Use of inhibitors of micrornas in the treatment of lung diseases

Inhibitors of microRNAs miR-210-3p and miR-155-5p, particularly LNA-ASOs, address the limitations of current IPF treatments by reducing ATII senescence and promoting ATII to ATI trans-differentiation, effectively regenerating the lung.

WO2025191011A1PCT designated stage Publication Date: 2025-09-18INT CENT FOR GENETIC ENG & BIOTECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/056760
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-12
Filing Date
2025-03-12
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

Current therapies for lung diseases such as idiopathic pulmonary fibrosis (IPF) are poorly effective and often transient, with low survival rates, and there is a need for treatments that promote effective lung regeneration rather than just addressing fibrosis.

Method used

Inhibitors of microRNAs miR-210-3p and miR-155-5p, particularly LNA-ASOs, are used to reduce ATII senescence and promote ATII to ATI trans-differentiation, thereby reactivating the lung's endogenous regenerative capacity.

Benefits of technology

The inhibitors effectively reduce senescent alveolar epithelial cells, restore physiological trans-differentiation processes, and trigger lung regeneration, offering a novel therapeutic approach for IPF and other lung diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000054_0001
    Figure IMGF000054_0001
  • Figure IMGF000036_0001
    Figure IMGF000036_0001
  • Figure IMGF000037_0001
    Figure IMGF000037_0001
Patent Text Reader

Abstract

The present invention refers to an agent for use in the prevention and / or treatment of lung pathological conditions associated with loss of alveolar epithelial type II to type I trans- differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, said agent being selected from the group consisting of: an inhibitor of miR-210-3p and an inhibitor of miR-155- 5p or a combination thereof, wherein said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia and acute interstitial pneumonia, chronic obstructive pulmonary disease, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] USE OF INHIBITORS OF MICRORNAS IN THE TREATMENT OF LUNG DISEASES

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to at least one agent selected from inhibitors of miR-210-3p or miR-155-5p or combinations thereof for use in the treatment and / or prevention of lung pathological conditions associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung condition, wherein the lung pathological condition is preferably selected from the group of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, post-acute COVID-19 syndrome, said interstitial lung disease being preferably selected from the group consisting of idiopathic pulmonary fibrosis, nonspecific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis- ILD, cryptogenic organizing pneumonia and acute interstitial pneumonia, preferably wherein said lung pathological condition is idiopathic pulmonary fibrosis.

[0004] BACKGROUND OF THE INVENTION

[0005] Idiopathic Pulmonary Fibrosis (IPF) is a chronic Interstitial Lung Disease (ILDs). ILDs with either known or unknown (Idiopathic) cause are characterized by gradual fibrotic scarring of the lungs that leads to the anatomopathological and radiological pattern of usual interstitial pneumonia (UIP) and, eventually, to death. Idiopathic Pulmonary Fibrosis (IPF) represents the most common encountered ILD in clinical practice, ranging from 0.9 to 14 cases / lOO.OOO / y in incidence worldwide [1], IPF is considered an aging-associated disease, with increase in both incidence and prevalence in aging population. Indeed, the IPF occurs mainly at 50-70 years of age [1], At the cellular level, pulmonary fibrosis can be considered as a compensatory fibrotic response to impaired lung regeneration following chronic or acute alveolar injury. Several studies suggest a central role of alveolar type II epithelial cells (ATII) cells in lung regeneration [2-4], Physiologically, the turnover of alveolar type I epithelial cells (ATI) cells is supported by the trans-differentiation of ATII cells into ATI cells; ATII cells are also responsible for surfactant production [2], It has been shown that both extensive ATII loss or the accumulation of ATII to ATI aberrant intermediates, after lung injury, may trigger inadequate alveolar repair promoting IPF progression as well as worsening other lung diseases such as Chronic Obstructive Pulmonary Disease COPD and post-acute respiratory distress syndrome (ARDS)[2, The incapability of ATIIs to transdifferentiate into ATIs is recapitulated also in the mouse model of bleomycin-induced lung fibrosis

[0011] , which currently represents the most accurate mouse preclinical model of IPF

[0013] ,

[0006] Bleomycin is a chemotherapeutic agent, which acts by causing single and double-strand DNA breaks in cellular DNA, thus leading to cell permanent cell cycle arrest and accumulation in the lungs of p21, pl6 and beta-gal positive cells. In addition, ageing processes have been shown to induce a dysfunctional phenotype in ATII cells, characterized by aberrant secretion of pro- fibrotic and pro-inflammatory senescence-associated factors SASP

[0014] ,

[0007] Similarly, multiple genes related with telomere maintenance such as TERT, TERC, TINF2, DKC1, RTEL1, PARN and NAF1 have been found to be mutated in the 25% of patients with familial IPF, thus further confirming the pathological role of cellular senescence in disease progression

[0015] ,

[0008] The bleomycin mouse presents some differences with human IPF, with the most significant being the progressive and spontaneous resolution of fibrosis in young mice, at 60 days after bleomycin administration

[0016] ,

[0009] Recent literature demonstrated that studies of bleomycin induced fibrosis in aged male mice (18 months) result to be the most clinically relevant for preclinical study for human

[0013] , Unlike young mice, aged mice haven’t been shown to undergo spontaneous resolution of bleomycin induces pulmonary fibrosis

[0017] , thus better reflecting human IPF. In support of connection between IPF and cellular senescence, it has been shown that selective ablation of senescent cells using senolytics alleviates IPF-related dysfunction in bleomycin mouse model, as well as in IPF patients [14, 18, 19],

[0010] MicroRNAs (miRNAs or miRs) are evolutionarily conserved small noncoding RNAs that regulate gene expression at the post-transcriptional level. In animal cells, repression of gene expression by microRNAs is achieved by base-pairing to partially complementary sequences present mostly in 3’ UTRs of target messenger RNAs (mRNAs), resulting in translation repression, mRNA degradation, or both

[0020] , The microRNA seed sequence, essential for the binding of the microRNA to the mRNA, is a conserved sequence, which is generally situated at positions 2-8 from the microRNA 5 '-end

[0021] , Even though base pairing of microRNA and its target mRNA is not perfect, the region corresponding to the seed sequence usually has to be perfectly complementary. Thus, the seed sequence is the primary specificity determinant for target selection. The small size of the seed sequence means that a single microRNA can regulate many, even hundreds, different genes. MicroRNAs are genome-encoded sequences generally transcribed by RNA polymerase II into primary microRNAs (pri-microRNAs). The pri- microRNAs are then sequentially processed by two endonucleases of the RNAse III family: in the nucleus, Drosha processes the pri-microRNA into a precursor microRNA (pre-microRNA) of approximately 60-80 nucleotides, after which the pre-microRNA is further processed, in the cytoplasm, by Dicer to form a duplex containing two strands of about 19-23 nucleotides. The microRNA duplex is then unwound, and the mature microRNA is incorporated into the RNA- induced silencing complex (RISC), containing, among others, Argonaute and GW182 proteins essential for the silencing by microRNAs

[0022] ,

[0011] MicroRNAs perform relevant roles in maintaining lung functions and homeostasis

[0023] , They are involved in several cellular processes which occur in the lung, such as cell proliferation, cell differentiation, apoptosis, and inflammatory responses. The importance of miRNAs in lung development has been demonstrated by Harris et al., who showed that conditional knock out of Dicer 1 in the murine lung epithelium, in both neonatal and adult lung, leads to an improper branching morphogenesis and a severe ECM production with fibrosis development

[0024] , Several miRNAs have been discovered to regulate specific processes in lung repair, such as miR-26, miR-142, miR-17, miR-92 that play crucial role in ATI and ATII cell homeostasis

[0025] , On the contrary, there are several miRNAs that have been involved in the pathogenesis of lung diseases, such as inflammation and viral infections, lung carcinogenesis, pulmonary allergy, asthma, chronic obstructive pulmonary disease and IPF

[0026] ,

[0012] Other microRNAs such as miR-21, miR-29, miR-153 are abnormally regulated in IPF lungs

[0017] , In normal lung, miR-21 is downregulated, leading to upregulation of Smad-7. Smad-7 inhibits the proliferation of interstitial fibroblasts. But in IPF lung, there is an increase in miR- 21 expression, thus an altered control of smad-7

[0027] , MicroRNA-29 is decreased in the IPF lung and the restoration of miR-29 physiological levels showed protective effect in mouse model of pulmonary fibrosis

[0026] , MicroRNA-29 has been shown to negatively regulate the production of collagen, thus its downregulation causes excessive ECM deposition, contributing to the development of fibrosis

[0028] , Another miRNA involved in the development of IPF is miR-153. Normally, this miRNA targets TGF-pi, regulating the proliferation and activation of fibroblasts and the ECM deposition. However, its expression levels are reduced in fibrotic lungs

[0029] ,

[0013] MicroRNA-based therapeutic approaches can be subdivided into two fundamental groups: microRNA replacement and miRNA inhibition

[0030] , The first system is used to rescue the microRNA effect, decreasing the expression of specific microRNA target. The second approach aims at reducing endogenous miRNA levels and herefore increasing the expression of specific microRNA targets. To down-regulate endogenous miRNA levels scientists developed different systems including short hairpin RNA (shRNA)

[0031] , linear miRNA- sponges

[0032] , circular-RNA miRNA sponges

[0033] , miRNA-targeting Tough Decoy (TuD) RNAs [34, 35], miRZips

[0036] , and anti-miRNA antisense oligonucleotides (ASOs)

[0037] , Locked Nucleic Acid (LNA) modified ASOs (LNA-ASOs) to improve DNA nucleases resistance

[0038] ,

[0014] ASOs, modified ASOs (LNA-ASOs), and miRZips are synthetic molecules that cannot be expressed in the target cells using genetic systems such as plasmids or viral vectors. As a result, they can only be delivered as synthetic molecules. In contrast, linear miRNA sponges, circular- RNA miRNA sponges, and miRNA-targeting Tough Decoy (TuD) RNAs can be expressed in the target cells by genetic systems (i.e. plasmids or viral vectors).

[0015] In the last years, different carriers for miRNA-based therapies are developed, such as liposomes, lipid nanoparticles (LNPs), extracellular vehicles (EVs), macrovesicles and viral vectors

[0039] , Liposomes mimic the composition of cell membrane. Liposomes are subdivided into neutral, anionic and cationic types, for example Polyethyleneglycol (PEG) lipids are widely used. However, they can cause undesired immune responses and toxicity. LNPs are mainly used for in vivo delivery of miRNAs due to their numerous advantages, such as payload preservation of miRNA agents, improvement of target specificity and tissue distribution

[0040] , Finally, viral vectors are used to deliver genetic material. Among viral vectors developed for gene delivery in humans there are adeno-associated viruses (AAVs)

[0041] , Currently, Adeno- associated virus (AAV) vectors are the leading platform for the delivery of genetic material for the treatment of a variety of human diseases and represent valuable alternative for the delivery of either miRNA mimics (i.e. pre-miRNA) or inhibitors (i.e. linear miRNA sponges, circular- RNA miRNA sponges, miRNA-targeting Tough Decoy (TuD) RNAs, and shRNA) to the lungs.

[0016] Current therapies for patients with IPF appear to be poorly effective and most frequently transient with a low survival rate. Nintedanib (Ofev) and Pirfernidone (Esbriet) are the only two approved treatments for IPF patients. Both drugs, if well-tolerated by patients, allow only to reduce lung progressive fibrotic remodeling, with mild efficacy in reducing severe respiratory events and no effect in promoting lung regeneration. Nowadays, IPF still represents the main cause of lung transplant worldwide. In 2023, the two most promising antifibrotic molecules for the treatment of IPF (Pamrevlumab and PRM-151) failed large Phase III clinical trials (Zephyrus I NCT03955146; Starscape NCT04594707).

[0017] Therefore, there is still the need for a treatment for promoting effective lung regeneration in subjects suffering from lung disease characterized by lung fibrotic scarring.

[0018] SUMMARY OF THE INVENTION

[0019] Inventors conducted the first-ever phenotypic cell-based High Throughput Screening (HTS) assay on 2042 human microRNA mimics to assess their efficacy in promoting cellular senescence while blocking ATII to ATI trans-differentiation in primary alveolar mouse epithelial cells. Among the tested microRNAs, hsa-miR-210-3p, hsa-miR-155-5p, and hsa- miR-490-3p scored as the most effective in promoting cellular senescence (measured by the number of p21 -positive ATI cells) while inhibiting ATII to ATI trans-differentiation (measured by the total number of ATI cells).

[0020] Human miR155-5p and miR-210-3p are both well-described hypoxia-regulated miRNAs [42, 43] and their expression is known to be up-regulated by HIFl-a. Involvement of both miR- 155-5p and miR-210-3p has thus far only been elucidated in lung fibroblasts, and their roles in epithelial cells and lung regeneration remain unexplored

[0044] , In particular, miR-155-5p has been described as upregulated upon silica-induced fibrosis and its ablation by anti-sense oligonucleotides (ASOs) has been proven effective in the same model

[0045] and miR-210-3p was shown to promote fibroblast proliferation in hypoxic conditions

[0046] , Of note, hsa-miR- 155-5p, was shown to target TRF1 an essential gene for telomere maintenance thus, if overexpressed, promoting telomere fragility in breast cancer cells

[0047] ,

[0021] It is crucial to emphasize that the evidence presented by Chen et al.

[0045] and Bodempudi et al.

[0046] highlights the significance of miR-155-5p and miR-210-3p in other cell types and not in ATII cells. Chen et al. demonstrated that miR-155-5p suppresses meprin a, thereby promoting fibroblast and macrophage activation in silicosis. Similarly, Bodempudi et al. reported that miR-210-3p is upregulated in response to hypoxia in idiopathic pulmonary fibrosis (IPF), driving fibroblast proliferation.

[0022] It is therefore evident, that these studies do not provide any evidence regarding the role of the aforementioned microRNAs in regulating ATII to ATI trans-differentiation or in the physiological processes of alveolar repair and lung regeneration driven by the process of ATII to ATI trans-differentiation. The key advantage of specifically targeting ATII cells over fibroblasts is that it aims to reactivate the lung’s endogenous alveolar regenerative capacity rather than only addressing fibrosis, which is a manifestation of the lung’ s failure to regenerate.

[0023] To validate the pathological relevance of selected microRNAs, Inventors confirmed that their endogenous expression levels were upregulated in both ATII and lung fibroblast cells isolated from bleomycin treated mice if compared with same cell types isolated from control mice.

[0024] The evidence that miR-155-5p and miR-210-3p negatively regulate ATII-driven alveolar regenerative process, by both increasing ATII cellular senescence and blocking ATII to ATI trans-differentiation, aligns well with the increased levels of these microRNAs in ATII cells upon disease progression.

[0025] Furthermore, ATII cells isolated from bleomycin-treated mice and transfected with LNAs targeting either mmu-miR-210-3p or mmu-miR-155-5p exhibited an improved level of ATII to ATI trans-differentiation and decreased levels of p21 -positive cells compared to ATII cells from healthy control mice.

[0026] Supporting the crucial role of diseased ATII cells in promoting lung fibrosis, the inventors demonstrated that elevated levels of these miRNAs in ATII cells contribute to the creation of a profibrotic and dysfunctional lung microenvironment by secreting profibrotic factors that drive fibroblast-to-myofibroblast activation. These findings further highlight the therapeutic potential of targeting hsa-miR-155-5p and hsa-miR-210-3p in ATII cells to both restore alveolar repair mechanisms and prevent ATII-driven fibrosis progression.

[0027] To further support the hypothesis that targeting ATII cells with inhibitors of the selected microRNAs promotes lung fibrosis regression by stimulating ATII-driven alveolar repair mechanisms, the inventors demonstrated the therapeutic efficacy of LNA-ASOs targeting these microRNAs in a mouse model of bleomycin induced lung fibrosis. Of note, a single-dose administration of ASOs targeting either miR-210-3p or miR-155-5p (via intra tracheal delivery) at 10 or 21 days post-bleomycin in young mice, as well as at 10 days post-bleomycin in aged mice (20 months old), resulted in a significant reduction in lung fibrosis and senescence. Notably, aged mice, exhibit severely limited regenerative capacity due to systemic cellular senescence, and therefore represent the most accurate model of human idiopathic pulmonary fibrosis (IPF).

[0028] These data suggest that the selected microRNAs miR-210-3p and miR-155-5p represent promising targets for the development of novel therapies for patients with Idiopathic Pulmonary Fibrosis (IPF). These therapies aim to: 1. Reduce the number of senescent alveolar epithelial cells, thereby eliminating the source of paracrine pro-fibrotic signals;

[0029] 2. Restore the physiological ATII to ATI trans-differentiation process;

[0030] 3. Eventually, trigger the lung's endogenous regenerative capacity.

[0031] Inventors here propose the use of inhibitors of selected human microRNAs to reduce ATII senescence and push the trans-differentiation of ATII cells into ATI cells as a novel therapeutical strategy to promote lung regeneration after alveolar injury.

[0032] Currently there are no available treatments that specifically promote lung regeneration by reducing ATII senescence and / or boosting ATII to ATI trans-differentiation and the disclosed therapeutical approach is based on the idea of reactivating the endogenous alveolar regenerative capacity rather than targeting fibrosis, which is indeed the clinical manifestation of the impossibility of the organ to regenerate.

[0033] The present inventors therefore found that inhibitors of microRNAs: miR-210-3p and miR- 155-5p are effective for promoting lung regeneration and for the treatment of lung diseases associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and consequent pathological remodelling of the lung, in particular for preventing and / or treating IPF.

[0034] It is therefore an object of the invention an agent for use in the prevention and / or treatment of a lung pathological condition, said agent being selected from the group consisting of: an inhibitor of miR-210-3p; an inhibitor of miR-155-5p; or a combination thereof; wherein said lung pathological condition is selected from the group consisting of: interstitial lung disease, chronic obstructive pulmonary disease, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome.

[0035] More specifically, it is an object of the invention an agent for use in the prevention and / or treatment of a lung pathological condition associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, said agent being selected from the group consisting of : an inhibitor of miR-210-3p; an inhibitor of miR-155-5p; or a combination thereof.

[0036] Said miR-210-3p can be murine or human, for example it can be hsa-miR-210-3p or mmu- miR-210-3p, preferably it is hsa-miR-210-3p

[0037] Said miR-155-5p can be murine or human, for example it can be hsa-miR-155-5p or mmu- miR-155-5p, preferably, it is hsa-miR-155-5p.

[0038] Preferably, the lung pathological condition is selected from the group consisting of: interstitial lung disease, chronic obstructive pulmonary disease, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome. Preferably, said interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia.

[0039] Preferably the lung pathological condition is idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases, or post-acute respiratory distress syndrome. More preferably, it is idiopathic pulmonary fibrosis. Preferably, said inhibitor is a nucleic acid molecule preferably selected from: a single-stranded or double-stranded nucleic acid molecule, an siRNA molecule, an shRNA molecule, an antisense oligonucleotide (e.g. an antagomir, a Locked Nucleic Acid (LNA) modified ASOs (LNA-ASOs)), a linear miRNA sponge, a circular RNA miRNa sponge, a miRNA-targeting Tough Decoy (TuD) RNA, and a miRZip, derivatives and mixtures thereof. More preferably it is an antisense oligonucleotide, even more preferably it is an antisense oligonucleotide comprising at least a locked nucleic acid (LNA).

[0040] Preferably, said inhibitor has sufficient complementarity to miR-210-3p, preferably to hsa- miR-210-3p, or to miR-155-5p, preferably to hsa-miR-155-5p, to form a hybrid under physiological conditions. Preferably, it comprises at least 7 nucleotides complementary to at least one sequence selected from SEQ ID NO. 1-4, 7-9 or a variant or a fragment thereof, preferably complementary to at least one sequence selected from SEQ ID NO. 1-4, or a variant or a fragment thereof. More preferably, said inhibitor is complementary to the seed sequence of said miRNAs, said sequence being 5’-UGUGCGU-3’ for miR-210-3p and 5’-UAAUGCU- 3’ for miR-155-5p. Preferably the inhibitor of miR-210-3p comprises a nucleotide sequence comprising or consisting of the sequence 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and / or the inhibitor comprises about 8 to about 30 nucleotides in length.

[0041] Preferably, the inhibitor of miR-155-5p comprises a nucleotide sequence comprising or consisting of the sequence 5'- TCACAATTAGC ATTA-3' (SEQ ID NO.12) and / or the inhibitor comprises about 8 to about 30 nucleotides in length.

[0042] Preferably, the inhibitor comprises at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides, or at least 21 nucleotides, or at least 22 nucleotides, or at least 23 nucleotides, or at least 24 nucleotides, or at least 25 nucleotides, or at least 26 nucleotides, or at least 27 nucleotides, or at least 28 nucleotides, or at least 29 nucleotides, or at least 30 at the 5' and / or at the 3’ of said nucleotide sequence.

[0043] A nucleic acid comprising or consisting of a sequence of SEQ ID NO.11 or of SEQ ID NO.12 is also an object of the invention.

[0044] Preferably, the inhibitor of hsa-miR-210-3p has at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% complementarity to a portion of a hsa-miR-210-3p sequence.

[0045] Preferably, the inhibitor of hsa-miR-155-5p has at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% complementarity to a portion of a hsa-miR-155-5p sequence.

[0046] Preferably, the inhibitor binds to a miRNA comprising a nucleic acid that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% identical to any one SEQ ID NOs: 1-4, 7-9

[0047] Preferably, the inhibitor comprises at least one modified nucleotide, more preferably the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and / or a peptide nucleic acid (PNA).

[0048] Preferably, the inhibitor of miR-210-3p comprises a nucleotide sequence comprising or consisting of the sequence 5'-GCTGTCACACGCACA-3' (SEQ ID NO. 11), and wherein at least one modified nucleotide is a locked nucleic acid (LNA). Preferably the inhibitor of miR-155-5p comprises a nucleotide sequence comprising or consisting of the sequence 5'- TC AC AATTAGC ATTA-3' (SEQ ID NO. 12), and wherein at least one modified nucleotide is a locked nucleic acid (LNA).

[0049] Preferably, the inhibitor comprises a backbone modification, more preferably a phosphorodiamidate morpholino oligomer (PMO) and / or phosphorothioate (PS) modification.

[0050] Preferably, the delivery agent comprises a vector, preferably a recombinant expression vector or a viral vector, a micelle, an exosome, a lipidoid, a lipoplex, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a conjugate, nanoparticles, microparticles, a liposome or other biological or synthetic vesicle or material including lipid nanoparticles, polymer-based nanoparticles, polymer-lipid hybrid a nanoparticle, a microparticle, a microsphere, a liposome, a colloidal gold particle, a graphene composite, a cholesterol conjugate, a cyclodextran complex, a polyethylenimine polymer, a lipopolysaccharide, a polypeptide, a polysaccharide, a lipopolysaccharide, a collagen or a pegylation of viral vehicle, or combinations thereof.

[0051] It is another object of the invention a vector, preferably a recombinant expression vector, comprising a coding sequence for of the agent for use as defined herein and / or expressing the agent for use as defined herein, such as an inhibitor of hsa-miR-210-3p or an inhibitor of hsa- miR-155-5p, preferably under the control of a suitable promoter, for use in the treatment and / or prevention of lung pathological conditions associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, wherein the lung pathological condition is preferably selected from the group consisting of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome. Preferably, said interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia. More preferably, said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases and post-acute respiratory distress syndrome. Even more preferably, said lung pathological condition is idiopathic pulmonary fibrosis. Preferably, the vector is a viral or non-viral vector, more preferably the viral vector is selected from adeno-associated virus (AAV) vectors of any capsid serotype, either natural or artificial, lentivirus vectors, adenoviral vector, retroviral vectors, alphaviral vectors, vaccinia virus vectors, herpes simplex virus (HSV) vectors, rabies virus vectors, and Sindbis virus vectors. Preferably the adeno-associated virus (AAV) vector is AAV6, AAV6.2 or AAV6.2FF.

[0052] In an embodiment the vector, preferably an AAV, comprises a coding sequence for at least one inhibitor of miR-210-3p and / or miR-155-5p, preferably wherein said inhibitor is selected from the group of: a linear miRNA sponge, a circular RNA miRNA sponge, a miRNA-targeting Tough Decoy (TuD) RNA, and a shRNA.

[0053] A further object of the invention is a host cell transformed with the vector as defined herein for use in the treatment and / or prevention of lung pathological conditions associated with loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with senescence of alveolar epithelial type II and / or type I cells and / or loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, wherein the lung pathological condition is preferably selected from the group of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and postacute COVID-19 syndrome. Preferably, said interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia. More preferably, said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases and post-acute respiratory distress syndrome. Even more preferably, said lung pathological condition is idiopathic pulmonary fibrosis.

[0054] Another object of the invention is a recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid encoding the at least one agent for use as defined herein, preferably the particle comprises a capsid derived from adeno-associated vectors AAV6, AAV6.2, AAV6.2FF, AAV8, AAV1, AAV2, AAV5, or AAV9, preferably wherein the nucleic acid is operably linked to a viral promoter or a tissue specific promoter, such as for example alveolar epithelial type II cells (ATII) specific promoter for use in the treatment and / or prevention of lung pathological conditions associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, wherein the lung pathological condition is preferably selected from the group of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome. Preferably, said interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia. More preferably, said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases and postacute respiratory distress syndrome. Even more preferably, said lung pathological condition is idiopathic pulmonary fibrosis.

[0055] It is an object of the present invention a pharmaceutical composition for use in the treatment and / or prevention of lung pathological conditions associated with loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with senescence of alveolar epithelial type II and / or type I cells and / or loss of lung regenerative capacity and / or for use in promoting lung regeneration in a subject with a lung pathological condition, wherein the pathological condition is preferably selected from the group consisting of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome, said pharmaceutical composition comprising an agent as defined herein, or the nucleic acid as defined herein, or the vector as defined herein, or the host cell as defined herein, or a recombinant adeno-associated virus (rAAV) particle as defined herein and at least one pharmaceutically acceptable vehicle and / or excipient. Preferably, said interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia. More preferably, said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases and post-acute respiratory distress syndrome. Even more preferably, said lung pathological condition is idiopathic pulmonary fibrosis.

[0056] DETAILED DESCRIPTION OF THE INVENTION

[0057] Inventors performed a cell based HTS assay on 2042 human microRNAs for their efficacy in promoting ATII to ATI trans-differentiation in primary alveolar mouse epithelial cells (ex vivo). They identified three microRNA mimics that respectively scored as the most effective in promoting ATII cellular senescence while inhibiting ATII to ATI trans-differentiation. Two out of three microRNAs, specifically hsa-miR-155-5p and hsa-miRNA-210-3p, were endogenously expressed by both mouse and human ATII cells. The levels of selected microRNAs were proved to be upregulated in the lungs of mice treated with Bleomycin, a chemical agent known to promote pulmonary fibrosis and therefore inducing ATII cellular senescence and apoptosis. To characterize the effect of LNAs targeting the microRNAs, mmu- miR-155-5p and mmu-miRNA-210-3p, inventors isolated diseased ATII cells from bleomycin- treated mice lungs and transfected them with selected LNAs.

[0058] Inventors demonstrated that LNAs targeting mmu-miR-155-5p and mmu-miRNA-210-3p, completely rescued ATII to ATI trans-differentiation, in diseased mouse ATII cells, if compared to untreated controls.

[0059] The agents of the invention are able to reduce ATII senescence and / or reprogram ATII into ATI and / or to promote and / or increase ATII to ATI trans-differentiation.

[0060] The sequence of hsa-miR-155-5p is available in the state of the art with the ID hsa-miR-155- 5p (www.mirbase.org; Database Release 21; stem-loop sequence accession number MI0000681, mature sequence accession number MIMAT0000646).

[0061] The sequence of hsa-miR-210-3p is available in the state of the art with the ID hsa-miR-210- 3p (www.mirbase.org; Database Release 21; stem-loop sequence accession number MI0000286, mature sequence accession number MIMAT0000267).

[0062] In particular, hsa-miR-155-5p can have anyone of the following sequences:

[0063] 5’-

[0064] CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUA UUAGC AUUAAC AG-3 ’ (SEQ ID NO. 2) corresponding to the accession number MI0000681;

[0065] 5’-UUAAUGCUAAUCGUGAUAGGGGU-3’ (SEQ ID NO. 1) corresponding to the mature sequence accession number MIMAT0000646.

[0066] In particular, hsa-miR-210-3p can have anyone of the following sequences:

[0067] 5’-

[0068] ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCU GCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCG ACCC-3’ (SEQ ID NO. 4) corresponding to the accession number MI0000286;

[0069] 5’-CUGUGCGUGUGACAGCGGCUGA-3’ (SEQ ID NO. 3) corresponding to the mature sequence accession number MIMAT0000267.

[0070] In some embodiment, the inhibitor for the use of the invention may also be complementary, at least partially, to one of the following sequences:

[0071] 5’-

[0072] CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUG UUAGC AUUAAC AG-3 ’ (SEQ ID NO. 8) corresponding to the accession number MI0000177 of mmu-miR-155-5p;

[0073] 5’ - UUAAUGCUAAUUGUGAUAGGGGU-3’ (SEQ ID NO. 7) corresponding to the mature accession number MIMAT0000165 of mmu-miR-155-5p;

[0074] 5’-

[0075] CCGGGGCAGUCCCUCCAGGCUCAGGACAGCCACUGCCCACCGCACACUGCGU UGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUCCCUGGGCAGC GCGAACC-3’ (SEQ ID NO. 9) corresponding to the accession number MI0000695 of mmu-miR-210-3p.

[0076] Inhibitors of anyone of the above sequences can be used according to the present invention. Also, inhibitors of any functional fragment of any of the above sequences can be used according to the present invention.

[0077] Preferably, in the present invention: hsa-miR-155-5p comprises or consists of the sequence with SEQ ID NO: 1 hsa-miR-210-3p comprises or consists of the sequence with SEQ ID NO: 3 mmu-miR-210-3p comprises or consists of the sequence with SEQ ID NO: 3 mmu-miR-155-5p comprises or consists of the sequence with SEQ ID NO: 7.

[0078] The hsa-miRs or miRs or miRNAs or mmu-miRs mentioned in the present invention preferably comprise or consist of the herein indicated sequences. They also may comprise homologs, analogs and orthologues thereof, primary miRNA molecules, precursor miRNA molecules, mature miRNA molecules, and miRNA mimetics. The nucleic acids may be selected from RNA, DNA or nucleic acid analog molecules, e.g. as sugar- or backbone-modified ribonucleotides or deoxyribonucleotides, peptide nucleic acids (PNA) or locked nucleic acids (LNA). In the present invention any combination of the above agents may be used. E.g. inhibitors of miR-210-3p and miR-155-5p can be used together. More than one agent may be used.

[0079] A "miRNA inhibitor" or “inhibitor of’ a miR as used herein, refers to a compound that can decrease, alter, and / or modulate miRNA expression, function, and / or activity.

[0080] The miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence. For instance, in some aspects, a miRNA inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that is at least partially complementary to the target miR nucleic acid sequence, such that the miRNA inhibitor hybridizes to the miR sequence. In further aspects, the hybridization of the miRNA inhibitor to the miR sequence decreases, alters, and / or modulates the expression, function, and / or activity of the miR. “miRNA inhibitor” may refer to a nucleotide sequence that is a reverse complement of a mature miRNA (the target site). In some embodiments, the miRNA inhibitor is chemically synthesized and / or is chemically modified to prevent nucleic acidprotein complex-induced cleavage (e.g., RISC-induced cleavage) of miRNA, enhance binding affinity to the target site, and / or provide resistance to nucleolytic degradation of the miRNA inhibitor. As used herein, a miRNA inhibitor includes any natural or artificial RNA transcripts that sequestrate miRNAs and decrease or eliminate their effects. Included herein are miRNA inhibitors that are identical to competing endogenous RNAs (ceRNAs). ceRNAs are natural and intracellular miRNA inhibitors that compete to bind to shared miRNA recognition elements (MREs) to decrease microRNA availability and relieve the repression of target RNAs.

[0081] In some embodiments, the inhibitor comprises or consist of a nucleic acid at least partially complementary to any one of SEQ ID NOs: 1-4, 7-9, preferably at least partially complementary to any one of SEQ ID NOs: 1-4, more preferably at least partially complementary to any one of SEQ ID NOs: 1 or 3.

[0082] In some embodiments, the nucleic acid sequence that is complementary to a target miRNA miR-210-3p and / or miR-155-5p can be an interfering RNA, including but not limited to a small interfering RNA ("siRNA") or a small hairpin RNA ("shRNA"). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.

[0083] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule, when expressed desirably forms a "hairpin" structure and is referred to herein as an "shRNA." The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see [31, 48-54],

[0084] In some embodiments, the inhibitor can be a linear miRNA sponge, a circular RNA miRNa sponge, a miRNA-targeting Tough Decoy (TuD) RNA, miRZip or nucleic acids coding thereof. MiRNA linear sponges or decoys [32, 55] are in vivo expressed transcripts that contain multiple high affinity miRNA antisense binding sites (MBS) that mimic those found in mRNAs and complementary to a miRNA to be targeted; these transcripts can efficiently sequester specific miRNAs and, thereby, prevent their binding to endogenous target genes. These binding sites are usually tandem repeats of identical sites designed to target either single specific miRNAs or miRNA family members sharing the same seed region; considering that the interaction between microRNA and target is dependent on base-pairing in the seed region (positions 2-8 of the microRNA), a decoy target should interact with all members of a microRNA seed family. Design of miRNA sponges or decoys have been disclosed for instance in Ebert et al.

[0032] and Kluiver et al

[0055] , Sponge sequences typically consist of multiple miRNA binding sites (MBS) separated by 4-6 nucleotides-long spacer sequences. MBSs are either perfectly anti-sense or contain a bulge at the central position. MiRNA sponges offer an advantage of inhibiting all seed family members and also when multiple MBS are introduced, they can be used for inhibition of whole miRNA clusters. MiRNA sponge construct design and off-targets testing may be performed using a web-based tool MiRNAsong: microRNA Sponge Generator and tester. Suitably, a Sponge is composed of a high affinity miRNA antisense binding site (MBS) which includes a sequence complementary to the target miRNA, and a “bulge” region, i.e. a mismatched region in nucleotides 9 to 12 of the MBS sequence. Suitably, the complementary region is at least 75 %, 80 %, 85 %, 90%, 95%, 99% or 100% identical to the target miRNA miR-210-3 p and / or miR-155-5p. Most preferably, the complementary region is at least 80% identical to the target miRNA. Suitably, sequence complementary to the target miRNA sequences, miR-210-3p and / or miR-155-5p, includes a sequence complementary to the SEED sequence, e.g. the sequence within a given miRNA which is essential to the target transcript recognition, and the “bulge” region is outside said Seed sequence. Said Seed sequence preferably comprises or consists of the sequence 5’-UGUGCGU-3’ for miR-210-3p and of the sequence 5’-UAAUGCU-3’ for miR-155-5p. Each MBS sequence (MBS SEQ) is the same length as the mature target miRNA. Each MBS SEQ is repeated several times, between 6 and 24 times. Suitably, MBS SEQs are separated from each other by a “spacer” sequence consisting of 4 to 6 nucleotides.

[0085] In some embodiments, the inhibitor can be a circular RNA miRNA sponge. A circular RNA miRNA sponge is a RNA sponge with a peculiar closed-loop structure that helps in preventing its degradation, thus increasing stability and sponging efficacy over time. Circular RNAs (circRNAs) are covalently closed-loop ssRNA molecules that lack 5-caps and 3-poly(A) tails

[0056] , CircRNAs are generated by back-splicing, a process in which the 3’-end splice site of a precursor mRNAs is linked with the upstream 5 ’-end splice site to form a closed-loop

[0056] , This closed-loop structure makes circRNAs resistant to RNA exonucleases-mediated degradation

[0056] , CircRNAs are naturally occurring in mammalian cells and can act as microRNA sponges by comprising within their sequence multiple miRNA target binding sites, thus negatively regulating microRNA activity by competing with mRNA-microRNA binding. CircCD44 (anti miR-502), cIRS-7 (anti miR-7), and circLRP6 (anti miR-145) are some examples

[0056] , CircRNAs can be invitro engineered to generate artificial circRNA sponges to specifically therapeutically target one or more microRNAs; such moelcules are generally termed as circmiRs. In example, Lavenniah et al. generated a circmiR targeting miR-132 and miR-212, two known cardiac pro-hypertrohpic microRNA; such circmiR has been delivered in vivo to cardiac myocytes by recombinant AAV vector and therapeutically reduced miR-132 and miR-212 level as well as cardiac hypertrophic remodeling

[0033] , The sequence design of circmiRs, depends on the number of miRNAs to be targeted and it relies on the same parameters considered for linear miRNA sponges, as discussed above. In particular, a circular RNA miRNA sponge for use according to the invention may comprise one or more sequences complementary to the target miRNA sequences, i.e. miR-210-3p and / or miR-155-5p, preferably including at least one sequence complementary to the seed sequences of such miRNAs, e.g. 5’-UGUGCGU-3’ for miR-210-3p and 5’-UAAUGCU-3’ for miR-155-5p.

[0086] In some embodiments, the inhibitor can be a miRNA-targeting Tough Decoy (TuD) RNA. Tough Decoy (TuD) RNA inhibitors are synthetic, not naturally occurring, ssRNA DNA- encoded miRNA inhibitors first reported by Haraguchi et al Haraguchi and they consist of a hairpin containing a large, internal bulge exposing two miRNA target sites with imperfect basepairing with the target miRNA sequence

[0035]

[0034] , Compared to linear sponge RNAs, Tough Decoy (TuD) RNA inhibitors, being shorter, were proven to be less sensitive to targeting by endogenous miRNAs and, therefore, less prone to down regulation than sponge-encoding vectors

[0057] , Tough Decoy (TuD) RNA inhibitors were successfully delivered in vivo by rAAV vectors. In particular, rAAV9 expressing anti-miR-122 or anti-let-7 TuDs were successfully used to reduce target miRNA levels in the liver by promoting miRNA tailing and trimming

[0058] ; similarly, AAV9-miR-25 TuD delivered to the murine pressure-overload heart failure model selectively decreased expression of miR-25 in cardiomyocytes, increased levels of SERCA2a protein, and ameliorated cardiac dysfunction and fibrosis

[0059] , A miRNA-targeting Tough Decoy (TuD) RNA targeting miR-210-3p and / or miR-155-5p can be manufactured according to common general knowledge in the field, such as above cited references. In some embodiments, the inhibitor can be a miRNA zipper (miRZip). MiRZip are synthetic DNA molecules, not naturally occurring, and specifically designed to bind to the 5 '-half sequence of one molecule and the 3 '-half sequence of another molecule of the target miRNA through a complementary interaction, thus connecting the target miRNA molecules end-to-end, and therefore blocking the functions of targeted miRNA. MiRZip usually includes LNA modified bases to increase stability and specificity. As reported by Meng et al, miRZips targeting two miRNAs, miR-221 and miR-17, have been validated in human breast cancer cell lines demonstrating 70% to 90% knockdown of miRNA levels by corresponding small RNA zippers at 24 h after transfection

[0059] , A miRzip targeting miR-210-3p and / or miR-155-5p can be manufactured according to common general knowledge in the field, such as above cited reference.

[0087] The terms "miRNA", "miR" and "microRNA" are used interchangeably and refer to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. Such terms refer to the single-stranded RNA molecule processed from a precursor. In some aspects, the term "antisense oligomers" can also be used to describe the microRNA molecules of the present disclosure. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression. Conversely, targeting miRNAs via molecules comprising a miRNA binding site (generally a molecule comprising a sequence complementary to the seed region of the miRNA) can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.

[0088] In some aspects, a miR inhibitor of the present invention comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miR binding site, wherein the nucleotide molecule does not encode a protein. In some aspects, the miR binding site is at least partially complementary to the target miRNA nucleic acid sequence, such that the miR inhibitor hybridizes to the miR nucleic acid sequence. In some aspects, the miR binding site of a miR inhibitor disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of the miR. In certain aspects, the miR binding site is fully complementary to the nucleic acid sequence of the miR. In certain aspects, the miR binding site is complementary to the miR except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.

[0089] MiRNA sequences and miRNA binding sequences that can be used in the context of the present invention include, but are not limited to, all or a portion of the sequences herein disclosed, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs. Any aspects of the disclosure involving specific miRNA binding sites by name is contemplated also to cover miRNAs complementary sequences whose sequences are at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA complementary sequence.

[0090] In some embodiments, the miRNA inhibitor binds to a miRNA comprising a nucleic acid that has at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least

[0091] 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least

[0092] 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least

[0093] 77%, at least 78%, at least 79%, at least 80%, least 81%, least 82%, least 83%, least 84%, least

[0094] 85%, least 86%, least 87%, least 88%, least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity, or at least 100% sequence identity (e.g ., at least 99.5% sequence identity, at least 99.6% sequence identity, at least 99.7% sequence identity, at least 99.8% sequence identity, at least 99.9% sequence identity, or at least 100% sequence identity) to the nucleic acid sequence of any one of SEQ ID NOs. 1-4, 7-9. In some embodiments, the miRNA inhibitor binds to a miRNA comprising a nucleic acid that is any one of SEQ ID NOs. 1-4, 7-9, preferably SEQ ID NOs. 1-4.

[0095] In some embodiments, the miRNA inhibitors are for example at least 5, 10, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides in length. In some embodiments, the miRNA inhibitors are no more than 600, 500, 400, 300, 200, 120, 115, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 10, or 5 nucleotides in length. In some embodiments, the miRNA inhibitors are at least 13 nucleotides in length. In some embodiments, the miRNA inhibitors are no more than 22 nucleotides in length. In some preferred embodiments, the miRNA inhibitors are 13 to 16 nucleotides in length. A miRNA inhibitor disclosed herein may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 substitutions.

[0096] A miRNA inhibitor is preferably between about 7 to 35 nucleotides (e.g., 17 to 25 nucleotides) in length and comprises a 5' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of a mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an miRNA inhibitor has a sequence (from 5' to 3') that is or is at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. One of skill in the art could use that portion of the longer probe sequence that is has at least partial complementarity to at least a portion of a sequence of a mature miRNA as the sequence for a miRNA inhibitor.

[0097] In certain embodiments, a vector comprises the miRNA inhibitor as described herein.

[0098] In certain embodiments, the miRNA inhibitors or agent provided herein comprise one or more chemical modifications, wherein the modification facilitates the penetration of a cellular membrane in the absence of a delivery vehicle. Any chemical modification of the miRNA inhibitor that sustains the same functional structure will bind with its intended target. Examples of any of the chemical modifications include a 2'-O-methylated nucleoside (20Me), a 2'-fluoro oligonucleotide (2'F), a 2'-0-methoxy ethyl oligonucleotide (2'MOE), a N6-methyladenosine (m6A), a phosphorodiamidate morpholino oligonucleotide (PMO), a peptide nucleic acid (PNA), a phosphorothioate bond (PS), a locked nucleic acid (LNA), a non-nucleotide N,N- diethyl-4-(4-nitronaphthalen-l-ylazo)-phenylamine (ZEN), a hydrophobic moiety, a naphthyl modifier, or a cholesterol moiety. In certain embodiments, the chemical modification of the miRNA is produced by methylation. The miRNA inhibitors or agent described herein can employ a variety of oligonucleotide chemistries. Examples of oligonucleotide chemistries include, without limitation, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorothioate, 2’0-Me-modified oligonucleotides, and morpholino chemistries, including combinations of any of the foregoing. The structures of LNAs can be found, for example, in Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54:3607, and Accounts of Chem. Research (1999) 32:301); Obika, et al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401, and Bioorganic Medicinal Chemistry (2008) 16:9230. Agents provided herein may incorporate one or more LNAs; in some cases, the compounds may be entirely composed of LNAs.

[0099] In an embodiment, the inhibitor comprises a nucleotide sequence comprising or consisting of the sequence of SEQ ID NO.11 wherein at least one nucleotide is a LNA. In some embodiments, said nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 LNAs.

[0100] In an embodiment, the inhibitor comprises a nucleotide sequence comprising or consisting of the sequence of SEQ ID NO.12 wherein at least one nucleotide is a LNA. In some embodiments, said nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 LNAs.

[0101] The miRNA inhibitors or agent described herein can be prepared by any appropriate method known in the art. For example, in some embodiments, the miRNA inhibitors described herein are prepared by chemical synthesis or in vitro transcription.

[0102] In the present methods, miRNA inhibitor or agent described herein can be administered to the subject, for example, as nucleic acid without a delivery vehicle, in combination with a delivery reagent, and / or as a nucleic acid comprising sequences that express the miRNA inhibitor or agent described herein. In some embodiments, any nucleic acid delivery method known in the art can be used in the methods described herein.

[0103] The microRNAs of the invention have been identified for the claimed use through a high- content, fluorescence-microscopy-based, high-throughput screen performed in primary mouse alveolar type II epithelial cells (ATII) cells using a library of 2042 miRNA mimics.

[0104] The use of nucleic acid or DNA coding for the inhibitor as defined above is also within the scope of the present invention. Such DNA, for example a cDNA, can be designed according to the general knowledge in the field.

[0105] Also included in the present invention are inhibitors of variants of mature miRNAs and of precursor miRNAs of the invention comprising a sequence with at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% identity to the reference sequences or DNA molecules encoding said miRNAs.

[0106] It has been found that hsa-miR-210-3p and hsa-miR-155-5p scored as the most effective in increasing cellular senescence and blocking trans-differentiation of ATII cells into ATI cells with a significant (p<0.10) Z-Score (a statistic parameter showing how a treatment is far from the mean of all treatments) at 72 hours post transfection.

[0107] Therefore, the above microRNAs are able to effectively inhibit the trans-differentiation of primary murine ATII cells into ATI cells by promoting cellular senescence.

[0108] Therefore, inhibitors of said miRNAs can be used for the treatment of all lung diseases in which the senescence of ATII cells or loss of alveolar epithelial type II to type I trans-differentiation capacity is the driver of the disease (for example, ILDs, IPF, chronic obstructive pulmonary (or lung) disease, post-acute respiratory distress syndrome). The present agents can therefore be used for medical use, in particular for the treatment of pathological conditions associated loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with senescence of alveolar epithelial type II and / or type I cells and / or loss of lung regenerative capacity and / or for promoting lung regeneration, wherein the pathological condition is preferably selected from the group of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome, said interstitial lung disease being preferably selected from idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia.

[0109] The present agents can therefore be used for the treatment of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome, said interstitial lung disease being preferably selected from idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia.

[0110] In an embodiment, an agent herein described is used for the treatment of a lung disease associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity and / or for promoting lung regeneration in a subject with a lung disease, when the acute phase of the inflammatory response of said disease is ceased. For “acute phase of the inflammatory response of the disease” is intended the phase of the disease characterized by an acute lung inflammatory response, typically immediately followed by an alveolar damage. According to this embodiment, the agents herein described can be advantageously administered to a subject affected by a lung disease in order to promote lung regeneration independently of both the type of insult and the state of inflammatory response.

[0111] For "promoting lung regeneration" it is herein intended promoting and / or increasing and / or reactivating the endogenous alveolar regenerative capacity of the lung. In particular, it is intended promoting and / or increasing ATIIs to ATIs trans-differentiation in the lung. In a particular embodiment, lung regeneration is promoted after an alveolar injury.

[0112] For “senescence of alveolar epithelial type II and / or type I cells” is intended the permanent arrest of cell cycle, the acquisition of characteristic senescence markers (i.e. p21 positivity), the loss of normal cellular functions, the abnormal activation of multiple pathways, the acquisition of secretory associated senescent phenotype (SASP), and / or the shortening or damage of telomeres.

[0113] The skilled person in the field, for example a physician specialized in the lung disease, is able to identify the pathologies characterized by pathological remodelling of lung architecture, fibrosis, loss of alveoli, and eventually reduced gas-exchange capacity, according to the common knowledge in the field, which may characterize the above indicated conditions.

[0114] Said inhibitors or agents can also be advantageously used in any condition at risk of developing lung diseases as defined above.

[0115] Indeed, for prevention it is intended the administration of the microRNA inhibitor or agent to a subject liable or at risk to develop a condition herein mentioned due, for example, to genetic predisposition (e.g. familial Pulmonary fibrosis), environment conditions (e.g. organic dust (livestock / agriculture / farming), metal and mineral dust, wood dust, asbestos, cigarette smoking) or the presence of some conditions or pathologies eventually leading to any pathological conditions associated with loss of alveolar epithelial type II to type I trans- differentiation capacity and / or with loss of lung regenerative capacity and / or for use in promoting lung regeneration, wherein the pathological condition is preferably selected from the group of interstitial lung diseases, chronic obstructive pulmonary diseases, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome, said interstitial lung disease being preferably selected from idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, and acute interstitial pneumonia.

[0116] The use of the present inhibitors in gene therapy is also a preferred embodiment of the invention.

[0117] For gene therapy it is intended the therapeutic delivery of nucleic acids into a patient's cells as a drug to treat a disease. According to the present invention, the agent of the invention can be delivered to cells of a subject in need thereof, for example a subject affected by or at risk of developing any of the above-mentioned diseases, in order to treat such diseases.

[0118] A further object of the present invention is an RNA stretch comprising the said microRNA inhibitor. The notion of RNA stretch as a continuous tract of RNA is commonly known in the field. Said RNA stretch can be obtained in vitro through cell-free transcription methods, produced synthetically or expressed in the cells upon transfer of the relative DNA coding sequence, or introduced or expressed in the cells by administration of a plasmid, a viral or other type of vector.

[0119] The present invention provides said RNA stretch for use as a medicament for prevention and / or treatment of any of the above-mentioned diseases.

[0120] In embodiments of the present invention, the agent of the invention can be administered to a subject as a medicament by conventional methods.

[0121] Conveniently, said medicament or agent or pharmaceutical composition as defined herein is in the form of a preparation for intra-tracheal instillation, inhalation (Aerosol), parenteral administration, intravenous administration, but other forms are equally suitable for carrying out the present invention. The person skilled in the art will decide the effective time of administration, depending on the patient's conditions, degree of severity of the disease, response of the patient and any other clinical parameter within the general knowledge of this matter.

[0122] Another object of the present invention is a pharmaceutical composition comprising the above defined agent as active ingredient for the prevention and / or treatment of any of the above- mentioned diseases.

[0123] The pharmaceutical composition according to the invention may contain at least one of the following: a synthetic DNA coding for to an inhibitor of the microRNA herein described, or of its primary transcript or precursor, a synthetic RNA corresponding to said inhibitor. The agent of the present invention or the corresponding coding DNA can be administered naked or together with lipid nanoparticle or lipidic molecules such as cationic lipids, or peptides, or in the context of polymeric scaffolds, which can facilitate their delivery, according to the art.

[0124] When the agent is administered using as a vector a lipidic molecule or nanoparticle, such as a liposome, the miRNA inhibitor is preferably binding the sequence corresponding to SEQ ID NO: 1, 3 and 7 (corresponding to mature miRNA sequences).

[0125] Another method to administer such agent or its corresponding DNA is by means of a suitable vector known for the administration of RNA or DNA.

[0126] A preferred vector is the adeno-associated vector (AAV) of any capsid serotype, either natural (such as, but not restricted to, AAV6, AAV1, AAV2, AAV8 or AAV9) or artificial (AAV6.2, AAV6.2FF [60, 61],

[0127] When the agent is administered using as a vector a viral vector, the miRNA inhibitor is preferably binding the sequence corresponding to SEQ ID NO: 1, 2, 3, 4, 7, 8 or 9.

[0128] The vector can be designed according to common general knowledge in the field. Typically, it comprises a suitable promoter, such as a CMV promoter or a U6 promoter, and a cDNA sequence coding for an agent as described herein.

[0129] A vector for use according to the present invention comprising at least the agent as defined above and / or a DNA coding for at least said agent, or a combination thereof is also an object of the invention.

[0130] All these methods and formulations to administer a microRNA inhibitor corresponding to the agent of the present invention, DNA coding for said agent, are conventional and well known in the art and do not need further explanations.

[0131] In particular, the skilled person knows how to choose the suitable administration mode and vector, for example for human administration, according to the general knowledge in the field.

[0132] Injection is an example of an administration route. However, the skilled person in the art can decide to administer the agents by means of any conventional pharmaceutical composition. Reference can be made to Remington’s Pharmaceutical Sciences, last edition.

[0133] The administration regime, dosage and posology will be determined by the physician according to his experience, the disease to be treated and the patient's conditions. According to the administration route chosen, the compositions will be in solid, liquid or nebulized form, suitable for oral, parenteral, intravenous or intra-tracheal administration.

[0134] In the context of the present invention, inhalational administration by aerosol is a preferred administration route. The compositions according to the present invention contain, along with the agent, at least one pharmaceutically acceptable vehicle or excipient. These may be particularly useful formulation co-adjuvants, e.g. solubilising agents, dispersing agents, suspension agents, and emulsifying agents.

[0135] Average quantities of the active agent may vary and in particular should be based upon the recommendations and prescription of a qualified physician.

[0136] The present invention also refers to the herein defined agents, pharmaceutical compositions, nucleic acids, vectors, host cells, recombinant adeno-associated virus (rAAV) particles and also refers to their medical use.

[0137] The present invention also refers to the herein defined agents, pharmaceutical compositions, nucleic acids, vectors, host cells, recombinant adeno-associated virus (rAAV) particles for use in the prevention and / or treatment of an interstitial lung disease.

[0138] The present invention also refers to the herein defined agents, pharmaceutical compositions, nucleic acids, vectors, host cells, recombinant adeno-associated virus (rAAV) particles for use in the prevention and / or treatment of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, acute interstitial pneumonia, chronic obstructive pulmonary diseases or post-acute respiratory distress syndrome or post-acute COVID-19 syndrome.

[0139] In the context of the present invention, the lung pathological condition associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity may be an interstitial lung disease.

[0140] In the context of the present invention, the lung pathological condition associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity may be idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, acute interstitial pneumonia, chronic obstructive pulmonary diseases or post-acute respiratory distress syndrome or post-acute COVID-19 syndrome. In the context of the present invention, the lung pathological condition associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity may be idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases or post-acute respiratory distress syndrome. Preferably, it is idiopathic pulmonary fibrosis.

[0141] In the context of the present invention, the lung pathological condition may be an interstitial lung disease.

[0142] In the context of the present invention, the lung pathological condition may be idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia, acute interstitial pneumonia, chronic obstructive pulmonary diseases or post-acute respiratory distress syndrome or postacute COVID-19 syndrome.

[0143] In the context of the present invention, the lung pathological condition may be idiopathic pulmonary fibrosis, chronic obstructive pulmonary diseases or post-acute respiratory distress syndrome. Preferably, it is idiopathic pulmonary fibrosis.

[0144] In the context of the present invention, the interstitial lung disease is preferably idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis-ILD, cryptogenic organizing pneumonia or acute interstitial pneumonia.

[0145] It is also an object of the present invention a method of prevention and / or treatment of lung pathological conditions associated with senescence of alveolar epithelial type II and / or type I cells and / or loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity, comprising administering at least one agent, pharmaceutical composition, nucleic acid, vector, host cell, recombinant adeno-associated virus (rAAV) particle or combination thereof as defined herein to a patient in need thereof.

[0146] It is also an object of the present invention a method of promoting lung regeneration in a subject with a lung pathological condition, comprising administering at least one agent, pharmaceutical composition, nucleic acid, vector, host cell, recombinant adeno-associated virus (rAAV) particle or combination thereof as defined herein to a patient in need thereof.

[0147] The present invention will now be illustrated with reference to the following figures and examples. Brief description of the figures

[0148] Figure 1. Human miRNA screening in primary mouse ATII cells for ATI! senescence and ATI! to ATI trans-differentiation. A. Screening workflow. Briefly 2042 human miRNA mimics were reverse- transfected (final concentration 25nM) into primary mouse ATII cells and at 72 hours after transfection cell were fixed in PFA and immune-stained for Rage (marker of ATI cells, to analyze the trans-differentiation) and P21 (marker of senescence). Plates were imaged and images were analyzed by counting the total cell number, the percentage of p21 and percentage of Rage positive cells. All non-toxic miRNAs were ranked for potency in either increasing cellular senescence (increasing the percentage of ATI / P21 positive cells) and blocking ATII to ATI trans-differentiation (decreasing of Rage positive cells percentage). B. Chart showing Z-Score of the total number of cells / well. MiRNAs corresponding to round gray dots are considered significantly toxic (Z<-1.96, P<0.05). C. Chart showing Z-Score of percentage of ATI / P21 positive cells. In particular, miRNAs corresponding to round white dots are considered significantly increasing the percentage of P21 positive cell s / well (Z> 1.65, P<0.10, dashed lines) and reducing the percentage of Rage positive cell s, so inhibiting the trans-differentiation of ATII to ATI cells (Z<-1.65, P<0.10, dashed lines). Out of them, only 3 miRNAs (hsa-miR-155-5p, hsa-miR-210-3p and hsa-miR-490-3p) were simultaneously increasing cellular senescence (Zscore % ATI / P21 positive cells >1.65, p<0.10). D. Image quantification, Z-Score of the percentage of ATI+P21+ cells / well for selected miRNAs and negative control (MC4, cel-miR-231-3p) are plotted. E. Representative immunofluorescence images of selected miRNAs that increasing cellular senescence, as it can be appreciated from the images of the single channel for P21 marker in bottom part of the panel, while decreasing ATII to ATI trans- differentiation, here represented by the total number of Rage (ATI) positive cells.

[0149] Figure 2. Two out of three selected miRNAs present high endogenous expression levels in bleomycin treated mice. A, B and C. Expression of selected miRNAs in total lung harvested from mice treated with saline (used as Ctrl) and mice treated with bleomycin. Specifically, mice were anesthetized by isoflurane and then, 60pl of bleomycin (1 ,8U / kg) were intratracheally injected using intubation method in mice. After 21 days from the injection, in the maximum development of lung fibrosis, mice were sacrificed. Graphs show an increase of endogenous expression of miR-155-5p (A) and miR-210-3p (B) in lung upon bleomycin treatment compared to the saline one. Whereas miR-490-3p isn’t expressed in lung neither in sham nor damaged condition (C). D and E. Relative expression of selected miRNA (miR-155-5p and miR-210-3p) in ATII cells isolated from untreated and bleomycin treated mice. Mice were intratracheally injected with 1.8U / kg of bleomycin and the ATII cells were isolated upon 21 days from the injection. Graphs show an increase of endogenous levels of miR-155-5p (D) and miR-210-3p (E) in ATI! isolated from bleomycin treated mice compared to untreated mice. F and G. Relative expression of selected miRNAs in murine alveolar fibroblasts isolated after 21 days from intratracheally injection of bleomycin and from untreated mice. As it can be evident from the graphs in figure 2F and 2G, both the expression of miR-155-5p (D) and miR-210-3p increase upon bleomycin treatment in alveolar fibroblasts. All endogenous expression levels of selected miRNAs were normalized to the 5S ribosomal RNA expression levels. Data were analyzed by one tailed unpaired t-test and statistical significance is reported as follows: *P<0.05.

[0150] Figure 3. The selected miRNAs are more expressed in pathological conditions. A and B. Relative expression of miR-155-5p and miR-210-3p respectively in human ATI! cells isolated from healthy patients and IPF patients. ATII cells were isolated from pieces of lung harvested from non-fibrotic and IPF patients. Charts show that the expression of selected miRNAs is significantly higher in ATI! cells isolated from IPF patients compared to heathy one. All endogenous expression levels of selected miRNAs were normalized to the levels of 5S ribosomal RNA used as endogenous standard housekeeping. Data from 3 independent experiments / conditions were analyzed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as follows: ** P<0,005.

[0151] Figure 4. Effect of ASO-hsa-miRNAs on ATI! cells isolated from bleomycin treated mice. A. Experimental workflow. ASO (antisense oligonucleotide) against selected two miRNAs (mmu-miR- 155-5p and mmu-miR-210-3p) were reverse-transfected (final concentration 30nM) into ATI! cells isolated from bleomycin treated mice (injection method, timing and dose are reported in the previous sections). After 72 hours from ASO transfection cells were fixed in PFA and stained for Rage (ATI cells), P21 (Senescent cells) and Hoechst (total cells). Plates were imaged and images were analyzed by counting the total cell number, the percentage of P21 / Rage positive cells and the percentage of Rage positive cells. B. Quantification of total cell number of ATI! cells / well. C. Quantification of the percentage of Rage positive cells over total number of cells per well. D. Quantification of the percentage ofP21 / Rage double positive cells over total number of cells per well. Data were analyzed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***P<0.0005, ** P<0.0075. E. Representative immunofluorescence images of bleomycin ATI! cells treated with ASO against selected miRNAs. Immunofluorescence images show the effect of ASO in promoting ATI! to ATI trans-differentiation as illustrated in the images for the single marker Rage and in reducing cellular senescence (Images for P21 senescence marker). Figure 5. Paracrine effect of primary mouse ATI cells, transfected with selected miRNA mimics, on primary mouse lung fibroblasts. A. Experiment workflow. Selected miRNAs, namely hsa-miR-155- 5p, hsa-miR-210-3p, and a negative control (cell-miR-231 -3p), were reverse-transfected into primary mouse alveolar type II (ATI!) cells at a final concentration of 25nM using Lipofectamine RNAiMAX (Thermo Fisher Scientific). Four days post-transfection, conditioned supernatants were collected and filtered through a 10 kDa cutoff filter. The filtered supernatant was then used to treat primary murine lung fibroblasts. Lung fibroblasts were isolated from mice and cultured in DMEM containing 0.1% serum to prevent activation and transition into myofibroblasts due to serum presence. The day of isolation, fibroblasts were treated with the collected supernatant. After 72 hours of treatment, the cells were fixed with PFA and immune-stained. Primary lung fibroblasts were immune-stained for a - SMA (a marker of activated fibroblasts, used to analyse fibroblast activation and transition to myofibroblasts) and P21 (a marker of cellular senescence). The plates were imaged using Operettta CLS microscope (Rewity), and the images were analysed by counting the total number of cells, the percentage of P21 -positive cells, and the percentage of a -SMA-positive cells. B. Representative immunofluorescence images. The upper part of the panel illustrates total cell number, as visualized by DAPI staining, the middle panel illustrate the number of a-SMA-positive cells, and the lower panel illustrates the number of p21 positive nuclei. C. Chart showing the total number of cells / well. D. Chart showing the percentage of a -SMA-positive cells / well. E. Chart showing the percentage of P21-positive cells / well. Data were analyzed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***p<0.0005.

[0152] Figure 6. Effect of ASO-mmu-miRNAs in the Bleomycin-Induced mouse model of IPF : therapeutic treatment with ASO 10 days post-bleomycin injection. A. Experiment workflow. Mice of 8 weeks were intratracheally injected with bleomycin to induce lung fibrosis. Mice were anesthetized with isoflurane, and 60 pL of bleomycin (1 U / kg) was administered via intratracheal administration after intubation. Ten days after bleomycin inj ection, as the inflammatory phase began to decrease and lung fibrosis started to develop, ASO targeting mmu-miR-155-5p and mmu-miR-210-3p were intratracheally injected individually at a concentration of 10 pg / mouse. Twenty-one days post- bleomycin injection, mice were sacrificed, and lungs were harvested. Lung weight was recorded, and hydroxyproline assays were performed to quantify collagen content and lung fibrosis. Additionally, lung tissue was collected to quantify the expression, by qRT-PCR, of key disease markers, including KRT8, HIF I a , and P16. B. Chart of total lung weight upon harvesting. C. Results of Hydroxyproline Assay. The hydroxyproline content is proportional to the degree of fibrosis in the lungs. D. E. Expression levels of selected miRNAs (mmu-miR-155-5p in D and mmu-miR-210-3p in E) in total lung tissue. F. mRNA expression levels of KRT8 in relation to tubulin. G. Chart of the mRNA expression levels of EUFla in relation to tubulin expression. H. mRNA expression levels of P16 in the total lung in relation to tubulin expression. Data were analysed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***P<0.0005, ** P<0.0075, * P<0.01.

[0153] Figure 7. Effect of ASO-hsa-miRNAs in the bleomycin-induced mouse model of IPF: therapeutic treatment with ASO 21 days post-bleomycin injection. A. Experiment workflow. Mice of 8 weeks were intratracheally injected with bleomycin to induce lung fibrosis. Mice were anesthetized with isoflurane, and 60 pL of bleomycin (1 U / kg) was administered via intratracheal administration after intubation. Twenty-one days after bleomycin injection, as the inflammatory phase began to decrease and lung fibrosis started to develop, ASO targeting mmu-miR-155-5p and mmu-miR-210-3p were intratracheally injected individually at a concentration of 10 pg / mouse. Twenty-one days post- bleomycin injection, mice were sacrificed, and lungs were harvested. Lung weight was recorded, and hydroxyproline assays were performed to quantify collagen content and lung fibrosis. Additionally, lung tissue was collected to quantify the expression, by qRT-PCR, of key disease markers, including KRT8, HIFla, andP16. B. Chart of total lung weight upon harvesting. C. Results ofHydroxyproline Assay. The hydroxyproline content is proportional to the degree of fibrosis in the lungs. D. E. Expression levels of selected miRNAs (mmu-miR-155-5p in D and mmu-miR-210-3p in E) in total lung tissue. F. mRNA expression levels of KRT8 in relation to tubulin. G. Chart of the mRNA expression levels of EUFla in relation to tubulin expression. H. mRNA expression levels of P16 in the total lung in relation to tubulin expression. Data were analyzed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***P<0.0005, ** P<0.0075, * P<0.01.

[0154] Figure 8. Effect of ASO-hsa-miRNAs in the bleomycin-induced mouse model of IPF : therapeutic treatment with ASO 10 days post-bleomycin inj ection in twenty-month-old mice. Mice of 20 months exhibit a loss of ability to repair lung damage following bleomycin-induced injury, whereas young mice are able to spontaneously resolve lung fibrosis and regenerate lung tissue within 60 days after bleomycin administration. For this reason, aged mice represent the best mouse model for IPF, mimicking the chronic conditions observed in human IPF. A. Experiment workflow. Mice of 20- months were intratracheally injected with bleomycin to induce lung fibrosis. Mice were anesthetized with isoflurane, and 60 pL of bleomycin (1 U / kg) was administered via intratracheal administration after intubation. Twenty-one days after bleomycin injection, as the inflammatory phase began to decrease and lung fibrosis started to develop, ASO targeting mmu-miR-155-5p and mmu-miR-210- 3p were intratracheally injected individually at a concentration of 10 pg / mouse. Twenty-one days post-bleomycin injection, mice were sacrificed, and lungs were harvested. Lung weight was recorded, and hydroxyproline assays were performed to quantify collagen content and lung fibrosis. Additionally, lung tissue was collected to quantify the expression, by qRT-PCR, of key disease markers, including KRT8, HLFla, and Pl 6. B. Chart of total lung weight upon harvesting. C. Results of Hydroxyproline Assay. The hydroxyproline content is proportional to the degree of fibrosis in the lungs. D. E. Expression levels of selected miRNAs (mmu-miR-155-5p in D and mmu-miR-210-3p in E) in total lung tissue. F. mRNA expression levels of KRT8 in relation to tubulin. G. Chart of the mRNA expression levels of HLFla in relation to tubulin expression. H. mRNA expression levels of P16 in the total lung in relation to tubulin expression. Data were analyzed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***P<0.0005, ** P<0.0075, * P<0.01.

[0155] Figure 9. Percentage of ATI! cells targeted by ASO following intratracheal injection. A. Experimental Workflow. ASO targeting control miRNAs, conjugated with FAM (fluorescent marker), was intratracheally injected (10 pg / mouse) in mice of 8 weeks. Five days after the injection, animals were sacrificed and the left lung lobes were sectioned and immune-stained for anti-FAM (to amplify the signal of FAM-ASO in paraffin sections), SPC (a marker of ATI! cells), and Coll Al (a marker of fibroblasts). Sections were imaged, and the images were analysed to quantify the percentage of SPC / FAM-ASO-positive cells and CollAl / FAM-ASO-positive cells. B. Representative immunofluorescence images. The images show the percentage of ATII cells and fibroblasts targeted by FAM-ASO in vivo following intratracheal injection of 10 pg of FAM-ASO against a control miRNA sequence. C. Chart showing quantifications as per experimental conditions in B. Data were analysed by One-Way ANOVA followed by Dunnet correction for multiple comparisons and statistical significance is reported as it follows: ****P<0.0001, ***P<0.0005, ** P<0.0075, * P<0.01.

[0156] Figure 10. Safety of ASO targeting selected miRNAs. A. Experiment Workflow. Mice of 8 weeks were intratracheally injected with 10 pg of FAM-ASO (antisense oligonucleotide targeting control miRNAs) and sacrifice 5 days post-injection. Organs including liver, kidney, heart and lung were harvested for analysis. Tissue sections were prepared from the harvested organs and immune-stained for anti-FAM antibodies (to amplify the FAM-ASO signal) and DAPI to stain cell nuclei. The sections were imaged, and the images were visually inspected to assess the number of FAM- ASO-positive cells in these organs. B. Representative immunofluorescence images. Images show the FAM-ASO signal in the kidney, liver, heart and lung following treatment as in A. C. Chart showing quantifications as per experimental conditions in B. D. Experimental Workflow. Mice were intratracheally injected with bleomycin to induce lung fibrosis. After anaesthesia with isoflurane, 60 pL of bleomycin (1 U / kg) was administered via intubation. Ten days post-bleomycin injection, ASOs targeting mmu-miR-155-5p and mmu-miR-210-3p were intratracheally injected individually at a concentration of 10 pg / mouse. Twenty-one days after bleomycin injection, the mice were sacrificed, and key organs for safety, including the liver, kidney, and heart, were harvested to quantify miRNA expression levels. E. Quantification by qRT-PCR of the expression of selected miRNAs (mmu-miR-155-5p on the left and mmu-miR- 210-3p on the right) in kidney, liver, and heart.

[0157] EXAMPLES

[0158] Example 1

[0159] Primary Screening Results

[0160] Inventors performed a cell-based phenotypic high throughput screening (HTS) assay on 2042 human miRNA mimics for their efficacy in increasing cellular senescence and inhibiting ATII to ATI trans-differentiation in primary alveolar mouse epithelial cells. They identified three miRNA mimics that significantly (ZScore>1.65, P<0.10) increased cellular senescence and decreased (ZScore<1.65, P<0.10) ATII to ATI trans-differentiation. Inventors isolated and cultured mouse alveolar ATII cells, obtaining a purity >90%. Isolated cells were reverse transfected with an arrayed library of 2042 human miRNA mimics at 25nM final concentration (Horizon Discovery) (Experimental scheme in Figure 1 A). In particular, 5 pl of miRNA mimic (250nM) were spotted by a Hamilton Starlet Liquid Handler on the bottom of 384-wells- phenoplate (PerkinElmer #6057300) previously coated in fibronectin / gelatin. Immediately after a mixture composed of 15 pl of Optimem (Gibco) and 0.15 lipofectamine RNAimax was added to each well, mixed and incubated for 30 minutes at room temperature. After 30 minutes of incubation, 15.000 cells diluted in a final volume of 30pl were added to each well. 72 hours post transfection the cells were fixed and stained for Rage (to label ATI cells and track the trans-differentiation), P21 (marker of senescence) and Hoechst 3342 (nuclei). An average of 1000 cells / condition have been imaged by automated fluorescence microscopy (Operetta CLS microscope) and a complete phenotypic profiling has been performed for all treatments.

[0161] Inventors excluded toxic miRNAs, that significantly reduced the number of cells / well (Z-Score viability < -1.96, P<0.05, round grey dot in Figure IB). Among the non-toxic miRNAs, Inventors selected three miRNAs simultaneously increasing the percentage of P21 positive ATI (RAGE positive) cells (Z>1,65, P<0,10) and reducing the percentage of ATI cells, thus inhibiting the trans-differentiation (Z<-1,65, P<0,10). According to these criteria, three miRNAs were identified: hsa-miR-155-5p, hsa-miR-210-3p and hsa-miR490-3p respectively (Figure 1C and Table 1). Representative images and data of ATII cells transfected with the selected miRNAs are reported in Figure ID and IE, where it is possible to appreciate a clear increase in cellular senescence (p21 positivity) associated with a decrease in the total number of ATI cells / well.

[0162] Table 1. Human miRNA sequences

[0163] Endogenous expression levels of selected miRNAs in the total lung of bleomycin-treated mice

[0164] The overall aim of this research is to use miRNAs as potential target for the development of anti-fibrotic anti-miRNA-based therapies. Therefore, the assessment of endogenous miRNA levels in pathological conditions is essential to evaluate the potential role of selected miRNAs in the development and progression of IPF, and consequently therapeutical impact of selected miRNA inhibition. Accordingly, the inventors quantified the relative expression of selected miRNAs in total lung harvested from saline and bleomycin treated mice. According to the American Thoracic Society, the mouse model of bleomycin induced lung fibrosis represents the most reliable animal model for the preclinical assessment of potential therapies for pulmonary fibrosis

[0013] , Briefly, C57BL / 6 mice were anesthetized using isoflurane and then, intubated and intra-tracheal injected either, with 60 pl of saline (Ctrl group) or / with 60 pl of bleomycin (1.8U / kg final concentration). After 21 days from the injection, mice were sacrificed, and lungs were harvested and snap frozen in liquid nitrogen. RNA extraction from frozen lung tissues was performed using the miRNeasy Mini Kit (Qiagen). Each tissue sample was homogenized and lysed in 1ml of Trizol with magnalyzer. RNA was retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed for murine sequences of selected miRNAs; reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping.

[0165] Inventors observed that the endogenous expression of selected miRNAs resulted to be higher in bleomycin treated lungs compared to saline one (Figure 2 A and B). Regarding miR-490- 3p; there was no expression in murine total lung neither in saline nor in bleomycin condition (Figure 2C) and for this reason it was not followed up further.

[0166] Table 2. Murine miRNA sequences

[0167] Example 2

[0168] Endogenous expression levels of selected miRNAs in the ATI! cells isolated from the lung of bleomycin-treated mice Inventors decided to investigate the different expression of selected miRNAs upon bleomycin treatment in the main cell types known to play an active role in the development of IPF. We treated adult C57BL / 6 mice with Bleomycin, as described above. After 21 days from the injection, we isolated ATI! cells, Ctrl ATI! cells were isolated from saline untreated mice. To quantify the expression of selected miRNAs, RNA extraction was performed using miRNeasy Micro Kit (Qiagen). Then, samples were retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed on the base on murine miRNAs sequences reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping.

[0169] As shown in figure 2 D and E, there is an increase of the endogenous expression levels of mmu- miR-155-5p and mmu-miR-210-3p in ATII cells isolated from bleomycin treated mice compared to untreated one.

[0170] Example 3

[0171] Endogenous expression levels of selected miRNAs in alveolar fibroblasts isolated from the lung of bleomycin-treated mice

[0172] Inventors quantified the endogenous expression levels of selected miRNAs also in alveolar fibroblasts isolated from the distal portion of the lungs belonging to saline (Ctrl) and bleomycin treated C57BL / 6 mice. The isolation allows to obtain a purity > 99 % after 2 days in culture in DMEM High Glucose 10% of FBS.

[0173] RNA was extracted from isolated fibroblasts using miRNeasy Micro Kit (Qiagen). Then, samples were retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), designed on murine miRNAs sequences reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping. Also in alveolar fibroblasts, the expression of mmu-miR-155-5p and mmu-miR-210-3p resulted to be significantly upregulated upon bleomycin treatment compared to control condition. (Figure 2F and 2G).

[0174] Example 4

[0175] Endogenous expression levels of selected miRNAs in the ATII cells isolated from human IPF lungs

[0176] To elucidate the pathogenic role of selected miRNAs in the IPF lung disease. Inventors decided to quantify the expression of hsa-miR-155-5p and hsa-miR-210-3p in human ATII cells isolated from healthy patients and IPF patients. RNA isolation and cDNA generation was performed as described in the previous sections. The endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed on the base of human sequences for selected miRNAs reported in Table 1.

[0177] As shown in figure 3 A and 3B, the expression of both miRNAs hsa-miR-155-5p and hsa-miR- 210-3p increase in IPF ATII cells compared to ATII isolate from healthy controls. These results underline the important involvement of selected miRNAs in human IPF. MiRNA expression levels were expressed relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping.

[0178] Example 5

[0179] Effect of ASO (antisense oligonucleotide) on primary bleomycin alveolar epithelial cells

[0180] Given the involvement of the miR-155-5p and miR-210-3p in lung fibrotic remodelling and aging (Figure 2), Inventors proposed to use miRNAs as targets for the development of innovative anti-aging and pro-regenerative medication for IPF. The inventors decided to use LNA-modified ASO (LNA-ASOs) to target selected miRNAs in primary mouse ATII cells isolated from the lungs of bleomycin treated mice. ATII cells were isolated from C57BL / 6 mice treated with 1.8U / kg of bleomycin at 21 days after bleomycin treatment. At this time point, ATII cells present higher levels of expression for selected miRNAs. In addition, diseased mouse ATII cells once isolated and cultured, are known to retain a limited ATII to ATI transdifferentiation capacity

[0062] , Similar evidence was shown on human ATII cells isolated from IPF lungs

[0063] , The aim of this experiment was to prove that LNAs, targeting selected miRNAs, were able to downregulate them and both reduce cellular senescence and restore effective ATII to ATI trans-differentiation in diseased ATII cells.

[0181] ASOs against selected miRNAs were designed and produced by QIAGEN, based on the sequence of miRNAs reported in Table 2. Sequences of said LNA-ASOs are 5'- GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'-TCACAATTAGCATTA-3' (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.i l) and miR-155-5p (SEQ ID NO.12). ASOs present some modifications in order to stabilize the structure, like the use of LNA nucleotides and a dimension between 13-16 nucleotides to be useful also in vivo. In the context of the present invention, ASOs comprise at least one modified nucleotide, wherein at least one modified nucleotide is a locked nucleic acid (LNA). In particular, 7,5 pl of ASO (500nM) were spotted on the bottom of 96-wells-phenoplate (PerkinElmer #6057300). Immediately after a mixture composed of 42pl of Optimem (Gibco) and 0.5 pl lipofectamine RNAimax was added to each well, mixed and incubated for 30 minutes at room temperature. After effective incubation, 50.000 cells diluted in a final volume of 100 JJ.1 were added to each well. The assay was stopped at 72 hours post transfection (experimental scheme in Figure 4A). Finally, cells were stained with fluorescent probe for Rage (to label ATI cells and see the ATII to ATI transdifferentiation), P21 (marker of senescence) and Hoechst 3342 (nuclei). An average of 1000 cells / condition have been imaged by automated fluorescence microscopy (Operetta CLS microscope) and a complete phenotypic profiling has been performed for all treatments.

[0182] We found that both LNA-ASOs effectively restored ATII to ATI trans-differentiation while inhibiting cellular senescence in ATII cell isolated from bleomycin treated lungs (Figure 4B and 4C). In particular, LNA-ASOs increase the number of total cells, the percentage of Rage positive cells and decrease the percentage of P21 positive cells compared to the bleomycin ATII cells transfected with ASO Negative Ctrl (Figure 4D).

[0183] These results together strongly support the role of selected miRNAs in the impairment of ATII’s capability to trans-differentiate into ATI cells and in promoting ATII cellular senescence. Whereas the use of LNA-ASOs targeting the selected miRNAs effectively restored ATII to ATI trans-differentiation capacity and reduced cellular senescence in diseased ATII cells.

[0184] Example 6

[0185] Given that diseased ATII cells exhibit highly elevated levels of hsa-miR-155-5p and hsa-miR- 210-3p, and recognizing the central role of ATII cells in this innovative anti-miRNA-based pro-regenerative therapeutic approach, the Inventors sought to determine whether primary mouse ATII cells over-expressing either hsa-miR-155-5p or hsa-miR-210-3p exert a pathological paracrine effect on mouse lung fibroblasts.

[0186] This experiment is crucial in demonstrating that by sequestering hsa-miR-155-5p or hsa-miR- 210-3p, the Inventors succeeded in not only restoring ATILto-ATI transdifferentiation, thereby reinstating the physiological mechanisms of alveolar repair and lung regeneration but also managed to prevent ATILdriven fibroblast activation and differentiation into myofibroblasts.

[0187] As shown in figure 5 A, selected miRNAs, namely hsa-miR-155-5p, hsa-miR-210-3p, and a negative control (cell-miR-231 -3p), were reverse-transfected into primary mouse alveolar type II (ATII) cells at a final concentration of 25 nM using Lipofectamine RNAiMAX (Thermo Fisher Scientific). Four days post-transfection, conditioned supernatants were collected and filtered through a 10 kDa cutoff filter. The filtered supernatant was then used to treat primary murine lung fibroblasts. Lung fibroblasts were isolated from mice and cultured in DMEM containing 0.1% serum to prevent activation and transition into myofibroblasts due to serum presence. The day of isolation, fibroblasts were treated with the collected supernatant. After 72 hours of treatment, the cells were fixed with PFA and immune-stained for a-SMA (a marker of activated fibroblasts, used to analyse fibroblast activation and transition to myofibroblasts) and P21 (a marker of cellular senescence). The plates were imaged using Operetta CLS microscope (Rewity), and the images were analysed by counting the total number of cells, the percentage of P21 -positive cells, and the percentage of a-SMA-positive cells. As shown in figure 5B, the supernatant collected from primary ATII cells over-expressing hsa-miR-155- 5p and hsa-miR-210-3p induced an increase in cellular senescence, and a remarkable increase in the transition of fibroblasts into myofibroblasts, represented by the higher percentage of a-SMA-positive cells. Figure 5 C-E reports quantification of total cells / well, % a-SMA-positive cells / well, and % a- p21 -positive cells / well. It appears evident that lung fibroblasts treated with the supernatant from ATI! cells transfected with hsa-miR-155-5p and hsa-miR-210-3p exhibited a significant increase in cell number, in the percentage of a-SMA-positive cells (transition of fibroblasts into myofibroblasts), and in % of p21 positive cells (cellular senescence), if compared to control treated cells.

[0188] These findings demonstrate that mouse primary ATII cells overexpressing hsa-miR-155-5p or hsa-miR-210-3p exert a pathological paracrine effect on mouse lung fibroblasts, promoting both cellular senescence and fibroblast-to-myofibroblast transition. The observed increase in fibroblast activation (a-SMA expression) and senescence (P21 expression) suggests that elevated levels of these miRNAs, in ATII cells, contribute to trigger a profibrotic and dysfunctional lung microenvironment. These results further support the therapeutic potential of targeting hsa-miR-155-5p and hsa-miR-210-3p in ATII cells to both restoring alveolar repair mechanisms and preventing ATII-driven fibrosis progression.

[0189] Example 7

[0190] The Inventors further evaluated the therapeutic potential of antisense oligonucleotides (ASOs) targeting mmu-miR-155-5p and mmu-miR-210-3p in a bleomycin-induced mouse model of idiopathic pulmonary fibrosis (IPF). The sequences of the LNA-ASOs used in this experiment are 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'-TCACAATTAGCATTA-3' (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.11) and miR-155-5p (SEQ ID NO.12). By administering ASO, intra tracheally, 10 days post-bleomycin injection, the Inventors aimed to determine whether inhibiting these miRNAs could reverse fibrosis progression and promote lung regeneration.

[0191] To induce lung fibrosis, 8-week-old mice were intratracheally injected with bleomycin at a dose of 1 U / kg under isoflurane anesthesia. After 10 days, when the inflammatory phase started to decline and fibrosis began developing, LNA-ASOs targeting mmu-miR-155-5p and mmu- miR-210-3p were individually delivered via intratracheal injection at a dose of 10 pg / mouse.

[0192] Mice were sacrificed at day 21 post-bleomycin injection, and the following analyses were performed to assess fibrosis severity and therapeutic efficacy: 1) Lung weight measurement as an indirect marker of fibrosis severity; 2) Masson’s tri chrome staining and hydroxyproline assay to quantify collagen content and fibrotic tissue; 3) Gene expression analysis of key disease markers, including KRT8 (aberrant ATILto-ATI transitional intermediates), HIFla (hypoxic response), and P16 (cellular senescence). In addition, to confirm the efficacy of LNA- ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression levels.

[0193] As shown in figure 6B, bleomycin-treated mice exhibited a significant increase in lung weight, reflecting fibrosis progression. However, LNA-ASO-treated mice displayed a marked reduction in lung weight, suggesting a regression of fibrosis and restoration of normal lung structure. These results were consistent with the results of hydroxyproline quantification (collagen content), as hydroxyproline is a key component of collagen fibers and therefore of extracellular matrix (ECM). As shown in figure 6C Bleomycin treatment led to a significant accumulation of collagen (increase in hydroxyproline content), while LNA-ASO treatment effectively reduced hydroxyproline content, confirming a reduction in the amount of fibrotic tissue.

[0194] To confirm that the reduction in fibrosis correlates with effective LNA-ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression. To quantify the expression of selected miRNAs, RNA extraction was performed using miRNeasy Micro Kit (Qiagen). Then, samples were retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed on the base on murine miRNAs sequences reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping. Given the strong increase in miRNAs’ levels upon bleomycin administration, LNA-ASO treatment led to a significant decrease in the levels of both mmu-miR-210-3p and mmu-miR- 155-5p, confirming successful in vivo knockdown following intratracheal administration (Figure 6D, E).

[0195] KRT8 (Keratin 8) is a marker of aberrantly transitioning ATII cells, commonly observed in fibrotic lungs where ATII-to-ATI differentiation is impaired

[0011] , Bleomycin treatment induced a significant increase in KRT8 expression, indicating an abnormal transition state of ATII cells into ATI cells. However, LNA-ASO treatment significantly reduced KRT8 levels, suggesting a restoration of the physiological ATII-to-ATI differentiation process, which is critical for alveolar repair and regeneration (Figure 6F). HIFla (Hypoxia-Inducible Factor 1- alpha) is a key regulator of the hypoxia response and is upregulated in fibrotic lungs, where poor oxygenation triggers pathological remodelling. In addition, it is known that the expression of both miR-155-5p and miR-210-3p is regulated by HIFla and therefore proportional to hypoxic state of the lung [42, 43], Bleomycin-treated mice showed increased HIFla expression, consistent with fibrosis-induced hypoxia. LNA-ASO treatment led to a reduction in HIFla levels, indicating a decrease in hypoxia-driven fibrotic mechanisms (Figure 6G). Last, P16 is a marker of cellular senescence, which plays a pivotal role in the pathophysiology of IPF by promoting a senescent pro-fibrotic microenvironment

[0014] , Bleomycin treatment led to a significant increase in P16 expression, reflecting heightened senescence-related fibrosis. Importantly, treatment with ASOs effectively reduced P16 levels, suggesting that targeting either mmu-miR-155-5p or mmu-miR-210-3p can counteract the senescent phenotype and contribute to fibrosis resolution by sustaining ATII-driven pro regenerative mechanisms (figure 6H).

[0196] These findings demonstrate that targeting mmu-miR-155-5p and mmu-miR-210-3p with LNA- ASOs at 10 days post-bleomycin administration effectively reduces fibrosis markers, restores ATII cell differentiation, mitigates hypoxia-driven damage, and reverses cellular senescence. This supports the therapeutic potential of miRNA inhibition in promoting lung repair and regeneration in IPF.

[0197] Example 8

[0198] Moreover, the Inventors herein evaluated the therapeutic potential of antisense oligonucleotides (ASOs) targeting mmu-miR-155-5p and mmu-miR-210-3p in a bleomycin- induced mouse model of idiopathic pulmonary fibrosis (IPF). The sequences of the LNA-ASOs used in the following experiment are 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'- TC AC AATTAGC ATTA-3' (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.11) and miR-155-5p (SEQ ID NO.12).

[0199] By administering ASO, intra tracheal, 21 days post-bleomycin injection, the Inventors aimed to determine whether inhibiting these miRNAs could reverse fibrosis once fibrosis is fully established and at its maximum peak, by promoting lung regeneration.

[0200] To induce lung fibrosis, 8-week-old mice were intratracheally injected with bleomycin at a dose of 1 U / kg under isoflurane anesthesia. After 21 days, once fibrosis is fully established and at its maximum peak, LNA-ASOs targeting mmu-miR-155-5p and mmu-miR-210-3p were individually delivered via intratracheal injection at a dose of 10 pg / mouse.

[0201] Mice were sacrificed at day 30 post-bleomycin injection, and the following analyses were performed to assess fibrosis severity and therapeutic efficacy: 1) Lung weight measurement as an indirect marker of fibrosis severity; 2) Masson’s tri chrome staining and hydroxyproline assay to quantify collagen content and fibrotic tissue; 3) Gene expression analysis of key disease markers, including KRT8 (aberrant ATILto-ATI transitional intermediates), HIFla (hypoxic response), and P16 (cellular senescence). In addition, to confirm the efficacy of LNA- ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression.

[0202] As shown in figure 7B, bleomycin-treated mice exhibited a significant increase in lung weight, reflecting fibrosis progression. However, LNA-ASO-treated mice displayed a marked reduction in lung weight, suggesting a regression of fibrosis and restoration of normal lung structure. These results were consistent with the results of hydroxyproline quantification (collagen content), as hydroxyproline is a key component of collagen fibers and therefore of ECM. As shown in figure 7C Bleomycin treatment led to a significant accumulation of collagen (increase in hydroxyproline content), while LNA-ASO treatment effectively reduced hydroxyproline content, confirming a reduction in the amount of fibrotic tissue.

[0203] To confirm that the reduction in fibrosis correlates with effective of LNA-ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression. To quantify the expression of selected miRNAs, RNA extraction was performed using miRNeasy Micro Kit (Qiagen). Then, samples were retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed on the base on murine miRNAs sequences reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping.

[0204] Given the strong increase in miRNAs’ levels upon bleomycin administration, LNA-ASO treatment led to a significant decrease in the levels of both mmu-miR-210-3p and mmu-miR- 155-5p, confirming successful in vivo knockdown following intratracheal administration (figure 7D, E).

[0205] KRT8 (Keratin 8) is a marker of aberrantly transitioning ATII cells, commonly observed in fibrotic lungs where ATII-to-ATI differentiation is impaired

[0011] , Bleomycin treatment induced a significant increase in KRT8 expression, indicating an abnormal transition state of ATII cells into ATI cells. However, ASO treatment significantly reduced KRT8 levels, suggesting a restoration of the physiological ATII-to-ATI differentiation process, which is critical for alveolar repair and regeneration (Figure 7F). HIFla (Hypoxia-Inducible Factor 1- alpha) is a key regulator of the hypoxia response and is upregulated in fibrotic lungs, where poor oxygenation triggers pathological remodelling. In addition, it is known that the expression of both miR-155-5p and miR-210-3p is regulated by HIFla and therefore proportional to hypoxic state of the lung [42, 43], Bleomycin-treated mice showed increased HIFla expression, consistent with fibrosis-induced hypoxia. LNA-ASO treatment led to a reduction in HIFla levels, indicating a decrease in hypoxia-driven fibrotic mechanisms (figure 7G). Last, P16 is a marker of cellular senescence, which plays a pivotal role in the pathophysiology of IPF by promoting a senescent pro-fibrotic microenvironment

[0014] , Bleomycin treatment led to a significant increase in P16 expression, reflecting heightened senescence-related fibrosis. Importantly, LNA-ASO treatment effectively reduced Pl 6 levels, suggesting that targeting either mmu-miR-155-5p or mmu-miR-210-3p can counteract the senescent phenotype and contribute to fibrosis resolution by sustaining ATII-driven pro regenerative mechanisms (figure 7H).

[0206] These findings demonstrate that targeting mmu-miR-155-5p and mmu-miR-210-3p with specific LNA-ASOs at 21 days post-bleomycin administration effectively reduces fibrosis markers, restores ATII cell differentiation, mitigates hypoxia-driven damage, and reverses cellular senescence. This supports the therapeutic potential of miRNA inhibition in promoting lung repair and regeneration in IPF.

[0207] Example 9 This experiment investigates the therapeutic efficacy of antisense oligonucleotides (ASOs), in particular LNA-ASOs, targeting mmu-miR-155-5p and mmu-miR-210-3p in a bleomycin- induced mouse model of idiopathic pulmonary fibrosis (IPF) using aged mice (20 months old). Unlike young mice, which can spontaneously resolve fibrosis and regenerate lung tissue within 60 days after bleomycin administration, aged mice exhibit a diminished capacity for lung repair, making them the most relevant model for studying chronic human IPF [13, 17],

[0208] The sequences of the LNA-ASOs used in this experiment are 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'-TCACAATTAGCATTA-3' (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.11) and miR-155-5p (SEQ ID NO.12).

[0209] To induce lung fibrosis, 20-months-old mice were intratracheally injected with bleomycin at a dose of 1 U / kg under isoflurane anesthesia. After 10 days, when the inflammatory phase started to decline and fibrosis began developing, LNA-ASOs targeting mmu-miR-155-5p and mmu- miR-210-3p were individually delivered via intratracheal injection at a dose of 10 pg / mouse.

[0210] Mice were sacrificed at day 21 post-bleomycin injection, and the following analyses were performed to assess fibrosis severity and therapeutic efficacy: 1) Lung weight measurement as an indirect marker of fibrosis severity; 2) Masson’s tri chrome staining and hydroxyproline assay to quantify collagen content and fibrotic tissue; 3) Gene expression analysis of key disease markers, including KRT8 (aberrant ATII-to-ATI transitional intermediates), HIFla (hypoxic response), and P16 (cellular senescence). In addition, to confirm the efficacy of LNA- ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression.

[0211] As shown in figure 8B, bleomycin-treated mice exhibited a significant increase in lung weight, reflecting fibrosis progression. However, LNA-ASO-treated mice displayed a marked reduction in lung weight, suggesting a regression of fibrosis and restoration of normal lung structure. These results were consistent with the results of hydroxyproline quantification (collagen content), as hydroxyproline is a key component of collagen fibers and therefore of ECM. As shown in figure 8C Bleomycin treatment led to a significant accumulation of collagen (increase in hydroxyproline content), while LNA-ASO treatment effectively reduced hydroxyproline content, confirming a reduction in the amount of fibrotic tissue.

[0212] To confirm that the reduction in fibrosis correlates with effective of LNA-ASO-mediated miRNA inhibition, total lung tissue was analysed for mmu-miR-155-5p and mmu-miR-210-3p expression. To quantify the expression of selected miRNAs, RNA extraction was performed using miRNeasy Micro Kit (Qiagen). Then, samples were retrotranscribed using miRCURY LNA RT kit (Qiagen) and the endogenous expression of selected miRNAs was quantified by miRCURY LNA miRNA PCR Assay (Qiagen), using probes designed on the base on murine miRNAs sequences reported in Table 2. Data were expressed as miRNA levels relative to the levels of 5S ribosomal RNA used as endogenous standard housekeeping.

[0213] Given the strong increase in miRNAs’ levels upon bleomycin administration, treatment with LNA-ASOs led to a significant decrease in the levels of both mmu-miR-210-3p and mmu-miR- 155-5p, confirming successful in vivo knockdown following intratracheal administration (figure 8D, E).

[0214] KRT8 (Keratin 8) is a marker of aberrantly transitioning ATII cells, commonly observed in fibrotic lungs where ATII-to-ATI differentiation is impaired

[0011] , Bleomycin treatment induced a significant increase in KRT8 expression, indicating an abnormal transition state of ATII cells into ATI cells. However, LNA-ASO treatment significantly reduced KRT8 levels, suggesting a restoration of the physiological ATII-to-ATI differentiation process, which is critical for alveolar repair and regeneration (Figure 8F). HIFla (Hypoxia-Inducible Factor 1- alpha) is a key regulator of the hypoxia response and is upregulated in fibrotic lungs, where poor oxygenation triggers pathological remodelling. In addition, it is known that the expression of both miR-155-5p and miR-210-3p is regulated by HIFla and therefore proportional to hypoxic state of the lung [42, 43], Bleomycin-treated mice showed increased HIFla expression, consistent with fibrosis-induced hypoxia. LNA-ASO treatment led to a reduction in HIFla levels, indicating a decrease in hypoxia-driven fibrotic mechanisms (figure 8G). Last, P16 is a marker of cellular senescence, which plays a pivotal role in the pathophysiology of IPF by promoting a senescent pro-fibrotic microenvironment

[0014] , Interestingly, the levels of pl6 in saline treated mice, were higher aged (20 months) mice compared to young (8 weeks) mice (Figure 6H, 7H, and 8H). Bleomycin treatment led to a significant increase in P16 expression, reflecting heightened senescence-related fibrosis. Importantly, treatment with LNA-ASOs effectively reduced P16 levels, suggesting that targeting either mmu-miR-155-5p or mmu- miR-210-3p can counteract the senescent phenotype and contribute to fibrosis resolution by sustaining ATII-driven pro regenerative mechanisms.

[0215] These results highlight that ASO-mediated inhibition of mmu-miR-155-5p and mmu-miR-210- 3p effectively reduces lung fibrosis, restores normal ATII-to-ATI transition, mitigates hypoxia- driven fibrosis, and reverses cellular senescence in an aged mouse model of IPF, which is the model that most closely resemble the human disease. These findings strongly support the therapeutic potential of targeting these miRNAs as a novel strategy for treating IPF and promoting lung regeneration.

[0216] Example 10

[0217] To further validate the central role of ATII-driven repair mechanisms in the therapeutic efficacy of ASO-mediated inhibition of mmu-miR-155-5p and mmu-miR-210-3p, as demonstrated in Examples 10, and 11, the Inventors investigated the cell-specific uptake of a non-targeting fluorescently labelled LNA-ASO molecules following intratracheal administration. For this experiment, they replicated the exact delivery procedure used in Examples 7, 8, and 9 to ensure consistency and comparability of the results.

[0218] In particular, to assess LNA-ASO uptake, 8-week-old mice were administered 10 pg of ASO conjugated with a FAM fluorescent marker via intratracheal injection. After five days, mice were sacrificed, and lungs were processed for immunofluorescence staining to visualize LNA- ASO localization and quantify its uptake in specific cell populations. Lung sections were stained for: l) FAM-ASO (amplified signal using anti-FAM staining); 2) SPC (ATII cell marker); 3) Coll Al (fibroblast marker). As reported in figure 9B, representative immunofluorescence images reveal that FAM-LNA-ASO is preferentially internalized by ATII cells, as evidenced by strong co-localization of FAM-ASO with SPC (ATII marker). In contrast, fibroblast uptake (Coll Al marker) was minimal, indicating a much lower LNA-ASO uptake in fibroblasts. Image quantification for all experimental conditions are reported in figure 9C. These findings support the conclusion that ATII cells are the primary mediators of LNA-ASO- driven therapeutic effects observed in bleomycin-induced models of lung fibrosis (Examples 7, 8, and 9).

[0219] Example 11

[0220] To evaluate the systemic distribution and potential off-target effects of antisense oligonucleotide (ASO) therapy, the Inventors conducted a series of intratracheal LNA-ASO administrations in mice and assessed the localization and impact on key organs.

[0221] As shown in figure 10A, 8-week-old mice were intratracheally injected with 10 pg of FAM-labeled LNA-ASO (FAM-LNA-ASO) designed with a non-targeting sequences. After a five-day period, which allows sufficient time for ASO expression, the mice were sacrificed, and major organs including the liver, kidney, and heart were harvested for analysis. Tissue sections from these organs were prepared and subjected to immunofluorescence staining using anti-FAM antibodies to enhance the FAM-LNA-ASO signal, along with DAPI staining to visualize cell nuclei. As shown in figure 10B and C, the kidney exhibited negligible FAM-LNA-ASO signal, whereas a faint signal was detected in the liver and heart. These findings indicate that intratracheal administration of ASO results with only minor presence in other organs, suggesting a low likelihood of off-target effects.

[0222] Next, to determine whether anti-miRNA LNA-ASO treatment induced off-target miRNA suppression in non-pulmonary organs, the expression levels of mmu-miR-155-5p and mmu-miR- 210-3p were measured in the kidney, liver, and heart coming from the bleomycin-induced lung fibrosis mouse model upon ASOs administration. The sequences of the LNA-ASOs used in this experiment are 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'- TC AC AATTAGC ATTA-3’ (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.11) and miR-155-5p (SEQ ID NO.12).

[0223] Mice were anesthetized with isoflurane and intratracheally administered 60 pL of bleomycin (1 U / kg) via intubation to induce fibrosis. Ten days post-bleomycin administration, LNA-ASOs targeting mmu-miR-155-5p and mmu-miR-210-3p were individually delivered intratracheally at a dose of 10 pg per mouse. Mice were sacrificed 21 days post-bleomycin injection, and the liver, kidney, and heart were harvested for further safety assessment (Figure 10C). Neither mmu-miR-210- 3p nor miR-155-5p expression analysis showed that anti-miRNA ASO intratracheal administration did not significantly alter miRNA levels in these organs compared to saline-treated controls (Figure 10D). Despite minor LNA-ASO presence in the liver and heart, as observed in immunofluorescence images (Figure 10B), the concentration was insufficient to induce significant inhibition of miRNA expression. These results reinforce that intratracheal LNA-ASO administration effectively targets the lungs while minimizing unintended systemic effects. These findings demonstrate that intratracheal delivery of LNA-ASO ensures targeted ATII cell treatment with minimal systemic exposure. This delivery method preserves miRNA expression levels in off-target organs such as the liver, kidney, and heart, highlighting its potential as a safe and effective approach for ATII-specific pro regenerative therapies.

[0224] Conclusions

[0225] Altogether, these data strongly support the therapeutic potential of LNA-ASOs targeting the selected miRNAs in ATII cell to treat respiratory diseases characterized by alveolar epithelial type II (ATII) cell senescence, impaired ATILto-ATI trans-differentiation, and diminished lung regenerative capacity, all of which contribute to lung fibrotic remodelling due to impaired alveolar repair. Furthermore, the present findings demonstrate the curative efficacy of the claimed LNA-ASOs (specifically 5'-GCTGTCACACGCACA-3' (SEQ ID NO.11) and 5'- TC AC AATTAGC ATTA-3’ (SEQ ID NO.12), respectively targeting miR-210-3p (SEQ ID NO.11) and miR-155-5p (SEQ ID NO.12)) in a bleomycin-induced lung fibrosis model, where a single-dose ASO administration of ASO targeting either miR-210-3p or miR-155-5p separately (i.e. via intra tracheal administration) at 10- and 21-days post-bleomycin in young mice significantly reduced lung fibrosis, senescence, and hypoxia. Additionally, the Inventors confirmed the curative efficacy of the aforementioned ASOs in aged mice (20 months old) subjected to bleomycin-induced fibrosis, where a single-dose ASO administration of LNA- ASO targeting either miR-210-3p or miR-155-5p separately (i.e. via intra tracheal administration) at 10 days post-bleomycin led to a marked reduction in lung fibrosis, senescence, and hypoxia. Aged mice, with their severely limited regenerative capacity due to systemic cellular senescence, best mimic human idiopathic pulmonary fibrosis (IPF) conditions. The results of the present invention further support the potential of ASO-based therapies for targeting pathogenic miRNAs in fibrotic lung diseases, as well as other lung conditions characterized by impaired alveolar repair.

[0226] BIBLIOGRAPHY

[0227] 1. Ley, B. and H.R. Collard, Epidemiology of idiopathic pulmonary fibrosis. Clin Epidemiol, 2013. 5: p. 483-92.

[0228] 2. Barkauskas, C.E., et al., Type 2 alveolar cells are stem cells in adult lung. J Clin Invest, 2013. 123(7): p. 3025-36.

[0229] 3. Desai, T.J., D.G. Brownfield, and M.A. Krasnow, Alveolar progenitor and stem cells in lung development, renewal and cancer. Nature, 2014. 507(7491): p. 190-4.

[0230] 4. Rock, J.R., et al., Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc Natl Acad Sci U S A, 2011. 108(52): p. E1475-83.

[0231] 5. Adams, T.S., et al., Single-cell RNA-seq reveals ectopic and aberrant lung-resident cell populations in idiopathic pulmonary fibrosis. Sci Adv, 2020. 6(28): p. eabal983.

[0232] 6. Basil, M.C., et al., Human distal airways contain a multipotent secretory cell that can regenerate alveoli. Nature, 2022. 604(7904): p. 120-126.

[0233] 7. Choi, J., et al., Inflammatory Signals Induce AT2 Cell-Derived Damage-Associated Transient Progenitors that Mediate Alveolar Regeneration. Cell Stem Cell, 2020. 27(3): p. 366-382 e7.

[0234] 8. Habermann, A.C., et al., Single-cell RNA sequencing reveals profibrotic roles of distinct epithelial and mesenchymal lineages in pulmonary fibrosis. Sci Adv, 2020. 6(28): p. eabal972.

[0235] 9. Jiang, P., et al., Ineffectual Type 2-to-Type 1 Alveolar Epithelial Cell Differentiation in Idiopathic Pulmonary Fibrosis: Persistence of the KRT8(hi) Transitional State. Am J Respir Crit Care Med, 2020. 201(11): p. 1443-1447.

[0236] 10. Kobayashi, Y., et al., Persistence of a regeneration-associated, transitional alveolar epithelial cell state in pulmonary fibrosis. Nat Cell Biol, 2020. 22(8): p. 934-946. 11. Strunz, M., et al., Alveolar regeneration through a Krt8+ transitional stem cell state that persists in human lung fibrosis. Nat Commun, 2020. 11(1): p. 3559.

[0237] 12. Wang, F., et al., Regulation of epithelial transitional states in murine and human pulmonary fibrosis. J Clin Invest, 2023. 133(22).

[0238] 13. Jenkins, R.G., et al., An Official American Thoracic Society Workshop Report: Use of Animal Models for the Preclinical Assessment of Potential Therapies for Pulmonary Fibrosis. Am J Respir Cell Mol Biol, 2017. 56(5): p. 667-679.

[0239] 14. Schafer, M.J., et al., Cellular senescence mediates fibrotic pulmonary disease. Nat Commun, 2017. 8: p. 14532.

[0240] 15. Martinez, F.J., et al., Idiopathic pulmonary fibrosis. Nat Rev Dis Primers, 2017. 3: p. 17074.

[0241] 16. Redente, E.F., et al., Tumor necrosis factor-alpha accelerates the resolution of established pulmonary fibrosis in mice by targeting profibrotic lung macrophages. Am J Respir Cell Mol Biol, 2014. 50(4): p. 825-37.

[0242] 17. Hecker, L., et al., Reversal of persistent fibrosis in aging by targeting Nox4-Nrf2 redox imbalance. Sci Transl Med, 2014. 6(231): p. 231ra47.

[0243] 18. Justice, J.N., et al., Senolytics in idiopathic pulmonary fibrosis: Results from a first-in- human, open-label, pilot study. EBioMedicine, 2019. 40: p. 554-563.

[0244] 19. Nambiar, A., et al., Senolytics dasatinib and quercetin in idiopathic pulmonary fibrosis: results of a phase I, single-blind, single-center, randomized, placebo-controlled pilot trial on feasibility and tolerability. EBioMedicine, 2023. 90: p. 104481.

[0245] 20. Shang, R., et al., microRNAs in action: biogenesis, function and regulation. Nat Rev Genet, 2023. 24(12): p. 816-833.

[0246] 21. Filipowicz, W ., S.N. Bhattacharyya, and N. Sonenberg, Mechanisms of post- transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet, 2008. 9(2): p. 102-14.

[0247] 22. Ghildiyal, M. and P.D. Zamore, Small silencing RN As: an expanding universe. Nat Rev Genet, 2009. 10(2): p. 94-108.

[0248] 23. Boateng, E. and S. Krauss-Etschmann, miRNAs in Lung Development and Diseases. Int J Mol Sci, 2020. 21(8).

[0249] 24. Harris, K.S., et al., Dicer function is essential for lung epithelium morphogenesis. Proc Natl Acad Sci U S A, 2006. 103(7): p. 2208-13.

[0250] 25. Stolzenburg, L.R. and A. Harris, The role of microRNAs in chronic respiratory disease: recent insights. Biol Chem, 2018. 399(3): p. 219-234.

[0251] 26. Montgomery, R.L., et al., MicroRNA mimicry blocks pulmonary fibrosis. EMBO Mol Med, 2014. 6(10): p. 1347-56.

[0252] 27. Marts, L.T., et al., MiR-21 -Mediated Suppression ofSmad7 Induces TGFbetal and Can Be Inhibited by Activation of Nrf2 in Alcohol-Treated Lung Fibroblasts. Alcohol Clin Exp Res, 2017. 41(11): p. 1875-1885.

[0253] 28. Cushing, L., et al., Disruption of miR-29 Leads to Aberrant Differentiation of Smooth Muscle Cells Selectively Associated with Distal Lung Vasculature. PLoS Genet, 2015. 11(5): p. el005238.

[0254] 29. Liang, C., et al., The anti-fibrotic effects of microRNA-153 by targeting TGFBR-2 in pulmonary fibrosis. Exp Mol Pathol, 2015. 99(2): p. 279-85.

[0255] 30. Baumann, V. and J. Winkler, miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med Chem, 2014. 6(17): p.

[0256] 1967-84.

[0257] 31. Wang, X., et al., Adenovirus-mediated shRNAs for co-repression of miR-221 and miR- 222 expression and function in glioblastoma cells. Oncol Rep, 2011. 25(1): p. 97-105. 32. Ebert, M.S., J.R. Neilson, and P.A. Sharp, MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods, 2007. 4(9): p. 721-6.

[0258] 33. Lavenniah, A., et al., Engineered Circular RNA Sponges Act as miRNA Inhibitors to Attenuate Pressure Overload-Induced Cardiac Hypertrophy. Mol Ther, 2020. 28(6): p. 1506-1517.

[0259] 34. Haraguchi, T., Y. Ozaki, and H. Iba, Vectors expressing efficient RNA decoys achieve the long-term suppression of specific microRNA activity in mammalian cells. Nucleic Acids Res, 2009. 37(6): p. e43.

[0260] 35. Hooykaas, M. J. G. , et al . , RNA accessibility impacts potency of Tough Decoy microRNA inhibitors. RNA Biol, 2018. 15(11): p. 1410-1419.

[0261] 36. Meng, L., et al., Small RNA zippers lock miRNA molecules and block miRNA function in mammalian cells. Nat Commun, 2017. 8: p. 13964.

[0262] 37. Lima, J.F., et al., Anti-miRNA oligonucleotides: A comprehensive guide for design. RNA Biol, 2018. 15(3): p. 338-352.

[0263] 38. Shin, M., et al., Intratracheally administered LNA gapmer antisense oligonucleotides induce robust gene silencing in mouse lung fibroblasts. Nucleic Acids Res, 2022. 50(15): p. 8418-8430.

[0264] 39. Dasgupta, I. and A. Chatterjee, Recent Advances in miRNA Delivery Systems. Methods Protoc, 2021. 4(1).

[0265] 40. O'Neill, C.P. and R.M. Dwyer, Nanoparticle-Based Delivery of Tumor Suppressor microRNA for Cancer Therapy. Cells, 2020. 9(2).

[0266] 41. Herrera-Carrillo, E., Y.P. Liu, and B. Berkhout, Improving miRNA Delivery by Optimizing miRNA Expression Cassettes in Diverse Virus Vectors. Hum Gene Ther Methods, 2017. 28(4): p. 177-190.

[0267] 42. Bruning, U., et al., MicroRNA-155 promotes resolution of hypoxia-inducible factor 1 alpha activity during prolonged hypoxia. Mol Cell Biol, 2011. 31(19): p. 4087-96.

[0268] 43. Huang, X., Q.T. Le, and A. J. Giaccia, MiR-210— micromanager of the hypoxia pathway. Trends Mol Med, 2010. 16(5): p. 230-7.

[0269] 44. Li, H. , et al . , MicroRNAs in idiopathic pulmonary fibrosis: involvement in pathogenesis and potential use in diagnosis and therapeutics. NcXa Pharm Sin B, 2016. 6(6): p. 531- 539.

[0270] 45. Chen, Y., et al., Inhibition of miR-155-5p Exerts Anti-Fibrotic Effects in Silicotic Mice by Regulating Meprin alpha. Mol Ther Nucleic Acids, 2020. 19: p. 350-360.

[0271] 46. Bodempudi, V., et al., miR-210 promotes IPF fibroblast proliferation in response to hypoxia. Am J Physiol Lung Cell Mol Physiol, 2014. 307(4): p. L283-94.

[0272] 47. Dinami, R., et al., miR-155 drives telomere fragility in human breast cancer by targeting TRF1. Cancer Res, 2014. 74(15): p. 4145-56.

[0273] 48. Brummelkamp, T.R., R. Bernards, and R. Agami, A system for stable expression of short interfering RNAs in mammalian cells. Science, 2002. 296(5567): p. 550-3.

[0274] 49. Lee, N.S., et al., Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat Biotechnol, 2002. 20(5): p. 500-5.

[0275] 50. Miyagishi, M. and K. Taira, U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol, 2002. 20(5): p. 497-500.

[0276] 51. Paddison, P. J., et al., Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev, 2002. 16(8): p. 948-58.

[0277] 52. Paul, C.P., et al., Effective expression of small interfering RNA in human cells. Nat Biotechnol, 2002. 20(5): p. 505-8.

[0278] 53. Sui, G., et al., A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci U S A, 2002. 99(8): p. 5515-20. 54. Yu, J.Y., S.L. DeRuiter, and D.L. Turner, RNA interference by expression of shortinterfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A, 2002. 99(9): p. 6047-52.

[0279] 55. Kluiver, J., et al., Generation of miRNA sponge constructs. Methods, 2012. 58(2): p. 113-7.

[0280] 56. Misir, S., N. Wu, and B.B. Yang, Specific expression and functions of circular RNAs. Cell Death Differ, 2022. 29(3): p. 481-491.

[0281] 57. Bak, R.O., et al., Potent microRNA suppression by RNA Pol Il-transcribed 'Tough Decoy’ inhibitors. RNA, 2013. 19(2): p. 280-93.

[0282] 58. Xie, J., et al., Long-term, efficient inhibition of microRNA function in mice using rAAV vectors. Nat Methods, 2012. 9(4): p. 403-9.

[0283] 59. Jeong, D., et al., miR-25 Tough Decoy Enhances Cardiac Function in Heart Failure. Mol Ther, 2018. 26(3): p. 718-729.

[0284] 60. Rindler, T.N., et al., Efficient Transduction of Alveolar Type 2 Cells with Adeno- associated Virus for the Study of Lung Regeneration. Am J Respir Cell Mol Biol, 2021. 65(1): p. 118-121.

[0285] 61. van Lieshout, L.P., et al., A Novel Triple-Mutant AAV6 Capsid Induces Rapid and Potent Transgene Expression in the Muscle and Respiratory Tract of Mice. Mol Ther Methods Clin Dev, 2018. 9: p. 323-329.

[0286] 62. Volpe, M.C., et al., Fltl produced by lung endothelial cells impairs ATII cell transdifferentiation and repair in pulmonary fibrosis. Cell Death Dis, 2023. 14(7): p. 437.

[0287] 63. Moimas, idiopathic pulmonar Open Res, 2019. 5(4

Claims

CLAIMS1. An agent for use in the prevention and / or treatment of a lung pathological condition, said agent being selected from the group consisting of: an inhibitor of miR-210-3p; an inhibitor of miR-155-5p; or a combination thereof, preferably said miR-210-3p is human hsa-miR-210-3p and / or said miR-155-5p is human hsa-miR-155-5p, wherein said lung pathological condition is selected from the group consisting of idiopathic pulmonary fibrosis, non-specific interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis- ILD, cryptogenic organizing pneumonia and acute interstitial pneumonia, chronic obstructive pulmonary disease, post-acute respiratory distress syndrome, and post-acute COVID-19 syndrome.

2. An agent for use according to claim 1, wherein the lung pathological condition is associated with senescence of alveolar epithelial type II and / or type I cells and / or with loss of alveolar epithelial type II to type I trans-differentiation capacity and / or with loss of lung regenerative capacity.

3. The agent for use according to any one of previous claims wherein the lung pathological condition is idiopathic pulmonary fibrosis.

4. The agent for use according to any one of previous claims wherein said agent is used when the acute phase of the inflammatory response of said lung pathological condition is ceased.

5. The agent for use according to any one of previous claims, wherein said inhibitor is a nucleic acid molecule preferably selected from: a single-stranded or double-stranded nucleic acid molecule, an siRNA molecule, an shRNA molecule, an antisense oligonucleotide, a linear miRNA sponge, a circular RNA miRNA sponge, a miRNA- targeting Tough Decoy (TuD) RNA, and a miRZip, derivatives and mixtures thereof, preferably said inhibitor is an antisense oligonucleotide.

6. The agent for use according to claim 5, wherein said nucleic acid molecule, or a portion thereof, has sufficient complementarity to miR-210-3p and / or miR-155-5p, or a fragment thereof, to form a hybrid under physiological conditions and / or has at least50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% complementarity to a portion of a hsa- miR-210-3p sequence and / or of a hsa-miR-155-5p sequence and / or comprises at least 7 nucleotides complementary to at least one sequence selected from SEQ ID NOs: 1-4, 7-9, or a variant or a fragment thereof, preferably complementary to the seed sequence of said miRNAs, said seed sequence being 5’-UGUGCGU-3’ for miR-210-3p and 5’- UAAUGCU-3’ for miR-155-5p, and / or binds to a miRNA comprising a nucleic acid that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 1-4, 7-9.

7. The agent for use according to any one of previous claims, wherein: the inhibitor of miR-210-3p comprises a nucleotide sequence comprising or consisting of the sequence 5'-GCTGTCACACGCACA-3' (SEQ ID NO. 11) and / or the inhibitor comprises about 8 to about 30 nucleotides in length; the inhibitor of miR-155-5p comprises a nucleotide sequence comprising or consisting of the sequence 5'- TCACAATTAGCATTA-3' (SEQ ID NO. 12) and / or the inhibitor comprises about 8 to about 30 nucleotides in length; and / or the inhibitor comprises at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides or at least 21 nucleotides, or at least 22 nucleotides, or at least 23 nucleotides, or at least 24 nucleotides, or at least 25 nucleotides, or at least 26 nucleotides, or at least 27 nucleotides, or at least 28 nucleotides, or at least 29 nucleotides, or at least 30 nucleotides at the 5' and / or at the 3’ of said nucleotide sequence.

8. The agent for use according to any one of previous claims, wherein the inhibitor is an antisense oligonucleotide and it comprises at least one modified nucleotide, preferably the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and / or a peptide nucleic acid (PNA) and / or the inhibitor comprises at least one backbone modification, preferably a phosphorodiamidate morpholino oligomer (PMO) and / or phosphorothioate (PS) modification, more preferably the at least one modified nucleotide is a locked nucleic acid (LNA).

9. The agent for use according to any one of previous claims, wherein: the inhibitor of miR-210-3p comprises a nucleotide sequence comprising or consisting of the sequence 5'-GCTGTCACACGCACA-3' (SEQ ID NO. 11); the inhibitor of miR-155-5p comprises a nucleotide sequence comprising or consisting of the sequence 5’- TC AC AATTAGC ATTA-3’ (SEQ ID NO. 12); and wherein at least one modified nucleotide is a locked nucleic acid (LNA).

10. A nucleic acid coding for the at least one agent for use according to any one of claims 1-9.

11. The agent for use according to any one of claims 1-9 or the nucleic acid for use according to claim 10, wherein said agent or nucleic acid is provided naked or within a delivery agent, preferably wherein the delivery agent comprises a vector, preferably a recombinant expression vector or a viral vector, a micelle, an exosome, a lipidoid, a lipoplex, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a conjugate, nanoparticles, microparticles, a liposome or other biological or synthetic vesicle or material including lipid nanoparticles, polymer-based nanoparticles, polymer-lipid hybrid a nanoparticle, a microparticle, a microsphere, a liposome, a colloidal gold particle, a graphene composite, a cholesterol conjugate, a cyclodextrin complex, a polyethylenimine polymer, a lipopolysaccharide, a polypeptide, a polysaccharide, a lipopolysaccharide, a collagen, a pegylation of viral vehicle, or combinations thereof.

12. A vector, preferably a recombinant expression vector, comprising a coding sequence of the agent for use according to any of claims 1 to 9, or comprising the nucleic acid of claim 10, and / or expressing the agent for use according to any one of claims 1 to 9 or expressing the nucleic acid of claim 10, preferably under the control of a suitable promoter, preferably the vector is a viral or non-viral vector, preferably the viral vector is selected from adeno-associated virus (AAV) vectors of any capsid serotype, either natural or artificial, lentivirus vectors, adenoviral vector, retroviral vectors, alphaviral vectors, vaccinia virus vectors, herpes simplex virus (HSV) vectors, rabies virus vectors, and Sindbis virus vectors, preferably the adeno-associated virus (AAV) vector is AAV6, AAV6.2 or AAV6.2FF.

13. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid encoding the at least one agent for use according to any one of claims 1-9, preferably the particle comprises a capsid derived from adeno-associated vectors AAV6, AAV6.2, AAV6.2FF, AAV8, AAV1, AAV2, AAV5, or AAV9, preferably wherein the nucleic acid is operably linked to a viral promoter or a tissue specific promoter, e.g. ATII cells specific promoter.

14. A pharmaceutical composition comprising an agent for use according to any one of claims 1-9 or 11, or the nucleic acid according to claim 10 or 11, or the vector according to claim 12, or a recombinant adeno-associated virus (rAAV) particle according to claim 13 and at least one pharmaceutically acceptable vehicle and / or excipient.

15. The pharmaceutical composition according to claim 14, wherein said composition is suitable for inhalational administration by aerosol.

Citation Information

Patent Citations

  • Application of micromolecule non-encoding RNA and host gene in diagnosis and treatment of gastric cancer

    CN113151280A

  • Application of miRNAs in group of exosomes in preparation of renal cell carcinoma markers and kit of miRNAs in group of exosomes

    CN113278701A

  • Discoidal Nano Universal Platform for Efficient Delivery of PNAs

    US20210369632A1