Orally administered Anti-inflammatory low-molecular-weight compound for treating inflammatory bowel disease, and use thereof

A low-molecular-weight compound targeting HMGB1 addresses the limitations of existing treatments by directly binding to HMGB1, effectively suppressing inflammatory responses and inducing mucosal healing in inflammatory bowel disease.

WO2026049548A1PCT designated stage Publication Date: 2026-03-05INDUSTRY UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/013257
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-30
Filing Date
2025-08-29
Publication Date
2026-03-05

Smart Images

  • Figure KR2025013257_05032026_PF_FP_ABST
    Figure KR2025013257_05032026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to an orally administered anti-inflammatory low-molecular-weight compound for treating inflammatory bowel disease, and use thereof. More specifically, the low-molecular-weight compound of the present invention can inhibit the activation of immune cells mediated using RAGE and TLR by targeting HMGB1 and directly binding thereto, and thus can inhibit the expression or secretion of inflammatory cytokines, enzymes and the like from immune cells, acts effectively even with respect to HMGB1 non-mediated inflammatory responses, effectively inhibits inflammatory responses in intestinal tissues when orally administered to inflammatory bowel disease animal models, and induces the regeneration of the intestinal mucosal layer by alleviating inflammatory responses, thereby being used the prevention or treatment of inflammatory bowel disease.
Need to check novelty before this filing date? Find Prior Art

Description

Oral anti-inflammatory small molecule compounds for the treatment of inflammatory bowel disease and their uses

[0001] The present invention relates to an oral anti-inflammatory small molecule compound for treating inflammatory bowel disease and its use.

[0002] Inflammatory bowel disease is a disease in which the intestinal environment is changed due to various causes, causing continuous damage to the intestinal barrier and a persistent immune inflammatory response. In the initial or relapsed stage of the inflammatory response, DAMPs (Damage-associated molecular pattern) substances such as high mobility group box 1 (HMGB1) are released, which triggers the activation of immune cells. That is, HMGB1 molecules can initiate an inflammatory response by forming a complex with the receptor for advanced glycation endproduct (RAGE) and lipopolysaccharide (LPS) present on immune cells, and then binding to Toll-like receptors (TLRs). Subsequently, the inflammatory response is amplified through the activation and recruitment of immune cells in the lamina propria, a thin layer of intestinal connective tissue, due to destruction of intestinal epithelial cells and increased intestinal permeability.

[0003] Currently, representative medications for the treatment of inflammatory bowel disease include salicylates, steroids, immunosuppressants, and biological agents (primarily antibody-based drugs). The majority of clinically used inflammatory bowel disease treatments are small-molecule compounds (mesalamine, 93% for ulcerative colitis) and antibody-based drugs (Crohn's disease, 36%).

[0004] 5-ASA (5-Aminosalicylic Acid; mesalamine), a low-molecular-weight salicylic acid drug, has an unknown mechanism of action, but it is thought to regulate the inflammatory response of the cyclic oxygenase (COX) and lipooxygenase (LOX) pathways, thereby reducing the synthesis of prostaglandins and leukotrienes. However, the overall response rate (ORR) of mesalamine is less than 60%, resulting in a high proportion of non-responsive patients. In addition, patients often fail to maintain remission despite mesalamine prescriptions, leading to complications such as strictures and fistulas.

[0005] Antibody drugs, which are biological agents, are mainly used to treat inflammatory bowel disease by targeting major cytokine factors that act in the immune response, such as TNF-α (Humira, Remicade, Simponi, etc.), interleukins (Stelara, Zenzalz, Rinvoq, etc.), and α4β7 integrin (Entyvio). Among these, JAK inhibitors (Zenzalz, Rinvoq) related to interleukins were recently confirmed by the FDA to cause serious side effects such as heart disease, cancer, and thrombosis. In addition, because antibody drugs have high binding affinity to antigens, they can cause side effects such as infections and cell cancer induced by immunosuppression. In addition, the drug non-response rate is as high as 10-40%, and the secondary loss of response (LOR; the rate of symptoms recurring or worsening due to a decrease in the effect during treatment) is high at 20-40% after one year of treatment. This is primarily due to the production of anti-drug antibodies (ADAs). Furthermore, antibody drugs are significantly more expensive than conventional synthetic drugs, making them difficult to obtain in patients with inflammatory bowel disease due to the barrier to access.

[0006] Steroid-based treatments, which are commonly prescribed for both ulcerative colitis and Crohn's disease (ulcerative colitis: 18%, Crohn's disease: 25%), have the side effect of worsening symptoms with long-term use. This is because most patients with inflammatory bowel disease are chronic or frequently relapse, and when steroid medications are used long-term, the inflammatory response that had been suppressed worsens the moment the medication is discontinued, resulting in a phenomenon called "steroid rebound." For this reason, in clinical practice, steroid preparations are rarely prescribed or long-term use is avoided whenever possible.

[0007] Therefore, there is a need for a treatment for inflammatory bowel disease that can be used before choosing antibody drugs that are expensive and have side effects, and at the same time, there is an urgent need to develop a treatment that can overcome the shortcomings of steroid drugs.

[0008] The purpose of the present invention is to provide an oral low-molecular-weight compound that can overcome the limitations of conventional inflammatory bowel disease treatment agents.

[0009] Another object of the present invention is to provide a therapeutic use of the low molecular weight compound for inflammatory bowel disease.

[0010] To achieve the above purpose, the present invention provides a compound of the following chemical formula 1:

[0011] [Chemical Formula 1]

[0012]

[0013] Here,

[0014] R1 is hydroxyl or And,

[0015] R2 and R3 are each independently hydrogen, hydroxyl or carboxyl,

[0016] X represents a carbon or nitrogen atom.

[0017] The present invention also provides a composition for preventing or treating inflammatory bowel disease comprising the compound.

[0018] The present invention also provides a method for treating inflammatory bowel disease, comprising administering a therapeutically effective amount of the compound to a subject in need thereof.

[0019] The low molecular weight compound of the present invention has the following effects.

[0020] First, it can suppress the activation of immune cells mediated by RAGE and TLR by directly binding to HMGB1, and second, it can suppress the expression or secretion of inflammatory cytokines and enzymes (TNF-α, IL-1β, IL-6, COX-2) from immune cells accordingly. In particular, it can effectively suppress the expression and secretion of IL-6 cytokine, showing that it works effectively in HMGB1-non-mediated inflammatory responses. Third, when orally administered to an inflammatory bowel disease animal model (DSS-induced colitis), it effectively suppresses the inflammatory response of intestinal tissue, and fourth, it induces mucosal healing by alleviating the inflammatory response.

[0021] Figure 1 shows the structure of the target protein, HMGB1.

[0022] Figure 2 shows the results of alleviating HMGB1-dependent inflammatory factor expression in immune cells by the small molecule compound of the present invention.

[0023] Figure 3 shows the concentration-dependent results of the small molecule compound #61-ortho on the inhibitory effect on HMGB1-dependent inflammatory factor expression.

[0024] Figure 4 shows the effect of low molecular weight compound #61-ortho on HMGB1 stimulation-induced inflammatory factor secretion.

[0025] Figure 5 shows the results of observing the morphology of HMGB1-stimulated immune cells according to the concentration of low-molecular-weight compound #61-ortho treatment (magnification 100x).

[0026] Figure 6 shows a graph analyzing the effect of low molecular weight compound #61-ortho on alleviating the expression of inflammatory factors induced by LPS stimulation.

[0027] Figure 7 shows the cell morphology according to the concentration of low-molecular compound #61-ortho treatment in LPS-stimulated immune cells (magnification 100x).

[0028] Figure 8 shows the effect of low-molecular-weight compound #61-ortho on alleviating HMGB1 / LPS-dependent inflammatory factor expression.

[0029] Figure 9 shows the results of the toxicity evaluation of low-molecular-weight compound #61-ortho on immune cells.

[0030] Figure 10 is a photograph showing the morphology of immune cells following treatment with low-molecular compound #61-ortho (magnification 100x).

[0031] Figure 11 shows the results of the toxicity evaluation of low-molecular-weight compound #61-ortho against intestinal epithelial cells.

[0032] Figure 12 illustrates the establishment of an ulcerative colitis animal model through DSS-negative and the drug administration plan.

[0033] Figure 13 shows the change in body weight of an ulcerative colitis animal model according to oral administration of each drug group.

[0034] Figure 14 shows the results comparing the colon length and spleen weight after oral administration of the drug to each group for 5 days.

[0035] Figure 15 shows a histopathological staining photograph of the colon region in an animal model of ulcerative colitis.

[0036] Figure 16 compares the regenerative effect through immunostaining of intestinal tissue in an animal model of ulcerative colitis.

[0037] Figure 17 compares the effect of maintaining tight junctions through immunostaining of intestinal tissue in an animal model of ulcerative colitis.

[0038] Figure 18 shows a fluorescence image showing whether 61-ortho is absorbed into cells.

[0039] Figure 19 shows fluorescence images showing the intracellular dose-dependent uptake characteristics of 61-ortho.

[0040] Figure 20 shows the gene expression regulatory effect of 61-ortho under HMGB1 and LPS stimulation conditions through NGS (KEGG) analysis.

[0041] Figures 21a and 21b show the gene expression regulatory effect of 61-ortho under HMGB1 and LPS stimulation conditions through NGS (Volcano plot) analysis (a: HMGB1+61-ortho vs HMGB1, b: LPS+61-ortho vs LPS).

[0042] Figure 22 shows the body weight change caused by 61-ortho in a DSS-induced chronic colitis mouse model.

[0043] Figure 23 shows the DAI score by 61-ortho in a DSS-induced chronic colitis mouse model.

[0044] Figure 24 shows the change in colon length by 61-ortho in a DSS-induced chronic colitis mouse model.

[0045] Figure 25 shows the change in spleen weight by 61-ortho in a DSS-induced chronic colitis mouse model.

[0046] Figure 26 shows the results of confirming dextran permeability by 61-ortho in a DSS-induced chronic colitis mouse model.

[0047] Figure 27 shows changes in LGR5 and Bmi1 expression by 61-ortho in a DSS-induced chronic colitis mouse model.

[0048] Figure 28 shows the results of histopathological analysis by 61-ortho in a DSS-induced chronic colitis mouse model.

[0049] Figure 29 shows changes in IL-6, TNF-α, and iNOS expression by 61-ortho in non-polarized human-derived immune cells.

[0050] Figure 30 shows the effect of 61-ortho on LPS (10 pg / mL)-induced inflammation in non-polarized human-derived immune cells.

[0051] Figure 31 shows the effect of 61-ortho on LPS (100 pg / mL)-induced inflammation in non-polarized human-derived immune cells.

[0052] Figure 32 shows changes in IL-6, TNF-α, and iNOS expression by 61-ortho in activated human-derived immune cells.

[0053] Figure 33 shows the effect of 61-ortho on LPS (10 pg / mL)-induced inflammation in activated human-derived immune cells.

[0054] Figure 34 shows the effect of 61-ortho on LPS (100 pg / mL)-induced inflammation in activated human-derived immune cells.

[0055] Figure 35 shows the results of cytotoxicity evaluation of 61-ortho in human-derived immune cells (THP-1 MO cells).

[0056] Figure 36 shows the results of cytotoxicity evaluation of 61-ortho in human-derived immune cells (THP-1 MO cells).

[0057] Figure 37 shows the results of cytotoxicity evaluation of 61-ortho in human-derived immune cells (THP-1 M1 cells).

[0058] Figure 38 shows the results of cytotoxicity evaluation of 61-ortho in human-derived immune cells (THP-1 M1 cells).

[0059] Hereinafter, the configuration of the present invention will be described in detail.

[0060] The present inventors, noting that HMGB1 is released in the initial or relapsed stage of an inflammatory response, triggering the activation of immune cells, sought to develop a low-molecular-weight compound that can inhibit the expression of inflammatory factors such as TNF-α, IL-1β, IL-6, COX-2, CXCL2, and iNOS by directly binding to HMGB1 and alleviating the activation of immune cells in the early stage.

[0061] To this end, the inventors of the present invention constructed a library of small molecule compounds predicted to have binding affinity for the target protein HMGB1 based on the chemical structures of glycyrrhizin, which is known to have anti-inflammatory effects, and mesalamine, a drug for treating inflammatory bowel disease.

[0062] The binding affinity of compounds in the above low-molecular compound library to HMGB1 was evaluated using molecular docking simulation, and compounds that were shown to have excellent binding affinity to HMGB1 were synthesized and their anti-inflammatory effects were evaluated to ultimately derive the compound of the following chemical formula 1.

[0063] The present invention provides a compound of the following chemical formula 1:

[0064] [Chemical Formula 1]

[0065]

[0066] Here,

[0067] R1 is hydroxyl or And,

[0068] R2 and R3 are each independently hydrogen, hydroxyl or carboxyl,

[0069] X represents a carbon or nitrogen atom.

[0070] Specifically, the compound of the above chemical formula 1,

[0071] If X is a carbon atom, R1 is hydroxyl or , and R2 and R3 can each independently be hydrogen, hydroxyl or carboxyl.

[0072] More specifically, the compound of the above chemical formula 1 is

[0073] If X is a carbon atom, R1 is hydroxyl or , and at least one of R2 and R3 may be carboxyl.

[0074] More specifically, the compound of the above chemical formula 1 is

[0075] When X is a nitrogen atom, R1 may be hydroxyl, and at least one of R2 and R3 may be carboxyl.

[0076] Most specifically, the compound of formula 1 may be any one of the compounds of formulae 1a to 1g below:

[0077] [Chemical Formula 1a]

[0078]

[0079] [Chemical Formula 1b]

[0080]

[0081] [Chemical Formula 1c]

[0082]

[0083] [Chemical Formula 1d]

[0084]

[0085] [Chemical Formula 1e]

[0086]

[0087] [Chemical formula 1f]

[0088]

[0089] [Chemical formula 1g]

[0090]

[0091] The target protein HMGB1 is composed of three domains, and the tertiary structure of the protein is as shown in Figure 1. Mesalamine, a treatment for inflammatory bowel disease currently used clinically, has no binding affinity for HMGB1. Glycyrrhizin is known to have a binding affinity of about 170 μM for the A box of HMGB1 and about 87 μM for the B box of HMGB1. According to the following examples of the present invention, the binding affinity of glycyrrhizin to HMGB1 in its complete structure was measured as a result of K D A significant binding affinity value could not be measured as the value was measured to be over 200. On the other hand, the low molecular weight compound of the present invention directly binds to HMGB1.

[0092] The low molecular weight compound of the present invention exhibits the following effects.

[0093] First, the HMGB1 neutralization effect - HMGB1 is a transcription factor protein that exists in the cell nucleus and stabilizes DNA like histone proteins, with a molecular weight of 25 kDa. When a living cell is damaged (damage, necrosis), the HMGB1 protein is passively released from the cell and binds to the PRR (pattern recognition receptor) receptors of immune cells, such as TLR-2 / 4 and RAGE, to promote HMGB1-dependent cytokine secretion. In addition, when HMGB1 binds to the receptor of TLR-4 of immune cells (e.g., macrophages, monocytes, dendritic cells, etc.), it sustains the ADP-ribosylation of HMGB1 by the PARP1 enzyme, inducing the active secretion of a large amount of HMGB1, acting as an inflammatory amplification loop. In addition, it is known that HMGB1 interacts with TLR-4 of neutriphils to stimulate the production of reactive oxygen species by NADPH oxidase, forms an HMGB1-LPS complex to activate TLR-4, and induces the binding of adapter proteins (such as MyD88) to activate signal transduction, thereby activating MAPK and NF-kB to induce the production of inflammatory molecules such as cytokines.

[0094] The low-molecular-weight compound of the present invention can directly bind to HMGB1 to initially alleviate the activation of immune cells and suppress the expression / secretion of inflammatory cytokines and enzymes (TNF-α, IL-1β, IL-6, COX-2, CXCL2, iNOS, etc.).

[0095] In addition, the low-molecular-weight compound of the present invention can suppress the expression / secretion of HMGB1-independent cytokines of activated immune cells that do not have HMGB1. This may be because (1) the low-molecular-weight compound binds to HMGB1 expressed / secreted by immune cells activated by LPS to suppress additional inflammatory responses, (2) the low-molecular-weight compound and LPS form a complex to block TLR receptor activation, or (3) the low-molecular-weight compound itself passes into the cytoplasm of immune cells to suppress signaling molecules such as NF-κB. By this mechanism, the low-molecular-weight compound of the present invention has a superior anti-inflammatory effect than mesalamine, a clinically prescribed competitive drug.

[0096] Second, the effect of alleviating inflammatory IL-6 cytokines - IL-6, together with TNF-α and IL-1, induces acute inflammatory responses and the transition from acute inflammation to acquired immunity or chronic inflammatory diseases. In colon tissue, IL-6 cytokines secreted by intestinal epithelial cells, T cells, and macrophages activate T cells, inhibit T cell apoptosis, induce macrophage activation, promote immune cell recruitment, and induce acute-phase proteins (e.g., C-reactive protein) through hepatocyte stimulation, thereby inducing excessive inflammation. Currently, antibodies that inhibit IL-6 include sirukumab, olokizumab, clazakizumab, siltuiximab, and EBI-029, and antibodies that inhibit IL-6R, the receptor to which IL-6 binds, include tocilizumab, sarilumab, NI-1201, and ALX-0061.

[0097] The low-molecular-weight compound of the present invention can alleviate inflammatory responses by directly acting on activated immune cells and effectively suppressing the expression / secretion of IL-6 cytokines in particular.

[0098] Third, the effect of alleviating COX-2 expression - Prostaglandin (1) has the effect of healing mucosal damage by inducing proliferation of epithelial cells, (2) inducing chloride secretion of intestinal epithelial cells, causing diarrhea, (3) causing congestion and edema of the intestinal mucosa by dilating blood vessels, and (4) regulating cytokine synthesis, which is related to the persistence of inflammation. This means that prostaglandin will play various roles in the colonic mucosa. In fact, large amounts of prostaglandin are detected in the mucosal tissue and rectal dialysate of patients with inflammatory bowel disease, and there is a good correlation between the amount of prostaglandin and the activity of the disease.

[0099] The low-molecular-weight compound of the present invention can alleviate inflammatory responses by alleviating the overexpression of COX-2 (Cyclooxygenase-2) in activated immune cells. This can reduce prostaglandins produced by COX-2.

[0100] In summary, first, it can suppress the activation of immune cells mediated by RAGE and TLR by directly binding to HMGB1, and second, it can suppress the expression or secretion of inflammatory cytokines and enzymes (TNF-α, IL-1β, IL-6, COX-2, CXCL2, iNOS, etc.) from immune cells. In particular, it can effectively suppress the expression and secretion of IL-6 cytokine, showing that it works effectively in HMGB1-non-mediated inflammatory responses. Third, it effectively suppresses the inflammatory response of intestinal tissue when administered orally to an inflammatory bowel disease animal model (DSS-induced colitis), and fourth, it induces mucosal healing regeneration by alleviating the inflammatory response.

[0101] Therefore, the low-molecular-weight compound of the present invention is a synthetic drug targeting HMGB1, a novel target acting in the early stage of the inflammatory response. To date, there are no drugs targeting HMGB1 for the treatment of inflammatory bowel disease. Since the HMGB1 molecule has a very high binding affinity (approximately 1-10 nM) to TLR-2 / 4 and RAGE receptors of immune cells, it is possible to effectively suppress / alleviate the lower inflammatory response by enabling early intervention of the inflammatory response through inhibition of the HMGB1 molecule. Therefore, it has very high potential for use as a treatment for inflammatory bowel disease (Crohn's disease and ulcerative colitis) based on a new mechanism.

[0102] Accordingly, the present invention provides a composition for preventing or treating inflammatory bowel disease comprising the low molecular weight compound.

[0103] The inflammatory bowel disease may be either Crohn's disease or ulcerative colitis.

[0104] Additionally, the composition for preventing or treating inflammatory bowel disease of the present invention may be for oral administration.

[0105] The composition for preventing or treating inflammatory bowel disease of the present invention may further include a pharmaceutically acceptable carrier.

[0106] The pharmaceutically acceptable carrier includes carriers and vehicles commonly used in the pharmaceutical field, and specifically includes, but is not limited to, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins (e.g., human serum albumin), buffer substances (e.g., various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (e.g., protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts), colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substrates, polyethylene glycol, sodium carboxymethylcellulose, polyarylates, waxes, polyethylene glycol or wool fat.

[0107] In addition, the composition of the present invention may additionally include a lubricant, a wetting agent, an emulsifier, a suspending agent, or a preservative in addition to the above components.

[0108] In one embodiment, the composition according to the present invention can be prepared as an aqueous solution for parenteral administration, preferably a buffered solution such as Hank's solution, Ringer's solution, or physically buffered saline. Aqueous injection suspensions can be prepared by adding a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran.

[0109] The composition of the present invention can be administered systemically or topically, and can be formulated into a suitable dosage form for such administration using known techniques. For example, for oral administration, it can be mixed with an inert diluent or edible carrier, sealed in a hard or soft gelatin capsule, or pressed into tablet form. For oral administration, the active compound can be mixed with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.

[0110] Various formulations for injection, parenteral administration, etc. can be manufactured and administered according to techniques known or commonly used in the art. For example, the formulation can be formulated as a solution in saline or buffer just prior to administration in a form suitable for intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, or transdermal administration.

[0111] The appropriate dosage of the composition of the present invention can be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity.

[0112] The present invention also relates to a method for treating inflammatory bowel disease, comprising administering a therapeutically effective amount of the low molecular weight compound to a subject in need thereof.

[0113] The subject may be a human or a non-human animal, such as a cow, monkey, bird, cat, mouse, rat, hamster, pig, dog, rabbit, sheep, horse, etc.

[0114] In the present invention, "treatment" refers to any action that suppresses, alleviates, or beneficially alters the clinical condition associated with a disease. Furthermore, treatment may also mean increased survival compared to the expected survival rate in the absence of treatment. Treatment encompasses preventative measures in addition to therapeutic measures.

[0115] As used herein, "therapeutically effective amount" means an amount necessary to delay or completely stop the onset or progression of a specific disease to be treated. The composition of the present invention may be administered in a pharmaceutically effective amount. It is apparent to those skilled in the art that an appropriate total daily dosage can be determined by a treating physician within the scope of sound medical judgment. For the purposes of the present invention, a specific therapeutically effective amount for a specific patient is preferably applied differently depending on various factors including the type and degree of response to be achieved, the specific composition including whether other agents are used in some cases, the patient's age, weight, general health, sex, and diet, the time of administration, the route of administration, and the excretion rate of the composition, the duration of treatment, drugs used together or concurrently with the specific composition, and similar factors well known in the medical field.

[0116] In the treatment method of the present invention, the formulation, administration method, etc. of the low molecular weight compound are as described above.

[0117] Hereinafter, the present invention will be described in detail based on the following examples. However, the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention.

[0118] <Example 1> Discovery of a low-molecular-weight compound with binding affinity to HMGB1

[0119] 1) Construction of a small molecule compound library targeting HMGB1

[0120] Based on the chemical structures of mesalamine, a clinically prescribed treatment for inflammatory bowel disease, and glycyrrhizin, known for its anti-inflammatory properties, a library of various chemical structural derivatives expected to bind to the target protein, HMGB1, was constructed. The target protein, HMGB1, is composed of three domains, and its tertiary structure is shown in Figure 1.

[0121] Chemical structure of the HMGB1-targeting drug library: Glycyrrhizin mesalamine 1-11-2 1-31-4 23 45 67 89 1011 1213 1415 1617 1819 2021 2223 2425 2627 2829 3031 3233 3435 3637 3839 4041 4243 4445 4647 4849 5051 5253 5456 5758 5960 61-ortho61-meta 61-para62 6667 6869 7071 7273 7475 7677 7879 80-ortho80-meta 80-para81-ortho 81-meta81-para 82-ortho82-meta 82-para83-ortho 83-meta83-para 8486 8788 8990 9192(Deoxycholic acid) 93(Lithocholic acid) 94(Ursodeoxycholic acid) 9596 9799 101102 103

[0122]

[0123] Next, the binding affinity of compounds in the small molecule library to the target protein HMGB1 (protein database PDB code: 2YRQ) was evaluated in a virtual simulation. To this end, the SMILES structure of the small molecule compound was converted into a 3D structure (PDB file) using Chimera software. The PDB file of HMGB1 (PDB code: 2YRQ) was converted to a PDBQT file using Auto Dock Vina software. The converted HMGB1 PDBQT file was opened and the PDB file was imported as a ligand file. The imported ligand file was converted to a PDBQT file. A command prompt was opened, the path to the PDBQT file was imported, and the binding affinity analysis was performed by entering the configuration code. The binding affinity analysis was performed by measuring the Gibb's free energy (ΔG) value released when the distance between the two substances is the closest (RMSD = 0 Å). A smaller ΔG value indicates a higher binding affinity.

[0124] The results of molecular docking simulation analysis of the binding between the library of small molecule compounds presented in Table 1 and the target protein HMGB1 are shown in Table 2.

[0125] Prediction of HMGB1 AB box binding affinity of HMGB1 target drug library through molecular docking analysis. Small molecule derivative number, chemical formula, molecular weight (Da), RMSD (Å), ΔG (kcal / mol), binding domain of HMGB1. Glycyrrhizin C42H62O16822.940-7.5ABmesalamine C7H7NO3153.140-4.5A1-1C49H67N2O18972.060-8.2B1-2C56H72N2O201093.170-7.9A1-3C56H72N2O201093.170-8.5B1-4C63H77N3O22----2C44H66O168510-8.6A3C5 4H76O211061.180-6.4A4C54H78O201047.20-6.7B5C48H78N2O13891.150-7.8A6C56H78N2O13987.240- 7.6B7C46H74N2O15895.10-8A8C50H82N2O13919.210-6.4A9C54H76O201045.190-6.3A10C45H71NO14850 .060-8.2A11C45H71NO14850.060-8.7A12C48H75NO14890.120-9.1A13C49H71NO14898.10-9A14C47H73 NO14876.090-9.1A15C48H76N2O15921.140-8.8A16C49H72N2O14913.120-8.7A17C44H67NO16866.010-8 .5A18C45H69NO16880.040-8.6A19C45H69NO17896.040-8.2A20C53H74N2O16995.170-8.5A21C51H73NO1 6956.140-8.5A22C51H73NO17972.140-8.4A23C47H71NO18938.070-7.7A24C46H69NO18924.050-8.1A25 (Ziyuglycoside I)C41H66O137670-7.3B26 (Ziyuglycoside II)C35H56O8604.80-6.9A27C63H81N3O161040260-7.1A28C63H81N3O161136.350--29C55H81N3O181072.260-7.2A30C57H85N3O161068.310-7.3B31C52H76N2O16985.180-8.3B32C52H76N2O16985.180-8.1B33C55H80N2O161025.240-7.5B34C56H76N2O161033.220-8.8B35C54H78N2O16 1011.220-8.4B36C55H81N3O171056.260-7.6B37C56H77N3O161048.240-8 .6B38C51H72N2O181001.130-8.2B39C52H74N2O181015.160-8.6B40C52H7 4N2O191031.160-8B41C60H79N3O181130.30--42C58H78N2O181091.260-7.1B43C58H78N2O191107.260-8.3B44C54H76N2O201073.20-8.4B45C53H74 N2O201059.170-8.1B46C56H72N2O201093.190-8.1A47C50H69NO18972.090-8.2B48C45H62F3N3O16957.990-7.9A49C45H68N2O16893.040-8.6A50C45H65N3O16904.250-8.9A51C44H65NO17879.990-8.2A52C45H67NO17894.020-8.6A53C44H68N2O17S929.090-8.2A54C47H70N2O16919.080-8.5A56C5 0H69NO17956.090-8.6A57C48H74N2O17951.120-7.9A58C49H76N2O17965.140-7.3A59C48H66N2O17943.050-8.7A60C49H68N2O17957.080-8.7A61-o rthoC49H67NO17942.050-9.2A61-metaC49H67NO17942.050-7.2A61-paraC49H67NO17942.050-9A62C50H67NO17956.090-8.8B66C48H65NO17928.040-9.0A67C49H67NO17942.070-8.9A68C49H67NO17942.070-7.7A69C50H69NO17956.090-7.7A70C49H69NO17944.080-8.4A71C50H71NO17958.110-8.5A72C49H67NO16926.070-7.8A73C49H67NO16926.070-7.6B74C50H69NO16940.090-7.7A75C49H69NO16928.080-9.1A76C49H69NO16928.080-8.9A77C50H71NO16942.110-9A78C49H68O18945.070-7.7A79C49H68N2O 17957.080-8.4A80-orthoC49H68O17929.070-8.5A80-metaC49H68O17929.070-8.6A80-paraC49H68O1792 9.070-8.1A81-orthoC50H70O17943.090-8.4A81-metaC50H70O17943.090-8.5A81-paraC50H70O17943.09 0-8.1A82-orthoC49H68N2O16941.080-8.6A82-metaC49H68N2O16941.080-8.4A82-paraC49H68N2O16941. 080-8.4A83-orthoC50H70N2O16955.110-8.4A83-metaC50H70N2O16955.110-8.5A83-paraC50H70N2O1695 5.110-8.2A84C50H67NO201002.070-8.6A86C50H67NO19986.070-8.2A87C33H50O5526.760-7.2A88C42H64O15808.960-7.2A89C48H67NO16914.060-7.6A90C48H67NO17930.050-9.1A91C48H67NO18946.050-8.7A92 (Deoxycholic acid)C24H40O4392.580-6.4B93 (Lithocholic acid)C24H40O3376.580-6.2B94(Ursodeoxycholic acid) acid)C24H40O4392.580-6.5B95C31H45NO6527.70-6.3B96C31H45NO5511.70-7.4B97C31H45NO6527.70-7.5B99C 50H67NO19986.070-8.7A101C64H85NO241252.350-6.5A102C50H71NO17958.110-8.7A103C48H71NO21998.080-9.0A.

[0126]

[0127] As shown in Table 2, mesalamine, the control drug prescribed to the patient, was confirmed to have very low binding affinity with the target protein HMGB1. Furthermore, glycyrrhizin, a raw drug known to have anti-inflammatory effects, was observed to have a higher binding affinity with the target protein HMGB1 than mesalamine. For some small-molecule compounds (#1-4, 28, 41), binding affinity could not be assessed.

[0128] As in the case of low molecular weight compounds #2~9 and #87, when the glucuronic acid portion of the sugar structure of glycyrrhizin was modified, the binding affinity for HMGB1 was similar or decreased. As in the case of low molecular weight compounds #10, #11, #23, #24, #49, #51~53, #57, #58, #63, and #64, when the carboxyl group (-COOH) portion of glycyrrhizin was modified, the binding affinity for HMGB1 was observed to increase. As in the case of low molecular weight compounds #12~22, when the carboxyl group portion of glycyrrhizin was modified into a ring structure, the binding affinity for HMGB1 was observed to increase significantly. However, when the ring structure was modified to a different position, as in the case of low-molecular-weight compounds #25 and #26, or when additional modifications were introduced to the ring structure, as in the case of low-molecular-weight compounds #31-48, the binding affinity for HMGB1 was reduced. Or, when the carboxyl moiety of glycyrrhizin was modified into a ring structure and the glucuronic acid moiety, which is a sugar structure, was modified, as in the case of low-molecular-weight compounds #27-30, the binding affinity for HMGB1 was reduced again. As in the case of low-molecular-weight compounds #92-97, it was confirmed that cholesterol analogues with a backbone similar to glycyrrhizin had very low binding affinity for HMGB1. As in the case of low molecular weight compounds # 1-1, # 1-2, # 1-3 and # 54~56 and # 59~86 and # 98~103, when the carboxyl moiety of glycyrrhizin was modified with a benzene group modified with a functional group such as a carboxyl group or a hydroxyl group (-OH), high binding affinity for HMGB1 was observed in some structures. Through this, a total of 14 candidates (low molecular weight compounds: # 1-1, # 1-2, # 12, # 14, # 50, # 59, # 61-ortho, # 61-meta, # 61-para, # 66, # 75, # 90, # 99, # 103) were discovered as shown in Table 2. Among them, 7 substances that were judged to have the best binding affinity to the target protein HMGB1 were selected.

[0129] <Example 2> Synthesis of low molecular weight compounds (compounds # 1-1, 1-2, 59, 61-ortho, 61-meta, 61-para, and 99)

[0130] ① Synthesis of #1-1

[0131] [Reaction Formula 1]

[0132]

[0133] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 ml) at room temperature, and 35% HCl (3.6 ml) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 ml of pyridine and 75 ml of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 ml of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) as a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and methyl 5-amino-2-hydroxybenzoate (0.11 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (ethyl acetate: hexane = 1:1) to obtain a concentrate. The concentrate (0.274 g, 0.000226 mol) was dissolved in a solution (30 mL) of THF: MeOH: H2O = 3:1:1, and lithium hydroxide (0.0652 g, 0.00271 mol) was added. The reaction mixture was stirred at room temperature for 48 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=2:1) ​​to obtain the compound. The synthesis of low-molecular-weight compound # 1-1 was verified by NMR analysis and LC-MS analysis.

[0134] NMR analysis of small molecule compound #1-1: 1 H NMR (400 MHz, DMSO-d6) δ 0.735-0.748(7H, d), 0.982-1.048(11H, t), 1.135(4H, s), 1.352-1.373(9H, d), 1.496-1.756(10H, m), 1.884(1H, m), 1.985-2.117(5H, m), 2.994-3.053(3H, m), 3.110-3.134(5H, m), 3.158-3.183(5H, m), 3.509(1H, s), 3.811(1H, s), 4.273-4.290(1H, d); 4.413-4.432(1H, d), 4.787(1H, s), 5.183(1H, s), 5.475(1H, s), 5.774(1H, s), 6.524-6.545(1H, d), 7.307-7.336(1H, q), 7.717-7.723(1H, d), 8.975(1H, s), 16.197(1H, s) LRMS (ESI) m / z 957.44(M + +1).

[0135] Molecular weight: 958.44 Da

[0136] LC-MS: 958.4449 m / z

[0137] ② Synthesis of #1-2

[0138] [Reaction Formula 2]

[0139]

[0140] At room temperature, glycyrrhizic acid (5 g, 0.00607 mol), methyl-5-amino-2-hydroxybenzoate (1.01 g, 0.00607 mol), HATU (2.77 g, 0.00728 mol), and DIPEA (1.58 mL, 0.00911 mol) were added to RB and stirred at 50℃ for 24 hours. The reactant was filtered under reduced pressure, and the filtered reactant was concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (MC:MeOH=20:1) to obtain the concentrate. The concentrate (0.274 g, 0.000244 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O=3:1:1, and lithium hydroxide (0.0703 g, 0.00293 mol) was added. The reaction mixture was stirred at room temperature for 48 hours. The reaction mixture was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=1:1.5). The synthesis of low-molecular-weight compounds #1-2 was verified by NMR and LC-MS analysis.

[0141] NMR analysis of small molecule compounds #1-2: 1H NMR: δ 0.85-1.05 (15H, 0.90 (s), 0.96 (s), 0.99 (s), 1.00 (s)), 1.19 (3H, s), 1.24-1.93 (21H, 1.29 (s), 1.41 (ddd, J = 13.4, 10.0, 3.4 Hz), 1.50 (dddd, J = 13.2, 10.2, 9.9, 3.0 Hz), 1.51 (ddd, J = 12.9, 10.2, 3.2 Hz), 1.52 (dd, J = 9.9, 1.9 Hz), 1.55 (dddd, J = 13.7, 3.4, 3.0, 2.6 Hz), 1.56 (ddd, J = 13.7, 10.0, 3.8 Hz), 1.57 (ddd, J = 13.5, 10.2, 3.1 Hz), 1.58 (ddd, J = 13.0, 10.3, 2.6 Hz), 1.59 (ddd, J = 13.4, 3.8, 2.4 Hz), 1.63 (dddd, J = 13.7, 10.3, 10.1, 2.8 Hz), 1.62 (dd, J = 13.4, 10.2 Hz), 1.62 (ddd, J = 13.0, 3.0, 2.8 Hz), 1.65 (ddd, J = 13.5, 3.2, 2.5 Hz), 1.70 (dddd, J = 13.2, 3.1, 2.7, 1.9 Hz), 1.72 (ddd, J = 13.5, 3.0, 2.7 Hz), 1.72 (ddd, J = 12.9, 3.2, 2.5 Hz), 1.77 (ddd, J = 13.5, 10.2, 3.2 Hz), 1.86 (ddd, J = 13.7, 3.4, 2.4 Hz)), 2.18 (1H, dd, J = 13.4, 3.1 Hz), 2.69-2.85 (2H, 2.76 (dd, J = 10.2, 3.1 Hz), 2.80 (s)), 3.11-3.33 (2H, 3.18 (t, J = 10.2 Hz), 3.27 (t, J = 10.2 Hz)), 3.39-3.53 (2H, 3.45 (t, J = 10.2 Hz), 3.47 (t, J = 10.2 Hz)), 3.56-3.96 (4H, 3.63 (dd, J = 10.1, 3.4 Hz), 3.70 (t, J = 10.2 Hz), 3.79 (t, J = 10.2 Hz), 3.90 (d, J = 10.3 Hz)), 4.16 (1H, d, J = 10.3 Hz), 4.40-4.62 (2H, 4.46 (d, J = 10.3 Hz), 4.55 (d, J = 10.3 Hz)), 5.83 (1H, s), 6.95-7.07 (2H, 7.01 (dd, J = 8.6, 0.5 Hz), 7.01 (dd, J = 8.7, 0.5 Hz)), 7.35-7.49 (2H, 7.41 (dd, J = 8.7, 1.7 Hz), 7.43 (dd, J = 8.6, 1.5 Hz)), 8.18-8.30 (2H, 8.24 (dd, J = 1.7, 0.5 Hz), 8.25 (dd, J = 1.5, 0.5 Hz)).

[0142] 분자량: 1093.19 Da

[0143] LC-MS: 1093.4769 m / z

[0144] ③#59의합성

[0145] [반응식 3]

[0146]

[0147] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 mL) at room temperature, and 35% HCl (3.6 mL) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and then stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 mL of pyridine and 75 mL of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 mL of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) as a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and methyl 5-aminonicotinate (0.10 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was poured into the reaction mixture, and it was extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (MC:MeOH=20:1) to obtain a concentrate. The concentrate (0.274 g, 0.000229 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O=3:1:1, and lithium hydroxide (0.066 g, 0.00275 mol) was added. The reaction mixture was stirred at room temperature for 24 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated under reverse phase column chromatography (H2O:AN=2:1) ​​conditions to obtain the product.

[0148] To verify the synthesis of the low-purity compound #59, which was synthesized, NMR analysis and LC-MS analysis were performed.

[0149] NMR analysis of small molecule compound #59 : 1 H NMR (400 MHz, DMSO-d6) δ 0.723-0.734(6H, d), 0.934-1.041(12H, m), 1.073-1.178(3H, m), 1.329-1.437(6H, m), 1.636(20H, s), 1.747-1.902(4H, m), 2.018-2.043(1H, m), 2.084(1H, s), 2.308-2.331(2H, m), 2.975-3.060(2H, m), 3.086-3.226(12H, m), 4.275-4.292(1H, d); 4.407-4.426(1H, d), 5.020(1H, s), 5.428(1H, s), 5.542(1H, s), 6.004(1H, s), LRMS (ESI) m / z 941.44 (M + +1).

[0150] Molecular weight: 1093.19 Da

[0151] LC-MS: 943.4453 m / z

[0152] ④ Synthesis of #61-ortho

[0153] [Reaction Formula 4]

[0154]

[0155] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 mL) at room temperature, and 35% HCl (3.6 mL) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and then stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 mL of pyridine and 75 mL of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 mL of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) in the form of a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and 2-aminobenzoic acid (0.09 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was poured into the reaction mixture, and it was extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (ethyl acetate:hexane = 1:1) to obtain a concentrate. The concentrate (0.274 g, 0.000232 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O = 3:1:1, and lithium hydroxide (0.0668 g, 0.00278 mol) was added. The reaction mixture was stirred at room temperature for 24 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=2:1) ​​to obtain the product. To verify the synthesis of the low-molecular-weight compound of #61-ortho, the product was confirmed by NMR analysis and LC-MS analysis.

[0156] NMR analysis of small molecule compound #61-ortho: 1 H NMR (400 MHz, DMSO-d6) δ 0.728-0.741(7H, d), 0.955-1.047(11H, m), 1.141-1.175(4H, d), 1.344-1.385(7H, m), 1.647(12H, m), 1.679-1.959(9H, m), 2.104-2.173(3H, m), 3.010-3.082(3H, m), 3.121-3.169(12H, t), 3.626-3.679(3H, q), 3.776-3.815(2H, q), 4.305-4.323(1H, d); 4.441-4.460(1H, d), 5.300-5.316(1H, q), 5.540(1H, s), 7.958-7.982(1H, q), 8.468-8.528(1H, q), 14.511(1H, s) LRMS (ESI) m / z 941.44 (M + +1).

[0157] Molecular weight: 942.07 Da

[0158] LC-MS: 942.4536 m / z

[0159] ⑤ # Synthesis of 61-meta

[0160] [Reaction Formula 5]

[0161]

[0162] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 mL) at room temperature, and 35% HCl (3.6 mL) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and then stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 mL of pyridine and 75 mL of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 mL of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) in the form of a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and 3-aminobenzoic acid (0.090 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was poured into the reaction mixture, and it was extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (ethyl acetate:hexane = 1:1) to obtain a concentrate. The concentrate (0.274 g, 0.000232 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O = 3:1:1, and lithium hydroxide (0.0668 g, 0.00278 mol) was added. The reaction mixture was stirred at room temperature for 24 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=2:1) ​​to obtain the product. To verify the synthesis of the low-molecular-weight compound of #61-meta, the product was confirmed by NMR analysis and LC-MS analysis.

[0163] NMR analysis of small molecule compound #61-meta:: 1H NMR: δ 0.85-1.04 (15H, 0.90 (s), 0.96 (s), 0.99 (s), 0.99 (s)), 1.19 (3H, s), 1.24-1.93 (21H, 1.29 (s), 1.42 (dddd, J = 13.3, 10.2, 9.9, 3.0 Hz), 1.41 (ddd, J = 13.4, 10.0, 3.4 Hz), 1.51 (ddd, J = 12.9, 10.2, 3.2 Hz), 1.56 (ddd, J = 13.7, 10.0, 3.8 Hz), 1.56 (dddd, J = 13.7, 3.4, 3.0, 2.6 Hz), 1.58 (ddd, J = 13.0, 10.3, 2.6 Hz), 1.60 (ddd, J = 13.5, 10.2, 3.1 Hz), 1.59 (ddd, J = 13.4, 3.8, 2.4 Hz), 1.59 (dd, J = 9.9, 1.9 Hz), 1.63 (dddd, J = 13.7, 10.3, 10.1, 2.8 Hz), 1.62 (dd, J = 13.4, 10.2 Hz), 1.62 (ddd, J = 13.0, 3.0, 2.8 Hz), 1.65 (ddd, J = 13.5, 3.2, 2.5 Hz), 1.71 (dddd, J = 13.3, 3.1, 2.7, 1.9 Hz), 1.72 (ddd, J = 13.5, 3.0, 2.7 Hz), 1.72 (ddd, J = 12.9, 3.2, 2.5 Hz), 1.77 (ddd, J = 13.5, 10.2, 3.2 Hz), 1.86 (ddd, J = 13.7, 3.4, 2.4 Hz)), 2.17 (1H, dd, J = 13.4, 3.1 Hz), 2.69-2.86 (2H, 2.76 (dd, J = 10.2, 3.1 Hz), 2.81 (s)), 3.11-3.33 (2H, 3.18 (t, J = 10.2 Hz), 3.27 (t, J = 10.2 Hz)), 3.35-3.53 (2H, 3.41 (t, J = 10.2 Hz), 3.47 (t, J = 10.2 Hz)), 3.55-3.80 (3H, 3.62 (dd, J = 10.1, 3.4 Hz), 3.70 (t, J = 10.2 Hz), 3.74 (t, J = 10.2 Hz)), 3.84-3.97 (2H, 3.90 (d, J = 10.3 Hz), 3.91 (d, J = 10.3 Hz)), 4.40-4.60 (2H, 4.46 (d, J = 10.3 Hz), 4.54 (d, J = 10.3 Hz)), 5.83 (1H, s), 7.40-7.57 (2H, 7.46 (dt, J = 7.8, 1.5 Hz), 7.51 (td, J = 7.8, 0.4 Hz)), 7.83 (1H, ddd, J = 7.8, 1.6, 1.5 Hz), 8.31 (1H, ddd, J = 1.6, 1.5, 0.4 Hz).

[0164] Molecular weight: 942.07 Da

[0165] LC-MS: 942.4511 m / z

[0166] ⑥ # Synthesis of 61-para

[0167] [Reaction Formula 6]

[0168]

[0169] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 mL) at room temperature, and 35% HCl (3.6 mL) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and then stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 mL of pyridine and 75 mL of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 mL of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) as a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and 4-aminobenzoic acid (0.0903 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was poured into the reaction mixture, and it was extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (ethyl acetate:hexane = 1:1) to obtain a concentrate. The concentrate (0.274 g, 0.000232 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O = 3:1:1, and lithium hydroxide (0.0668 g, 0.00278 mol) was added. The reaction mixture was stirred at room temperature for 24 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=2:1) ​​to obtain the product. To verify the synthesis of the low-molecular-weight compound of #61-para, which was synthesized, NMR analysis and LC-MS analysis were performed.

[0170] NMR analysis of small molecule compound #61-para: 1H NMR: δ 0.85-1.04 (15H, 0.90 (s), 0.96 (s), 0.99 (s), 0.99 (s)), 1.19 (3H, s), 1.24-1.93 (21H, 1.29 (s), 1.42 (dddd, J = 13.3, 10.2, 9.9, 3.0 Hz), 1.41 (ddd, J = 13.4, 10.0, 3.4 Hz), 1.48 (ddd, J = 12.9, 10.2, 3.2 Hz), 1.56 (ddd, J = 13.7, 10.0, 3.8 Hz), 1.56 (dddd, J = 13.7, 3.4, 3.0, 2.6 Hz), 1.58 (ddd, J = 13.0, 10.3, 2.6 Hz), 1.60 (ddd, J = 13.5, 10.2, 3.1 Hz), 1.59 (ddd, J = 13.4, 3.8, 2.4 Hz), 1.59 (dd, J = 9.9, 1.9 Hz), 1.63 (dddd, J = 13.7, 10.3, 10.1, 2.8 Hz), 1.62 (dd, J = 13.4, 10.2 Hz), 1.62 (ddd, J = 13.0, 3.0, 2.8 Hz), 1.65 (ddd, J = 13.5, 3.2, 2.5 Hz), 1.71 (dddd, J = 13.3, 3.1, 2.7, 1.9 Hz), 1.72 (ddd, J = 13.5, 3.0, 2.7 Hz), 1.74 (ddd, J = 12.9, 3.2, 2.5 Hz), 1.76 (ddd, J = 13.5, 10.2, 3.2 Hz), 1.86 (ddd, J = 13.7, 3.4, 2.4 Hz)), 2.20 (1H, dd, J = 13.4, 3.1 Hz), 2.63-2.86 (2H, 2.70 (dd, J = 10.2, 3.1 Hz), 2.81 (s)), 3.11-3.33 (2H, 3.18 (t, J = 10.2 Hz), 3.27 (t, J = 10.2 Hz)), 3.35-3.53 (2H, 3.41 (t, J = 10.2 Hz), 3.47 (t, J = 10.2 Hz)), 3.55-3.80 (3H, 3.62 (dd, J = 10.1, 3.4 Hz), 3.70 (t, J = 10.2 Hz), 3.74 (t, J = 10.2 Hz)), 3.84-3.97 (2H, 3.90 (d, J = 10.3 Hz), 3.91 (d, J = 10.3 Hz)), 4.40-4.60 (2H, 4.46 (d, J = 10.3 Hz), 4.54 (d, J = 10.3 Hz)), 5.83 (1H, s), 7.35 (2H, ddd, J = 8.5, 1.4, 0.5 Hz), 8.05 (2H, ddd, J = 8.5, 1.7, 0.5 Hz).

[0171] Molecular weight: 942.07 Da

[0172] LC-MS: 942.4548 m / z

[0173] ⑦ #99's synthesis

[0174] [Reaction Formula 7]

[0175]

[0176] Glycyrrhizic acid (5 g, 0.00607 mol) was dissolved in methanol (180 mL) at room temperature, and 35% HCl (3.6 mL) was added to the reaction mixture. The mixture was stirred at room temperature until glycyrrhizic acid was completely dissolved, and then stirred at the same temperature for 1 hour. Triethylamine was added little by little to neutralize the pH to 7. The solvent was concentrated under reduced pressure, and 75 mL of pyridine and 75 mL of acetic anhydride were added to the concentrate, and the mixture was stirred at room temperature for 24 hours. After confirming that the reaction was complete, 250 mL of purified water was slowly added dropwise to the reaction mixture at 0°C, and a white solid was precipitated. The precipitated solid was filtered under reduced pressure, washed with purified water and hexane in that order, and the filtrate was dried in an oven for 24 hours to obtain 2.7 g (41.9%) in the form of a white solid. The dried filtrate (0.5 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane and stirred at 0°C for 15 minutes. Thionyl chloride (34 μL, 0.000471 mol) was slowly added dropwise to the reaction mixture, the temperature was gradually raised, and the mixture was stirred at 45°C for 30 minutes. When the reaction was complete, the reaction mixture was concentrated under reduced pressure, and a small amount of dichloromethane was additionally added, and the concentration under reduced pressure was repeated twice. The concentrate (0.508 g, 0.000471 mol) was dissolved in 10 mL of dichloromethane, and triethylamine (98.2 μL, 0.000706 mol) and dimethyl 5-aminoisophthalate (0.138 g, 0.000659 mol) were added to the reaction mixture, and the reaction mixture was stirred at room temperature for 3 hours. Water was poured into the reaction mixture, and it was extracted with dichloromethane. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrate was purified and concentrated using column chromatography (EA:Hex=1.5:1) to obtain a concentrate. The concentrate (0.274 g, 0.000218 mol) was dissolved in a solution (30 mL) of THF:MeOH:H2O=3:1:1, and lithium hydroxide (0.063 g, 0.00262 mol) was added. The reaction mixture was stirred at room temperature for 24 hours.The reactant was concentrated under reduced pressure, and the concentrate was purified and concentrated using reverse-phase column chromatography (H2O:AN=3:1) to obtain the product. To verify the synthesis of the low-molecular-weight compound #99, which was synthesized, NMR analysis and LC-MS analysis were performed.

[0177] NMR analysis of small molecule compound #99: 1H NMR: δ 0.86-1.04 (15H, 0.91 (s), 0.96 (s), 0.99 (s), 0.99 (s)), 1.19 (3H, s), 1.24-1.93 (21H, 1.29 (s), 1.41 (ddd, J = 13.4, 10.0, 3.4 Hz), 1.50 (dddd, J = 13.2, 10.2, 9.9, 3.0 Hz), 1.51 (ddd, J = 12.9, 10.2, 3.2 Hz), 1.56 (ddd, J = 13.7, 10.0, 3.8 Hz), 1.56 (dddd, J = 13.7, 3.4, 3.0, 2.6 Hz), 1.57 (ddd, J = 13.5, 10.2, 3.1 Hz), 1.58 (ddd, J = 13.0, 10.3, 2.6 Hz), 1.59 (ddd, J = 13.4, 3.8, 2.4 Hz), 1.58 (dd, J = 9.9, 1.9 Hz), 1.63 (dddd, J = 13.7, 10.3, 10.1, 2.8 Hz), 1.62 (dd, J = 13.4, 10.2 Hz), 1.62 (ddd, J = 13.0, 3.0, 2.8 Hz), 1.65 (ddd, J = 13.5, 3.2, 2.5 Hz), 1.70 (dddd, J = 13.2, 3.1, 2.7, 1.9 Hz), 1.72 (ddd, J = 13.5, 3.0, 2.7 Hz), 1.72 (ddd, J = 12.9, 3.2, 2.5 Hz), 1.76 (ddd, J = 13.5, 10.2, 3.2 Hz), 1.86 (ddd, J = 13.7, 3.4, 2.4 Hz)), 2.18 (1H, dd, J = 13.4, 3.1 Hz), 2.69-2.85 (2H, 2.76 (dd, J = 10.2, 3.1 Hz), 2.80 (s)), 3.11-3.33 (2H, 3.18 (t, J = 10.2 Hz), 3.27 (t, J = 10.2 Hz)), 3.35-3.53 (2H, 3.41 (t, J = 10.2 Hz), 3.47 (t, J = 10.2 Hz)), 3.55-3.80 (3H, 3.62 (dd, J = 10.1, 3.4 Hz), 3.70 (t, J = 10.2 Hz), 3.74 (t, J = 10.2 Hz)), 3.84-3.97 (2H, 3.90 (d, J = 10.3 Hz), 3.91 (d, J = 10.3 Hz)), 4.40-4.60 (2H, 4.46 (d, J = 10.3 Hz), 4.54 (d, J = 10.3 Hz)), 5.83 (1H, s), 7.60 (2H, t, J = 1.9 Hz), 8.43 (1H, t, J = 1.9 Hz).

[0178] Molecular weight: 986.07 Da

[0179] LC-MS: 986.4440 m / z

[0180] <Experimental Example 1> Experiment on inhibition of HMGB1-dependent inflammatory factor expression in activated immune cells by low-molecular-weight compounds

[0181] In the group treated only with HMGB1 in RAW 264.7 cells, which are immune cells, the relative expression inhibition rate was calculated for the group of mesalamine (250 μM) prescribed to patients with inflammatory bowel disease, the group of glycyrrhizin (concentration 250 μM) known to have anti-inflammatory effect, and 7 types of low-molecular-weight compounds (250 μM), based on 100% of the gene expression amount of each inflammatory factor in the positive control (PC) group. For this, 1 X 10 RAW 264.7 cells were seeded in a 12-well plate. 6Cells were placed per well and cultured in a humidified incubator (37°C, 5% CO2) for 24 hours. The experiment was started when the cells reached 80% or more confluence. Small-molecule compounds were dissolved in the culture medium, and HMGB1 was dissolved in the culture medium to prepare a concentration of 100 ng / mL. The culture medium containing the small-molecule compounds and HMGB1 was mixed and reacted in an incubator for 30 minutes. The cultured cells were washed twice with PBS. The cells were treated with a solution containing the pre-prepared mixture of HMGB1 and small-molecule compounds and cultured in an incubator for 3 hours. The cells were washed twice with PBS. Total RNA from the cells was extracted using QIAzol Lysis Reagent and RNeasy Mini Kit (QIAGEN, Germany), and then iScript TM 1 μg of RNA was reverse transcribed into cDNA using the cNDA synthesis kit (BIO RAD Laboratories, USA). Next, qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems™, USA) in an Applied Biosystems Instrument (USA). GAPDH was used as an endogenous control to normalize the relative mRNA expression of the following genes. The primer sequences used are shown in Table 3.

[0182] primer TypeForward(5'-3')Reverse(3'-5')GAPDHCAGGAGGCATTGCTGATGATGAAGGCTGGGGCTCATTTTNF-αCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAGIL-6TAGTCCTTCCT ACCCCAATTTCCTTGGTCCTTAGCCACTCCTTCIL-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACTCOX-2TTCTCTACAACAACCCATCCTCGCAGCCATTTCCTTCTCTCC

[0183]

[0184] As shown in Fig. 2, mesalamine (yellow) showed a minimal effect, and glycyrrhizin (orange) showed a significant effect only on IL-6 cytokine. Low-molecular-weight compounds #1-1 and #59 and #99 were effective on TNF-α, IL-6, IL-1β, etc., but had a minimal effect on COX-2. Low-molecular-weight compounds #61-ortho and #61-para effectively inhibited four types of inflammatory factors. In particular, they showed a very high inhibitory effect on IL-6 cytokine.

[0185] As shown in Table 4, when comparing only the low-molecular-weight compounds that showed an inhibitory effect of 50% or more on four types of inflammatory factors, the low-molecular-weight compound #61-ortho showed the best effect. In addition, it can be seen that the drug effects differ depending on the position of the carboxyl group of the benzyl group, such as in low-molecular-weight compounds #61-ortho, #61-meta, and #61-para.

[0186] Meanwhile, in the case of low molecular compound #1-1, it can be seen that the structure has a hydroxyl group at the para-position of the benzyl group in the low molecular compound #61-meta structure, and this low molecular compound #1-1 has better performance than the #61-meta structure.

[0187] Inhibition rate of HMGB1-dependent inflammatory factor expression in immune cells by low-molecular-weight compounds Low-molecular-weight compound derivative number HMGB1 stimulation TNF-α (%) IL-6 (%) IL-1β (%) COX-2 (%) + 100.00 100.00 100.00 100.00 Glycyrrhizin + 61.45 28.55 60.30 78.30 Mesalamine + 77.35 68.35 86.13 116.39 1-1 + 39.07 13.07 42.64 80.05 1-2 + 90.7471.8585.67127.7759+70.8030.5243.65103.6461-ortho+39.685.1023.5345.4461- meta+70.9320.1048.4382.2561-para+52.928.0926.8757.9499+88.8517.7654.66100.93

[0188]

[0189] Next, the concentration dependence of the low-molecular-weight compound #61-ortho, which has excellent anti-inflammatory factor inhibitory efficacy, was evaluated.

[0190] As shown in Fig. 3 and Table 5, the effect on the six measured inflammatory factors began to appear at a concentration of 25 μM of the low-molecular compound #61-ortho and showed concentration dependence.

[0191] Concentration-dependent alleviation of HMGB1-dependent inflammatory factor expression by small molecule compound #61-ortho Type of inflammatory factor #61-ortho (μM)02550100250TNF-α100%105.00%83.19%64.68%33.04%IL-6100%90.76%71.29%48.12%15.53%IL-1β100%97.95%69.66%63.55 %24.45%COX-2100%83.02%98.93%61.87%31.03%CXCL2100%97.49%112.14%65.30%2.31%iNOS100%100.60%109.94%66.53%21.44%

[0192]

[0193] <Experimental Example 2> Experiment on inhibition of HMGB1-dependent inflammatory factor secretion by activated immune cells by low-molecular-weight compounds

[0194] The effect of low-molecular-weight compounds on inflammatory factor secretion (TNF-α (EliKine™ Mouse TNF-α ELISA Kit, Abbkine), IL-6 (EliKine™ Mouse IL-6 ELISA Kit, Abbkine)) secretion by HMGB1 stimulation was evaluated. For this purpose, 1 X 10 RAW 264.7 cells were seeded in a 12-well plate. 6 Cells were seeded per well and cultured in a humidified incubator (37°C, 5% CO2) for 24 hours. The experiment was started when the cells reached 80% or more confluence. Small-molecule compounds were dissolved in the culture medium, and HMGB1 was dissolved in the culture medium to prepare a concentration of 100 ng / mL. The culture medium containing the small-molecule compounds and HMGB1 was mixed and incubated in an incubator for 30 minutes. The cultured cells were washed twice with PBS. The cells were treated with a solution containing the previously prepared HMGB1 and small-molecule compounds and cultured in an incubator for 3 hours. The cell culture medium was collected and stored frozen at -80°C. ELISA analysis of inflammatory factors in the cell culture medium was performed according to the provided protocol. Table 6 shows the types of inflammatory factors analyzed and the company information for the ELISA assay kit.

[0195] Inflammatory Factor TypeModel NumberManufacturerTNF-αEliKine™ Mouse TNF-α ELISA KitAbbkineIL-6EliKine™ Mouse IL-6 ELISA KitAbbkine

[0196]

[0197] As shown in Figure 4 and Table 7, for TNF-α, the cytokine protein secretion inhibition effect was not very high compared to the gene expression inhibition effect (approximately 71% secretion inhibition efficacy at 250 μM). On the other hand, for IL-6, it was confirmed that both the gene expression inhibition effect and the cytokine protein secretion inhibition effect were excellent.

[0198] The rate of alleviation of inflammatory factor secretion induced by HMGB1 stimulation by small molecule compound #61-ortho. Type of inflammatory factor #61-ortho (μM)0.50100250TNF-α100%95.34%112.46%71.09%IL-6100%93.11%66.97%3.66%

[0199]

[0200] In addition, as shown in Fig. 5, when HMGB1 was treated in RAW 264.7 cells, which are immune cells, the morphology of the immune cells was observed to change. This is because the immune cells are activated by HMGB1. On the other hand, when HMGB1 and the small molecule compound #61-ortho were treated together, the morphology of the immune cells was observed to be maintained in an inactive form in a concentration-dependent manner of the small molecule compound.

[0201] <Experimental Example 3> Experiment on inhibition of HMGB1-independent inflammatory factor expression in activated immune cells by low-molecular-weight compounds

[0202] Activation of immune cells, RAW 264.7 cells, by treating them with lipopolysaccharide (LPS) is a different pathway from HMGB1-mediated activation. That is, HMGB1 itself is a pathway that activates them by binding to the RAGE receptor, while LPS itself is a pathway that activates them by binding to the TLR (Toll-Like Receptor) receptor. RAW 264.7 cells, which are immune cells, were treated with only LPS, and the expression level of inflammatory factors was set to 100%, and the remaining groups were expressed as relative expression levels. For this, 1 X 10 RAW 264.7 cells were seeded in a 12-well plate. 6Cells were placed per well and cultured in a humidified incubator (37°C, 5% CO2) for 24 hours. The experiment was started when the cells reached 80% or more confluence. Small-molecule compounds were dissolved in the culture medium, and lipopolysaccharide (LPS) was dissolved in the culture medium to prepare a concentration of 1 ng / mL. The culture medium containing the small-molecule compounds and LPS was mixed and reacted in an incubator for 30 minutes. The cells were washed twice with PBS. The cells were treated with a solution containing the prepared small-molecule compounds and LPS and cultured in an incubator for 3 hours. The cells were washed twice with PBS. Total RNA was extracted from the cells using QIAzol Lysis Reagent and RNeasy Mini Kit (QIAGEN, Germany), and then iScript TM 1 μg of RNA was reverse transcribed into cDNA using the cNDA synthesis kit (BIO RAD Laboratories, USA). Next, qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems™, USA) in an Applied Biosystems Instrument (USA). GAPDH was used as an endogenous control to normalize the relative mRNA expression of the following genes. The primer sequences used are shown in Table 8.

[0203] primer TypeForward(5'-3)Reverse(3'-5')GAPDHCAGGAGGCATTGCTGATGATGAAGGCTGGGGCTCATTTTNF-αCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAGIL-6TAGTCCTTCCTA CCCCAATTTCCTTGGTCCTTAGCCACTCCTTCIL-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACTCOX-2TTCTCTACAACAACCCATCCTCGCAGCCATTTCCTTCTCTCC

[0204]

[0205] As shown in Fig. 6 and Table 9, when the low-molecular-weight compound #61-ortho was treated at different concentrations, the inflammatory factors TNF-α, IL-6, IL-1β, and COX-2 decreased depending on the concentration of the low-molecular-weight compound #61-ortho. In particular, at a drug treatment concentration of 250 μM, the expression of the inflammatory factors TNF-α, IL-6, IL-1β, and COX-2 decreased by approximately 50%. This shows that the low-molecular-weight compound #61-ortho can also inhibit the expression of HMGB1-independent inflammatory factors.

[0206] The above results can be explained in three cases: (1) low-molecular-weight compound #61-ortho binds to HMGB1 expressed / secreted by immune cells activated by LPS to suppress additional inflammatory responses, (2) low-molecular-weight compound #61-ortho forms a complex with LPS to block TLR receptor activation, or (3) low-molecular-weight compound #61-ortho itself may pass into the cytoplasm of immune cells to suppress signaling molecules such as NF-κB.

[0207] Analysis of the effect of low-molecular-weight compound # 61-ortho on alleviating the expression of inflammatory factors induced by LPS stimulation. Type of inflammatory factor # 61-ortho (μM) 0 5 0 1 0 2 5 0 TNF-α 100% 84.18% 67.22% 49.87% IL-61 00% 54.21% 48.81% 35.41% IL-1β 100% 82.35% 74.82% 45.03% COX-2 100% 98.13% 82.73% 65.30%

[0208]

[0209] In addition, as shown in Fig. 7, when RAW 264.7 cells, which are immune cells, were treated with LPS, the morphology of the immune cells was observed to change. This is because the immune cells were activated by LPS. On the other hand, when LPS and the low-molecular compound #61-ortho were treated together, the morphology of the immune cells was observed to be maintained in an inactive form depending on the concentration of the low-molecular compound.

[0210] <Experimental Example 4> Inhibition of HMGB1 / LPS-dependent inflammatory factor expression in immune cells by low-molecular-weight compound #61-ortho

[0211] HMGB and LPS, which are processed to activate immune cells, can act on RAGE and TLR receptors, respectively, and HMGB1 / LPS can form a complex to act on TLR receptors. Therefore, the efficacy of the small molecule compound #61-ortho drug was confirmed in this environment.

[0212] As shown in Fig. 8 and Table 10, when HMGB1 / LPS were treated together, the drug effect of low-molecular-weight compound # 61-ortho was high. This result was superior to the LPS treatment results in Fig. 3 and Table 9, but the effect was somewhat lower than the HMGB1 treatment results in Fig. 3 and Table 5. These results imply that low-molecular-weight compound # 61-ortho is mainly superior in suppressing the expression of HMGB1-dependent inflammatory factors.

[0213] Rate of alleviation of HMGB1 / LPS-dependent inflammatory factor expression by small molecule compound # 61-ortho Inflammatory factor type # 61-ortho (μM) 0 2 5 5 0 1 0 2 5 TNF-α 100% 77.27% 70.17% 60.94% 43.71% IL-6 100% 62.77% 66.58% 45.51% 24.66% IL-1β 100% 75.58% 69.67% 64.30% 40.55% COX-2 100% 81.36% 88.08% 60.10% 41.78%

[0214]

[0215] <Experimental Example 5> Toxicity Evaluation of Low-Molecular-Weight Compound #61-ortho on Immune Cells

[0216] To demonstrate that the effect of low-molecular-weight compound # 61-ortho on the expression / secretion of inflammatory factors is independent of the toxic effect on immune cells, RAW 264.7 cells, which are immune cells that were not stimulated with HMGB1 and LPS, were treated with low-molecular-weight compound # 61-ortho at various concentrations and cultured for 24 hours, and the viability of immune cells was analyzed using the CCK-8 assay. For this, 1 X 10 RAW 264.7 cells were seeded in a 96-well plate. 4 Cells were placed per well and cultured for 24 hours in a humidified incubator (37°C, 5% CO2). When the cells reached 80% or more confluence, small molecule drug treatment experiments were initiated. Cells were washed twice with PBS. Cells were treated for 24 hours by dividing them into a group treated with only the culture medium and a group treated with drugs prepared by dissolving small molecule compounds in the medium at different concentrations. All media and drugs treated with the cells were removed and washed twice with PBS. 100 μL of the medium containing 10% of the previously prepared CCK-8 solution was added to each cell and the cells were incubated for 2 hours in a humidified incubator (37°C, 5% CO2). The absorbance of the 96-well plate was checked at 450 nm using a plater reader.

[0217] As shown in Figure 9, it was confirmed that there was no change in survival rate by the low-molecular-weight compound #61-ortho at concentrations up to 500 μM compared to the control group. In addition, as shown in Figure 10, there was almost no change in the morphology of immune cells at this time.

[0218] <Experimental Example 6> Toxicity Evaluation of Low-Molecular-Weight Compound #61-ortho on Intestinal Epithelial Cells

[0219] To evaluate the toxicity of low-molecular-weight compound #61-ortho in intestinal epithelial cells, Caco-2 cells were treated with low-molecular-weight compound #61-ortho at various concentrations, cultured for 24 hours, and the viability was analyzed using the CCK-8 assay. For this purpose, 1 X 10 Caco-2 cells were seeded in a 96-well plate. 4 Cells were plated at a ratio of cells / well and cultured for 24 hours in a humidified incubator (37°C, 5% CO2). When the cells reached 80% or more confluence, a small molecule drug treatment experiment was initiated. The cells were washed twice with PBS. The cells were divided into a group treated with only the culture medium and a group treated with drugs prepared by dissolving small molecule compounds in the medium at different concentrations, and the cells were treated for 24 hours. All the medium and drugs treated with the cells were removed and washed twice with PBS. 100 μL of the medium containing 10% of the previously prepared CCK-8 solution was added to each cell and the cells were reacted for 2 hours in a humidified incubator (37°C, 5% CO2). The absorbance of the 96-well plate was checked at 450 nm using a plate reader.

[0220] As shown in Figure 11, it was confirmed that there was no change in viability by the low-molecular-weight compound #61-ortho at concentrations up to 1000 μM compared to the control group (0 μM). In addition, there was no change in the morphology of intestinal epithelial cells at this time.

[0221] <Experimental Example 7> Confirmation of the binding affinity of seven low-molecular-weight compounds to HMGB1.

[0222] SPR analysis was performed to determine whether the drug binds to HMGB1. To this end, the binding affinity of glycyrrhizin, #1-1, #1-2, #59, #61-ortho, #61-meta, #61-para, and #99 as analytes to the ligands Human HMGB1 and Mouse HMGB1 was confirmed through SPR analysis. The ligands were bound to the chip in a directionally aligned state using the His-tag binding method, and then the analytes were flowed through for analysis.

[0223] As shown in Table 11, mesalamine administered to patients with inflammatory bowel disease did not show any binding to HMGB1. Glycyrrhizin, known to have anti-inflammatory effects, is known to have a binding affinity of approximately 170 μM for the A box of HMGB1 and approximately 87 μM for the B box of HMGB1. In addition, the binding affinity of glycyrrhizin to the complete HMGB1 structure was measured to be K D Since the values ​​were measured to be over 200, no significant binding affinity values ​​could be measured. Meanwhile, low-molecular-weight compounds #1-1, #59, #61-ortho, etc. were confirmed to have excellent binding affinity to HMGB1.

[0224] Binding Affinity Evaluation of Human and Mouse HMGB1 Proteins with Low-Molecular-Weight Compounds LigandAnalyteKon (M-1S-1)Koff (S-1)Rmax (RU)K D Human HMGB1 mesalamine-unbound glycyrrhizin*- - 34.4*>200 μM*1-13.70 X 10 1 1.36 X 10 -3 35.036.8 μM592.08 X 10 1 1.91 X 10 -4 71.59.19 μM61-Ortho1.06 X 10 1 4.96 X 10 -4 1324.67 μM Mouse HMGB1 Mesalamine Unbound Glycyrrhizin*- -12.9*>200 μM*1-11.32 X 10 1 8.55 X 10 -4 84.464.9 μM591.42 X 10 1 4.07 X 10 -5 1562.88 μM61-Ortho1.27 X 10 1 6.58 X 10 -5 2115.16 μM* Glycyrrhizin Analysis Method: In the kinetic analysis method, there was almost no signal remaining in the dissociation region, making it difficult to evaluate the dissociation rate constant (Kd). This can be interpreted as an increase due to additional reactions at other sites of the ligand HMGB1 or interactions between the compounds through complex formation. Therefore, the steady-state affinity analysis method was used, but the steady-state affinity analysis method has the disadvantage of being less accurate than the kinetic analysis method. Except for glycyrrhizin, the remaining analytes were analyzed using the kinetic analysis method.

[0225]

[0226] <Experimental Example 8> Establishment of an animal model of ulcerative colitis induced by DSS and evaluation of the efficacy of drug #61-ortho

[0227] An animal model of ulcerative colitis was established through DSS drinking water. To this end, 7-week-old male C57BL / 6 mice were given 2.5% DSS (Dextran sodium sulfate) dissolved in drinking water. The mice were allowed free DSS drinking water for 5 days, and the small molecule compound #61-ortho was orally administered once daily during the same period (Fig. 12).

[0228] Next, to confirm the effect of the drug #61-ortho in an ulcerative colitis animal model, the body weight change graph and the intestinal length and spleen weight were compared in the ulcerative colitis animal model. For this, the control group (Normal) was provided with regular drinking water during the experimental period, and the control group (DSS) and the experimental group (mesalamine 50 mpk, #61-ortho 25 mpk, #61-ortho 50 mpk) were provided with drinking water containing 2.5% DSS for 5 days. The experimental group was administered the drug orally once daily during the experimental period. On the last day of the experiment (Day 5), the experimental animals were sacrificed, blood was collected, and the colon, spleen, kidney, and liver tissues were removed. The weight of the removed spleen and the length of the colon were measured.

[0229] As shown in Figure 13, no significant change in body weight was observed in any of the experimental animals.

[0230] After sacrificing each experimental animal, the colon length and spleen weight were compared in the ulcerative colitis animal model. As shown in Fig. 14, the colon length was shortened by approximately 1 cm and the spleen weight increased by approximately 18 mg in the DSS group, indicating that early ulcerative colitis was induced. Oral administration of 50 mg / kg mesalamine, a concentration prescribed to patients with inflammatory bowel disease, did not result in any improvement in colon length or spleen weight. On the other hand, oral administration of 25 mg / kg of the small molecule compound #61-ortho resulted in an improvement in colon length, but the difference was not statistically significant.

[0231] Histological analysis of intestinal tissue from an ulcerative colitis animal model was performed for each drug administration group. For this purpose, tissues were fixed in a 10% formalin solution for at least one day. The fixed tissues were washed for several hours. To dehydrate the tissues, they were sequentially soaked in ethyl alcohol for a set period of time to remove moisture. For transparency, the alcohol within the tissues was removed by soaking them in xylene. For embedding, the tissues were soaked in a paraffin solution to evaporate the solvent, and any voids within the tissues were filled with paraffin. The above process was performed using a Leica TP1020 semi-enclosed benchtop tissue processor (Leica Biosystems, Wetzlar, Hesse, Germany). The paraffinized tissues were placed in appropriate molds and filled with paraffin to create paraffin blocks suitable for sectioning. Sections were performed at 5 μm thickness using a Leica RM2145 microtome (Leica Biosystems). The sectioned tissue was floated in a gelatin solution to smooth out any wrinkles, placed on a glass slide, and the slide was allowed to dry sufficiently for several days.

[0232] Next, for structural analysis of intestinal tissue using H&E tissue staining, a small-molecule compound #61-ortho was administered orally for 5 days in an animal model of ulcerative colitis, and then the structural analysis of intestinal tissue using H&E tissue staining was evaluated. To this end, well-dried paraffin tissue on a glass slide was deparaffinized by immersing it in xylene. The immersion was changed from 100% alcohol to 70% alcohol and finally in tap water to hydrate it. Afterwards, it was immersed in a hematoxylin solution and, after a certain period of time, in tap water to rinse off any residual hematoxylin. It was then immersed in an eosin solution and rinsed with tap water as described above. The stained tissue was dehydrated by immersing it in a series of transitions from 70% alcohol to 100% alcohol. Finally, it was immersed in xylene to complete dehydration. After the staining and dehydration process, the mounting solution was dropped using a dropper and covered with a cover glass. The tissue was observed under a microscope.

[0233] Next, we compared the regenerative effects of intestinal tissue using immunostaining in an animal model of ulcerative colitis. For this purpose, well-dried paraffin tissue on glass slides was deparaffinized in xylene, then immersed in 100% alcohol, then 70% alcohol, and finally immersed in tap water for hydration. Cells were washed twice with PBS-Tween 20 for approximately 2 minutes each. Then, for blocking, cells were incubated in PBS-Tween 20 with 20% goat serum for 30 minutes at room temperature. Goat serum (20% in PBST-20) and the primary antibody, anti-mouse MUC-2, diluted 100:1, were incubated for 1 hour at room temperature. The slides were washed with PBS. The secondary antibody, goat anti-mouse-488, was diluted 1:200 in PBS and incubated with the cells. The slides were stored protected from light for 1 hour. Washed twice in PBS for 3 minutes each. One or two drops of DAPI mounting solution were added, covered with a cover slide, and observed under a confocal microscope.

[0234] As shown in Figure 15, in the group in which ulcerative colitis was induced (DSS), immune cell infiltration, destruction of the villus tissue, and fibrosis were observed. These results were observed at similar levels in the group that was orally administered 50 mg / kg of mesalamine. In contrast, in the groups that were orally administered 25 mg / kg or 50 mg / kg of the small-molecule compound #61-ortho, the structure of the colonic tissue was similar to that of healthy normal tissue (NOR), or a very low level of inflammatory response was observed.

[0235] Meanwhile, as indicated in the photograph of the normal (NOR) tissue in Fig. 15, the severity of the inflammatory response was evaluated from 0 to 4 points for each area, such as crypt architecture, inflammation infiltration, muscle thickness, and goblet cell depletion, and the sum of each item was calculated from 0 to 16 points.

[0236] As shown in Table 12, when mesalamine was administered at 50 mg / kg, no anti-inflammatory effect was observed even with short-term drug administration for 5 days, which means that mesalamine requires long-term administration to have an anti-inflammatory effect. On the other hand, when the small-molecular compound #61-ortho drug, which has a lower dose than mesalamine, was administered at 25 mg / kg, it was confirmed that the anti-inflammatory effect was very high, which means that even short-term administration of the drug has a significant anti-inflammatory effect.

[0237] Group Animal Individual Number Histological Evaluation (Histology Score) Item Sum (Total Score 16 points) Score Cryptographic Architecture Inflammation Infiltration Muscle Thickness Goblet Cell Depletion NOR (healthy) 1000000.0 200000 300000 400000 500000 DSS (colitis) 1221274.0 20100 1302114 40100 15221276 0110 270110 28220 159 22116 1012115 DSS / Mesalamine 50mg / kg1010013.72010013110024122165220266221277221058010019221271001001DSS / 61-ortho25mg / kg1010012.22010013010014111035 110026010017121048120149111141001001DSS / 61-ortho50mg / kg1010012.42010013010014010015000006121157010018010019221161022127

[0238]

[0239] <Experimental Example 9> Confirmation of intestinal mucosal MUC-2 using tissue immunohistochemistry (IHC)

[0240] The regenerative effects of intestinal tissue were compared through immunohistochemical staining in an animal model of ulcerative colitis. To this end, well-dried paraffin tissue on glass slides was deparaffinized in xylene, then immersed in 100% alcohol, then 70% alcohol, and finally immersed in tap water for hydration. Cells were washed twice with PBS-Tween 20 for approximately 2 minutes each. Cells were then incubated in PBS-Tween 20 with 20% goat serum for 30 minutes at room temperature for blocking. Goat serum (20% in PBST-20) and the primary antibody, anti-mouse MUC-2, diluted 100:1 were incubated for 1 hour at room temperature. The slides were then washed with PBS. The secondary antibody, goat anti-mouse-488, was diluted 1:200 in PBS and incubated with the cells. The slides were stored protected from light for 1 hour. Washed twice in PBS for 3 minutes each. One or two drops of DAPI mounting solution were added, covered with a cover glass, and observed under a confocal microscope.

[0241] As shown in Figure 16, in the normal (NOR) tissue, MUC-2 (red), a molecule that forms intestinal mucus by goblet cells, was sufficiently stained. On the other hand, in the group with an inflammatory response (DSS), MUC-2 (red, indicated by arrows) was hardly observed as goblet cells were destroyed. Meanwhile, MUC-2 was hardly observed in the group that was orally administered 50 mg / kg of mesalamine. On the other hand, in the group treated with 25 mg / kg or 50 mg / kg of the low-molecular-weight compound # 61-ortho, MUC-2 staining was observed in the goblet cell part that plays a role in mucus secretion. This means that the low-molecular-weight compound # 61-ortho helps regenerate intestinal tissue damaged by an inflammatory response. Therefore, it is expected that the small molecule compound #61-ortho (1) mediates the reactivation of Lgr5+ stem cells in the crypt region by suppressing the inflammatory response in the intestine, or (2) directly induces the proliferation of intestinal epithelial cells to help regenerate intestinal tissue.

[0242] In addition, Occludin immunostaining was performed to confirm the effect of the low-molecular-weight compound #61-ortho on maintaining tight junctions between cells in the colon tissue in an animal model of ulcerative colitis.

[0243] As shown in Fig. 17, green fluorescence of Occludin, which indicates tight junctions, was observed in normal (NOR) tissue. On the other hand, green fluorescence was not observed in the DSS group where inflammation occurred. Meanwhile, Occludin was barely visible in the group that was orally administered 50 mg / kg of mesalamine. On the other hand, occludin staining was observed in the groups treated with 25 mg / kg or 50 mg / kg of the small molecule compound #61-ortho. It appears that the small molecule compound #61-ortho helps maintain the tight junctions of cells in the intestinal tissue that are damaged by the inflammatory response and maintain the structure of the tissue.

[0244] <Experimental Example 10> Fluorescence imaging to confirm cellular uptake of #61-ortho

[0245] To determine whether 61-ortho is absorbed into cells and its dose-dependent uptake characteristics, the drug was labeled with a fluorescent label (FITC, fluorescein isothiocyanate), and its intracellular distribution was visually confirmed using a confocal microscope. The experimental method is as follows:

[0246] Cell lines: RAW 264.7 (mouse macrophage, P26) and M1-differentiated THP-1 (human monocyte, P23)

[0247] THP-1 cell differentiation method: M0 state differentiation was achieved by treating with Phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours. M0 cells were differentiated into M1 state by treating with interferon-γ (IFN-γ, 20 ng / mL) and lipopolysaccharide (LPS, 10 pg / mL) for 48 hours.

[0248] Drug: FITC-tagged 61-ortho

[0249] Tagging was performed through the reaction of FITC with the primary amine group in the drug molecule.

[0250] Drug treatment concentrations: 0 μM (negative control), 50 μM, 100 μM, 250 μM

[0251] Drug treatment time: 3 hours

[0252] Fluorescent staining and image processing

[0253] Nuclear staining: DAPI (Blue)

[0254] Drug visualization: FITC (Green)

[0255] Image acquisition: After Z-stack acquisition using a confocal laser scanning microscope, sliced ​​and stacked image analysis were performed.

[0256] As shown in Figure 18, in the case of RAW 264.7 cells, almost no intracellular green fluorescence was observed in the control group (0 μM). From the 50 μM treatment group, a weak fluorescence signal was observed in the cytoplasm, and punctate fluorescence was distributed around the nucleus. In the 100 μM and 250 μM treatment groups, strong green fluorescence was distributed throughout the cytoplasm, visually confirming that the drug was effectively introduced into the cells. In particular, the stacked images clearly showed a dose-dependent intracellular accumulation of the drug. It has a distribution characteristic of being confined to the cytoplasm without passing through the nuclear membrane.

[0257] In the case of M1-differentiated THP-1, as shown in Figure 19, a morphology similar to that observed in Raw 264.7 cells was observed in M1-differentiated THP-1 cells. In the untreated group, almost no fluorescence signal was detected. At 50 μM treatment, weak punctate fluorescence appeared around the nucleus. In the 100 μM and 250 μM treatment groups, strong green fluorescence was distributed throughout the cytoplasm. Stacked images clearly observed a concentration-dependent intracellular accumulation, and the fluorescence was distributed confined to the cytoplasm rather than within the nucleus.

[0258] <Experimental Example 11> # Evaluation of the pharmacodynamic properties of 61-ortho

[0259] # 61-Ortho's in vivo pharmacokinetics (PK) characteristics were evaluated to elucidate the drug's absorption and distribution characteristics in the body via various administration routes (intravenous, intraperitoneal, and subcutaneous). Through this, the drug's bioavailability and duration of action (T₁ / ₂) were quantitatively analyzed, which was utilized as basic data for optimizing administration strategies and developing drug formulations.

[0260] Experimental animals: Male Sprague-Dawley rats (200-250 g, n=4 per group)

[0261] Route of drug administration and dosage: Intravenous (IV) (10 mg / kg), intraperitoneal (IP) (10 mg / kg), subcutaneous (SC) (20 mg / kg)

[0262] Blood collection times: 0.167, 0.5, 1, 1.5, 2, 4, 6, 8, and 10 hours after administration

[0263] Plasma Analysis: After sample preparation, plasma proteins were removed and concentrated. Blood drug concentrations were quantified using UPLC-MS / MS analysis. Precision was improved by using an internal standard (glycyrrhizin).

[0264] # 61-ortho(IV, 10mg / kg)Parameter#1#2#3#4MEANS.D.Tmax (h)0.501.000.170.500.540.34T1 / 2 (h)2.312.403.892.372.750.77Cmax (ng / mL)45464060563456634976802AUClast (h ng / mL)16452180372201221052193882589AUCINF (h ng / mL)17480186332629322177211463971

[0265] # 61-ortho(IP, 10mg / kg)Parameter#1#2#3#4MEANS.D.Tmax (h)1.501.501.501.501.500.00T1 / 2 (h)4.263.775.612.524.041.28Cmax (ng / mL)82995196312711004188AUClast (h ng / mL)3727391138503943385895AUCINF (h ng / mL)45214771522244294736355Bioavailability(%)19.220.219.920.319.90.49

[0266] # 61-ortho(SC, 20mg / kg)Parameter#1#2#3#4MEANS.D.Tmax (h)1.501.502.001.501.630.250T1 / 2 (h)2.662.941.696.483.442.10Cmax (ng / mL)77357763155563497.8AUClast (h ng / mL)24292363269420282378274AUCINF (h ng / mL)27342696277423662643187Bioavailability(%)6.266.096.955.236.130.71

[0267]

[0268] As shown in Tables 13 to 15, immediate high-concentration blood distribution was confirmed upon intravenous (IV) injection. Upon intraperitoneal (IP) injection, the maximum concentration was reached after gradual drug absorption (Cmax: 1004 ng / mL, Tmax: 1.5 hr), and the bioavailability was approximately 20%. The lowest bioavailability (Cmax: 634 ng / mL, bioavailability: 6.13%) was confirmed upon subcutaneous (SC) injection. The drug half-life in the body (T₁ / ₂) was confirmed to be 2.75-4.04 hr depending on the route. Although oral administration was not evaluated in this study, it suggests the possibility of reference for the development of non-injection formulations.

[0269] <Experimental Example 12> Gene expression regulation effect of #61-ortho under HMGB1 and LPS stimulation conditions through NGS analysis

[0270] # 61-Ortho's effect on the transcriptome of RAW 264.7 mouse macrophage cells was investigated, and changes in the expression of genes related to inflammatory responses and immune regulation were elucidated. Specifically, the drug's effects under HMGB1 stimulation were validated at the molecular level, and its mechanism of action and potential disease applications were assessed. The experimental method was as follows:

[0271] Cell line: RAW 264.7 (Mus musculus, macrophage)

[0272] Treatment conditions: Group 1 (negative control), Group 2 (HMGB1 treatment), Group 3 (HMGB1 + 61-Ortho), other groups (18 samples in total, including drug alone, LPS, and LPS + drug)

[0273] RNA analysis method: After total RNA extraction, mRNA was purified and a library was constructed. Paired-end RNA-seq (2x101 bp) was performed on the Illumina platform. Analysis tools included HISAT2 (mapping), StringTie (assembly), and DESeq2 (DEG analysis). The statistical criteria were |log₂FC| ≥ 1 and raw p < 0.05.

[0274] As shown in Figure 20, in the HMGB1-stimulated group, significant expression changes were confirmed in a total of 273 genes (DEGs). This was centered around downregulated genes, suggesting that some inflammatory genes induced by HMGB1 stimulation were suppressed. GO analysis revealed significant changes in immune-related biological processes such as inflammatory response, cell mobility, and cytokine signaling. KEGG analysis revealed a tendency for inhibition in cytokine-cytokine receptor interaction, Toll-like receptor signaling, and chemokine signaling pathways. Therefore, the drug's partial control of HMGB1-induced inflammatory response suggests the possibility of an anti-inflammatory effect in autoimmune and aseptic inflammatory conditions.

[0275] In addition, in the LPS-stimulated group, significant expression changes were confirmed in a total of 257 genes (DEGs). Similarly, many inflammation-related genes were downregulated, and some cellular metabolism and anti-stress-related genes were upregulated. GO analysis results showed changes in gene groups related to the innate immune response, inflammatory response, and NF-κB pathway. KEGG analysis results showed a tendency to suppress inflammatory signaling pathways such as NOD-like receptor signaling, MAPK signaling, and TNF signaling. Therefore, since the typical inflammatory gene activation induced by LPS was partially alleviated by the drug, it suggests the possibility of an anti-inflammatory effect under conditions similar to bacterial infection.

[0276] As described above, 61-Ortho exhibited significant inhibitory effects on inflammatory gene expression under both HMGB1 and LPS stimulation conditions, suggesting that the drug exerts common immunomodulatory functions across diverse inflammatory pathways. GO and KEGG analyses demonstrated that the drug selectively modulates key inflammatory pathways, including cytokine receptor signaling and the TLR / NOD / MAPK pathway.

[0277] As shown in Fig. 21a, a total of 223 genes satisfied the conditions when selecting genes with log2FC ≥ ±2 and p-value < 0.001. Among them, the top genes with large absolute log2FC values ​​included Ptger1, Ifit3b, Rsad2, Ifit3, Mx1, Cmpk2, Gbp2b, Gbp7, Ifit1, Gbp2, Gbp3, Ifit2, Ifit1bl2, Gm5431, Apol9b, Oasl2, Zbp1, Isg20, Cxcl10, and 9930111J21Rik1. Many of these genes are known to have functions closely related to immune and inflammatory responses, such as IFN signaling (Ifit family, Mx1, Rsad2), inflammation-related cytokines (Cxcl10), and apolipoprotein-related genes (Apol9b, etc.).

[0278] As shown in Fig. 21b, genes with log2FC ≥ ±2 and p-value < 0.001 were selected, and a total of 199 genes satisfying the above conditions were discovered. These include Gbp2, Gbp2b, Rsad2, Mx1, Cmpk2, Ifit3b, Ifit3, Ifit2, Gbp3, Kif5c, 9930111J21Rik1, Gbp9, Ifi47, Gbp7, Gm5431, 9930111J21Rik2, Isg20, Fcgr1, Hap1, and Phf11a. Many of the selected genes are related to IFN signaling and antiviral responses, and genes related to inflammation regulation and antibody-mediated responses were also identified, such as the GBP family (Gbp2, Gbp2b, Gbp3, Gbp7, Gbp9) (GTP-binding proteins that play an important role in controlling intracellular pathogens), the IFIT family (Ifit3b, Ifit3, Ifit2), Mx1, Rsad2 (representative antiviral genes by type I IFN response), Isg20, Ifi47 (immune-related genes that strongly respond to interferon stimulation), Fcgr1 (high-affinity Fc receptor), and Phf11a.

[0279] Based on the above DEG, referring to the volcano plot (Figs. 21a and 21b), the mechanism of action of 61-ortho can be considered as follows:

[0280] Inhibition of Type I Interferon (IFN-I) Signaling: Ifit1, Ifit2, Ifit3, Ifit3b, Ifit1bl2, Isg20, and Oasl2 are all antiviral genes induced by type I IFN. Inhibition of their expression indicates that the drug blocks or attenuates the IFN-I response induced by HMGB1 or LPS stimulation. This suggests the possibility of inhibition of the TBK1-IRF3 / 7 pathway. Therefore, the drug may act as an IFN-I pathway inhibitor or a negative regulator of viral mimicry / inflammatory signals.

[0281] Inhibition of guanylate-binding proteins (Gbps) expression: Gbp2, Gbp2b, Gbp3, and Gbp7 are GTPases induced by IFN-γ and IFN-I. They are involved in inflammatory responses, apoptosis, and immune defense. Inhibition of Gbps is associated with excessive immune cell activation or inhibition of pyroptosis. Therefore, the drug may contribute to the alleviation of inflammatory cell death (hypersensitivity response following PAMP / DAMP recognition).

[0282] Inhibition of the chemotactic gene (Cxcl10): Cxcl10 is a representative inflammatory chemokine induced in conjunction with the IFN-γ response. It plays a pathological role in autoimmune / inflammatory diseases by participating in the influx of T cells and NK cells. Therefore, the drug has the potential to limit immune cell infiltration into tissues and suppress tissue damage.

[0283] Inhibition of innate sensing elements such as Zbp1, Rsad2, and Mx1: Zbp1 is a Z-DNA / RNA recognition sensor that induces necroptosis and pyroptosis. Rsad2 (Viperin) and Mx1 are involved in activating virus-mimicking signaling. Therefore, drugs can inhibit nucleic acid-sensing-based innate immune sensing, blocking responses to DAMP / RNA-like stimuli.

[0284] In conclusion, #61-Ortho is a novel immunomodulatory agent that regulates type I IFN-based inflammatory signaling and excessive immune cell activation by suppressing the expression of interferon-stimulated genes (ISGs) and pyroptosis-related genes under HMGB1 or LPS stimulation conditions. In particular, downregulation of IFIT family members, GBPs, Zbp1, and Cxcl10 may contribute to the suppression of tissue damage in autoimmune or aseptic inflammatory diseases.

[0285] <Experimental Example 13> Anti-inflammatory and mucosal regeneration effects of #61-ortho in a DSS-induced chronic colitis mouse model

[0286] To evaluate the potential of #61-Ortho for the treatment of inflammatory bowel disease (IBD), we tested its anti-inflammatory and tissue regenerative effects in a chronic colitis model induced by repeated DSS administration. This allowed us to assess the drug's long-term anti-inflammatory effects and potential for tissue regeneration. The experimental method was as follows:

[0287] Animal model: C57BL / 6 mouse

[0288] Colitis induction method: 1–1.5% DSS was administered cyclically three times (5 days DSS + 5 days water). A chronic colitis model was created by repeatedly inducing inflammation for a total of 3 cycles.

[0289] Treatment groups: Healthy, DSS + Vehicle, DSS + Rinvoq (upadacitinib, UPA) 5 mg / kg (competitive drug), DSS + #61-ortho 5 mg / kg

[0290] Dosage: Orally administered daily after DSS induction.

[0291] Observational parameters: weight change, disease activity index (DAI), colon length, spleen weight, histopathology, and stem cell marker expression.

[0292] As shown in Figure 22, no significant difference in body weight was found between the groups.

[0293] The Disease Activity Index (DAI) is a comprehensive indicator that evaluates stool status, bleeding, and body weight. As shown in Figure 23, the #61-ortho group had a lower DAI score. When the clinical drug response rate (based on the DSS group, individuals with lower DAI scores were considered to have responded) was calculated based on the DAI score, it was 85% for Rinvoq and 100% for #61-ortho (Table 16).

[0294]

[0295]

[0296] In addition, colon length shortening was observed in the DSS model, and the #61-ortho treatment group showed a significant recovery effect (p<0.05). When the Healthy group was calculated as 1, the DSS, Rinvok, and #61-ortho treatment groups were confirmed to be 0.71 ± 0.03, 0.71 ± 0.03, and 0.87 ± 0.04, respectively. In other words, the drug group showed the greatest recovery (Fig. 24).

[0297] In the case of spleen weight, which is an indicator of systemic inflammation relief, splenomegaly was observed in the DSS model, and recovery of spleen weight was observed in the #61-ortho treatment group (Fig. 25).

[0298] In the case of intestinal mucosal recovery rate (verification of dextran permeability), it was confirmed that the dextran permeability was significantly increased in the DSS model, but it was found that the permeability was decreased in the Rinvoq and # 61-ortho treatment groups (p<0.001). In particular, it was found that the permeability was further decreased in the # 61-ortho treatment group compared to Rinvoq (p<0.001) (Fig. 26).

[0299] Group drug LGR5+ Stem cell BMI1 Stem cell Healthy-11 DSS vehicle 0.9 ± 0.1 0.3 ± 0.0 (3) Rinvoq 0.7 ± 0.1 0.2 ± 0.0 (4) 61-ortho 1.8 ± 0.2 (2) 0.8 ± 0.1 5,6 * Based on qRT-PCR analysis method

[0300]

[0301] In the case of LGR5 expression, the DSS-induced group and the Rinvoq-treated group showed a decrease in expression compared to the healthy group (approximately 0.9-fold and 0.7-fold, respectively). In the #61-ortho-treated group, LGR5 expression significantly increased compared to the DSS injury model, and was recovered or overexpressed to approximately 1.8-fold compared to the healthy group. Therefore, the induction of regeneration of active stem cells (LGR5 stem cells) of the intestinal epithelium was confirmed. In addition, in the case of Bmi1 expression, Bmi1 expression was significantly reduced in the DSS-induced group and the Rinvoq-treated group (0.2-0.3 levels). In the case of #61-ortho-treated group, Bmi1 expression was recovered to approximately 0.8-fold compared to the healthy group, confirming the recovery of reserve stem cells (Bmi1) (Table 17 and Figure 27).

[0302] As shown in Figure 28, histopathological analysis results showed that #61-ortho exhibited a stronger tissue protective effect than Rinvoq, as assessed by histological scores for lymphocyte infiltration, mucosal destruction, and epithelial damage. Specifically, when the recovery rate was calculated based on the scores of the DSS-induced group, #61-ortho demonstrated a superior recovery rate than Rinvoq:

[0303]

[0304] <Experimental Example 14> # 61-ortho-induced anti-inflammatory effect in non-polarized human immune cells

[0305] To evaluate the potential of #61-Ortho to modulate inflammatory immune responses, we established a model of HMGB1-induced inflammatory responses in unpolarized human-derived immune cells (M0 macrophages) and verified the drug's ability to alleviate HMGB1-mediated inflammation. This allowed us to assess #61-Ortho's ability to suppress early-stage inflammatory responses. The experimental methods are as follows:

[0306] Cell line: THP-1 (human monocyte)

[0307] THP-1 cell differentiation and treatment method: Differentiation to M0 state was achieved by treatment with Phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours.

[0308] Drug: #61-ortho

[0309] Drug treatment concentrations: 0.05, 0.1, 1, 5, 10, 25, 50, 100, 250 μM

[0310] Drug processing time: 24 hours

[0311] Treatment conditions: M0 + medium (negative control), M0 + HMGB1 (100 ng / mL) (positive control), M0 + HMGB1 + # 61-ortho

[0312] Analytical Method: After total RNA extraction, 1 μg of RNA was reverse transcribed into cDNA and subjected to qRT-PCR. GAPDH was used as an endogenous control. The primer sequences used are shown in Table 18.

[0313] Primer type Forward (5'-3) Reverse (3'-5')GAPDHATGCCTCCTGCACCACCAACTATGGCATGGACTGTGGTCATGAGTTNF-αCAGCAAGGGACAGCAGAGGAGTATGTGAGAGGAAGAGAACCIL-6TGATGAGGAACAAGCCAGAGATGCTACATTTGCCAAAGAGiNOSTCCAAATCTTGCCTGGGGTCAGAAGCTCATCTGGAGGGGT

[0314]

[0315] As shown in Figure 29, the expression of IL-6 increased approximately 40-fold compared to the M0 group when treated with HMGB1. In the #61-ortho treatment group, IL-6 expression decreased with increasing concentration, and was significantly suppressed by approximately 60% or more at 50 μM or higher. These results suggest that #61-ortho can effectively block IL-6 production induced by HMGB1 and alleviate the initial inflammatory response. In the case of TNF-α, the expression decreased as the concentration of #61-ortho increased in the HMGB1 treatment group, and was almost completely suppressed at 100 μM or higher, reaching a level similar to that of the M0 group. These results demonstrate that #61-ortho has a marked effect on suppressing HMGB1-induced inflammatory mediators. In addition, under HMGB1 treatment conditions, #61-ortho suppressed iNOS expression in a concentration-dependent manner, and was reduced by approximately 70% at 50 μM or higher. Considering that iNOS is a representative indicator of M1 macrophages, our results confirm that #61-ortho potently inhibits inflammatory macrophage activation.

[0316] <Experimental Example 15> # 61-ortho-induced anti-inflammatory effect in non-polarized human immune cells

[0317] To evaluate the efficacy of #61-Ortho in human immune cells, we established a model of an inflammatory response induced by LPS, a pathogen-associated molecular pattern (PAMP), in nonpolarized human immune cells and verified the drug's ability to alleviate LPS-mediated inflammation. This allowed us to assess #61-Ortho's potential to block TLR signaling pathways and modulate early inflammatory responses. The experimental methods were as follows:

[0318] Cell line: THP-1 (human monocyte)

[0319] THP-1 cell differentiation method: Differentiation to M0 state was achieved by treatment with Phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours.

[0320] Drug: #61-ortho

[0321] Drug treatment concentrations: 0.05, 0.1, 1, 5, 10, 25, 50, 100, 250 μM

[0322] Drug processing time: 24 hours

[0323] Treatment conditions: M0 + medium (negative control), M0 + LPS (10, 100 pg / mL) (positive control), M0 + LPS + # 61-ortho

[0324] Analytical Method: After total RNA extraction, 1 μg of RNA was reverse transcribed into cDNA and subjected to qRT-PCR. GAPDH was used as an endogenous control.

[0325] As shown in Fig. 30, when treated with 10 pg / mL of LPS, IL-6 expression in THP-1 and M0 cells rapidly increased, reaching approximately 9 times the level of M0 when treated with low-concentration LPS. When treated with # 61-ortho, expression decreased in proportion to the increasing concentration, and was suppressed by approximately 90% or more at 10 μM or higher. At 50 μM or higher, IL-6 levels recovered to similar levels of THP-1 and M0 basal levels. This suggests that # 61-ortho is excellent in suppressing IL-6 production in inflammatory responses induced by low-concentration LPS. In addition, TNF-α expression decreased in a concentration-dependent manner when treated with # 61-ortho, and decreased similarly to the level of the M0 group at 50 μM or higher. These results demonstrate that # 61-ortho can effectively suppress TNF-α production promoted by low-concentration LPS and alleviate inflammatory responses. Expression of iNOS increased approximately twofold compared to M0 when treated with low-concentration LPS. In the #61-ortho-treated group, expression tended to decrease at all concentrations. Considering that iNOS is a representative indicator of M1 macrophages, these results suggest that #61-ortho effectively suppresses inflammatory macrophage activation.

[0326] Also, when treated with 100 pg / mL of LPS, as shown in Fig. 31, IL-6 expression was significantly increased in the LPS (100 pg / mL) treatment group compared to the LPS (10 pg / mL) treatment group when compared to THP-1 and M0 cells, and was increased by about 110 times or more compared to M0. When treated with # 61-ortho, expression decreased in proportion to the concentration increase, and was inhibited by about 70% or more at 25 μM or higher. This suggests that # 61-ortho effectively blocks IL-6 production in the inflammatory response induced by high concentrations of LPS. In addition, TNF-α expression increased by about 2.5 times when treated with high concentrations of LPS in THP-1 and M0 cells. In the # 61-ortho treatment group, a concentration-dependent decrease was observed, and about 60% or more was inhibited at 50 μM or higher. These results demonstrate that #61-ortho effectively suppresses TNF-α expression increased by LPS stimulation, thereby blocking the TLR signaling pathway. The expression of iNOS increased approximately 2-fold compared to M0 when treated with LPS. #61-ortho suppressed iNOS expression in a concentration-dependent manner, with a decrease of approximately 60% at concentrations above 5 μM. iNOS is a representative biomarker of M1 macrophages, and these results suggest that #61-ortho effectively suppresses the activation of inflammatory macrophages.

[0327] <Experimental Example 16> # Inhibitory effect of 61-ortho on HMGB1-dependent inflammatory factor expression in activated human immune cells

[0328] To evaluate the potential of 61-Ortho to modulate inflammatory immune responses, we established a model of HMGB1-induced inflammatory responses in activated human-derived immune cells (M1 macrophages) and verified the drug's inhibitory effect on HMGB1-dependent inflammatory factor expression. The experimental method was as follows:

[0329] Cell line: THP-1 (human monocyte)

[0330] THP-1 cell differentiation method: M0 state differentiation was achieved by treating with phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours. Next, M0 cells were differentiated into M1 state by treating with interferon-γ (IFN-γ, 20 ng / mL) and lipopolysaccharide (LPS, 10 pg / mL) for 48 hours.

[0331] Drug: #61-ortho

[0332] Drug treatment concentrations: 0.05, 0.1, 1, 5, 10, 25, 50, 100, 250 μM

[0333] Drug processing time: 24 hours

[0334] Treatment conditions: M1 + medium (negative control), M1 + HMGB1 (100 ng / mL) (positive control), M1 + HMGB1 + # 61-ortho

[0335] Analytical Method: After total RNA extraction, 1 μg of RNA was reverse transcribed into cDNA and subjected to qRT-PCR. GAPDH was used as an endogenous control.

[0336] As shown in Figure 32, IL-6 expression was significantly increased about 150-fold in activated immune cells (M1) compared to non-polarized (M0) and THP-1 cells. When treated with HMGB1 alone, expression was further increased about 1.5-fold or more, and IL-6 expression was restored to the M1 group level at all concentrations when #61-ortho was treated concurrently. This suggests that #61-ortho effectively blocks the HMGB1-mediated increase in IL-6 expression by binding to HMGB1. In addition, TNF-α was approximately 2.2-fold higher in M1 cells compared to the M0 and THP-1 groups. When #61-ortho was co-treated with HMGB1, TNF-α decreased to the M1 level at all concentrations. These results demonstrate that #61-ortho effectively inhibits HMGB1-induced TNF-α expression. Expression of iNOS was increased approximately 1.8-fold and 3.2-fold in M0 and M1 cells, respectively, compared to THP-1. When #61-ortho was co-treated with HMGB1, expression decreased to the M1 cell level at all concentrations. iNOS is a representative biomarker of M1 macrophages, and these results suggest that #61-ortho effectively suppresses inflammatory macrophage activation.

[0337] <Experimental Example 17> # Inhibitory effect of 61-ortho on the expression of HMGB1-independent inflammatory factors in activated human immune cells

[0338] To evaluate the ability of #61-Ortho to modulate inflammatory immune responses, we established an LPS-induced inflammatory response model in activated human-derived immune cells (M1 macrophages) and verified the drug's efficacy in suppressing HMGB1-independent inflammatory factor expression. This also allowed us to evaluate #61-Ortho's ability to block TLR signaling pathways in inflammatory macrophages. The experimental methods are as follows:

[0339] Cell line: THP-1 (human monocyte)

[0340] THP-1 cell differentiation method: M0 state differentiation was achieved by treating with phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours. Next, M0 cells were differentiated into M1 state by treating with interferon-γ (IFN-γ, 20 ng / mL) and lipopolysaccharide (LPS, 10 pg / mL) for 48 hours.

[0341] Drug: #61-ortho

[0342] Drug treatment concentrations: 0.05, 0.1, 1, 5, 10, 25, 50, 100, 250 μM

[0343] Drug processing time: 24 hours

[0344] Treatment conditions: M1 + medium (negative control), M1 + LPS (10, 100 pg / mL) (positive control), M1 + LPS + # 61-ortho

[0345] Analytical Method: After total RNA extraction, 1 μg of RNA was reverse transcribed into cDNA and subjected to qRT-PCR. GAPDH was used as an endogenous control.

[0346] As shown in Figure 33, IL-6 expression in activated immune cells increased approximately 500-fold after treatment with 10 pg / mL of LPS compared to non-polarized and THP-1 cells. When treated with low-concentration LPS, it was expressed approximately 1.6-fold higher than that in M1. When treated with #61-ortho, the expression level gradually decreased with increasing concentration, and at 50 μM or higher, it became similar to the level of the M1 group. This suggests that #61-ortho is excellent in suppressing IL-6 production in an inflammatory response induced by low-concentration LPS. In addition, TNF-α expression was approximately 2.2-fold higher in M1 cells compared to M0 and THP-1 cells. The expression level decreased in a concentration-dependent manner with #61-ortho treatment, and recovered to the level of M1 cells at 50 μM or higher. These results demonstrate that #61-ortho effectively blocks the TLR signaling pathway by suppressing LPS-stimulated TNF-α expression. Expression of iNOS was approximately 1.8-fold and 3.2-fold higher in M0 and M1 cells, respectively, compared to THP-1. Treatment with #61-ortho at concentrations greater than 10 μM decreased iNOS expression, restoring it to the level of M1 cells. Considering that iNOS is a representative indicator of M1 macrophages, these results suggest that #61-ortho strongly inhibits inflammatory macrophage activation.

[0347] Also, as shown in Figure 34, when treated with 100 pg / mL of LPS, IL-6 expression increased approximately 26-fold compared to M1 and more than 400-fold compared to M0 when treated with high-concentration LPS. When treated with #61-ortho, there was almost no change at low concentrations, but IL-6 expression decreased rapidly at 25 μM and was suppressed by approximately 70% or more. At 250 μM, it recovered to a level almost identical to the M1 group level. This suggests that #61-ortho effectively blocks IL-6 production in inflammatory macrophages induced by high-concentration LPS. In addition, TNF-α expression was approximately 2-fold higher in M1 than in M0 and THP-1. When stimulated with high-concentration LPS, it further increased to approximately 2-fold compared to M1. #61-ortho showed a clear inhibitory effect at 50 μM or higher and reduced it to the M1 level. These results demonstrate that #61-ortho inhibits the TLR signaling pathway by suppressing TNF-α production stimulated by high concentrations of LPS. The expression of iNOS was observed to be approximately 1.8-fold and 3.2-fold higher in M0 and M1, respectively, compared to THP-1. The LPS-treated group showed an additional increase of approximately 1.5-fold compared to M1. #61-ortho suppressed expression in a concentration-dependent manner, and decreased by approximately 70% or more at concentrations of 0.1 μM or higher. When #61-ortho was treated at concentrations of 25 μM or higher, iNOS expression was significantly reduced and restored to the level of M1 cells. Considering that iNOS is a representative indicator of M1 macrophages, these results suggest that #61-ortho strongly inhibits inflammatory macrophage activation.

[0348] <Experimental Example 18> # 61-ortho toxicity evaluation against human immune cells

[0349] To confirm that the effect of #61-ortho on inflammatory factor expression in human immune cells was independent of cytotoxicity, THP-1 cells were treated with various concentrations of #61-ortho without HMGB1 or LPS stimulation, cultured for 24 hours, and cell viability was assessed using the CCK-8 assay. The experimental method was as follows:

[0350] Cell line: THP-1 (human monocyte)

[0351] THP-1 cell differentiation method: The cells were differentiated into the M0 state by treating with phorbol 12-myristate 13-acetate (PMA, 100 ng / mL) for 24 hours. Then, the M0 cells were differentiated into the M1 state by treating with interferon-γ (IFN-γ, 20 ng / mL) and lipopolysaccharide (LPS, 10 pg / mL) for 48 hours.

[0352] Treatment groups: M0 negative control, M0 + 61-ortho 25, 50, 100, 250, 500, 1000, 2500 μM, M1 negative control, M1 + #61-ortho 25, 50, 100, 250, 500, 1000, 2500 μM

[0353] As shown in Figure 35, no significant change in cell viability was observed compared to the control group even when THP-1 M0 cells were treated with #61-ortho at a concentration of up to 500 μM. In addition, the immune cell morphology of the group treated with #61-ortho at 500 μM in THP-1 M0 cells also showed almost no change compared to the untreated group (Figure 36).

[0354] In addition, as illustrated in Figure 37, no significant difference in cell viability was observed compared to the control group when #61-ortho was treated in THP-1 M1 cells at a concentration of up to 500 μM. In addition, even when #61-ortho was treated in THP-1 M1 cells at a concentration of 500 μM, almost no morphological changes in immune cells were observed compared to the untreated group (Figure 38).

[0355] The low molecular weight compounds of the present invention can be used to treat inflammatory bowel disease.

Claims

1. A compound of the following chemical formula 1: [Chemical Formula 1] Here, R1 is hydroxyl or And, R2 and R3 are each independently hydrogen, hydroxyl or carboxyl, X represents a carbon or nitrogen atom.

2. In paragraph 1, If X is a carbon atom, R1 is hydroxyl or A compound wherein R2 and R3 are each independently hydrogen, hydroxyl or carboxyl.

3. In paragraph 1, If X is a carbon atom, R1 is hydroxyl or A compound wherein at least one of R2 and R3 is carboxyl.

4. In paragraph 1, A compound in which, when X is a nitrogen atom, R1 is hydroxyl and at least one of R2 and R3 is carboxyl.

5. In paragraph 1, The compound of formula 1 is any one of the compounds of formulae 1a to 1g below: [Chemical Formula 1a] [Chemical Formula 1b] [Chemical Formula 1c] [Chemical Formula 1d] [Chemical Formula 1e] [Chemical formula 1f] [Chemical formula 1g] 6. In paragraph 1, A compound having binding affinity to HMGB1 (high mobility group box 1).

7. In paragraph 1, A compound that inhibits the expression of any one of the inflammatory factors TNF-α, IL-1β, IL-6, COX-2, CXCL2 or iNOS.

8. A composition for preventing or treating inflammatory bowel disease comprising the compound of paragraph 1.

9. In paragraph 8, A composition for the prevention or treatment of inflammatory bowel disease, wherein the inflammatory bowel disease is either Crohn's disease or ulcerative colitis.

10. In paragraph 8, A composition for preventing or treating inflammatory bowel disease is a composition for preventing or treating inflammatory bowel disease for oral administration.

11. A method for treating inflammatory bowel disease, comprising administering a therapeutically effective amount of the compound of claim 1 to a subject in need thereof.

Citation Information

Patent Citations

  • Orally absorbable small molecule for treatment of inflammatory bowel disease and use thereof

    KR102730443B1

  • AMIDE β GLYCIRRHIZIC ACID WITH PHENYLBORON ACID SHOWING ANTIINFLAMMATORY AND ANTIULCEROUS ACTIVITY

    RU2032694C1