Composition for prevention, amelioration, or treatment of gastrointestinal diseases, comprising lysimachia mauritiana extract as active ingredient

The extract of Lysimachia mauritiana addresses gastrointestinal issues by reducing gastric lesions and inflammation, and enhancing antioxidant enzyme expression, offering a comprehensive solution for gastric protection.

WO2026054422A1Undetermined Publication Date: 2026-03-12KOREA INST OF ORIENTAL MEDICINE
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
WO2026054422P0
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Current compositions do not effectively address gastrointestinal diseases caused by non-steroidal anti-inflammatory drugs (NSAIDs) that inhibit cyclooxygenase (COX) enzymes, leading to gastric ulcers, gastritis, and bleeding, as they primarily target COX-2 while inhibiting COX-1, which protects the gastrointestinal mucosa.

Method used

A pharmaceutical, health functional food, and veterinary composition containing an extract of Lysimachia mauritiana, which reduces gastric lesion indices, histamine and cAMP levels, and increases expression of antioxidant enzymes like SOD-1, SOD-2, and Catalase, providing gastric protection.

Benefits of technology

The extract of Lysimachia mauritiana significantly reduces gastric mucosal damage, decreases inflammatory cytokines, and enhances antioxidant enzyme expression, effectively treating and preventing gastrointestinal disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025013262_12032026_PF_FP_ABST
    Figure KR2025013262_12032026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for the prevention, amelioration, or treatment of gastrointestinal diseases, the composition comprising a Lysimachia mauritiana extract as an active ingredient, wherein the administration of the Lysimachia mauritiana extract significantly reduces a gastric lesion index caused by gastric mucosal damage, reduces histamine and cAMP content which cause excessive acid secretion and mucosal damage under gastric irritation or inflammatory conditions, decreases gene expression levels of inflammatory cytokines in the gastric mucosa, and increases the gene expression levels of genes exhibiting antioxidant effects and genes having gastroprotective functions in the gastric mucosa, and therefore the present invention can be effectively used as a pharmaceutical, health functional food, or feed additive for gastrointestinal diseases caused by gastric mucosal damage.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for preventing, improving or treating gastrointestinal diseases containing extract of the magpie beard as an active ingredient

[0001] The present invention relates to a composition for preventing, improving or treating gastrointestinal diseases, containing an extract of Lysimachia mauritiana as an active ingredient.

[0002] This invention was carried out with the support of the Ministry of Science and ICT's Biomedical Technology Development Project (Project No. 2710069506) and the Ministry of Science and ICT's Korea Institute of Oriental Medicine Research Operation Support Project (Project No. 1711100504).

[0003] When food enters the stomach, it secretes gastric acid, a strong acid, to digest it. During this process, the mucosal protective layer acts to protect the gastric mucosa from damage by the gastric acid. Factors that adversely affect the function of the human gastrointestinal system are extremely diverse in nature. For example, non-steroidal anti-inflammatory drugs (NSAIDs), such as aspirin and indomethacin, cause continuous oxidative stress on the gastric mucosa or form oxidative radicals through metabolism in the body, causing gastric ulcers, gastritis, and gastric bleeding. The side effects of NSAIDs on the gastrointestinal tract are mainly caused by inhibition of cyclooxygenase (COX). COX is an enzyme that converts arachidonic acid into PG and thromboxane, the first step in the prostaglandin (PG) biosynthesis process. The PGs mainly produced in the stomach and duodenum are PGE2, I2, and F2α, which promote the production of mucus and bicarbonate, regulate blood circulation in the mucosa, protect the mucosal damage, preserve the mucosal barrier of the stomach, and promote cell proliferation. Most NSAIDs inhibit PG production by inhibiting COX, the rate-limiting enzyme for PG production. This effect mainly appears through systemic actions rather than local effects of NSAIDs. Currently, two isoforms of COX are known, COX-1 and COX-2. COX-1 is a constitutive enzyme that is expressed in most tissues of the body and acts as a "house-keeping gene", thereby protecting the gastrointestinal mucosa, regulating blood flow to the kidneys, and maintaining platelet function. On the other hand, COX-2 is an induced enzyme and is not expressed in most tissues under normal conditions, but its expression increases when inflammation occurs in these tissues.According to the "COX-2 hypothesis," the therapeutic effect of NSAIDs is mainly achieved by inhibition of COX-2, and inhibition of COX-1 is reported to cause side effects in the gastrointestinal tract.

[0004] Meanwhile, Lysimachia mauritiana is a plant in the Primula family, also known as Geumgachisuyeong and Geumjolssalpul. It is a dicotyledonous plant found in rocky coastal areas in southern regions, including Jeju Island and Ulleungdo Island. Its young leaves are edible, and its fruit is used for ornamental purposes. The flowers are white, 10-12 mm in diameter, and bloom in racemes at the ends of branches from May to July. The fruit is a round capsule, 4-6 mm in diameter, and when ripe in July and August, a small hole is made in the top to release the seeds. In oriental medicine, it is used as a cardiotonic and diuretic, and is known to be effective for high blood pressure, diabetes, edema, and bruises.

[0005] As for prior art related to the sea squirt, Korean Patent Publication No. 2023-0103836 discloses a 'composition for preventing, improving or treating metabolic diseases containing a sea squirt extract as an active ingredient', and Korean Patent Publication No. 2023-0161341 discloses a 'composition for preventing, improving or treating arthritis and joint pain containing a sea squirt extract as an active ingredient'. However, no composition for preventing, improving or treating gastrointestinal diseases containing the sea squirt extract of the present invention as an active ingredient has been disclosed to date.

[0006] The present invention was derived from the above needs, and the present invention provides a composition for preventing, improving or treating gastric diseases containing an extract of the sedge ...

[0007] To achieve the above purpose, the present invention provides a pharmaceutical composition for preventing or treating gastrointestinal diseases containing an extract of Lysimachia mauritiana as an active ingredient.

[0008] In addition, the present invention provides a health functional food composition for preventing or improving gastrointestinal diseases containing an extract of Lysimachia mauritiana as an effective ingredient.

[0009] In addition, the present invention provides a feed additive for preventing or improving gastrointestinal diseases containing an extract of Lysimachia mauritiana as an effective ingredient.

[0010] In addition, the present invention provides a veterinary composition for preventing or treating gastrointestinal diseases containing an extract of Lysimachia mauritiana as an active ingredient.

[0011] The present invention relates to a composition for preventing, improving or treating gastric diseases containing an extract of the scutellaria root as an effective ingredient, wherein the administration of the extract of the scutellaria root significantly reduces the gastric lesion index caused by gastric mucosal damage, and not only reduces the contents of histamine and cAMP, which cause a lot of acid secretion and mucosal damage in a state of gastric stimulation or inflammation, but also has the effect of reducing the gene expression level of inflammatory cytokines in the gastric mucosa and increasing the expression level of genes exhibiting an antioxidant effect and genes having a gastric protective function in the gastric mucosa.

[0012] Figure 1 shows (A) a photograph of the gastric mucosa and (B) a gastric lesion index as a result of confirming the degree of gastric mucosal damage after orally administering the extract of the scutellaria baicalensis of the present invention to an animal model in which gastric mucosal damage was induced. Con is a control group in which gastric mucosal damage was induced, PC is a positive control group administered 5 mg / kg of famotidine, and scutellaria baicalensis is a group administered 200 mg / kg of the scutellaria baicalensis extract according to the present invention. *, ** indicate that the degree of gastric mucosal damage in the positive control group (PC) or the group administered with the scutellaria baicalensis extract of the present invention was statistically significantly reduced compared to the control group (Con), and * indicates p<0.05 and ** indicates p<0.01.

[0013] Figure 2 shows the results of confirming the changes in the expression levels of (A) inflammatory cytokines (TNF-α, IL-6), (B) histamine and cAMP, which are factors related to gastric juice secretion, and (C) PGE2, a gastric mucosal protective factor, after orally administering the extract of the scutellaria baicalensis of the present invention to an animal model in which gastric mucosal damage was induced. Nor is the normal group, Con is the control group in which gastric mucosal damage was induced, PC is the positive control group that was administered 5 mg / kg of famotidine, and scutellaria baicalensis is the group that was administered the extract of the scutellaria baicalensis of the present invention at a dose of 200 mg / kg. #, ##, ### indicate that the expression levels of inflammatory cytokines (TNF-α, IL-6), histamine, cAMP, and PGE2 in the control group (Con) were statistically significantly increased or decreased compared to the normal group (Nor), and # indicates p<0.05, ## indicates p<0.01, and ### indicates p<0.001. * indicates that the expression levels of inflammatory cytokines (TNF-α, IL-6), histamine, cAMP, and PGE2 in the positive control group (PC) or the group administered with the Magpie's Beard extract of the present invention were statistically significantly decreased or increased compared to the control group (Con), and p<0.05.

[0014] Figure 3 shows the results of confirming the change in the mRNA expression levels of SOD-1, SOD-2, and Catalase in the gastric mucosa after oral administration of the extract of the scutellaria baicalensis of the present invention to an animal model in which gastric mucosal damage was induced. Nor is a normal group, Con is a control group in which gastric mucosal damage was induced, PC is a positive control group that was administered 5 mg / kg of famotidine, and scutellaria baicalensis is a group that was administered 200 mg / kg of the extract of the scutellaria baicalensis of the present invention. #, ## indicate that the change in the mRNA expression levels of SOD-1, SOD-2, and Catalase in the control group (Con) was statistically significantly reduced compared to the normal group (Nor), and # indicates p<0.05 and ## indicates p<0.01. *, ** indicate that the mRNA expression levels of SOD-1, SOD-2, and Catalase in the positive control group (PC) or the group administered with the extract of the sea bream of the present invention were statistically significantly increased compared to the control group (Con). * indicates p<0.05, and ** indicates p<0.01.

[0015] The present invention relates to a pharmaceutical composition for preventing or treating gastrointestinal diseases containing an extract of Lysimachia mauritiana as an active ingredient.

[0016] The above-mentioned extract of the magpie beard may be any one extract selected from the above-ground part, underground part and whole plant, and is preferably an extract of the magpie beard leaf, but is not limited thereto.

[0017] The extraction solvent of the above sea bream extract is preferably water, a C1 to C4 lower alcohol, or a mixture thereof, more preferably ethanol, and even more preferably 50% (v / v) ethanol, but is not limited thereto.

[0018] In the method for producing the above extract, the extraction of the sea squirt baleen can be performed using any conventional method known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The extraction solvent is preferably added in an amount of 1 to 25 times the weight of the sea squirt baleen, more preferably 5 to 20 times, and the extraction temperature is preferably 20 to 110°C, but is not limited thereto. The extraction time is preferably 0.5 to 10 hours, and more preferably 0.5 to 5 hours, but is not limited thereto. Concentration under reduced pressure is preferably performed using a vacuum reduced pressure concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, drying is preferably performed by reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

[0019] The above gastric disease may preferably be a gastric disease caused by damage to the gastric mucosa, and more preferably, it may be any one selected from acute gastritis, chronic gastritis, chronic active gastritis, chronic atrophic gastritis, gastric ulcer, gastric bleeding, and gastric perforation caused by damage to the gastric mucosa, but is not limited thereto. The above gastric mucosa damage may be damage caused by alcohol, but is not limited thereto.

[0020] The composition of the present invention can be prepared in any one formulation selected from capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols, but is not limited thereto.

[0021] The composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent in addition to the above-mentioned effective ingredient, and may be in various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include capsules, powders, granules, tablets, pills, etc., and these solid preparations are prepared by mixing one or more compounds with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, emulsions, syrups, and aerosols. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilizers, and suppositories. Non-aqueous solvents and suspending agents can be propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0022] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The level of the effective amount may be determined based on factors including the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0023] The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and disease severity. The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

[0024] The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by topical application to the skin, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

[0025] In addition, the present invention relates to a health functional food composition for preventing or improving gastrointestinal diseases containing an extract of Lysimachia mauritiana as an effective ingredient.

[0026] The above gastric disease may preferably be a gastric disease caused by damage to the gastric mucosa, and more preferably, it may be any one selected from acute gastritis, chronic gastritis, chronic active gastritis, chronic atrophic gastritis, gastric ulcer, gastric bleeding, and gastric perforation caused by damage to the gastric mucosa, but is not limited thereto. The above gastric mucosa damage may be damage caused by alcohol, but is not limited thereto.

[0027] The above composition is preferably prepared in any one of the following dosage forms: powder, granules, pills, tablets, capsules, candies, syrups, and beverages, but is not limited thereto.

[0028] When the health functional food composition of the present invention is used as a food additive, the effective ingredient may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method. The amount of the effective ingredient mixed may be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range, and since there is no problem in terms of safety, the effective ingredient may also be used in an amount exceeding the above range.

[0029] There are no specific restrictions on the types of the above foods. Examples of foods to which the above active ingredients can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and all health functional foods in the conventional sense are included.

[0030] When the composition of the present invention is used as a health beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates mentioned above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclotensin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 g of the composition of the present invention. The composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These components may be used independently or in mixtures. The proportion of these additives is not particularly important, but the composition of the present invention is typically selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight.

[0031] In addition, the present invention relates to a feed additive for preventing or improving gastrointestinal diseases containing an extract of Lysimachia mauritiana as an effective ingredient.

[0032] The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act. The term 'feed' in the present invention may mean any natural or artificial diet, meal, etc., or ingredients of the meal, which are suitable for or intended for animals to eat, ingest, and digest. The type of the feed is not particularly limited, and feed commonly used in the relevant technical field may be used. Non-limiting examples of the feed include plant feeds such as grains, roots, fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal, or grain by-products; and animal feeds such as proteins, inorganic substances, oils and fats, mineral substances, oils and fats, single-cell proteins, zooplankton, or food. These may be used alone or in combination of two or more.

[0033] In addition, the present invention relates to a veterinary composition for preventing or treating gastrointestinal diseases containing an extract of Lysimachia mauritiana as an active ingredient.

[0034] The veterinary composition of the present invention may further comprise suitable excipients and diluents according to conventional methods. Excipients and diluents that may be included in the veterinary composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, cetanol, stearyl alcohol, liquid paraffin, sorbitan monostearate, polysorbate 60, methylparaben, propylparaben, and mineral oil. The veterinary composition according to the present invention may further include fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, etc., and the veterinary composition according to the present invention may be formulated using a method well known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to an animal, and the formulation may be in the form of powders, granules, tablets, capsules, suspensions, emulsions, solutions, syrups, aerosols, soft or hard gelatin capsules, suppositories, sterile injectable solutions, sterile topical preparations, etc. The effective amount of the veterinary composition according to the present invention may be appropriately selected depending on the individual animal. It may be determined according to factors including the severity of the disease or condition, the sensitivity to the active ingredient of the present invention depending on the age, weight, health condition or sex of the individual, the route of administration, the period of administration, other compositions combined with or used simultaneously with the composition, and other factors well known in the physiological or veterinary fields.

[0035]

[0036] Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0037]

[0038] Example 1. Preparation of Magpie Beard Extract

[0039] 15 ℓ of 50% (v / v) ethanol was added to 1 kg of the leaves of the Magpie beard plant, extracted at 85℃ for 3 hours, filtered, and then concentrated under reduced pressure and dried at 45℃ to obtain the Magpie beard leaf extract.

[0040]

[0041] Example 2. Confirmation of the effect of the extract of the magpie beard on suppressing gastric mucosa damage.

[0042] The test animals were 7-week-old male ICR mice. After acclimation for 7 days, they were randomly divided into groups of 5. 200 mg / kg of the extract of the scutellaria baicalensis and the positive control group [5 mg / kg of famotidine] were administered once a day for 5 times. Each test substance and control drug were orally administered for 5 days, and 50% (v / v) ethanol was orally administered 1 hour later. On the 5th day, 50% (v / v) ethanol was administered, and 1 hour later, the mice were anesthetized with avertine. The stomachs were removed and the gastric mucosa was photographed. The area of ​​the damaged area was analyzed using Image J software (NIH, Bethesda, MD).

[0043] Gastric lesion index = [gastric lesion area / total gastric area] × 100

[0044] As a result, as disclosed in Fig. 1, it was confirmed that the gastric mucosal lesions in the group administered with the extract of the sea squirt of the present invention were significantly reduced.

[0045]

[0046] Example 3. Confirmation of the anti-inflammatory and gastric mucosal protective effects of the extract of the magpie beard.

[0047] The expression levels of inflammatory cytokines (TNF-α, IL-6), histamine and cAMP, which are factors related to gastric juice secretion, and PGE2, a gastric mucosal protective factor, were confirmed in the blood or gastric tissue of experimental animals using the ELISA technique.

[0048] As a result, in the control group (Con) where the gastric mucosa was damaged by alcohol, the inflammatory cytokines TNF-α and IL-6 increased, but in the positive control group (PC) or the group administered the Magpie Whisker extract, the production of the inflammatory cytokines TNF-α and IL-6 was reduced, inhibiting the inflammatory-mediated response. In addition, in the control group (Con), histamine and cAMP secretion, which promote gastric juice secretion and cause mucosal damage, increased, and were significantly reduced by the positive control group (PC) or the administration of the Magpie Whisker extract. The PGE2 content, which plays a role in protecting the gastric mucosa by increasing mucus and blood flow as a cytoprotective substance, decreased in the control group (Con), whereas it increased by the administration of the positive control group (PC) or the Magpie Whisker extract, confirming the effect of the Magpie Whisker extract in reducing gastric mucosal damage and protecting the mucosa (Fig. 2).

[0049]

[0050] Example 4. Confirmation of the effect of the extract of the magpie beard on antioxidant enzymes.

[0051] In the stomach tissue of experimental animals, the mRNA expression levels of SOD-1, SOD-2, and Catalase, which are related to antioxidant activity, were confirmed.

[0052] Primer sequences of SOD-1, SOD-2, Catalase, and GAPDH. Gene name. Direction. Sequence (5' → 3'). Sequence number. SOD-1. Forward. AACCAGTTGTGTTGTCAGGAC1. SOD-1. Reverse. CCACCATGTTTCTTAGAGTGAGG2. SOD-2. Forward. CAGACCTGCCTTACGACTATGG3. SOD-2. Reverse. CTCGGTGGCGTTGAGATTGTT4. Catalase. Forward. AGCGAGATCAGATGAAGCAGTG5. Catalase. Reverse. TCCGCTCTCTGTCAAAGTGTG6. GAPDH. Forward. CATACCAGGAAATGAGCTTG7. GAPDH. Reverse. ATGACATCAAGAAGGTGGTG8.

[0053] As a result, as disclosed in Fig. 3, in the control group (Con) in which the gastric mucosa was damaged by alcohol, the mRNA expression levels of SOD-1, SOD-2, and Catalase decreased, but in the positive control group (PC) or the group administered with the extract of the sea squirt of the present invention, the mRNA expression levels of SOD-1, SOD-2, and Catalase increased.

Claims

1. A pharmaceutical composition for the prevention or treatment of gastrointestinal diseases containing an extract of *Lysimachia mauritiana* as an active ingredient.

2. A pharmaceutical composition for the prevention or treatment of gastrointestinal diseases according to claim 1, characterized in that the sea aster extract is a sea aster leaf extract.

3. A pharmaceutical composition for preventing or treating gastrointestinal diseases, characterized in that the extraction solvent of the extract of the sea squirt is one selected from water, C1 to C4 lower alcohols, and mixtures thereof in the first paragraph.

4. A pharmaceutical composition for preventing or treating a gastrointestinal disease, characterized in that in paragraph 1, the gastrointestinal disease is any one selected from among acute gastritis, chronic gastritis, chronic active gastritis, chronic atrophic gastritis, gastric ulcer, gastric bleeding, and gastric perforation caused by damage to the gastric mucosa.

5. A pharmaceutical composition for the prevention or treatment of gastrointestinal diseases, characterized in that, in paragraph 4, the gastric mucosal damage is damage caused by alcohol.

6. A pharmaceutical composition for preventing or treating gastrointestinal diseases, characterized in that the composition is prepared in any one formulation selected from among capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols in the first paragraph.

7. A pharmaceutical composition for preventing or treating gastrointestinal diseases, characterized in that in paragraph 1, the composition further comprises a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient.

8. A health functional food composition for the prevention or improvement of gastrointestinal diseases containing an extract of *Lysimachia mauritiana* as an active ingredient.

9. A health functional food composition for preventing or improving gastrointestinal diseases, characterized in that in paragraph 8, the gastrointestinal disease is any one selected from among acute gastritis, chronic gastritis, chronic active gastritis, chronic atrophic gastritis, gastric ulcer, gastric bleeding, and gastric perforation caused by damage to the gastric mucosa.

10. A health functional food composition for the prevention or improvement of gastrointestinal diseases, characterized in that, in claim 9, the gastric mucosal damage is damage caused by alcohol.

11. A health functional food composition for preventing or improving gastrointestinal diseases, characterized in that the composition is manufactured in any one formulation selected from powder, granules, pills, tablets, capsules, candy, syrup, and beverage in the 8th paragraph.

12. A feed additive for the prevention or improvement of gastrointestinal diseases containing Lysimachia mauritiana extract as an active ingredient.

13. A veterinary composition for the prevention or treatment of gastrointestinal diseases containing an extract of *Lysimachia mauritiana* as an active ingredient.

Citation Information

Patent Citations

  • Method and appratus for determining travel sensibility feature of travel destination based on artificial intelligence

    KR1020240082170A

  • Spray cooling type dust collecting duct of iron-making equipment

    KR102672375B1

  • Mobile medical image device for providing digital tomosynthesis including improved source arm

    KR102686159B1

  • KR20210087405A