Varicella zoster virus immediate-early protein 62 and derivatives thereof packaged into lipid particles, and uses thereof for suppression of neuroinflammation

Abstract

Embodiments of the present disclosure generally relate to a new class of compositions that include VZV IE62 or a derivative thereof (e.g., a mutant) and lipid particles. Embodiments of the present disclosure also relate to uses of the compositions for treating, alleviating, or reducing the severity of, various diseases or medical conditions in a patient. For example, embodiments described herein may be utilized for treating, alleviating, or reducing the severity of various neuroinflammation and related pathologies and diseases such as psoriasis, rheumatoid arthritis, systemic lupus erythematosus, ulcerative colitis, multiple sclerosis, neuromyelitis optica, or dementia, among others.

Description

TITLE: Varicella Zoster Virus Immediate-Early Protein 62 and Derivatives Thereof Packaged into Lipid Particles, and Uses Thereof for Suppression of Neuroinflammation INVENTORS: Andrew Bubak; Ravi Mahalingam; Jeffrey Bennett; Kimberly Bruce CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of and priority to U.S. Provisional Patent Application No. 63 / 669,907, filed on July 11, 2024, which is incorporated herein by reference in its entirety.GOVERNMENT RIGHTS

[0002] This invention was made with government support pursuant to Grant No. All 76110 from the National Institutes on Aging of the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] This application contains references to amino acid and nucleic acid sequences which have been submitted as the sequence listing text file entitled “SEQ ID NOs 1-37”, file size 44 KiloBytes (KB), created June 25, 2024, which is hereby incorporated by reference in its entirety.FIELD

[0004] Embodiments of the present disclosure generally relate to a new class of compositions that include varicella zoster virus immediate-early protein 62 (VZV IE62) or a derivative (e.g., a mutant) thereof and lipid particles. Embodiments described herein also to methods of treating, alleviating, or reducing the severity of, various diseases or medical conditions in a patient utilizing the new class of compositions.BACKGROUND

[0005] Neuroinflammation is a serious problem in many neurological and non- neurological diseases. Current treatments rely on steroids, immunomodulatory medications, and others which can have very serious side effects and are not specific.

[0006] There is a need for new compositions and methods for treating, alleviating, or reducing the severity of neuroinflammation and related pathologies and diseases.SUMMARY

[0007] Embodiments of the present disclosure generally relate to a new class of compositions that include VZV IE62 or a derivative thereof (e.g., a mutant) and lipid particles. Embodiments of the present disclosure also relate to uses of the compositions for treating, alleviating, or reducing the severity of, various diseases or medical conditions in a patient. For example, embodiments described herein may be utilized for treating, alleviating, or reducingthe severity of various neuroinflammation and related pathologies and diseases such as psoriasis, rheumatoid arthritis, systemic lupus erythematosus, ulcerative colitis, multiple sclerosis, neuromyelitis optica, or dementia, among others.

[0008] As described herein, the inventors have discovered a novel mechanism in which varicella zoster virus (VZV) utilizes to suppress neuroinflammatory processes. Specifically, the inventors found a VZV protein, IE62, which is released by extracellular vesicles into the extracellular environment to suppress cells critical to mount a neuroinflammatory response. This mechanism is an immune evasion strategy employed by the virus that will shut down the defenses of the host prior to the invasion of a whole infectious virion. In various embodiments, the inventors exploit this mechanism, in the absence of infectious virions, to aid in other diseases known to be caused by neuroinflammatory responses by cells such as microglia, macrophages, and other immune and tissue-specific resident cells. The inventors have substantial evidence both in vitro and in vivo that this protein can suppress the interferon response in these cells which would be beneficial in various applications when used without the presence of the whole VZV virion. The inventors have also found that derivatives (e.g., variants or mutants) of the VZV IE62 that may act similarly.

[0009] In an embodiment is provided a composition for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient. The composition includes lipid particles formulated with an amino acid sequence comprising one or more of SEQ ID NOs: 1 or 3-24 or an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0010] In another embodiment is provided a combination therapy for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient. The combination therapy includes a composition described herein; and a material that repairs, stimulates, or induces myelination of a neuron.

[0011] In another embodiment is provided a method of suppressing demyelination of a neuron in a patient. The method includes administering to the patient a composition described herein.

[0012] In another embodiment is provided a method of treating, alleviating, or reducing the severity of a demyelinating disease or condition or an autoimmune disease or condition. The method includes administering to the patient a composition described herein.

[0013] In another embodiment is provided a method of treating, alleviating, or reducing the severity of a demyelinating disease or condition or an autoimmune disease or condition. The method includes administering to the patient a combination therapy described hereinBRIEF DESCRIPTION OF THE DRAWINGS

[0014] So that the manner in which the above recited features of the present disclosure can be understood in detail, a more particular description of the disclosure, briefly summarized above, may be had by reference to embodiments, some of which are illustrated in the appended drawings. It is to be noted, however, that the appended drawings illustrate only exemplary embodiments and are therefore not to be considered limiting of its scope, and the exemplary embodiments may admit to other equally effective embodiments.

[0015] FIG. 1 shows nonlimiting data for characterization and infectivity assay of VZV- infected human sensory neuron (huSNs) small extracellular vesicles (sEVs): FIG. 1A) Representative grayscale images of mock-infected huSNs or VZV-infected huSNs at low (top and middle, lOx mag) or high (bottom, 40x mag) magnification showing Tuj l, VZV gB, and DAP1. FIG. IB) Representative histograms of nanoparticle tracking analysis for mock sEVs and VZV sEVs (n=6 / group). FIG. 1C) Concentration (mean) and size (mode) of sEVs from mock or VZV-infected huSNs (n=6 / group); 1 / 10 dilution. FIG. ID) VZV gB staining of primary human brain vascular adventitial fibroblasts (HBVAFs) exposed to VZV sEVs (top) or directly infected HBVAFs (bottom). Arrows indicate positive staining (scale bar = 200um) (grayscale image). FIG. IE) HBVAFs containing fluorescently labeled (white color) mock sEVs (left) or VZV sEVs (right) (scale bar = lOum). FIG. IF) Concentration of IFNP secreted from HBVAFs exposed to vehicle, mock, or VZV sEVs following poly(I:C) stimulation. *p<0.03, **p<0.002, ***p<0.0002, ****p<0.0001.

[0016] FIG. 2 shows nonlimiting data for gene expression changes in primary human brain vascular adventitial fibroblasts (HBVAFs) following VZV sEV or mock sEV exposure: FIG. 2A) Volcano plot showing significantly upregulated (open square) or down-regulated (open triangle) genes (FDR <0.05; FC cut-off = ±2) comparing VZV sEV treatment to mock sEV treatment (n=3 / group). FIG. 2B) Gene set enrichment analysis (GSEA) showing significantly enriched pathways (FDR <lE-3) with both positive and negative Normalized Enrichment Scores (NES). Positive NES scores indicate pathway activation by VZV sEVs treatment whereas negative NES scores indicate pathway suppression. FIG. 2C) GSEA enrichment plot showing running enrichment scores of cholesterol biosynthesis and Interferon alpha beta signaling Reactome genesets. The vertical lines in the middle show the leading-edge location of gene set members of the cholesterol biosynthesis (solid lines) or Interferon alpha beta signaling pathway (dashed lines). FIG. 2D) Predicted activation and repression of upstream regulators of HBVAF differentially expressed genes using Ingenuity Pathway Analysis. Shown are the predicted z-scores for upstream regulators with an FDR <0.01. FIG.2E) Plots showing the expression of genes that were significantly upregulated (top row) or down-regulated (bottom row) following VZV sEV exposure compared to mock sEV exposure (error bars denote 95% confidence interval; line inside box is 50thpercentile (median)). FIG. 2F) Heatmap showing row-scaled expression values from sEV-treated HBVAF RNA-seq data for the geneset members of the Reactome Matrisome pathway.

[0017] FIG. 3 shows nonlimiting data for small RNA analysis of VZV sEVs compared to mock sEVs: FIG. 3A) Volcano plot showing significantly enriched small RNAs in VZV sEVs compared to mock sEVs (FDR <0.05; FC cut-off = ±2)(n=3 / group). The top 7 VZV sEV enriched miRNAs are labeled. FIG. 3B) Expression plots showing the normalized RNA-seq expression counts (log2 +1) of selected significantly enriched VZV sEV miRNAs. FIG. 3C) Gene Ontology (GO) enrichment analysis of all 1,627 targets >2 VZV sEV enriched miRNAs. Enriched gene sets are shown as bubbles with different sizes based on the number of genes in the geneset. The x-axis is statistic value (adjusted p-value) and the y-axis is Fold Enrichment of each gene set. FIG. 3D) miRNA-mRNA network analysis showing the validated targets of all 67 / 71 Reactome interferon alpha beta signaling genes targeted by 24 / 35 VZV sEVs. Target genes that are significantly reduced in expression (FDR <0.05) are indicated as downregulated. Target genes that are significantly downregulated (FC <2) are labeled (IFI6 and I ITMl) and the miRNAs that commonly target these genes are also labeled.

[0018] FIG. 4 shows nonlimiting data for protein characterization and enrichment analyses of VZV sEVs compared to mock sEVs: FIG. 4A) Volcano plot showing the significantly differentially enriched proteins comparing mock sEV to VZV sEV proteins by mass spectrometry (FDR <0.05; FC cut-off = ±2)(n=3 / group). FIG. 4B) Heatmap showing log2 centered intensity values of enriched proteins in VZV sEVs. FIG. 4C) Expression of VZV IE62 and host proteins in mock or VZV sEVs. FIG. 4D) Pathway enrichment analyses of differentially expressed proteins in VZV sEVs, showing the number of VZV sEV enriched (count) that map to pathway (FDR <0.05). FIG. 4E) Ct threshold value of ORF62 following transfection of pciNEO (control) or pORF62 in HBVAFs (mean ± SEM). FIG. 4F) Expression of interferon genes following transfection of pciNEO or pORF62 at 24 hours in HBVAFs (mean ± SEM). FIG. 4G) Concentration of IFNP secretion by HBVAFs following transfection of pciNEO or pORF62 as detected with a Mesoscale interferon ELISA (mean ± SEM). **p<0.01, ***p<0.001 Each dot represents individual replicate.

[0019] FIG. 5 shows nonlimiting data for VZV sEV exposure in vivo increases neuroinvasion of HSV-1. Immunofluorescence analysis was performed in the OE (18-20 sections / animal) and OB (-12-15 sections / animal) for HSV-1 (magenta), macrophage (IBA1),and olfactory sensory neurons (Tuj l) in C57BL / 6 mice: FIG. 5A) Exposure to VZV sEVs + HSV-1 showed a dramatic decrease in macrophage ibal expression in the olfactory epithelium (OE) compared to mock sEV and vehicle-treated mice (n=4 / group). FIG. 5B) Examination of HSV-1 infiltration into the olfactory bulb (OB) showed positive HSV-1 antigen in 2 / 4 mice in the vehicle + HSV-1 group, 0 / 4 HSV-1 in the mock sEV + HSV-1 group, and 4 / 4 mice treated with VZV sEVs + HSV-1. FIG. 5C) Quantification of the % area of HSV-1 in the OB found significantly more HSV-1 antigen in the OB of VZV sEV treated animals compared to vehicle treated mice. FIG. 5D) HSV-1 titers and DNA yields in the trigeminal ganglia were similar in vehicle, mock sEV, and VZV sEV treated animals. **p<0.01, ***p<0.001.

[0020] FIG. 6: FIG. 6A) RNA-seq library sizes. The library sizes were calculated using DESeq2 and were measured in millions of reads. FIG. 6B) PC A plot of RNA-seq data using the variance stabilized transformation (VST) from DESeq2. The plot shows the top 500 genes based on their expression profiles. Each point represents a sample, and the hatching represents the condition. The greatest source of variation, as indicated by PCI, is due to the difference conditions. Samples from the same condition tend to cluster together, indicating that replicates of each condition have similar expression patters. FIG. 6C) Gene Ontology (GO) Enrichment analysis of differentially expressed genes in HBVAF cells with VZV sEV treatment compared to mock sEV treatment. Top scoring GO terms (q-value <le-2) are shown for each of the GO domains. FIG. 6D) nonlimiting data for gene ratio and number of genes.

[0021] FIG. 7: FIG. 7A) small RNA-seq library sizes generated from mock or VZV sEV samples. FIG. 7B) PCA plot of small RNA-seq data separated by sample type. FIG. 7C) Annotation distribution of small RNA types in VZV sEVs compared to mock sEVs.

[0022] FIG. 8: FIG. 8 A) PCA plot of mass spectrometry data based on the normalization intensity of all 207 identified proteins. Each point represents a samples, and the hatching of the points represents the condition. FIG. 8B) VZV sEV protein-protein interaction network. Analysis of the VZV sEV proteins using STRING database reveals interactions between VZV sEV enriched proteins (nodes).

[0023] FIG. 9: FIG. 9A) Distribution of CD63, CD81, or CD9 capture antibodies from mock sEVs compared to VZV sEVs (n=3 / group). FIG. 9B) CD9-positive particles that coexpress VZV proteins as measured by ExoView R200 (n=3 / group; mean + / - SD).

[0024] Figures included herein illustrate various embodiments of the disclosure. It is contemplated that elements and features of one embodiment may be beneficially incorporated in other embodiments without further recitation.DETAILED DESCRIPTION

[0025] Embodiments of the present disclosure generally relate to a new class of compositions that include VZV IE62 or a derivative thereof (e.g., a mutant) and lipid particles. Embodiments of the present disclosure also relate to uses of the compositions, for example, in treating, alleviating, or reducing the severity of, various diseases or medical conditions in a patient such as neuroinflammation and related pathologies and diseases such as psoriasis, rheumatoid arthritis, systemic lupus erythematosus, ulcerative colitis, multiple sclerosis, neuromyelitis optica, or dementia, among others.

[0026] As described above, the inventors have found a protein, VZV IE62, which is released by extracellular vesicles into the extracellular environment to suppress cells critical to mount a neuroinflammatory response. In various embodiments, a composition that includes VZV IE62 or a derivative (e.g., a mutant or variant) thereof may be utilized to suppress neuroinflammatory responses. Such compositions may be utilized for treating, alleviating, or reducing the severity of various diseases or medical conditions in a patient, such as neurological diseases and others, affected by neuroinflammatory responses. In some examples, the inventors exploit an evolutionarily driven mechanism in which a ubiquitous virus uses to invade and evade nervous system inflammatory defenses in a highly specific manner.

[0027] As used herein, a “composition” can include component(s) of the composition, reaction product(s) of two or more components of the composition, a remainder balance of remaining starting component(s), or combinations thereof. Compositions of the present disclosure can be prepared by any suitable mixing process. The term “patient”, “subject”, or “individual” are used interchangeably herein and refer to a vertebrate, such as a mammal. Mammals may include, but are not limited to, humans, nonhuman primates, rodents such as rats or mice, to domestic animals such as dogs and cats, horses, cows, among other animals.

[0028] Embodiments of the present disclosure generally relate to compositions for treating, alleviating, or reducing the severity of a disease or medical condition in a patient. The composition may include lipid particles formulated with an amino acid sequence comprising one or more of SEQ ID NOs: 1 or 3-24 or an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 1 or 3-24. Such variants may be functional variants of one or more of SEQ ID NOs: 1 or 3-24.

[0029] SEQ ID NO: 1 is a VZV IE62 protein. Mutants (also known as a variant or a derivative) of the VZV IE62 protein include SEQ ID NOs: 3-24, as well as amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0030] With respect to formulation, the amino acid sequence (a protein) of the composition may be dispersed within, encapsulated in, or otherwise formulated with the lipid particles of the composition. For example, the amino acid sequence (protein) of the composition may be formulated with or packaged into lipid particles or lipid nanoparticles using one or more of several approaches including, but not limited to, peptide-nanoparticle conjugation through chemical bonds or non-covalent interactions, encapsulation within the aqueous core of lipid nanoparticles, incorporation into liposomes, conjugation to solid lipid nanoparticles, among others.

[0031] The lipid particles of the composition may serve to solubilize the amino acid sequence of the composition. The lipid particles of the composition may serve as a carrier of the amino acid sequence of the composition such that the amino acid sequence may traverse a membrane and / or provide stability to the amino acid sequence in the extracellular environment. The lipid particles may protect the amino acid sequence from various degrading factors present in the extracellular milieu. The lipid particles may be any suitable lipid particles that cause no significant adverse toxicological effects to the patient. The lipid particles may serve to mimic extracellular vesicles.

[0032] Any suitable lipid particles may be utilized for compositions described herein such as anionic lipid particles, cationic lipid particles, non-ionic lipid particles, or combinations thereof. The lipid particles of the composition may comprise lipid nanoparticles. Lipid nanoparticles have a size of 1,000 nm or less. Suitable sizes of the lipid particles may be 1,000 nm or less, such as about 750 nm or less, such as from about 10 nm to about 500 nm, such as from about 20 nm to about 350 nm, such as from about 30 nm to about 200 nm, or from about 10 nm to about 1,000 nm, such as from about 50 nm to about 1,000 nm, such as from about 200 nm to about 750, such as from about 400 nm to about 600 nm.

[0033] Compositions described herein may be utilized for treating, alleviating, or reducing the severity of a disease or medical condition in a patient. Diseases and medical conditions may include any suitable autoimmune conditions or diseases such as neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, as well as demyelinating disease such as those that affect the central nervous system and / or peripheral nervous system. Suitable demyelinating diseases or conditions that may be treated with, alleviated by, or reduced in severity by compositions of the present disclosure may include multiple sclerosis, dementia, neurodegeneration, neuromyelitis optica, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis (CPM), Guillain-Barre Syndrome (GBS),Charcot-Marie-Tooth disease (CMT), chronic inflammatory demyelinating polyneuropathy, combinations thereof, among others. It is noted that various diseases and medical conditions in this list are both autoimmune and demyelinating such as neuromyelitis optica and multiple sclerosis.

[0034] Compositions of the present disclosure may serve or be configured to suppress demyelination of a neuron in a patient, aid in the remyelination of a neuron in a patient, or combinations thereof. Compositions of the present disclosure may serve or be configured to suppress neuroinflammation in a patient. Compositions of the present disclosure may be utilized for carrying out a method of the present disclosure.

[0035] Embodiments of the present disclosure also generally relate to combination therapies for treating alleviating, or reducing the severity of a disease or medical condition in a patient. Diseases and medical conditions that may be treated with, alleviated by, or reduced in severity by combination therapies described herein may include those autoimmune diseases or conditions and / or demyelinating diseases or conditions described herein.

[0036] Combination therapies of the present disclosure may include: (i) a first component comprising a composition described herein; and (ii) a second component. Combination therapies of the present disclosure may be utilized for carrying out a method of the present disclosure.

[0037] The first component may include lipid particles formulated with an amino acid sequence comprising one or more of SEQ ID NOs: 1 or 3-24 or an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 1 or 3-24. As described herein, such variants may be functional variants of one or more of SEQ ID NOs: 1 or 3-24..

[0038] The second component of the combination therapy may include a material, such as a pharmaceutical. The material, e.g., pharmaceutical, may (or may be configured to) repair, stimulate, and / or induce myelination of a neuron of a patient. The pharmaceutical may be natural, synthetic, or semi synthetic. The pharmaceutical may be a biologic, e.g., a protein, a cell, nucleotide sequence, a carbohydrate, or combinations thereof. Suitable materials (e.g., pharmaceuticals) for use as the second component of combination therapies of the present disclosure may include any suitable pharmaceutical used for treatment of those demyelinating and / or autoimmune diseases described herein. Illustrative, but non-limiting examples, of suitable materials (e.g., pharmaceuticals) may include teriflunomide, clemastine, clobetasol,metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

[0039] The first component of the combination therapy may serve to or be configured to suppress demyelination of a neuron in a patient, aid in the remyelination of a neuron in a patient in a patient, or combinations thereof. Additionally, or alternatively, the first component of the combination therapy may serve or be configured to suppress neuroinflammation in a patient. The second component of the combination therapy may (or may be configured to) repair, stimulate, and / or induce myelination of a neuron of a patient.

[0040] Compositions and combination therapies described herein may be formulated with any suitable pharmaceutically acceptable adjuvant, carrier, diluent, excipient, or combinations thereof. Pharmaceutically acceptable adjuvants, pharmaceutically acceptable carriers, pharmaceutically acceptable diluents, and pharmaceutically acceptable excipients refers to adjuvants, carriers, diluents, and excipients that cause no significant adverse toxicological effects to the patient. For example, such adjuvants, carriers, diluents, and excipients refer to adjuvants, carriers, diluents, and excipients that can be taken into the mammalian subject’s body in association with an active compound (e.g., an amino acid sequence of the composition, the amino acid sequence of the combination therapy, and / or the material of the combination therapy) with no significant adverse toxicological effects to the subject.

[0041] Compositions and combination therapies described herein may be formulated with pharmaceutically acceptable adjuvants, carriers, diluents, excipients, or combinations thereof in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19thEdition, Gennaro, Ed., Mack Publishing Co., Easton, Pa., 1995.

[0042] Any suitable pharmaceutically acceptable carrier may be utilized. For example, the carrier may include any suitable solvent, dispersion medium, coating, antibacterial agent, antifungal agent, isotonic delaying agent, and absorption delaying agent, and the like that are physiologically compatible. The carrier may be suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (for example, by injection or infusion). Depending on the route of administration, the active compound, e.g., amino acid sequence, protein, polypeptide, nucleotide sequence, or nucleic acid molecule, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the active compound.

[0043] Actual dosage levels of the active ingredients in compositions, pharmaceutical compositions, and combination therapies of the present disclosure may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic responsefor a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level may depend upon a variety of pharmacokinetic factors including the activity of the particular compositions or combination therapies of the present disclosure employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and / or materials used in combination with the particular compositions or combination therapies employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

[0044] Embodiments of the present disclosure also generally relate to kits for treating alleviating, or reducing the severity of a disease or medical condition in a patient. Diseases and medical conditions that may be treated with, alleviated by, or reduced in severity by use of kits described herein may include those autoimmune diseases or conditions and / or demyelinating diseases or conditions described herein. Kits of the present disclosure may be utilized for carrying out a method of the present disclosure.

[0045] The kit may include (i) a first component comprising a composition described herein and (ii) a second component. The first component may include a composition described herein. Compositions described herein may include lipid particles formulated with an amino acid sequence comprising one or more of SEQ ID NOs: 1 or 3-24 or an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 1 or 3-24. As described herein, such variants may be functional variants of one or more of SEQ ID NOs: 1 or 3-24. The composition of the kit may serve to (or may be configured to) suppress demyelination of a neuron in a patient. Additionally, or alternatively, the composition of the kit may serve to (or may be configured to) suppress neuroinflammation.

[0046] The second component of the kit may include a material, such as a pharmaceutical. The pharmaceutical may be natural, synthetic, or semisynthetic. The pharmaceutical may be a biologic, e.g., a protein, a cell, nucleotide sequence, a carbohydrate, or combinations thereof. Suitable materials (e.g., pharmaceuticals) for use with kits of the present disclosure may include any suitable pharmaceutical used for treatment of those demyelinating and / or autoimmune diseases described herein. Illustrative, but non-limiting, examples of suitable materials (e.g., pharmaceuticals) may include teriflunomide, clemastine, clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinationsthereof. The second component of the kit may (or may be configured to) repair, stimulate, and / or induce myelination of a neuron of a patient.

[0047] Kits described herein may further include instructions for using the components of the kit to practice methods described herein. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc. The instructions may be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. Additionally, or alternatively, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided with the kit. An example of this embodiment is a kit that includes a web address where the instructions may be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions may be recorded on a suitable substrate.

[0048] Embodiments described herein also generally relate to various methods of treating, alleviating, and / or reducing the severity of a disease or medical condition in a patient. Such methods may include use of compositions, combination therapies, and / or kits described herein. For example, a method of suppressing demyelination of a neuron in a patient and / or suppressing neuroinflammation in a patient may include administering to the patient a composition described herein.

[0049] A method of treating, alleviating, or reducing the severity of a demyelinating disease in a patient, a demyelinating condition in a patient, an autoimmune disease in a patient, an autoimmune condition in a patient, or combinations thereof in a patient is also provided. The method may include administering to the patient a composition described herein.

[0050] Embodiments of the present disclosure also generally relate to various methods that include use of the combination therapies described herein. For example, methods of treating, alleviating, or reducing the severity of a disease or medical condition in a patient (e.g., a demyelinating disease in a patient, a demyelinating condition in a patient, an autoimmune disease in a patient, an autoimmune condition in a patient, or combinations thereof in a patient) are provided. The method may include administering to the patient a combination therapy described herein. The administering to the patient the combination therapy may include: (a) administering to the patient the first component comprising a composition described herein; and (b) administering to the patient the second component comprising the material (e.g., apharmaceutical). The composition of the combination therapy may serve to (or may be configured to) suppress demyelination of a neuron in a patient. Additionally, or alternatively, the composition of the combination therapy may serve to (or may be configured to) suppress neuroinflammation. The second component of the combination therapy comprising the material may repair, may be configured to repair, may stimulate, may be configured to stimulate, may induce, and / or may be configured to induce myelination of a neuron. Operation (a) may be performed prior to, during, and / or after performing operation (b).

[0051] Embodiments of the present disclosure also generally relate to various methods that include use of kits described herein. For example, methods of treating, alleviating, or reducing the severity of a disease or medical condition in a patient (e.g., a demyelinating disease in a patient, a demyelinating condition in a patient, an autoimmune disease in a patient, an autoimmune condition in a patient, or combinations thereof in a patient) are provided. The method may include administering to the patient a kit described herein. The administering to the patient the kit may include: (a) administering to the patient the first component comprising a composition described herein; and (b) administering to the patient the second component comprising the material (e.g., a pharmaceutical). The first component of the kit may suppress, or may be configured to suppress, demyelination of a neuron in a patient. Additionally, or alternatively, the composition of the kit may suppress, or may be configured to suppress, neuroinflammation in a patient. The second component of the kit may repair, may be configured to repair, may stimulate, may be configured to stimulate, may induce, and / or may be configured to induce myelination of a neuron. Operation (a) may be performed prior to, during, and / or after performing operation (b).

[0052] In suitable embodiments, which may be combined with other embodiments, a patient may take or may be administered the composition, combination therapy, or component(s) of the kit in any suitable dosage form, such as topical, oral, nasal, intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (for example, by injection or infusion).Definitions

[0053] “Coding sequence” refers to that portion of a nucleic acid (e.g., a gene) that encodes (i) an mRNA that is translated into an amino acid sequence of a protein; or (ii) a functional RNA, such as an interfering RNA or antisense molecule.

[0054] “Recombinant,” when used with reference to, e.g., a cell, nucleic acid, polypeptide, expression cassette or vector, refers to a material, or a material corresponding to the natural or native form of the material, that has been modified by the introduction of a new moiety oralteration of an existing moiety, or is identical thereto but produced or derived from synthetic materials. For example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell (i.e., “exogenous nucleic acids”) or express native genes that are otherwise expressed at a different level, typically, under-expressed or not expressed at all.

[0055] Recombinant techniques may include, e.g., use of a recombinant nucleic acid such as a cDNA encoding a protein or an antisense sequence, for insertion into an expression system, such as an expression vector; the resultant construct is introduced into a cell, and the cell expresses the nucleic acid, and the protein, if appropriate. Recombinant techniques also encompass the ligation of nucleic acids to coding or promoter sequences from different sources into one expression cassette or vector for expression of a fusion protein, constitutive expression of a protein, or inducible expression of a protein.

[0056] As used herein, a “variant” refers to an amino acid sequence, a protein, a polypeptide, a nucleotide sequence, or a nucleic acid molecule which is not identical to, but has significant homology (for example, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) over the entire length of the amino acid sequence, protein, polypeptide, nucleotide sequence, or nucleic acid molecule, as exemplified by sequences in the public sequence databases, such as GenBank.

[0057] “Position corresponding to” refers to a position of interest (i.e., base number or residue number) in an amino acid sequence, a protein, a polypeptide, a nucleotide sequence, or a nucleic acid molecule relative to the position in another reference amino acid sequence, protein, polypeptide, nucleotide sequence, or nucleic acid molecule. Corresponding positions can be determined by comparing and aligning sequences to maximize the number of matching nucleotides or residues, for example, such that identity between the sequences is greater than 90%, greater than 95%, greater than 96%, greater than 97%, greater than 98% or greater than 99%. The position of interest is then given the number assigned in the reference amino acid sequence, protein, polypeptide, nucleotide sequence, or nucleic acid molecule. For example, if a particular polymorphism in Gene-X occurs at nucleotide 173 of SEQ ID No. X, to identify the corresponding nucleotide in another allele or isolate, the sequences are aligned and then the position that lines up with 173 is identified. Because various alleles may be of different length, the position designate 173 may not be nucleotide 173, but instead is at a position that “corresponds” to the position in the reference sequence.

[0058] “Percentage of sequence identity”, “% sequence identity”, and “percentage homology” are used interchangeably herein to refer to comparisons among amino acidsequences, proteins, polypeptides, nucleotide sequences, or nucleic acid molecules, and are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for alignment of the two sequences. The percentage may be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Alternatively, the percentage may be calculated by determining the number of positions at which either the identical nucleic acid base or amino acid residue occurs in both sequences or a nucleic acid base or amino acid residue is aligned with a gap to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Those of skill in the art appreciate that there are many established algorithms available to align two sequences. Alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'L Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin Software Package), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995 Supplement) (Ausubel)). Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as, the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as “seeds” for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignmentscore can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negativescoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).

[0059] While all of the above mentioned algorithms and programs are suitable for a determination of sequence alignment and % sequence identity, for purposes of the disclosure herein, determination of % sequence identity will typically be performed using the BESTFIT program in the GCG Wisconsin Software package (Accelrys, Madison Wisconsin), using default parameters provided.

[0060] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use embodiments of the present disclosure, and are not intended to limit the scope of embodiments of the present disclosure. Efforts have been made to ensure accuracy with respect to numbers used but some experimental errors and deviations should be accounted for.ExamplesExample 1 : VZV IE62 and the Preparation of Constructs and Compositions

[0061] VZV IE62 was discovered in VZV sEVs (lipid particles) and analyzed by mass spectrometry. The wild-type VZV IE62 has the amino acid sequence set forth in SEQ ID NO: 1 and is shown in Table 1 A.Table 1A

[0062] SEQ ID NO: 2, shown in Table IB, is a wild-type RNA copy of the DNA sequence coding for VZV IE62. Because ST.26 requires the symbol “f ’ to represent uracil in RNA, “T” in SEQ ID NO: 2 refers to U (uracil).Table IBl.A. Preparation of example constructs

[0063] Peptides of <200 amino acids were obtained from commercial sources such as GenScript and Biomatik as dry powder and reconstituted in appropriate buffer for inoculation. For peptides >200 amino acids, the DNA segment coding for the specific region of VZV IE- 62 were PCR-amplified and cloned into an expression vector using the GeneArt Elements Vector Construction and Combinatorial Parts Assembly kit from Invitrogen.

[0064] A cytomegalovirus (CMV) early promoter was used and included a histidine tag at the 3” end of the DNA segment. The fusion protein was expressed in E.Coli. Upon lysis of the bacteria, the recombinant protein was purified on a nickel-based affinity column and TEV Protease was used to cleave the Histidine-tag following purification.

[0065] Example VZV IE62 constructs (mutants) of the present disclosure have an amino acid sequence as set forth in SEQ ID NOs: 3-23 and are shown in Table 2. The N-terminus VZV IE62 construct (mutant) has an amino acid sequence as set forth in SEQ ID NO: 24 and is shown in Table 2. While not wishing to be bound by theory, the N-terminus region may represent a cleavage product stuck in a host cell.Table 2

[0066] Table 3 shows selected peptide sequences of VZV IE62 detected by mass spectrometry. In Table 3, the column header “P” refers to probability, the column header “SC” refers to spectral count, and the column header “In ’ refers to intensity.Table 31.B. Preparation of example compositions

[0067] Non-limiting examples of methods of making lipid nanoparticle compositions are described, for example, in Semple et al. (2010) Nat. BiotechnoL 28: 172-176; Jayarama et al. (2012), Angew. Chem. Int. Ed., 51 : 8529-8533; and Maier et al. (2013) Molecular Therapy 21, 1570-1578 (the contents of each of which are incorporated herein by reference in their entirety).

[0068] An amino acid sequence (protein) was packaged into or formulated with lipid particles or lipid nanoparticles using one or more of several approaches including, but not limited to, peptide-nanoparticle conjugation through chemical bonds or non-covalent interactions, encapsulation within the aqueous core of lipid nanoparticles, incorporation into liposomes, conjugation to solid lipid nanoparticles, among others.

[0069] In one approach, an amino acid sequence (protein) was formulated for experiments by mixing the amino acid sequence with the lipid nanoparticles at a set ratio. To test the ability of these lipidoids to form particles, a standard formulation process used for protein-lipid formulations was used as a starting point. After formation of the lipid particle, the amino acid sequence was added and allowed to integrate. The encapsulation efficiency was determined using a standard dye exclusion assay.Example 2: VZV extracellular vesicles suppress antiviral response: Suppression of the host antiviral response by non-infectious VZV extracellular vesicles2.A. Overview

[0070] VZV is a ubiquitous human virus that predominantly spreads by direct cell-cell contact and requires efficient and immediate host immune evasion strategies to spread. The mechanisms of immune evasion prior to virion entry have not been fully elucidated and represent a critical gap in the understanding of VZV pathogenesis. The study described herein presents, e.g., a previously unreported antiviral evasion strategy employed by VZV through theexploitation of the infected host cell’s small extracellular vesicle (sEV) machinery. The findings suggest, for example, that non-infectious VZV sEVs could travel throughout the body, affecting cells remote from the site of infection, challenging the current understanding of VZV clinical disease, which has focused on local effects and direct infection. The significance of these sEVs in early VZV pathogenesis highlights the importance of further investigating their role in viral spread and secondary disease development to reduce systemic complications following VZV infections.

[0071] VZV reactivates from ganglionic sensory neurons to produce herpes zoster (shingles) in a unilateral dermatomal distribution, typically in the thoracic region. Reactivation not only heightens the risk of stroke and other neurological complications but also increases susceptibility to co-infections with various viral and bacterial pathogens at sites distant from the original infection. The mechanism by which VZV results in complications remote from the initial foci remains unclear. Small extracellular vesicles (sEVs) are membranous signaling structures that can deliver proteins and nucleic acids to modify the function of distal cells and tissues during normal physiological conditions. Although viruses have been documented to exploit the sEV machinery to propagate infection, the role of non-infectious sEVs released from VZV-infected neurons in viral spread and disease has not been studied. Multi-omic approaches were utilized to characterize the content of sEVs released from VZV-infected human sensory neurons (VZV sEVs). One viral protein was detected (immediate-early 62 [IE62]), as well as numerous immunosuppressive and vascular disease-associated host proteins and miRNAs that were absent in sEVs from uninfected neurons. Notably, VZV sEVs were non-infectious yet transcriptionally altered primary human cells, suppressing the antiviral type 1 interferon response, and promoted neuroinvasion of a secondary pathogen in vivo. These results challenge the understanding of VZV infection, proposing that virus may contribute to distant pathologies through non-infectious sEVs beyond the primary infection site. Furthermore, this study provides a previously undescribed immune-evasion mechanism induced by VZV that highlights the significance of non-infectious sEVs in early VZV pathogenesis.2.B. Introduction

[0072] VZV is an exclusively human, double-stranded DNA alphaherpesvirus that produces varicella (chickenpox) on primary infection then establishes life-long latency in ganglionic sensory neurons in >95% of adults. With aging and immunosuppression, VZV reactivates in at least 1 in 3 individuals to produce zoster rash (shingles) that can be further complicated by vasculitis (inflammation of the vasculature), myelitis (inflammation of thespinal cord), and / or chronic pain (post-herpetic neuralgia, PHN). Additionally, individuals can reactivate without the characteristic and diagnostic rash (zoster sine herpete). In fact, it is predicted for every 1 individual with rash, 7 individuals reactivate without rash resulting in a clinically difficult diagnosis of VZV reactivation. Furthermore, the inventors show that individuals can still shed VZV DNA in their saliva following a reactivation event up to 10 years following initial rash onset, indicating the occurrence of multiple sub-clinical reactivation events and / or persistence of viral replication in lieu of reestablishing latency. Thus, the burden of VZV disease is likely substantially underappreciated.

[0073] Unlike the other alphaherpesviruses (herpes simplex virus types 1 and 2), VZV is a cell associated virus meaning direct cell-to-cell contact is required for viral spread outside of skin lesions. During reactivation, infectious virions travel down the neurites and infect innervated cells. A component in a successful infection is the rapid evasion or delay of the host innate immune defenses. As such, VZV has evolved multiple immune evasion strategies that are employed once the virus has entered the cell. For example, VZV immediate-early protein ORF61p interacts with interferon regulatory factor (IRF)-3 leading to its ubiquitination and proteasomal degradation. VZV ORF47p prevents Ser396 phosphorylation and subsequent transcription of target genes such as IFNP and ISG15. Further, intracellular VZV immediate- early (IE)-62 can inhibit IRF3 phosphorylation independent of TBK-1 and IRF3 binding. While the role of VZV specific viral proteins have been shown to play a significant role during lytic infection, it fails to consider how VZV could potentially alter innate immune signaling in distal cells, away from the site of infection. This process would suggest a potential soluble factor released by infected or reactivated sensory neurons. This factor may contribute to VZV-related disease development even before entry of an infectious virion.

[0074] Viruses have been shown to exploit the host cell’s small extracellular vesicle (sEV) machinery to aid in viral propagation. sEVs are a diverse group of membranous structures, which include exosomes and microvesicles, released by all cells. They have emerged as vital mediators of intercellular communication, delivering a wide range of cargo, including proteins, lipids, nucleic acids (such as miRNAs), and other bioactive molecules, to distant cells and tissues. The significance of sEVs in infectious diseases is increasingly being recognized. For instance, sEVs derived from platelets, megakaryocytes, and peripheral blood mononuclear cells have been shown to transfer receptors like CXCR4 and CCR5 to recipient cells, thereby increasing susceptibility to HIV infection. Additionally, sEVs released from nasopharyngeal carcinoma cells, positive for Epstein Barr virus, carry viral latent membrane protein 1 and other factors that manipulate the tumor microenvironment, promoting tumor progression andsuppressing immune responses. Moreover, the inventors’ recent findings that non-infectious plasma sEVs isolated from herpes zoster patients contained prothrombotic and proinflammatory properties, which were present even 3 months after zoster, provides mechanistic support for a long-lasting pathogenic effect on stroke risk seen epidemiologically.

[0075] Herein, the present study provides, for example, a detailed characterization of the cargo within sEVs released from VZV-infected human sensory neurons through advanced proteomic and transcriptomic analyses, aimed to uncover the specific components responsible for mediating the earliest stages of VZV infection. The inventors discovered the presence of a single VZV protein, VZV IE62, as well as multiple host proteins and miRNAs with known immunosuppressive abilities that were enriched in VZV-derived sEVs. By functionally testing the role of these sEVs in naive primary human brain vascular cells, the inventors observed their potent ability to transcriptionally alter the host cell and modulate the type 1 interferon response in the absence of infectious virions. The inventors further tested the suppression of the immune response of VZV sEVs in vivo and found VZV-derived sEVs increased neuroinvasion of a secondary pathogen, herpes simplex virus type 1 (HSV-1). These findings not only expand the knowledge of VZV-associated cargo within sEVs but also provide critical insight into the interplay between VZV and the host immune system that was previously unrecognized.2.C. Non-limiting Results2.C.I. VZV-induced sEVs from human sensory neurons are non-infectious

[0076] Small extracellular vesicles (sEVs) are comprised of a class of secretory vesicles ranging from 50 nm up to 1 pm in size and include exosomes, vesicles originating from multi- vesicular endosomes, and microvesicles (ectosomes), which are derived from the plasma membrane. sEVs were isolated from human sensory neurons (huSNs) 4 days after VZV or mock infection. To confirm infection of huSNs, immunohistochemistry was performed for the neuronal marker Tuj l and VZV-gly coprotein B (gB, FIG. 1A). sEVs were extracted from supernatant and analyzed for size distributions and concentrations by nanoparticle tracking analysis (n=6 / group; representative histograms in FIG. IB). No difference in the concentration of sEVs between VZV- and mock-infected huSNs were observed (1.39e9 ± 7.34e7 vs 1.18e9 ± 1.13e8 particles / mL; mean ± SE). VZV-infected huSNs released smaller vesicles compared to mock-infected huSNs (165.75 ± 5.98 vs 194.1 ± 5.52nm; mode ± SE; two-tailed unpaired t- test; FIG. 1C), however, the biological significance of this is unknown but a shift towards smaller vesicles has been observed in disease states such as metabolic syndromes. Although a statistically significant smaller size overall was measured, the VZV sEV samples also appeared to have populations of sEVs that were larger than mock sEV samples (demonstrated byhistogram in FIG. IB). Next examined was whether sEVs derived from VZV-infected huSNs were themselves infectious. Here, naive primary human brain vascular adventitial fibroblasts (HBVAFs) were exposed to VZV-derived sEVs and cultured them for 7 days. No viral plaques, cytopathic effect, or VZV gB antigen staining was observed, suggesting these sEVs are non- infectious (FIG. ID, upper panel; n=3). For comparison, directly VZV-infected HBVAFs showed robust viral plaques and VZV gB staining by 3 days post-infection (FIG. ID, lower panel; n=3).2.C.2, VZV sEVs suppress the innate antiviral pathway in naive bystander cells.

[0077] VZV utilizes a diverse array of strategies to regulate innate immune responses within cells. Thus, the inventors tested whether VZV sEVs suppressed innate antiviral responses in naive bystander cells. Given VZV is associated with vascular disease, quiescent primary human brain vascular adventitial fibroblasts (HBVAFs) were chosen to mimic an infection within innervated vasculature; HBVAFs have been shown to be among the initial vascular cell infected during VZV vasculitis. HBVAFs were exposed to mock sEVs or VZV sEVs labeled with a fluorescent marker to test cellular uptake; at 3 hours post-treatment, fluorescently labeled mock sEVs and VZV sEVs were observed (n=3; representative images in FIG. IE).

[0078] Previous reports show a strong suppression of VZV replication by IFNP in vitro and that direct VZV infection of cells evades this host response by suppressing the induction of IFNP, supporting a mechanistic role for IFNP in VZV pathogenesis. To functionally test whether VZV sEVs can suppress this antiviral response in the absence of a lytic infection, naive HBVAFs were exposed to either mock sEVs, VZV sEVs, or vehicle for 36 hours then stimulated IFNP release using poly(EC), a known activator of the interferon response. The results shown in FIG. IF indicated that poly(EC) exposure significantly increased IFNP release of HBVAFs pre-treated with vehicle compared to unstimulated, vehicle treated cells. Mock sEV treated HBVAFs showed a similar increase in IFNP release compared to vehicle plus poly(I:C) stimulation. However, HBVAFs pretreated with VZV sEVs blunted the IFNP release induced by poly(EC) (one-way ANOVA with Tukey’s multiple comparisons test). These data suggest that VZV sEVs have the capacity to suppress the IFNP antiviral response in the absence of infectious virions.2.C.3, Exposure to VZV sEVs induces altered gene regulation in human vascular cells.

[0079] To investigate the mechanisms by which VZV sEVs elicit modulatory effects, naive primary HBVAF cells were exposed to mock (n=3) or VZV sEVs (n=3) for 36 hours for bulk RNA-seq analysis. Principal component analysis (PCA) revealed a reproducible and robusteffect of VZV sEVs on HBVAF gene expression with clustering of independent replicates across treatment conditions (FIG. 6). A total of 110 differentially expressed genes (DEGs) that change >2-fold with exposure to VZV sEVs compared to mock sEVs (FDR <0.05, FIG. 2A) were identified. DEGs in HBVAF cells treated with VZV sEVs were significantly enriched (FDR <0.05) in diverse Gene Ontology (GO) terms associated with key aspects of fibroblast function, including cell adhesion, cell communication, and extracellular matrix organization (FIG. 6).

[0080] Gene set enrichment analysis (GSEA) revealed significant enrichment of distinctive gene sets from the Canonical Pathways msigdb database (FIG. 2B). Significantly enriched gene sets with a negative Normalized Enrichment Score (NES) indicated that pathways related to extracellular matrix and innate immune responses were suppressed in HBVAF cells with VZV sEV treatment. Notably, the expression of interferon alpha beta signaling genes were suppressed in VZV sEV treated HBVAF cells (NES = -2.0, FDR <1 0E-3; FIG. 2C), supporting the detected blunting of IFNP release following poly(EC) stimulation (FIG. IF). Specifically, VZV sEV downregulated the expression of several genes encoding critical mediators of interferon signaling including IFITM1-3, GBP2, JAK1, IFI6, and OAS3 (FIG. 2C).

[0081] In contrast, VZV sEV treatment activated the expression of pathways including cholesterol biosynthesis, cell cycle, nuclear events mediated by NFE2L2, and negative regulation of Notch4 signaling (FIG. 2B). NFE2L2 (aka NRF2) is a stress-responsive transcription factor that regulates the transcription of downstream responses such inflammatory responses. It has been reported that reciprocal crosstalk between NFE2L2 and NF-KB may provide an advantage for virus infections to promote the survival of the infected cells via reduction of the inflammatory responses to help viral propagation. Specifically, NFE2L2 has been shown to downregulate IFN production. Similarly, the negative regulation of Notch4 signaling pathway may have significant implications for suppressing antiviral responses. The Notch receptors (Notchl-4) and their ligands (i.e., Jagged and Delta-like proteins) mediate intercellular communication and play a critical role in antiviral responses. The observed upregulation of this pathway suggests that the VZV sEV treatment suppresses the activity of Notch4 signaling. Together these mechanisms could lead to impaired interferon responses and compromised immune cell function.

[0082] Notably, VZV sEV treatment downregulated the expression of genes enriched in innate immune responses including IFITM1 encoding a potent inhibitor viral entry into cells including other alphaherpesvirus, HSV-1. Ingenuity Pathway Analysis was used to predict the upstream regulators of VZV sEV-induced gene expression changes, which showed IFNA2,IFNB1, INFL I , and IRF1 as the top upstream regulators of VZV sEV expression responses in HBVAF cells (FIG. 2D), consistent with the suppression of the interferon antiviral response and downregulation of pro-inflammatory genes IL34, IL6R, IFITM1, and IFI6 (FIG. 2E). A significant increase in vasoactive intestinal peptide receptor 1 (VIPR1) expression was also measured; VIPR1 signaling induces pronounced immunomodulatory activity, primarily antiinflammatory and immunosuppressive. Similarly, elevated transcript levels of IL20RA were detected, which has been observed to promote a tumor-favorable immune microenvironment. Conversely, a significant increase in STAT4 transcripts following VZV sEV treatment was detected, which could represent a mounted host antiviral response. Finally, there was a significant enrichment of genes encoding extracellular matrix (ECM) proteins, indicating that VZV sEV treatment considerably modifies the adventitial fibroblast cell surface that could contribute to vascular cell remodeling and vascular disease (FIG. 2F). Elevated genes included matrix metallopeptidase 1 (MMP-1) which is found in patients with acute myocardial infarction and are found at higher levels near atherosclerotic plaques. Overall, these results indicate that VZV-induced sEVs alter HBVAF phenotypes through changes in gene expression associated with ECM remodeling and innate antiviral immune pathways.2.C.4, VZV sEVs contain unique miRNAs associated with vascular disease, immune evasion, and viral replication.

[0083] Because extracellular vesicles encompass small RNA species, such as microRNA (miRNA), high-throughput small RNA sequencing was performed to characterize the small RNA species enriched in sEV samples derived from mock-infected conditions and VZV- infected conditions (n=3 / group). Differential expression analysis identified a total of 138 unique RNAs that were significantly enriched in VZV sEVs compared to mock sEVs (FDR <0.05, FC ±2, FIG. 3 A; FIG. 7). miRNAs comprised the highest proportion of RNA biotypes differentially enriched in VZV sEVs, but also included vault RNAs, Y RNAs, piwi-interacting RNAs (piRNAs), and other small RNA species (FIG. 7).

[0084] Among the identified VZV sEV-enriched miRNAs, a robust increase in miRNAs associated with immune evasion and vascular disease pathogenesis was detected. Specifically, the following results were detected: a significant increase in hsa-miR-221 and hsa-miR-222 which are elevated in individuals with vascular disease, hsa-miR-143 which is a mediator of pulmonary arterial hypertension, and hsa-miR-31 which increases oxidative stress in vascular smooth muscle cells (FIG. 3B). Hsa-miR-100 modulates vascular inflammation and angiogenesis and has been found in higher concentrations of atherosclerotic plaques in symptomatic populations compared to asymptomatic individuals. Also found was a significantenrichment of hsa-miR-146a-5p, which has been reported as over-expressed in viral and prion mediated neurological and neurodegenerative diseases such as Alzheimer’s disease. hsa-miR- 146a-5p has also been reported to suppress the antiviral type 1 interferon response. To examine the regulatory potential of miRNAs from VZV sEVs, a list of experimentally validated target genes for the miRNAs from the miRTarbase validated target database (v8) was obtained. Pathway enrichment analysis showed that the target genes of VZV sEV miRNAs (1,657 distinct targets) were enriched in platelet-derived growth factor binding, cyclin-dependent protein serine / threonine kinase activity, and transcription factor GO terms (padj <0.05) (FIG. 3C).

[0085] Given that miRNAs can reduce their target mRNA expression level, validated VZV sEV miRNA target genes were compared to differentially expressed genes identified from bulk RNA-seq of sEV-treated HBVAF cells. A total of 27 / 47 (57%) of the significantly down- regulated HBVAF DEGs were targets of 19 / 61 (31%) of the VZV sEV-enriched miRNAs, suggesting a potential regulatory relationship between miRNA and mRNA expression in sEV- treated HBVAF cells. The examination of whether any VZV sEV miRNAs had the potential to target interferon alpha beta signaling genes was performed to determine potential miRNA- mediated suppression of interferon by VZV sEVs. Among genes of the Reactome Interferon alpha beta signaling gene set, 60 / 71 (85%) were targets of 24 / 61 (39%) VZV sEV miRNAs (FIG. 3D). Notably, interferon signaling genes significantly reduced in expression in HBVAF cells with VZV sEV treatment were targets of VZV sEV miRNAs (FDR <0.05 indicated as downregulated in FIG. 3D). In addition, IFITM1 and IFI6 were significantly downregulated by VZV sEV treatment (FIG. 3D), and both genes are jointly targeted by multiple different VZV sEV-enriched miRNAs (hsa-miR-21-3p, hsa-miR-146a-5p, and hsa-miR-155-5p) (FIG. 3D). Overall, these results suggest that VZV sEV miRNAs may have a role in modulating the expression of interferon signaling genes.2.C.5, VZV-induced sEVs contain unique proteins associated with vascular and infectious diseases.

[0086] Next, mass spectrometry (MS) was used to study the protein composition of mock and VZV-induced sEV samples. In total, >200 sEV-associated proteins from either condition were identified, among which 196 / 207 (95%) matched to a curated list of proteins previously identified in extracellular vesicles. Differential enrichment analysis identified 44 differentially expressed proteins (DEPs) in VZV sEVs compared to mock sEVs (FDR <0.05). Distribution and relative expression of top DEPs are shown as a volcano plot and heatmap (FIG. 4A-B). VZV immediate-early protein (IE)-62 was the only viral protein detected in the samples (FIG.4C; no VZV IE62 peptides were detected in mock sEV samples). Coverage of detected VZV IE62 peptides by mass spectrometry are shown in Table 3 (above). To confirm VZV protein presence, sEVs were precipitated with CD63, CD81, or CD9 capture antibodies, which allows for the isolation of exosomes specifically, and stained with a VZV polyclonal antibody using the Exo View R200 instrument. A significant co-localization of VZV antibodies within the CD9-positive sEV subpopulation in VZV sEVs but not mock sEVs (FIG. 9B; n=3) was observed; colocalization staining for CD63 and CD81 with VZV was not within the limit of detection. In general, no difference in the distribution of CD63, CD81, or CD9 subpopulations were detected between groups. (FIG. 9A; n=3). It is noted that this method only captures sEVs expressing CD63, CD81, or CD9, which are between 50-200 nm, thus, the presence of VZV IE62 on other sEV subpopulations is possible.

[0087] Vimentin (VIM) was significantly enriched in the VZV sEVs compared to mock sEVs (FIG. 4C), which is a negative regulator of the type 1 interferon response upon viral infection. Integrin beta 1 (ITGB1) and heat shock protein family A (Hsp70) member 1 like (HSPA1L), were only detected in VZV sEVs. These are of biological significance given ITGB1 is involved in viral entry and HSPA1L facilitates viral replication. Additional representative proteins observed at elevated levels in VZV sEVs compared to mock sEVs included glyceraldhyde-3 -phosphate dehydrogenase (GAPDH), pyruvate kinase Ml / 2 (PKM), phosphoglycerate kinase 1 (PGK1), and Talin 1 (TLN1) (FIG. 4C, lower panel). Conversely, aldehyde dehydrogenase 1 family member A3 (ALDH1A3) was detected at higher concentrations in mock sEVs compared to VZV sEVs. Notably, ALDH1A3 is involved in the apoptotic process and is downregulated in human papillomavirus-infected, malignant cervical keratinocytes.

[0088] Protein-protein interaction (PPI) potential of VZV sEV enriched proteins was investigated using a list of experimentally supported interactions obtained from the STRING database. VZV sEV enriched proteins form a network of interconnected interactions (FIG. 8B), indicating potential functional associations within the sEV cargo. Pathway enrichment analysis was performed to gain insights into the biological processes associated with proteins enriched in VZV sEVs using the STRING vl l database. This analysis identified viral, immune and vascular disease associated pathways as being significantly enriched, including viral mRNA translation, immune response, transient ischemic attack, stroke, and blood coagulation (FIG. 4D). Together, these findings suggest that the proteins present in VZV sEVs play important roles in viral replication, vascular disease, and host immune responses.2.C.6, VZV IE62 is sufficient to suppress the innate antiviral response.

[0089] A previous report has shown transfection of VZV IE62 into human embryonic lung fibroblasts can suppress the type 1 interferon response. Given VZV IE62 was the only VZV protein detected in the VZV sEVs, this may reflect an immune evasion strategy utilized by VZV. To validate this previous report and to test whether VZV IE62 alone can recapitulate transcriptional changes detected by bulk RNAseq, HBVAFs were transfected with either a plasmid containing open-reading frame 62 (pORF62) or control (pCINeo). HBVAFs transfected with pORF62 had detectable VZV ORF62 transcripts by 24hrs; no VZV ORF62 was detected in pCINeo transfected HBVAFs (FIG. 4E). At 24 hours post-transfection, the following results were measured: a significant decrease in IFIT1 and IFIT2 expression (multiple unpaired t-tests, Holm-Sidak multiple comparison correction), critical interferon- stimulated genes in the IFNP antiviral pathway, similar to the bulk RNA-seq data obtained from VZV sEV exposed HBVAFs and consistent with the previous report on VZV IE62’s function in the type 1 interferon response (FIG. 4F). No differences in IRF3 expression were detected (FIG. 4F). Secreted IFNP was also significantly lower at 24 hours post-transfection of pORF62 compared to pCINeo (FIG. 4G). While it does not exclude other components of VZV sEVs that may have similar actions, these results suggest that VZV IE62 is sufficient to recapitulate the transcriptional and functional findings following VZV sEV exposure to HBVAFs.2.C.7 , VZV sEVs suppress macrophages in the mouse olfactory epithelium and promote central nervous system invasion of a secondary infection.

[0090] To test whether VZV sEVs suppress the immune response in vivo and potentially promote a more severe secondary infection and / or neuroinvasion, C57 / BL6 mice were intranasally inoculated with vehicle (PBS), mock sEVs or VZV sEVs followed by intranasal inoculation of herpes simplex virus type-1 (HSV-1; McKrae strain, 10e5; FIG. 5). Herpesvirus infection canonically infects the oral and nasal mucosa, where it infects the trigeminal ganglia (TG). The olfactory epithelium (OE) contains olfactory sensory neurons that synapse onto neurons in the olfactory bulb (OB) in the central nervous system (CNS), which, is also innervated by the TG. The OE, while it provides a direct route of pathogen entry to the CNS, is thought to have a robust immune response, mediated largely by resident macrophages, given its vulnerable nexus to the CNS. Histological analysis revealed similar spread of HSV-1 antigen in the OE between all three pre-treatment groups (magenta, FIG. 5A). Further, examination of resident macrophages (IB Al, FIG. 5 A) was similar between vehicle and mock sEV treated animals. However, VZV sEV pretreatment showed a substantial decrease in IBA1 staining (FIG. 5A), suggestive of a suppression of OE macrophages; areas, both with andwithout HSV-1 antigen, exhibited a lack of IBA1 staining. To examine if suppression of the OE macrophage population led to an increase in HSV-1 infiltration into the CNS, the presence of HSV-1 in the OB was examined (FIG. 5B). In the vehicle pretreated group, 50% (2 / 4) of OB’s with HSV-1 were observed. However, HSV-1 antigen levels were in small isolated areas (FIG. 5B). In comparison, it was found that 100% (4 / 4) OB’s were infected with HSV-1 in the VZV sEV pretreated group (FIG. 5B). Additionally, the area of HSV-1 antigen was significantly greater in the VZV sEV pretreated group compared to vehicle pretreated group (FIG. 5C; one-way ANOVA, Tukey’s multiple comparison). No HSV-1 invasion in the mock sEV pretreated group were found (0 / 4; FIG. 5B, 5C). A plaque assay of infectious HSV-1 isolated from the TG and total HSV-1 DNA in the TG was not different between groups, confirming successful infection of all groups (FIG. 5D).2.D. Non-limiting Discussion

[0091] The role of sEVs in infectious diseases is becoming increasingly recognized, especially as mediators of the initial stages of infectious pathology. In the study presented herein, the inventors discovered a novel mechanism in which VZV utilizes non-infectious sEVs to suppress the innate antiviral response prior to contact with an infectious virion. This process has likely evolved as an immediate strategy to outpace the host cell’s antiviral defense. While the exact molecular mechanisms mediating this cascade remain to be elucidated, the inventors provide multiple proteins and miRNAs of interest that are likely candidates including a sole VZV protein, IE62. Gaining insights into the initial immune evasion strategies utilized by VZV is vital for understanding the complete spectrum of VZV pathogenesis. Furthermore, enrichment analyses of sEV cargo and transcriptional changes observed in HBVAFs exposed to sEVs revealed diseases and complications known to occur in patients with VZV reactivation suggesting a possible unappreciated role of non-infectious sEVs in secondary VZV disease pathology.

[0092] Consistent with VZV being a cell associated virus in vitro, the sEVs isolated from VZV-infected huSNs, were found to be non-infectious. However, a prior study investigating sEVs from VZV-infected primary human brain vascular adventitial fibroblasts reported transmittable virions. While differences in EV isolation methods and / or specific cell-type production of EVs may contribute to this discrepancy, the data provide evidence of a non- infectious action of VZV-produced sEVs on distal cells. While non-infectious, the study did find a single VZV protein, VZV IE62, present in the sEVs isolated from VZV-infected huSNs. VZV IE62 plays a critical role in early viral replication processes and has been reported to have innate immune evasive properties, specifically inhibiting IRF3 phosphorylation once inside acell. The results expand on this finding by demonstrating that VZV IE62 is packaged within sEVs and released into the extracellular environment. This data provides valuable insight into previously unknown immune evasion mechanisms employed by VZV, even without infectious virions. In addition to VZV IE62, other sEV cargo may be responsible for the IFNP suppression found in this study. Specifically, hsa-mir-146a-5p has been shown to have type 1 interferon suppressing properties that aid in viral infections. The precise molecular mechanism(s) for the observed IFNP suppression following VZV sEV exposure is currently being investigated.

[0093] Aside from antiviral suppression pathways, enrichment analyses of sEV cargo from VZV-infected huSNs and HBVAFs exposed to VZV sEVs revealed other diseases and biological pathways known to occur in patients following zoster. For example, zoster patients have a significantly increased risk of stroke and myocardial infarctions, which can last up to a year following rash. The inventors recently found that sEVs extracted from acute zoster patients’ plasma are prothrombotic and have the capacity to activate platelets ex vivo, providing a biological mechanism for this epidemiologically observed vascular risk independent of a lytic infection of the arteries. The origin of these pathogenic sEVs is currently unknown. However, in the current study, the inventors discovered similar pathways enriched by the sEV protein cargo including platelet aggregation and stroke. It may be important to determine the origins of circulating, pathogenic sEVs in zoster plasma and whether they are from ganglionic sensory neurons. A major hurdle in assigning a causative role of VZV to some of the diseases / complications is the absence of detectable virus in diseased tissues. However, this study provides a potential explanation for this disconnect by showing robust transcriptional and phenotypical changes in naive cells exposed to non-infectious VZV sEVs. One question that remains is how long do cells infected with VZV produce pathogenic sEVs. Perhaps intermittent or chronic low-grade sEV release from ganglionic sensory neurons without lytic infection is responsible for the epidemiologically observed diseases following zoster, however, this remains to be tested.

[0094] In addition to the vasculature, sensory neurons residing in the TG also innervate the OE, which provides the first barrier to pathogens entering the OB and CNS. The release of antiviral suppressing sEVs into this region could render the area vulnerable to secondary exogenous pathogens. Indeed, this study provides the first evidence that non-infectious VZV sEVs suppress resident macrophages in the mouse OE, resulting in a hyper-permissible state for a secondary pathogen to enter the OB / CNS. Multiple case reports and studies have described co-reactivation events of VZV and HSV-1, specifically from the TG distribution. This study provides plausible evidence that non-infectious VZV sEVs may play a critical rolein secondary infection persistence and / or vulnerability. Although the precise mechanism mediating the observed immune suppression is unknown, the enrichment of hsa-mir-146a-5p in VZV sEVs is of specific interest given the association of this modulatory and potentially pathogenic miRNA in numerous neurodegenerative and neuroinvasive diseases. This small RNA is packaged in sEVs and has been shown to be induced in numerous neurotropic viral infections. It is postulated that hsa-mir-146a-5p can aid in CNS entry which makes it particularly important given that VZV is a highly neurotropic virus that can cause devastating neurological complications.

[0095] The robust modulatory role of the detected proteins and miRNAs in the VZV sEVs along with the absence of detectable VZV transcripts and infectious virions would result in a clinically difficult causative diagnosis. Given these findings in addition to the inventors’ previous report that VZV sEVs remain pathogenic at least 3 months following zoster rash warrants the reevaluation of VZV pathogenesis as a whole. Specifically, direct infection may not be required to cause VZV associated diseases and the surveillance of diseased tissue for VZV presence may miss the causative association and ultimately antiviral treatment.2.E. Experimental Methods2.E.1, Cells and virus

[0096] Immortalized human dorsal root sensory ganglion cells (huSNs; HD10.6 cell line) were passaged in proliferation media on T75cm2flasks coated with 16.6 pg / mL fibronectin for 15 minutes at 37°C (Millipore; FC010). Proliferation media consisted of Advanced DMEM / F12 (Gibco-Life Tech; 12634-010) and was supplemented with B-27 lx (Gibco-Life Tech), glutaMAX lx (Gibco; 35050061), 10 ng / mL prostaglandin El (Sigma; P5515), penicillin-streptomycin lx, 0.5 pg / mL basic fibroblast growth factor (bFGF) (Stemgent; 03- 0002), and 50 mg / mL geneticin (G418) (Roche; 05727878001). For maturation, flasks were coated with poly-L-ornithine (PLO) (Millipore Sigma; P4957) for one hour followed by laminin (Millipore Sigma; P4957) for three hours at 37°C. Maturation media consisted of Neuralbasal Plus Medium (Gibco; A3582901) and was supplemented with glutaMAX lx (Gibco; A3582801), 50 ng / mL nerve growth factor (NGF) (Shenandoah Biotechnology Inc.; 100-38), 25 ng / mL ciliary neurotrophic factor (CNTF) (PeproTech; 450-13), 25 ng / mL glial cell-derived neurotrophic factor (GDNF) (PeproTech; 450-10), and 25 ng / mL neurotrophin-3 (NT-3) (PeproTech; 450-03), penicillin-streptomycin lx, Img / mL tetracycline (Sigma; T- 7660), and 25mM Forskolin from coleus forskohlii (Sigma; F6886). T75s were seeded at 4 x 10A6 cells in proliferation media and then switched to maturation media the following day. A 50% maturation media change occurred 5 days and 8 days after seeding.

[0097] VZV is a cell-associated virus, therefore a VZV cell lysate was utilized to infect huSNs. VZV-infected fetal human lung fibroblasts with a known titer (or uninfected fibroblasts for mock infections) were lysed with an insulin syringe and applied to mature huSNs at a multiplicity of infection of 0.003 (Gilden Strain, GenBank No. MH379685). After 3 hours, media was removed, and flasks were washed twice with PBS before being replaced with lOmLs of maturation complete media. Supernatant was collected for EV extraction 4 days postinfection as described below. At 4 days post-infection, neurons show a robust infection but no morphological signs of distress.

[0098] Primary human brain vascular adventitial fibroblasts (HBVAF; ScienCell, Carlsbad, CA) were plated in FM growth media (10% p / s, 5% FBS; 8,000 cells / cm2) in a 12- well dish. The next day, cells were changed into quiescent FM media (10% p / s, 0.5% FBS). On the 7th day cells were treated with EVs at 10% well volume (~35ug total sEV protein / well); 50 pL / well of EVs and 450 pL / well of quiescent EV free FM media. At 36 hours post-EV treatment, cells were harvested for RNAseq using the Qiagen RNeasy Plus Mini Kit (Cat no. 74136).

[0099] Vero (ATCC, Virginia, USA) cells for plaque assays were grown in 12-well plates at 2 x 10A5 cells / well using Dulbecco’s Modified Eagle Medium media containing 10% fetal bovine serum, 1% L-glutamine, and 1% penicillin-streptomycin (cDMEM).2.E.2, Small Extracellular Vesicle Extraction and Validation

[0100] At 4 days post infection, 10 mL of supernatant was collected from both VZV and mock infected huSN flasks and flash frozen using liquid nitrogen and stored at -80°C. sEV extraction was performed using ExoQuick-TC Exosome Precipitation Solution (System BioScience; EXOTC50A-1) and the protocol was followed with no modifications. Exosomes were then resuspended in 150 pL of cell specific buffer for downstream application. Particle size and distributions were characterized using the NanoSight NS300 instrument (Malvern Panalytical).2.E.3, Immunofluorescent Antibody Assay (IF A)

[0101] HuSNs and HBVAFs were plated into 24-well p-plates (ibidi GmbH, Martinsried, Germany). Cells were fixed with 4% paraformaldehyde for IFA analysis, as previously described. Cells were permeabilized with 0.1% Triton X (Sigma) followed by blocking reagent 10% normal donkey serum made in phosphate buffer saline (PBS). To confirm the presence of VZV antigen, the following primary antibodies were used: rabbit anti-Tuj l (1 : 1000 dilution; Abeam, Cambridge, Massachusetts); mouse anti-VZV glycoprotein B (gB; 1 :500, Abeam). Secondary antibodies included Alexa Fluor 488 donkey anti-rabbit immunoglobulin G (IgG;Invitrogen, Carlsbad, California), 594 donkey anti-mouse IgG (Invitrogen), at a 1 :500 dilution. After secondary antibody application and phosphate PBS washes, 4’6-diamidino-2- phenylindole (DAPI, Vector Laboratories, Burlingame, California) was added at 1 :500 for 5 mins; wells were washed 3 times in PBS and then stored in 2 mL PBS at 4°C. To visualize sEV uptake in HBVAFs, fresh sEVs were treated with ExoGlow Protein EV labeling kit (System BioSciences) following manufacturer’s instructions. Labeled sEVs were administered to HBVAFs and subsequently fixed with 4% paraformaldehyde 3 hours later. All cells were visualized by confocal microscopy using a 31 Marianas inverted spinning disk on Zeiss Axio observer Z 1 (Oberkochen, Germany) and analyzed using 3i Slidebook 6 software (3i Intelligent Imaging Innovations; Denver, Colorado).2.E.4, Mass Spectrometry and Proteomics

[0102] sEV pellets were analyzed by liquid chromatography with tandem mass spectrometry (MS) by the Mass Spectrometry Proteomics Shared Resource Facility located at the University of Colorado School of Medicine. Exosome pellets were solubilized in 8M urea / O.lM Tris (pH 8.5), and protein concentrations were determined using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific, Waltham, MA) following the manufacturer’s instructions. Equal amount of protein (50 pg) per sample were reduced with 5 mM TCEP (tris(2-carboxyethyl)phosphine) for 20 minutes and alkylated with 50 mM 2-chloro-2- iodacetamide for 15 minutes in the dark, all at room temperature (RT). Samples were diluted with four volumes of 100 mM Tris-HCl (pH 8.5) then digested with sequencing grade trypsin (Promega, Madison, WI) at an enzyme / substrate ratio of 1 :50 overnight at 37°C. Following overnight digestion, formic acid (FA) was added to the samples to a final concentration of 5%, and tryptic peptides were purified with Pierce Cl 8 tips (ThermoFisher Scientific) following the manufacturer’s protocol. Digests were dried in a vacuum centrifuge and resuspended in 0.1% FA. Liquid chromatography mass spectrometry (LC-MS / MS) was performed using an Easy nLC 1200 instrument coupled to a Q-Exactive HF mass spectrometer (both from ThermoFisher Scientific). Tryptic peptides were loaded on a C18 column (100 pM inner diameter x 20 cm) packed in-house with 2.7 pm Cortecs C18 resin and separated at a flow rate of 0.4 pL / minute with solution A (0.1% FA) and solution B (0.1% FA in ACN) and under the following conditions: isocratic at 4% B for 3 minutes, followed by 4%-32% B for 102 minutes, 32%-55% B for 5 minutes, 55%-95% B for 1 minute and isocratic at 95% B for 9 minutes. LC- MS / MS was performed using a data-dependent acquisition (DDA) top 15 method with dynamic exclusion set to 20s. Fragmentation spectra was interpreted using MSFragger-based FragPipe computational platform against the combined UniProtKB / SwissProt human and VZVproteome databases. Reverse decoys and contaminants were included automatically. The precursor mass tolerance and fragment mass tolerance were set to 10 ppm and 0.2 Da, respectively. Cysteine carbamidomethylation was selected as a fixed modification and oxidation of methionine was selected as a variable modification. Two missed tryptic cleavages were allowed, and the protein-level false discovery rate (FDR) was < 1%. Fold-changes of proteins were calculated by comparing zoster spectral intensity values of each protein to control levels. Significant differential expression of identified proteins (DEPs) between mock and VZV sEVs were determined using the two-stage step-up method (Benjamini, Krieger, and Yekutieli) of FDR set at q-value <0.05 using GraphPad Prism (GraphPad, San Diego, CA) statistical software. Filtering required that a DEP is to be detected in all 3 samples of either mock or VZV sEVs. Bioinformatic and enrichment analyses were conducted on enriched VZV sEV proteins using the STRING vl l (http: / / string-db.org) database which implements well- known classification systems such as Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG). Visualization of DEPs for volcano and heatmap plots was conducted using the DEP package in R. Figures were made using GraphPad Prism, R, and BioRender.2.E.5. RNA extraction and RNA-seq

[0103] Total RNA was extracted from HBVAFs treated with mock exosomes or VZV exosomes after 36 hours using the RNeasy Kit (Qiagen), and libraries were generated using Universal Plus mRNA-Seq with a NuQuant kit (NuQuant) following the manufacturer’s guidelines. Samples were sequenced at 80 million paired end total sequencing reads (2x150) per sample using an Illumina NovaSeq 6000 at the Genomics and Microarray Core Facility located on the University of Colorado School of Medicine, Anschutz Medical Campus, Aurora, Colorado.2.E.6, RNA-seq analysis

[0104] Raw RNA-seq reads were assessed for quality, adaptor content, and duplication rates using FastQC version 0.11.9. Alignment of RNA-seq reads to human genome version hg38 / GRCh38 or to the VZV genome (NC_001348.1) was performed by STAR version 2.7.1a. For gene expression analyses, transcript level counts were obtained using Salmon version 0.11.2 in mapping-based mode with default settings, using a reference prepared with GRCh38 genome and GENCODE (v36) annotation files. Notably, no unique reads aligned to the VZV reference genome and no VZV transcripts were detected. Transcript level counts were collapsed into gene level counts with tximport version 1.12.0. Differentially expressed genes (DEGs) were identified using DESeq2 version 1.36.0. Only genes with a minimum FC of ±1, a maximum Benjamini -Hochberg corrected P value of 0.05 were classified as significantDEGs. Correlations of gene counts per sample were assessed using Spearman’s rank correlation algorithm. Heat maps were generated using the pheatmap package version 1.0.12. Gene set enrichment analysis was performed using the genekitr R package ranking genes by fold-change and performing analysis against the C2 canonical pathways genesets from mSigDB.2.E.7, sEV RNA-seq analysis

[0105] sEV RNA was prepared from mock-infected HD 10.6 cells and VZV-infected HD10.6 cells collected at 4 DPI as described herein, using the ExoQuick RNA purification kit (System Biosciences, Palo Alto, CA). Samples were sequenced at >20 million paired end total sequencing reads (2x150) per sample using the Illumina Hi-Seq at System Biosciences. Sequence reads were assessed for quality, adaptor content, and duplication rates using FastQC version 0.11.9. Raw reads were trimmed to remove adapters, then trimmed and filtered based on quality scores using trimmomatic version 0.40. Sequences with lengths >16 nucleotides (nt) were aligned against miRNA from miRBase as well as human GRCh38 and VZV (NC_001348.1) reference genomes with Bowtie (version 1.1.1). The alignment parameters used were: -m 3 -n 1 -f -a —best —strata. Differential gene expression was performed using DESeq2 version 1.36.0.2.E.8, miRNA target analysis

[0106] To perform enrichment analysis on the targets of VZV sEV enriched miRNAs, the inventors retrieved 1,627 unique human target genes with >2 miRNAs interactions with 35 VZV sEV miRNAs from the miRTarBase experimentally validated miRNA target database version 7.0 using the multimiR R package. Gene Over-Representation Enrichment Analysis was performed using the genORA function genekitr R package with the GO Molecular Functions genesets retrieved from the Molecular Signatures Database (MSigDB version 6.016) with the parameters p cutoff = 0.01, q cutoff = 0.01 and the Benjamini -Hochberg for correction method. Similarity between the enriched results was then reduced using the GOsim function using the Resnik method. To visualize the VZV sEV miRNA targets belonging the Reactome Interferon Alpha Beta Signaling pathway, all 71 geneset genes were compared to the full list of 14,244 miRTarBase targets and the miRNA-mRNA network was visualized using the igraph R package. Genes in HBVAFs with reduced expression (padj <0.05) were indicated as downregulated in FIG. 3D.2.E.9, Interferon ELISA

[0107] HBVAFs were treated with vehicle (PBS), mock sEVs, or VZV sEVs for 36 hours followed by treatment of either polyinosinic:polycytidylic acid (poly(I:C); 2.5 pg / mL) orvehicle (EV-free FM media). Supernatant was collected 24 hours post poly(I:C) exposure, flash frozen with liquid nitrogen, and stored at -80°C. Supernatants were analyzed for IFN-P using a human Mesoscale ELISA following the manufacturer’s protocol (Mesoscale; Cat no. K15094K-2).2.E.10, VZV ORF62 transfection and qRT-PCR

[0108] HBVAFs were seeded at 70% confluency and transfected with 100 ng of pCINeo vector without and with VZV ORF62 insert (pORF62) using lipofectamine 2000. At 24 hours post-transfection, total RNA was isolated, reverse transcribed to cDNA, and analyzed by qRT- PCR for transcripts specific to the following: ORF62: (F-CCTTGGAAACCACATGATCGT(SEQ ID NO: 25); R-AGCAGAAGCCTCCTCGACAA (SEQ ID NO: 26)), IFIT1 (F-CCACAAGACAGAATAGCCAGAT (SEQ ID NO: 27); R-GCTCCAGACTATCCTTGACCT (SEQ ID NO: 28)), IFIT2 (F-AGAGGAAGATTTCTGAAGAGTGC (SEQ ID NO: 29); R-CATCAAGTTCCAGGTGAAATGG (SEQ ID NO: 30)), IRF3 (F-ACCAGTACAAGGCCTACT (SEQ ID NO: 31); R-CATAGCAGGAACCAGTTTATTGG (SEQ ID NO: 32)), and GAPDH (F-CACATGGCCTCCAAGGAGTAA (SEQ ID NO: 33); R- TGAGGGTCTCTCTCTTCCTCTTGT (SEQ ID NO: 34)).2.E.11, Exo View analysis of Total and Immunoprecipitated sEVs

[0109] sEVs were analyzed using ExoView microarray human Tetraspanin kits (Unchained labs) with capture antibodies against CD9, CD63, and CD81 and murine IgG control spot. Analysis was performed according to manufacturer’s instructions on an Exoview R200 (Unchained labs). Captured sEVs were lysed and subsequently stained for VZV proteins using a polyclonal rabbit anti-VZV antibody conjugated to Alexa Fluor 555 (Invitrogen, Carlsbad, CA).2,E, 12, Animals

[0110] Adult C57BL / 6 mice were purchased from Jackson Laboratories (Bar Harbor, ME). All animals were housed on a 14-10 light / dark cycle and fed ad libitum diet. All animal care and procedures complied with the Animal Care and Use Committee of the University of Colorado Anschutz Medical Campus.2.E.13, HSV-1 infection and tissue collection[OHl] Male and female C57BL / 6 mice were briefly anesthetized with isoflurane and inoculated with 20 pL of sEVs for three consecutive days. On day 4, mice were inoculated in the same manner with HSV-1 (105plaque-forming units / animal; McKrae strain; GenBank accession number JX142173) before being sacrificed at 5-days post-HSV-1 infection (DPI).

[0112] For tissue harvesting, mice were deeply anesthetized with FatalPlus and intracardiac perfusion was performed with ice-cold PBS IX (~ 20 mL) followed by ice-cold PFA 4% (~ 20 mL). The heads were dissected to harvest the nasal cavity, trigeminal ganglia, and the brain. The samples were post-fixed in 4% PFA for 24-48h at 4°C.

[0113] OB were incubated in sucrose 30% for 24-48h at 4°C. The nasal cavity was incubated in EDTA solution (10% in distilled water, pH 7.4) for up to one week until the bones were soft enough to be sliced. The sample was washed 3 times with PBS IX, incubated in sucrose 20% for 24-48h at 4°C, then embedded in OCT, frozen on dry ice, and stored at -80°C until sectioning. The nasal cavities were cryo-sectioned in the plane of the cribriform plate into 16 pm-thick sections, and sections from specific regions were mounted on Superfrost Plus slides (VWR, West Chester, PA) coated with poly-D-lysine. Whole brains and TG were embedded in OCT and sliced coronally, 45 pm-thick free-floating sections for brains and 16 pm-thick sections mounted on Superfrost Plus slides coated with poly-D-lysine for TG. Slides were stored at -80°C, and brain-free-floating sections were stored at 4°C until use.

[0114] DNA extraction and qRT-PCR. Adjacent sections were scraped and placed into a lysis buffer with proteinase K, and DNA was extracted using the manufacturer’s protocol (Qiagen). Predesigned and validated primers and probes were used for quantitative polymerase chain reaction (qPCR) for HSV-1 (F-TGGTATTGCCCAACACTTTCC (SEQ ID NO: 35); R- GCGCCAGGCACACACAT (SEQ ID NO: 36); Probe: FAM-CGTGTCGCGTGTGGT-BHQ (SEQ ID NO: 37)). Cycling conditions were held for 10 minutes at 95°C, followed by 40 cycles at 95°C for 30 seconds and 60°C for 1 minute.2.E.14, Immunohistochemistry

[0115] For the nasal cavity, frozen slides were allowed to dry at room temperature for 5 min, then heated on a hot plate at 60°C for Ih. Slices were then processed as further described for brain tissue. Brain tissue sections were incubated in heated citrate buffer (sodium citrate, pH 6.0), and then permeabilized with 1% Triton X-100. Brain sections were then blocked in 10% normal donkey serum. Primary antibodies for rabbit polyclonal anti-HSV-1 pan glycoprotein (Dako, 1 :500), goat anti-IBAl (Abeam, 1 :500 dilution), and mouse anti-Tuj l (BioLegend, 1 :500 dilution) were incubated overnight with 0.1% Triton X-100 and 1% normal donkey serum. Sections were incubated in secondary antibodies for two hours. Sections were then counterstained with a nuclear label (DAPI) before being mounted and were cover slipped. The entire anterior-to-posterior axis was sliced and every 6thsection was mounted and stained. A total of 18-20 OE and 12-15 OB sections, representative of the entire tissue, were stained and analyzed. To calculate HSV-1 area, 40x max z-projections were generated around allidentified HSV-1 antigen-positive tissue in the OB. The percent area of HSV-1 was calculated by the area of HSV-1 antigen over the total region imaged. The total region was identified by positive DAPI staining. If multiple HSV-1 antigen-positive areas were identified, then averages were taken across tissue sections.2.E.15, HSV-1 plaque assay

[0116] Mouse TGs were weighed and homogenized followed by three freeze / thaw cycles. Supernatant was used as viral inoculum. Vero cells were inoculated with 100 pL / well of serially diluted supernatant ranging from neat (undiluted inoculum) to 10A-7. Tenfold serial dilutions of the virus inoculant were made using cDMEM. HSV-1 inoculum was incubated for 1 hour at 37°C, then cells were washed twice with lx PBS and an overlay medium of cDMEM and lx carboxymethyl cellulose with 4% PFA and stained with crystal violet. Plaque numbers were quantified for each group.EMBODIMENTS LISTING

[0117] The present disclosure provides, among others, the following embodiments, each of which can be considered as optionally including any alternate embodiments:

[0118] Clause 1. A composition for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the composition comprising: lipid particles formulated with an amino acid sequence comprising one or more of SEQ ID NOs: 1 or 3-24 or an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0119] Clause 1. A composition for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the composition comprising: lipid particles formulated with an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0120] Clause 2. The composition of Clause 1, wherein the amino acid sequence has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0121] Clause 3. The composition of any one of Clauses 1-2, wherein the amino acid sequence is dispersed in the lipid particles, encapsulated within the lipid particles, or a combination thereof.

[0122] Clause 4. The composition of any one of Clauses 1-3, wherein the amino acid sequence and the lipid particles are conjugated through chemical bonds, are conjugated through non-covalent interactions, or a combination thereof.

[0123] Clause 5. The composition of any one of Clauses 1-4, wherein the amino acid sequence is encapsulated within the core of the lipid particles.

[0124] Clause 6. The composition of any one of Clauses 1-5, wherein the lipid particles are configured to: (a) solubilize the amino acid sequence of the composition; (b) serve as a carrier of the amino acid sequence of the composition such that the amino acid sequence may traverse a membrane; (c) provide stability to the amino acid sequence in the extracellular environment; (d) protect the amino acid sequence from various degrading factors present in the extracellular milieu; or (e) combinations thereof.

[0125] Clause 7. The composition of any one of Clauses 1-6, wherein the lipid particles are configured to mimic extracellular vesicles.

[0126] Clause 8. The composition of any one of Clauses 1-7, wherein: (a) the lipid particles comprise anionic lipid particles, cationic lipid particles, non-ionic lipid particles, or combinations thereof; (b) the lipid particles have a size of 1,000 nm or less (such as about 750 nm or less, such as from about 10 nm to about 500 nm, such as from about 20 nm to about 350 nm, such as from about 30 nm to about 200 nm, or from about 10 nm to about 1,000 nm, such as from about 50 nm to about 1,000 nm, such as from about 200 nm to about 750, such as from about 400 nm to about 600 nm; or (c) combinations thereof.

[0127] Clause 9. The composition of any one of Clauses 1-8, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0128] Clause 10. The composition of any one of Clauses 1-9, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain-Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

[0129] Clause 11. The composition of any one of Clauses 1-10, wherein the composition suppresses demyelination of a neuron.

[0130] Clause 12. The composition of any one of Clauses 1-11, wherein the composition suppresses neuroinflammation.

[0131] Clause 13. A combination therapy for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the combination therapy comprising: thecomposition of any one of Clauses 1-12; and a material that repairs, stimulates, or induces myelination of a neuron.

[0132] Clause 14. The combination therapy of Clause 14, wherein the composition suppresses neuroinflammation.

[0133] Clause 15. The combination therapy of any one of Clauses 13-14, wherein the material that repairs, stimulates, or induces myelination of a neuron comprises a pharmaceutical.

[0134] Clause 16. The combination therapy of any one of Clauses 13-15, wherein the material that repairs, stimulates, or induces myelination of a neuron comprises teriflunomide, clemastine, clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

[0135] Clause 17. The combination therapy of any one of Clauses 13-16, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0136] Clause 18. The combination therapy of any one of Clauses 13-17, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain- Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

[0137] Clause 19. A kit for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the kit comprising: the composition of any one of Clauses 1-12; and a material that repairs, stimulates, or induces myelination of a neuron.

[0138] Clause 20. The kit of Clause 19, wherein the composition suppresses neuroinflammation.

[0139] Clause 21. The kit of any one of Clauses 19-20, wherein the material that repairs, stimulates, or induces myelination of a neuron comprises a pharmaceutical.

[0140] Clause 22. The kit of any one of Clauses 19-21, wherein the material that repairs, stimulates, or induces myelination of a neuron comprises teriflunomide, clemastine, clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

[0141] Clause 23. The kit of any one of Clauses 19-22, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0142] Clause 24. The kit of any one of Clauses 19-23, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain-Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

[0143] Clause 25. The use of the composition of any one of Clauses 1-12, the combination therapy of any one of Clauses 8-13, or the kit of any one of Clauses 14-19 to suppress demyelination of a neuron in a patient, to aid in the remyelination of a neuron in a patient, to suppress neuroinflammation in a patient, or combinations thereof.

[0144] Clause 26. The use of the composition of any one of Clauses 1-12, the combination therapy of any one of Clauses 13-18, or the kit of any one of Clauses 19-24 to treat, alleviate, or reduce the severity of a demyelinating disease or condition or an autoimmune disease or condition in a patient.

[0145] Clause 27. A method of suppressing demyelination of a neuron in a patient, the method comprising: administering to the patient the composition of any one of Clauses 1-12, the combination therapy of any one of Clauses 13-18, or the kit of any one of Clauses 19-24.

[0146] Clause 28. A method of treating, alleviating, or reducing the severity of a demyelinating disease or condition or an autoimmune disease or condition in a patient, the method comprising: administering to the patient the composition of any one of Clauses 1-12, the combination therapy of any one of Clauses 13-18, or the kit of any one of Clauses 19-24.

[0147] Clause 29. The method of Clause 28, wherein the administering to the patient the combination therapy or the kit comprises: (a) administering to the patient the composition of any one of Clauses 1-12; and (b) administering to the patient the material that repairs, stimulates, or induces myelination of a neuron.

[0148] Clause 30. The method of Clause 29, wherein (a) is performed prior to, during, and / or after (b).

[0149] Clause 31. A composition for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the composition comprising: a lipid particle; and anamino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0150] Clause 32. The composition of Clause 31, wherein: the amino acid sequence is dispersed in the lipid particle; the amino acid sequence is encapsulated within the lipid particle, or a combination thereof; the amino acid sequence and the lipid particle are conjugated through one or more chemical bonds; the amino acid sequence and the lipid particle are conjugated through non-covalent interactions; or combinations thereof.

[0151] Clause 33. The composition of any one of Clauses 31-32, wherein the lipid particle mimics or is configured to mimic an extracellular vesicle.

[0152] Clause 34. The composition of Clauses 31-33, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0153] Clause 35. The composition of any one of Clauses 31-34, wherein: the lipid particles comprise anionic lipid particles, cationic lipid particles, non-ionic lipid particles, or combinations thereof; the lipid particles have a size of 1,000 nm or less; or combinations thereof.

[0154] Clause 36. The composition of any one of Clauses 31-35, wherein the lipid particles have a size from about 10 nm to about 500 nm.

[0155] Clause 37. The composition of any one of Clauses 31-36, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0156] Clause 38. The composition of any one of Clauses 31-37, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain-Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

[0157] Clause 39. The composition of any one of Clauses 31-38, wherein: the composition suppresses demyelination of a neuron in the patient; the composition suppresses neuroinflammation in the patient; or a combination thereof.

[0158] Clause 40. A combination therapy for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the combination therapy comprising: (a) a composition comprising: a lipid particle; and an amino acid sequence having at least 50%sequence identity to one or more of SEQ ID NOs: 1 or 3-24; and (b) a material that repairs, stimulates, or induces myelination of a neuron.

[0159] Clause 41. The combination therapy of Clause 40, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0160] Clause 42. The combination therapy of any one of Clauses 40-41, wherein the material that repairs, stimulates, or induces myelination of the neuron comprises teriflunomide, clemastine, clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

[0161] Clause 43. The combination therapy of any one of Clauses 40-42, wherein: the amino acid sequence is dispersed in the lipid particle; the amino acid sequence is encapsulated within the lipid particle, or a combination thereof; the amino acid sequence and the lipid particle are conjugated through one or more chemical bonds; the amino acid sequence and the lipid particle are conjugated through non-covalent interactions; or combinations thereof.

[0162] Clause 44. The combination therapy of any one of Clauses 40-43, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0163] Clause 45. The combination therapy of any one of Clauses 40-44, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain- Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

[0164] Clause 46. A kit for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the kit comprising: (a) a first component comprising a composition, the composition comprising: a lipid particle; and an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24; and (b) a second component, the second component comprising a material that repairs, stimulates, or induces myelination of a neuron.

[0165] Clause 47. The kit of Clause 46, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

[0166] Clause 48. The kit of any one of Clauses 46-47, wherein the material that repairs, stimulates, or induces myelination of the neuron comprises teriflunomide, clemastine,clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

[0167] Clause 49. The kit of any one of Clauses 46-48, wherein: the composition suppresses demyelination of a neuron in the patient; the composition suppresses neuroinflammation in the patient; or a combination thereof.

[0168] Clause 50. The kit of any one of Clauses 46-49, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

[0169] As is apparent from the foregoing general description and the specific embodiments, while forms of the embodiments have been illustrated and described, various modifications can be made without departing from the spirit and scope of the present disclosure. Accordingly, it is not intended that the present disclosure be limited thereby. Likewise, the term “comprising” is considered synonymous with the term “including.” Likewise whenever a composition, an element or a group of elements is preceded with the transitional phrase “comprising,” it is understood that we also contemplate the same composition or group of elements with transitional phrases “consisting essentially of,” “consisting of,” “selected from the group of consisting of,” or “Is” preceding the recitation of the composition, element, or elements and vice versa, such as the terms “comprising,” “consisting essentially of,” “consisting of’ also include the product of the combinations of elements listed after the term.

[0170] For purposes of this present disclosure, and unless otherwise specified, all numerical values within the detailed description and the claims herein are modified by “about” or “approximately” the indicated value, and consider experimental error and variations that would be expected by a person having ordinary skill in the art. For the sake of brevity, only certain ranges are explicitly disclosed herein. However, ranges from any lower limit may be combined with any upper limit to recite a range not explicitly recited, as well as, ranges from any lower limit may be combined with any other lower limit to recite a range not explicitly recited, in the same way, ranges from any upper limit may be combined with any other upper limit to recite a range not explicitly recited. For example, the recitation of the numerical range 1 to 5 includes the subranges 1 to 4, 1.5 to 4.5, 1 to 2, among other subranges. As another example, the recitation of the numerical ranges 1 to 5, such as 2 to 4, includes the subranges 1 to 4 and 2 to 5, among other subranges. Additionally, within a range includes every point or individual value between its end points even though not explicitly recited. For example, the recitation of the numerical range 1 to 5 includes the numbers 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, amongother numbers. Thus, every point or individual value may serve as its own lower or upper limit combined with any other point or individual value or any other lower or upper limit, to recite a range not explicitly recited.

[0171] As used herein, the indefinite article “a” or “an” shall mean “at least one” unless specified to the contrary or the context clearly indicates otherwise. For example, embodiments comprising “a sequence” includes embodiments comprising one, two, or more sequences, unless specified to the contrary or the context clearly indicates only one sequence is included.

[0172] All patents, patent applications, patent publications, scientific articles and the like, cited or identified in this application are hereby incorporated by reference in their entirety in order to describe more fully the state of the art to which the present application pertains.

[0173] While the foregoing is directed to embodiments of the present disclosure, other and further embodiments of the disclosure may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.

Claims

CLAIMSWhat is claimed is:

1. A composition for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the composition comprising: a lipid particle; and an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

2. The composition of claim 1, wherein: the amino acid sequence is dispersed in the lipid particle; the amino acid sequence is encapsulated within the lipid particle, or a combination thereof; the amino acid sequence and the lipid particle are conjugated through one or more chemical bonds; the amino acid sequence and the lipid particle are conjugated through non-covalent interactions; or combinations thereof.

3. The composition of claim 1, wherein the lipid particle mimics or is configured to mimic an extracellular vesicle.

4. The composition of claim 1, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

5. The composition of claim 1, wherein: the lipid particles comprise anionic lipid particles, cationic lipid particles, non-ionic lipid particles, or combinations thereof; the lipid particles have a size of 1,000 nm or less; or combinations thereof.

6. The composition of claim 1, wherein the lipid particles have a size from about 10 nm to about 500 nm.

7. The composition of claim 1, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

8. The composition of claim 1, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain-Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

9. The composition of claim 1, wherein: the composition suppresses demyelination of a neuron in the patient; the composition suppresses neuroinflammation in the patient; or a combination thereof.

10. A combination therapy for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the combination therapy comprising: a composition comprising: a lipid particle; and an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24; and a material that repairs, stimulates, or induces myelination of a neuron.

11. The combination therapy of claim 10, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

12. The combination therapy of claim 10, wherein the material that repairs, stimulates, or induces myelination of the neuron comprises teriflunomide, clemastine, clobetasol, metformin, methotrexate, infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

13. The combination therapy of claim 10, wherein: the amino acid sequence is dispersed in the lipid particle;the amino acid sequence is encapsulated within the lipid particle, or a combination thereof; the amino acid sequence and the lipid particle are conjugated through one or more chemical bonds; the amino acid sequence and the lipid particle are conjugated through non-covalent interactions; or combinations thereof.

14. The combination therapy of claim 10, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

15. The combination therapy of claim 10, wherein the disease or medical condition comprises neuromyelitis optica, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, ulcerative colitis, dementia, neurodegeneration, neuromyelitis optica spectrum disorder, transverse myelitis, leukodystrophy, acute disseminated encephalomyelitis, central pontine myelinolysis, Guillain-Barre Syndrome, Charcot-Marie-Tooth disease, chronic inflammatory demyelinating polyneuropathy, or combinations thereof.

16. A kit for treatment, alleviation, or reducing the severity of a disease or medical condition in a patient, the kit comprising: a first component comprising a composition, the composition comprising: a lipid particle; and an amino acid sequence having at least 50% sequence identity to one or more of SEQ ID NOs: 1 or 3-24; and a second component, the second component comprising a material that repairs, stimulates, or induces myelination of a neuron.

17. The kit of claim 16, wherein the amino acid sequence has at least 85% sequence identity to one or more of SEQ ID NOs: 1 or 3-24.

18. The kit of claim 16, wherein the material that repairs, stimulates, or induces myelination of the neuron comprises teriflunomide, clemastine, clobetasol, metformin, methotrexate,infliximab, tocilizumab, plasma exchange, intravenous immunoglobulin, or combinations thereof.

19. The kit of claim 16, wherein: the composition suppresses demyelination of a neuron in the patient; the composition suppresses neuroinflammation in the patient; or a combination thereof.

20. The kit of claim 16, wherein the disease or medical condition comprises a demyelinating disease or condition, an autoimmune disease or condition, or combinations thereof.

Images