Microorganism of genus corynebacterium with improved ability to produce l-lysine and method for producing l-lysine using same

By genetically enhancing glucose-facilitated diffusion transporter and glucokinase activity in Corynebacterium microorganisms, L-lysine production is significantly increased, addressing the limitations of existing methods and achieving improved yield.

WO2025193050A1PCT designated stage Publication Date: 2025-09-18DAESANG CORP
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/099676
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-14
Filing Date
2025-03-12
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

Existing methods for enhancing L-lysine production in Corynebacterium microorganisms are limited by the complexity and variability of proteins involved in the biosynthetic pathway, making it difficult to determine effective enhancements.

Method used

Enhancing the activity of the glucose-facilitated diffusion transporter and glucokinase in Corynebacterium microorganisms through genetic modifications, such as introducing specific genes or increasing copy numbers, and using recombinant vectors to improve glucose utilization and glycolytic pathway efficiency.

Benefits of technology

The enhanced activity of these transporters and enzyme leads to increased L-lysine production by up to 100% compared to parent strains, improving overall productivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTKR2025099676-APPB-IMG-000001
    Figure PCTKR2025099676-APPB-IMG-000001
Patent Text Reader

Abstract

The present invention relates to a microorganism of the genus Corynebacterium with an improved ability to produce L-lysine and a method for producing L-lysine, using same. The microorganism of the genus Corynebacterium exhibits enhanced activities of a glucose-facilitated diffusion transporter and glucokinase, and thus can have improved L-lysine production yield as compared to a parent strain or cases where a glucose-facilitated diffusion transporter or glucokinase is enhanced alone.
Need to check novelty before this filing date? Find Prior Art

Description

Corynebacterium microorganism with enhanced L-lysine production ability and method for producing L-lysine using the same

[0001] The present invention relates to a microorganism of the genus Corynebacterium having improved L-lysine production ability and a method for producing L-lysine using the same.

[0002] L-lysine is an essential amino acid that cannot be synthesized in humans or animals and must be supplied externally. It is typically produced through fermentation using microorganisms such as bacteria or yeast. L-lysine can be produced using either wild-type strains obtained from nature or mutant strains modified for enhanced L-lysine production.

[0003] Recently, in order to improve the production efficiency of L-lysine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to develop various recombinant strains or mutants with excellent L-lysine production ability, and methods for producing L-lysine using them. In particular, there have been attempts to increase L-lysine production by targeting genes such as enzymes, transcription factors, and transport proteins involved in the L-lysine biosynthetic pathway, or by inducing mutations in the promoters that regulate their expression. However, since there are many and diverse types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-lysine production, much research is still needed to determine whether changes in the activity of these proteins increase L-lysine production.

[0004] [Prior Art Literature]

[0005] [Patent Document]

[0006] Korean Patent No. 10-0838038

[0007] Korean Patent No. 10-2139806

[0008] The purpose of the present invention is to provide a microorganism of the genus Corynebacterium having improved L-lysine production ability.

[0009] In addition, the present invention aims to provide a method for producing L-lysine using the above-described Corynebacterium genus microorganism.

[0010] One aspect of the present invention provides a Corynebacterium genus microorganism having enhanced L-lysine production ability by enhancing the activity of glucose-facilitated diffusion transporter and glucokinase.

[0011] The "glucose facilitated diffusion protein" used in the present invention is a transport protein present in the plasma membrane and involved in the facilitated diffusion of glucose. The glucose facilitated diffusion transporter in the present invention may be a polypeptide encoded by the glf gene and having glucose facilitated diffusion transporter activity, but is not limited thereto.

[0012] The “glucokinase” used in the present invention is an enzyme that catalyzes the reaction that produces glucose 6-phosphate from glucose and ATP, and is the first enzyme to introduce glucose into the glycolytic pathway together with other hexokinases. The glucokinase in the present invention may be a polypeptide encoded by the glk gene and having glucokinase activity, but is not limited thereto.

[0013] Nucleic acid sequence and protein sequence information for the above glucose-facilitated diffusion transporter and glucokinase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0014] As used herein, “enhanced activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, or transport protein is increased compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such enhanced activity includes cases where the activity of the protein itself is increased compared to the activity of the protein possessed by the original microorganism through modification of the nucleotides encoding the gene (e.g., substitution, insertion, deletion of some nucleotides in the target gene, or a combination thereof), cases where the copy number of the gene is increased, cases where the overall protein activity level in a cell is higher than that of the wild-type strain or the strain before modification due to increased expression or increased translation of the target gene due to modification of a non-coding region that does not encode a gene, such as a promoter (e.g., modification of all or part of the nucleotides in the promoter sequence, replacement with a strong promoter), and combinations thereof.

[0015] The above nucleotide modification means that the nucleotide sequence is different from the original nucleotide sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotide sequence. The above promoter modification means that the nucleotides in the promoter sequence are different from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotides, thereby increasing the expression level or enhancing the activity of the target gene. In addition, the promoter modification includes replacing the promoter of the original gene with a promoter that has a stronger expression level or activity for the target gene. Here, a substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0016] According to one specific example of the present invention, the activity enhancement of the glucose-facilitated diffusion transporter may be achieved by introduction of a gene encoding the glucose-facilitated diffusion transporter, increase in copy number, promoter modification, or a combination thereof.

[0017] According to one specific example of the present invention, the glucose-facilitated diffusion transporter may be encoded by a glf gene derived from Zymomonas mobilis.

[0018] The above-mentioned glf gene derived from Zymomonas mobilis may include the base sequence of sequence number 1.

[0019] In addition, according to one specific example of the present invention, the glucose-facilitated diffusion transporter may be encoded by the iolT1 (NCgl0178) and iolT2 (NCgl2953) genes derived from Corynebacterium glutamicum.

[0020] The above-mentioned iolT1 and iolT2 genes derived from Corynebacterium glutamicum encode myo-inositol transporters IolT1 and IolT2, respectively, which are known to be functionally similar to the glucose-facilitated diffusion transporter encoded by the glf gene of Zymomonas mobilis (FEMS Microbiol Lett. 2009 Jan;290(2):227-35.).

[0021] The above Corynebacterium glutamicum-derived iolT1 gene may include the base sequence of SEQ ID NO: 2, and the Corynebacterium glutamicum-derived iolT2 gene may include the base sequence of SEQ ID NO: 3.

[0022] For example, the enhancement of the activity of the glucose-facilitated diffusion transporter may be due to introduction of one or more of the glf gene from Zymomonas mobilis, the iolT1 gene from Corynebacterium glutamicum, and the iolT2 gene from Corynebacterium glutamicum, an increase in the copy number thereof, or a combination thereof.

[0023] According to one specific example of the present invention, the activity enhancement of the glucokinase may be achieved by introduction of a gene encoding glucokinase, increase in copy number, promoter modification, or a combination thereof.

[0024] According to one specific example of the present invention, the glucokinase may be encoded by the glk (NCgl2105) gene derived from Corynebacterium glutamicum.

[0025] The above-mentioned Corynebacterium glutamicum-derived glk gene may include the base sequence of SEQ ID NO: 4.

[0026] The base sequence of the glucose-facilitated diffusion transporter or glucokinase according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the base sequence of SEQ ID NO: 1, 2 or 3, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between a reference base sequence and any other base sequence when they are aligned and analyzed to correspond as much as possible.

[0027] As used herein, “improved productivity” means increased productivity of L-lysine compared to the target of mutation (parent strain). The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium microorganism or a strain of the Corynebacterium genus that has no L-lysine production ability or has L-lysine production ability and is mutated from the wild type.

[0028] According to one specific example of the present invention, the Corynebacterium genus microorganism is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,These may include, but are not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, and Corynebacterium flavescens.

[0029] For example, the above-mentioned Corynebacterium genus microorganism may be Corynebacterium glutamicum.

[0030] The Corynebacterium genus microorganism according to the present invention can improve L-lysine production ability by enhancing the activity of glucose-facilitated diffusion transporter and glucokinase.

[0031] Specifically, the Corynebacterium genus microorganism having enhanced L-lysine production ability exhibits increased L-lysine production ability compared to the parent strain, and in particular, the L-lysine production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, It may be increased by 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto. For example, the Corynebacterium genus microorganism with enhanced glucose-facilitated diffusion transporter and glucokinase activity may have an L-lysine production increased by 3% or more, specifically 3 to 40% (preferably 5 to 30%) compared to the parent strain.

[0032] A composition comprising a microorganism of the genus Corynebacterium according to the present invention can be used as a composition for producing L-lysine.

[0033]

[0034] A Corynebacterium genus microorganism according to one specific example of the present invention can be implemented through a recombinant vector including a gene encoding a glucose-facilitated diffusion transporter and glucokinase targeting a parent strain.

[0035] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0036] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0037] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0038] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0039] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0040] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0041] When transforming prokaryotic cells to produce recombinant microorganisms, host cells may be used, including, but not limited to, Escherichia coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus.

[0042] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0043] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0044] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0045] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0046] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0047] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0048]

[0049] Another aspect of the present invention provides a method for producing L-lysine, comprising the steps of culturing the above-described Corynebacterium microorganism in a medium; and recovering L-lysine from the above-described Corynebacterium microorganism or the medium in which the Corynebacterium microorganism is cultured.

[0050] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0051] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0052] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0053] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0054] According to one specific example of the present invention, the step of recovering L-lysine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-lysine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but the present invention is not limited thereto.

[0055] According to one specific example of the present invention, the step of recovering the L-lysine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0056] According to one specific example of the present invention, the step of recovering L-lysine may include a process of purifying L-lysine.

[0057] The Corynebacterium microorganism according to the present invention can improve the production yield of L-lysine compared to the parent strain or the case where the glucose-facilitated diffusion transporter or glucokinase is enhanced alone by enhancing the activity of the glucose-facilitated diffusion transporter and glucokinase.

[0058] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0059]

[0060] Example 1. Production of a strain with enhanced glucose-facilitated diffusion transporter and glucokinase activity.

[0061] To produce a strain with enhanced activity of glucose-facilitated diffusion transporter and glucokinase, Corynebacterium glutamicum DS1 (accession no. KCCM12969P) and E. coliDH5a (HIT Competent cells™, Cat No. RH618) were used.

[0062] The above Corynebacterium glutamicum DS1 was cultured at 30°C in CM-broth medium (pH 6.8) containing 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract in 1 L of distilled water.

[0063] The above E. coliDH5a was cultured at 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.

[0064] The antibiotic kanamycin was a product from Sigma.

[0065] DNA sequencing analysis and gene synthesis were performed by Macrogen, Inc.

[0066]

[0067] 1-1. Recombinant vector

[0068] To introduce the glf gene (SEQ ID NO: 1) encoding a glucose-facilitated diffusion transporter from Zymomonas mobilis, the iolT1 gene (SEQ ID NO: 2) and iolT2 genes (SEQ ID NO: 3) encoding myo-inositol transporters from Corynebacterium glutamicum, and the glk gene (SEQ ID NO: 4) encoding glucokinase, the 594 bp sequence between the NCgl1668 and NCgl1669 genes in Corynebacterium glutamicum was disrupted, and the target gene was introduced at that position. A recombinant vector was constructed using the promoter of the ddh gene of Corynebacterium glutamicum (SEQ ID NO: 5) for expression of the target gene. The 762 bp portion on the left arm and the 7906 bp portion on the right arm, along with the corresponding promoter and target gene, were amplified by PCR around the 594 bp fragment sequence on the Corynebacterium glutamicum genome, and then linked by the overlap PCR method and cloned into the pk19mobsacB (ATCC, 87098) vector. To construct the five plasmids, the primers in Table 1 below were used to amplify each gene fragment, and the glf base sequence was obtained through gene synthesis and used as a template.

[0069] PrimerPrimer sequence (5'-3')Sequence numberPddh-glfLeft homology armAmplification primerLF1cacagatcgtcgtgcacagt6LF2tgattacgcccacagatcgtcgtgcacagt7LR1tgcgtacactttatggccca8LR2ttatggcccataaaaatggt9PromoterAmplification primerP-F1atccggataaaccaccatga10P-F2agtgtacgcaatccggataaaccaccatga11P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13glfAmplification Primer glf-F1 atgagttctgaaagtagtca14 glf-F2 ttacaagaacatgagttctgaaagtagtca15 glf-R1 ctacttctgggagcgccaca16 glf-R2 gagcgccacatctcctcgat17 Right homology arm amplification primer RF1 aacgcttatattattttaag18 RF2 ccagaagtagaacgcttatattattttaag19 RR1 atggtgacaacatctgggcc20 RR2 catctgggcctagtcgatta21 Pddh-iolT1-Pddh-iolT2 Left homology arm amplification Primer LF1cacagatcgtcgtgcacagt6LF2tgattacgcccacagatcgtcgtgcacagt7LR1tgcgtacactttatggccca8LR2ttatggcccataaaaatggt9Promoter1Amplification Primer P-F1atccggataaaccaccatga10P-F2agtgtacgcaatccggataaaccaccatga11P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13iolT1Amplification Primer iolT1-F1atggctagtaccttcattca22iolT1-F2ttacaagaacatggctagtaccttcattca23iolT1-R1ttagtgcacctttccttttc24iolT1-R2tttccttttcggatgtcctt25promoter2amplificationPrimer P-F1atccggataaaccaccatga10P2-F2ggtgcactaaatccggataaaccaccatga26P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13iolT2Amplification Primer iolT2-F1atgacggacatcaaggccac27iolT2-F2ttacaagaacatgacggacatcaaggccac28iolT2-R1ttaagccttcttgaagatct29iolT2-R2ttgaagatctggccggtgaa30Right homology arm amplification Primer RF1aacgcttatattattttaag18RF2ggtgcactaaaacgcttatattattttaag31RR1atggtgacaacatctgggcc20RR2catctgggcctagtcgatta21Pddh-glkLeft homology arm amplification primer LF1cacagatcgtcgtgcacagt6LF2tgattacgcccacagatcgtcgtgcacagt7LR1tgcgtacactttatggccca8LR2ttatggcccataaaaatggt9Promoter amplification primer P-F1atccggataaaccaccatga10P-F2agtgtacgcaatccggataaaccaccatga11P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13glk amplification Primer glk-F1atgccacaaaaaccggccag32glk-F2ttacaagaacatgccacaaaaaccggccag33glk-R1ctagttggcttccactacag34glk-R2tccactacagagcgtcgagc35Right homology arm amplification primer RF1aacgcttatattattttaag18RF2agccaactagaacgcttatattattttaag36RR1atggtgacaacatctgggcc20RR2catctgggcctagtcgatta21Pddh-glf-Pddh-glkLeft homology arm amplificationPrimer LF1cacagatcgtcgtgcacagt6LF2tgattacgcccacagatcgtcgtgcacagt7LR1tgcgtacactttatggccca8LR2ttatggcccataaaaatggt9Promoter1Amplification Primer P-F1atccggataaaccaccatga10P-F2agtgtacgcaatccggataaaccaccatga11P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13glfAmplification Primer glf-F1atgagttctgaaagtagtca14glf-F2ttacaagaacatgagttctgaaagtagtca15glf-R1ctacttctgggagcgccaca16glf-R2gagcgccacatctcctcgat17Promoter2Amplification Primer P-F1atccggataaaccaccatga10P2-F2ccagaagtagatccggataaaccaccatga37P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13glkAmplification Primer glk-F1atgccacaaaaaccggccag32glk-F2ttacaagaacatgccacaaaaaccggccag33glk-R1ctagttggcttccactacag34glk-R2tccactacagagcgtcgagc35Amplification of right homology arm Primer RF1aacgcttatattattttaag18RF2agccaactagaacgcttatattattttaag36RR1atggtgacaacatctgggcc20RR2catctgggcctagtcgatta21Pddh-iolT1-Pddh-iolT2-Pddh-glkLeft homology arm amplification primer LF1cacagatcgtcgtgcacagt6LF2tgattacgcccacagatcgtcgtgcacagt7LR1tgcgtacactttatggccca8LR2ttatggcccataaaaatggt9Promoter1 amplificationPrimer P-F1atccggataaaccaccatga10P-F2agtgtacgcaatccggataaaccaccatga11P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13iolT1Amplification Primer iolT1-F1atggctagtaccttcattca22iolT1-F2ttacaagaacatggctagtaccttcattca23iolT1-R1ttagtgcacctttccttttc24iolT1-R2tttccttttcggatgtcctt25Promoter2Amplification PrimerP-F1atccggataaaccaccatga10P2-F2ggtgcactaaatccggataaaccaccatga26P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13iolT2Amplification PrimeriolT2-F1atgacggacatcaaggccac27iolT2-F2ttacaagaacatgacggacatcaaggccac28iolT2-R1ttaagccttcttgaagatct29iolT2-R2ttgaagatctggccggtgaa30Promoter3Amplification Primer P-F1atccggataaaccaccatga10P3-F2gaaggcttaaatccggataaaccaccatga38P-R1gttcttgtaatcctccaaaattgt12P-R2tcctccaaaattgtggtggc13glkAmplification primer glk-F1atgccacaaaaaccggccag32glk-F2ttacaagaacatgccacaaaaaccggccag33glk-R1ctagttggcttccactacag34glk-R2tccactacagagcgtcgagc35Right homology arm amplification primer RF1aacgcttatattattttaag18RF2agccaactagaacgcttatattattttaag36RR1atggtgacaacatctgggcc20RR2catctgggcctagtcgatta21

[0070]

[0071] PCR was performed using the above primers under the following conditions. Using a thermocycler (TP600, TAKARA BIO Inc., Japan), 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) was added to the reaction solution. 1 pM of oligonucleotide and 10 ng of chromosomal DNA of Corynebacterium glutamicum ATCC 13032 or glf synthetic DNA derived from Zymomonas mobilis were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed under the following conditions: (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 72°C for 1 to 2 minutes (providing a polymerization time of 2 minutes per 1 kb).

[0072] The gene fragment thus produced was cloned into the pk19mobsacB vector using self-assembly cloning. The vector was transformed into E. coliDH5a, plated on LB agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was accurately present in the vector. The vector was then isolated and used for recombination in a Corynebacterium glutamicum strain.

[0073] As a common process in the above method, the amplification of the corresponding genes was amplified by PCR from the genomic DNA of Corynebacterium glutamicum ATCC 13032 or glf synthetic DNA derived from Zymomonas mobilis, and inserted into the pk19mobsacB vector by the self-assembled cloning method according to the strategy, and selected in E. coliDH5a. Chromosomal base substitution was performed by individually amplifying each fragment of the gene and producing the target DNA fragment by overlap PCR. For the PCR amplification enzymes for genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used, and various restriction enzymes and DNA modifying enzymes were used from NEB products, and were used according to the supplied buffer and protocol.

[0074]

[0075] Experimental Example 1. Evaluation of L-lysine production capacity

[0076] The L-lysine production ability of the Corynebacterium glutamicum mutant strain produced in Example 1 was evaluated compared to the parent strain.

[0077] Each strain (parent strain or mutant) was inoculated into a 100 mL flask containing 10 mL of the lysine production medium in Table 2 below and cultured with shaking at 30°C, 180 rpm, for 28 hours. After completion of culture, the concentration of L-lysine in the medium was measured using HPLC (Shimazu, Japan), and the results are shown in Table 3 below.

[0078] Ingredients (based on 1 L of distilled water) Glucose 100 g Ammonium sulfate 55 g KH2PO4 1.1 g MgSO4ㆍH2O 1.2 g MnSO4ㆍH2O 180 mg FeSO4ㆍH2O 180 mg ThiamineㆍHCl 9 mg Biotin 1.8 mg CaCO 3 5% pH 7.0

[0079] strain OD610 L-Lysine (g / L) per cell L-Lysine (g / gDCW)DS122.066.87.2DS1_iolT1_iolT223.167.26.9DS1_glf23.671.57.2DS1_glk24.369.76.8DS1_iolT1_iolT2_glk21.571.27.9DS1_glf_glk20.278.39.2

[0080]

[0081] As shown in Table 3 above, when the activity of the glucose-facilitated diffusion transporter or glucokinase was enhanced, the L-lysine production per unit cell was no different from that of the parent strain. However, when the activity of both the glucose-facilitated diffusion transporter and glucokinase was enhanced, the L-lysine production per unit cell increased compared to the parent strain, and the total L-lysine production was confirmed to have increased by a minimum of approximately 6.6% and a maximum of approximately 17.2%. These results suggest that the enhanced activity of the glucose-facilitated diffusion transporter and glucokinase increases the sugar utilization ability of microorganisms, thereby improving L-lysine production.

[0082]

[0083] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0084]

[0085] [Accession number]

[0086] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0087] Accession number: KCCM12969P

[0088] Date of acceptance: 20210402

[0089]

Claims

1. A microorganism of the genus Corynebacterium with enhanced L-lysine production due to enhanced glucose-facilitated diffusion protein and glucokinase activity.

2. In claim 1, A microorganism of the genus Corynebacterium, wherein the activity of the glucose-facilitated diffusion transporter is enhanced by introduction of a gene encoding the glucose-facilitated diffusion transporter, increase in copy number, promoter modification, or a combination thereof.

3. In claim 1, A microorganism of the genus Corynebacterium in which the activity of the above glucokinase is enhanced by introduction of a gene encoding glucokinase, increase in copy number, promoter modification, or a combination thereof.

4. In claim 1, The above Corynebacterium genus microorganism is Corynebacterium glutamicum.

5. A step of culturing the Corynebacterium genus microorganism of claim 1 in a medium; and A method for producing L-lysine, comprising a step of recovering L-lysine from a microorganism of the genus Corynebacterium or a medium in which a microorganism of the genus Corynebacterium is cultured.

Citation Information

Patent Citations

  • Nucleotide sequences coding for the glk gene

    KR1020010062078A

  • Method of Producing Succinic Acid and Other Chemicals Using Facilitated Diffusion for Sugar Import

    KR1020160033210A

  • Mold for constructing concrete building

    KR1020200087537A

  • Camera module

    KR1020200108155A

  • Device for swivel elbow assembly

    KR1020210108631A