 1 shows that Kefeng 1 is sensitive to salt stress, while Nannong 1138-2 exhibits much higher salt tolerance than Kefeng 1.

[0091] Transcriptome analysis of Kefeng No. 1 (a salt-sensitive variety) and Nannong 1138-2 (a salt-tolerant variety) under normal and high salt stress conditions identified a gene with the locus Alias: Glyma11g19920 (Locus name: Glyma.11G193600). The transcript level of Glyma11g19920 decreased significantly upon treatment with 120 mM NaCl. Therefore, it is considered that this gene may negatively regulate salt tolerance in plants.

[0092] The salt-tolerant soybean variety Nannong 1138-2 was cultured under light conditions and, after two weeks of growth, seedlings were harvested for RNA extraction. One gram of fresh seedlings was ground in liquid nitrogen and suspended in 4 mol / L guanidine sulfoxide. The mixture was extracted with acidic phenol and chloroform. The supernatant was then added with anhydrous ethanol to precipitate total RNA. The supernatant was then dissolved in water to obtain total RNA. cDNA was synthesized using reverse transcriptase using primers Gm19920-F1 / Gm19920-R1. The primers were: Gm19920-F1: ATGCCATCATCACTATCCTCTTTC (SEQ ID NO: 6); Gm19920-R1: CTAACACTCTGGGATAAATGTGTGG (SEQ ID NO: 7).

[0093] Real-time PCR identification: Real-time PCR reaction was performed using the RealTime PCR Master Mix kit from TOYOBO according to the instructions. Gm19920-F1 / Gm19920-R1 were used as primers to detect the expression level of Glyma.11G193600. The soybean Tublin gene was used as an internal standard. The primers used were Primer-TF: 5'-AACCTCCTCCTCATCGTACT (SEQ ID NO: 8) and Primer-TR: 5'-GACAGCATCAGCCATGTTCA (SEQ ID NO: 9).

[0094] Figure 2 shows that Glyma11g19920 was significantly reduced when treated with 120mM NaCl for 3 hours. The transcription level when not treated was set to 1. The relative transcription amount was about 0.55 when treated for 3 hours, and continued to reach the lowest point of about 0.11 after 20 hours. Sequencing showed that Glyma11g19920 contains 909bp, encoding 302 amino acid residues, and belongs to the plant-specific xyloglucan endoglycosyltransferase / hydrolase (XTH) family. In GenBank, the gene is only described by sequence and is located on chromosome 11, with no functional description. The protein was named GmXTH32. The protein sequence of GmXTH32 is shown in Sequence 1, its CDS is shown in Sequence 1, and its gene sequence is shown in Sequence 3. Sequence 3 is as follows:

[0095] Example 2: Construction of a plant expression vector for soybean transcription factor GmXTH32

[0096] Construction of GmXTH32 overexpression vector pROKII-GmXTH32

[0097] The cDNA of Nannong 1138-2 was used as a template and PCR amplification was performed using GmXTH32-pROKII-F2 and GmXTH32-pROKII-R2 to obtain PCR products.

[0098] GmXTH32-pROKII-F2:

[0099] GmXTH32-pROKII-R2:

[0100] The pROKII vector was double-digested with restriction endonucleases BamHI and KpnI, and the PCR product fragments obtained above were ligated into the pROKII vector using homologous recombination [Seamless Assembly Cloning Kit (Clone Smarter, C5891-50)]. The ligated vector was transformed into DH5ɑ, and a single colony was picked for culture and plasmid sequencing. The single colony with correct sequencing was named DH5ɑ / recombinant vector pROKII-GmXTH32. DH5ɑ / recombinant vector pROKII-GmXTH32 is a DH5 strain containing the recombinant vector pROKII-GmXTH32. The recombination site of the recombinant vector pROKII-GmXTH32 is shown in Figure 3 (Figure 3).

[0101] The recombinant plasmid pROKII-GmXTH32 is obtained by replacing the fragment between the restriction enzyme recognition sites BamHI and KpnI of the pROKII vector with DNA fragment 1 (nucleotide sequence is SEQ ID NO.1), keeping the other nucleotide sequences of the pROKII vector unchanged, and obtaining the recombinant plasmid pROKII-GmXTH32 (also known as recombinant vector pROKII-GmXTH32 or vector pROKII-GmXTH32).

[0102] Construction of GmXTH32 RNAi expression vector pZH01-GmXTH32-RNAi

[0103] First, total RNA from soybean Kefeng 1 ('KF1') was extracted using the Trizol method. The cDNA obtained by reverse transcription was used as a template. The RNAi vector was pZH01. The 91-353 bp fragment of the CDS (SEQ ID NO 1) was selected to construct the RNAi vector:

[0104] The primers for RNAi-1 construction are as follows:

[0105] Xba I Sac I

[0106] Sal I Kpn I

[0107] cDNA was amplified using XTH32Ri-F1 and XTH32Ri-R1 as templates to obtain amplified products. The products were first digested with Sac I and Kpn I for the first ligation and then digested with Xba I and Sal I for the second ligation. The above-constructed vectors were sequenced to verify the correct construction and obtain the recombinant vector pZH01-GmXTH32 RNAi for the next experiment.

[0108] The recombinant vector pZH01-GmXTH32 RNAi is prepared by replacing the fragment between the restriction endonuclease recognition sites SacI and KpnI of the pZH01 vector with DNA fragment 2 (nucleotide sequence is SEQ ID NO 4), and replacing the fragment between the restriction endonuclease recognition sites XbaI and SalI of the pZH01 vector with DNA fragment 3 (nucleotide sequence is SEQ ID NO 5), while keeping the other nucleotide sequences of the pZH01 vector unchanged, thereby obtaining the recombinant plasmid pZH01-GmXTH32 RNAi.

[0109] DNA fragment 2:

[0110] DNA fragment 3:

[0111] Example 4: Obtaining GmXTH32 Transgenic Soybean Hairy Roots

[0112] The Agrobacterium rhizogenes infection method was slightly modified based on the method of Attila Kereszt et al. (Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of root biology, Nature Protocols, 2007, 2(4), 549-552). Please refer to Wang, Fang; Chen, Hao-Wei; Li, Qing-Tian; Wei, Wei; Li, Wei; Zhang, Wan-Ke; Ma, Biao; Bi, Ying-Dong; Lai, Yong-Cai; Liu, Xin-Lei; Man, Wei-Qun; Zhang, Jin-Song; Chen, Shou-Yi, GmWRKY27 interacts with GmMYB174 to reduce expression of GmNAC29 for stress tolerance in soybean plants, 2015, The Plant Journal, 83, 224–236, or authorized patent Chen Shouyi et al., Plant stress tolerance-related transcription factor GmWRKY78 and its encoding gene and application, authorization number: ZL201110053083.7, authorization date 2013.10.09.

[0113] Obtaining Hairy Roots by Overexpressing GmXTH32 and GmXTH32-RNAi

[0114] 1) Obtaining recombinant Agrobacterium

[0115] The recombinant plasmid pROKII-GmXTH32 and recombinant vector pZH01-GmXTH32RNAi obtained above were introduced into Agrobacterium rhizogenes K599 (commercially available) by electroporation, resulting in Agrobacterium K599 / recombinant plasmid pROKII-GmXTH32 and Agrobacterium K599 / recombinant vector pZH01-GmXTH32RNAi. Agrobacterium K599 / recombinant plasmid pROKII-GmXTH32 is Agrobacterium K599 containing the recombinant plasmid pROKII-GmXTH32, while Agrobacterium K599 / recombinant vector pZH01-GmXTH32RNAi is Agrobacterium K599 containing the recombinant vector pZH01-GmXTH32RNAi.

[0116] The same method was used to obtain Agrobacterium K599 / pROKII and Agrobacterium K599 / pZH01. Agrobacterium K599 / pROKII is Agrobacterium K599 containing the pROKII vector, and Agrobacterium K599 / pZH01 is Agrobacterium K599 containing the pZH01 vector.

[0117] 2) Hairy root transformation

[0118] Six-day-old, two-leaf, soybean seedlings (Glycine max No. 1) were inoculated with the aforementioned Agrobacterium K599 / recombinant plasmid pROKII-GmXTH32 and Agrobacterium K599 / recombinant vector pZH01-GmXTH32 RNAi using a syringe. The specific method is as described above for Agrobacterium rhizogenes infection. The seedlings were kept moisturized with a 16-hour light cycle, a temperature of 25°C, and a humidity of 50%. After two weeks, hairy roots were generated and molecular identification was performed to confirm that the generated hairy roots were transgenic.

[0119] A total of 123 hairy root chimeric plants transformed with the recombinant plasmid pROKII-GmXTH32 (also known as XTH-OE, GmXTH-OE, or GmXTH3-OE) and 121 hairy root chimeric plants transformed with the recombinant vector pZH01-GmXTH32RNAi (also known as XTH-Ri, GmXTH-Ri, or GmXTH32-Ri) were obtained for further transgenic identification and salt tolerance testing.

[0120] The same method was used to transform Agrobacterium rhizogenes K599 / pROKⅡ (pZH01 vector) containing the empty vector pROKⅡ (pROKII vector) into the roots of 6-day-old soybean seedlings with two true leaves. 127 pROKⅡ empty-vector hairy root chimera plants (also called empty-vector hairy roots or controls) were obtained as experimental controls.

[0121] 3) Molecular identification of transgenic hairy roots

[0122] A small piece of transgenic hairy root was extracted from each of the 123 hairy root chimeric plants transformed with the recombinant plasmid pROKII-GmXTH32, and the total RNA of all hairy roots was extracted and reverse transcribed into cDNA to obtain the total cDNA of the hairy roots of the 123 hairy root chimeric plants transformed with the recombinant plasmid pROKII-GmXTH32. The same method was used to obtain the total cDNA of the hairy roots of 121 hairy root chimeric plants transformed with the recombinant vector pZH01-GmXTH32 RNAi and the total cDNA of 127 hairy root chimeric plants transformed with the pROKⅡ empty vector.

[0123] GmXTH32 gene expression was analyzed using the three total cDNAs described above, using Gm19920-F1 (ATGCCATCATCACTATCCTCTTTC) (SEQ ID NO: 6) and Gm19920-R1 (CTAACACTCTGGGATAAATGTGTGG) (SEQ ID NO: 7). The soybean GmTubulin gene was used as an internal standard, and the primers used were Primer-TF (5'-AACCTCCTCCTCATCGTACT) (SEQ ID NO: 8) and Primer-TR (5'-GACAGCATCAGCCATGTTCA) (SEQ ID NO: 9). The experiment was repeated three times, and the results are presented as mean ± SD. Figure 4 shows (the control is a chimeric plant transfected with pROKⅡ, the XTH-OE is a chimeric plant transfected with the recombinant plasmid pROKII-GmXTH32, and the XTH-Ri is a chimeric plant transfected with the recombinant vector pZH01-GmXTH32 RNAi). The expression levels of GmXTH32 in the control, overexpressing GmXTH32 (OE), and GmXTH32-RNAi hairy roots were approximately 0.37, 8.65, and 0.18, respectively. The expression level of GmXTH32 in the overexpressing GmXTH32 (OE) was extremely significantly higher than that in the control, while the expression level of GmXTH32 in the GmXTH32-RNAi hairy roots was significantly lower than that in the control (Figure 4).

[0124] Example 5: Identification of salt tolerance of GmXTH32-transgenic and GmXTH32-RNAi hairy roots

[0125] The experimental samples were hairy root chimeric plants transformed with the recombinant plasmid pROKII-GmXTH32, hairy root chimeric plants transformed with the recombinant vector pZH01-GmXTH32 RNAi, and hairy root chimeric plants transformed with the pROKII empty vector.

[0126] The transgenic plants were cultured at 26°C under 14-hour light conditions and grown to the two-leaf stage. The roots of the hairy root chimera plants transformed with the recombinant plasmid pROKII-GmXTH32, the hairy root chimera plants transformed with the recombinant vector pZH01-GmXTH32 RNAi and the hairy root chimera plants transformed with the pROKII empty vector were randomly divided into two groups: an experimental group (treated with 120 mM NaCl for 3 days) and a control group (hydroculture). In the experimental group, 30 hairy root chimera plants transformed with the recombinant plasmid pROKII-GmXTH32, the hairy root chimera plants transformed with the recombinant vector pZH01-GmXTH32 RNAi and the hairy root chimera plants transformed with the pROKII empty vector (control) were randomly selected and inoculated with 120 mM NaCl. The plants were hydroponically cultured in NaCl aqueous solution at 25°C for 3 days. Thirty plants of the control group, including the recombinant plasmid pROKII-GmXTH32 hairy root chimera plants, the recombinant vector pZH01-GmXTH32 RNAi hairy root chimera plants, and the pROKII empty vector hairy chimera plants, were immersed in clean water and hydroponically cultured at 25°C for 3 days. After the culture was completed, the growth status was observed and photographed, and the survival rate and NaCl treatment ion permeability were calculated and tested. The biological experiment was repeated three times, and the results were expressed as the mean ± standard deviation.

[0127] The ion permeability test for NaCl treatment is as follows: soybean leaves are cut and placed in a clean screw-top glass bottle. Rinse three times with deionized water. Then, add 80 mL of deionized water to completely immerse the leaves and evacuate the solution for 45 minutes. After standing at room temperature for 30 minutes, the conductivity (E1) is measured using a conductivity meter (DDC-308A, Shanghai Boyu Instrument Co., Ltd.). The leaves are then boiled for 15 minutes, cooled to room temperature, mixed, and the conductivity (E2) is measured using a conductivity meter. Relative ion permeability (EL) (%) = E1 / E2 x 100, where E1 and E2 represent the conductivity.

[0128] The results are shown in Figure 5. The control is a chimeric plant transfected with pROKⅡ, GmXTH32-OE is a chimeric plant transfected with the recombinant plasmid pROKII-GmXTH32, GmXTH32-Ri is a chimeric plant transfected with the recombinant vector pZH01-GmXTH32 RNAi, a chimeric plant transfected with the pROKⅡ empty vector, and two transgenic chimeric plants and leaf phenotypes. It can be seen that there is no significant difference in the growth of hairy roots among the chimeric plants transfected with the recombinant plasmid pROKII-GmXTH32, the chimeric plants transfected with the recombinant vector pZH01-GmXTH32 RNAi, and the pROKⅡ empty vector in hydroponic culture (control group, plants were immersed in clean water for hydroponic culture and treated at 25°C for 3 days), the chimeric plants transfected with the recombinant plasmid pROKII-GmXTH32, the chimeric plants transfected with the recombinant vector pZH01-GmXTH32 RNAi, and the pROKⅡ empty vector. The hairy roots of the chimeric plants were treated with 120 mM NaCl for 3 days (experimental group, plants were immersed in 120 mM NaCl for 3 days). The roots and leaves of the hairy root chimera plants transfected with the recombinant plasmid pROKII-GmXTH32 (hydrocultured in NaCl aqueous solution and treated at 25°C for 3 days) had significantly lower wilting degrees than those of the roots and leaves of the hairy root chimera plants transfected with the recombinant plasmid pROKII-GmXTH32 (control).

[0129] Survival rate test:

[0130] The results are shown in Figure 6. The horizontal axis: the control is the pROKⅡ transgenic hairy root chimera plant, the XTH-OE is the recombinant plasmid pROKII-GmXTH32 transgenic hairy root chimera plant, and the XTH-Ri is the recombinant vector pZH01-GmXTH32 RNAi hairy root chimera plant. The hydroponic culture is the control group, and the salt treatment is the experimental group. In A, the vertical axis is the survival rate percentage, and in B, the vertical axis is the relative conductivity percentage. After 3 days of hydroponic culture (the hydroponic culture in Figure 6), the survival rate of all plants was 100%. After 3 days of 100 mM NaCl treatment (the salt treatment in Figure 6), the hairy root chimera plant transfected with the pROKⅡ empty vector, the hairy root chimera plant transfected with the recombinant plasmid pROKII-GmXTH32, and the hairy root chimera plant transfected with the recombinant vector pZH01-GmXTH32 RNAi The survival rates of RNAi hairy root chimera plants were approximately 39.5%, 35.5%, and 51.2%, respectively. The differences between the hairy root chimera plants transfected with the recombinant plasmid pROKII-GmXTH32 and the recombinant vector pZH01-GmXTH32 RNAi and the hairy root chimera plants transfected with the empty pROKII vector were extremely significant. This suggests that overexpression of GmXTH32 reduces salt tolerance in plants, while reduced expression increases salt tolerance.

[0131] NaCl treatment ion permeability test:

[0132] When plant tissues are damaged by adverse stress, cell membrane function is impaired or structure is damaged, increasing permeability and allowing the extravasation of various water-soluble substances, including electrolytes, from the cells. When plant tissue is immersed in deionized water, the water's conductivity increases due to the extravasation of electrolytes. The more severe the damage and the more severe the cell membrane damage, the more severe the extravasation, and the higher the water conductivity. Therefore, a conductivity meter can be used to measure changes in the conductivity of the extravasated fluid, indirectly reflecting the extent of damage to the plant tissue. Therefore, conductivity testing can be used to calculate relative ion permeability, which indicates the degree of damage to the plant cell membrane.

[0133] The results are shown in Figure 6. Under clear water culture conditions, the ion permeability of all plants was very low, about 6%. After 3 days of treatment with 100 mM NaCl, the relative ion permeabilities of the hairy root chimera plants transfected with the pROKⅡ empty vector, the hairy root chimera plants transfected with the recombinant plasmid pROKII-GmXTH32, and the hairy root chimera plants transfected with the recombinant vector pZH01-GmXTH32 RNAi were approximately 48.1%, 58.4%, and 31.2%, respectively. This indicates that the leaf cell membrane of the hairy root chimera plants overexpressing GmXTH32 was most severely damaged under salt stress, followed by the control. However, reducing the expression of GmXTH32 significantly protected the cell membrane from damage under salt stress.

[0134] The above results indicate that in plants, GmXTH32 negatively regulates salt tolerance, and reducing the expression of its encoding gene GmXTH32 significantly improves the salt tolerance of plants.

[0135] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0136] Industrial Applications

[0137] The present invention discloses a salt-tolerance-related protein GmXTH32 and its related biomaterials and applications. Studies have shown that the expression level of the gene encoding the soybean protein GmXTH32 is related to salt tolerance. The present invention uses hairy root technology to construct an overexpression vector for the protein GmXTH32 encoding gene, which is introduced into soybeans to obtain GmXTH32 gene-overexpressing chimeric soybeans. Furthermore, an RNAi vector for the GmXTH32 encoding gene is constructed and introduced into soybeans to obtain GmXTH32 gene-silenced chimeric soybeans. Wild-type soybeans, GmXTH32 gene-overexpressing soybeans, and GmXTH32 gene-silenced soybeans were cultured under high salt concentration conditions. It was found that compared with wild-type soybeans, GmXTH32 gene-silenced soybeans grew better, while GmXTH32 gene-overexpressing plants grew weaker. This indicates that GmXTH32 negatively regulates salt tolerance, reduces the expression of its encoding gene GmXTH32, and significantly improves the salt tolerance of plants.

Claims

1. Use of GmXTH32, a substance that regulates the expression of a gene encoding GmXTH32, or a substance that regulates the activity or content of the GmXTH32 protein in any of the following; A1) Application in improving plant salt tolerance and / or application in preparing products for improving plant salt tolerance; A2) application in improving the survival rate of plants under salt stress and / or application in preparing products for improving the survival rate of plants under salt stress; A3) application in improving the survival rate of plants under salt stress and / or application in preparing products for improving the survival rate of plants under salt stress; The GmXTH32 is any of the following proteins: B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in B1); B3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

2. The use according to claim 1, characterized in that: The protein is derived from soy beans.

3. The use according to claim 1, characterized in that: The substance that regulates the expression of the gene encoding the protein is any one of the following: B1), a nucleic acid molecule that inhibits, reduces or down-regulates the expression of the gene encoding the protein of claim 1 or inhibits, reduces or down-regulates the activity or content of the protein; B2), expressing the coding gene of the nucleic acid molecule described in B1); B3), an expression cassette containing the gene described in B2); B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3); B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4); B6), a transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7), transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8), a transgenic plant organ containing the gene described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4); B9), a nucleic acid molecule encoding the protein described in claim 1; B10), an expression cassette containing the nucleic acid molecule described in B9); B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B11); B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11); B14), transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11); B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

4. The use according to claim 3, characterized in that: B9) The nucleic acid molecule described is a DNA molecule whose nucleotide sequence is shown in Sequence 1.

5. The use according to claim 3, characterized in that: B1) The nucleic acid molecule is an RNA transcribed from a DNA molecule as shown in formula (I): SEQ forward-X-SEQ reverse (I); The SEQ forward is a partial fragment of sequence 1; the SEQ reverse sequence is reverse complementary to the SEQ forward sequence; and X is a spacer sequence between the SEQ forward and the SEQ reverse sequence, so that the RNA molecule transcribed from the DNA molecule shown in formula (I) forms a stem-loop structure.

6. The use according to claim 1, characterized in that: The plant is any of the following: J1) dicotyledonous plants; J2) Leguminosae; J3) Glycine max; J4) Soybean.

7. A method for cultivating plants with high salt tolerance, characterized in that: The method comprises down-regulating, weakening or reducing the expression level of the gene encoding the protein described in claim 1 in the target plant, and / or the activity and / or content of the protein to obtain a high salt-tolerant plant, wherein the salt tolerance of the high salt-tolerant plant is higher than that of the target plant.

8. The method according to claim 7, characterized in that The down-regulation, attenuation or reduction of the expression of the gene encoding the protein of claim 1 in the plant comprises introducing the nucleic acid molecule described in B1) of claim 3, the expression cassette described in B2) of claim 3 or the recombinant vector described in B3) of claim 3 into the target plant.

9. The method according to claim 7, characterized in that The plant is any of the following: J1) dicotyledonous plants; J2) Leguminosae; J3) Glycine max.

10. A method for improving plant salt tolerance, characterized in that: The method comprises improving the salt tolerance of plants by down-regulating, weakening or reducing the expression of the gene encoding the protein described in claim 1 in the plant, and / or the activity and / or content of the protein described in claim 1.

11. The method according to claim 10, characterized in that The down-regulation, attenuation or reduction of the expression of the gene encoding the protein of claim 1 in the plant comprises introducing the nucleic acid molecule described in B1) of claim 3, the expression cassette described in B2) of claim 3 or the recombinant vector described in B3) of claim 3 into the target plant.

12. The method according to claim 11, characterized in that The down-regulation, attenuation or reduction of the expression of the gene encoding the protein of claim 1 in the plant comprises introducing the nucleic acid molecule described in B1) of claim 3, the expression cassette described in B2) of claim 3 or the recombinant vector described in B3) of claim 3 into the target plant.

13. The method according to claim 10, characterized in that The plant is any of the following: J1) dicotyledonous plants; J2) Leguminosae; J3) Glycine max; J4) Soybean.

Images