Engineered cells comprising a DLL3 binding receptor or a p53 r175h binding receptor

Engineered immune cells with a DLL3 binding receptor and CARD domain address the limitations of CAR-T therapies by enhancing T cell persistence and safety, effectively targeting solid tumors with reduced exhaustion and adverse events.

WO2026058219A1PCT designated stage Publication Date: 2026-03-19MOONLIGHT BIO INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/059211
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-06-26
Filing Date
2025-09-13
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Existing engineered T cell therapies, such as CAR-T cell therapies, face challenges in effectively targeting solid tumors due to factors like T cell exhaustion, poor persistence in vivo, and immunosuppressive environmental factors, while also posing risks of severe adverse events.

Method used

Development of engineered immune cells with a recombinant receptor, including a DLL3 binding region and a caspase-associated recruitment domain (CARD) to enhance T cell signaling and persistence, and the use of a peptide epitope or mimotope for antibody-mediated removal in case of adverse events.

Benefits of technology

The engineered cells demonstrate enhanced potency against solid tumors with improved persistence and safety, reducing exhaustion and adverse events, and maintaining effective anti-tumor activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2025059211_19032026_PF_FP_ABST
    Figure IB2025059211_19032026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates generally to compositions and methods for improving the safety of adoptive immune cell therapy, including the use of a depletion tag (e.g., an epitope or a mimotope) that is capable of binding to another molecule (e.g., an antibody) to facilitate the depletion of the engineered immune cells. One class of depletion tags disclosed herein contain an epitope or mimotope derived from a biomarker of a hematologic cancer (e.g., CCR4). A second class of depletion tags disclosed herein contain an epitope or mimotope derived from the same antigen that the engineered receptor binds to (e.g., a DLL3 derived depletion tag for engineered immune cells that bind to DLL3).
Need to check novelty before this filing date? Find Prior Art

Description

Cooley Ref. No.: MNBI-005 / 02WO 352505-2074ENGINEERED CELLS COMPRISING A DLL3 BINDING RECEPTOR OR A P53 R175H BINDING RECEPTORCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 694,390, filed on September 13, 2024, and U.S. Provisional Application No. and 63 / 831,076, filed on June 26, 2025, the content of each of which is herein incorporated by reference in its entirety.STATEMENT REGARDING SEQUENCE LISTING

[0002] The Sequence Listing XML associated with this application is provided in XML file format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is MNBI_005_02WO_SeqList_ST26.xml. The XML file is 773,590 bytes and created on September 12, 2025, and is being submitted electronically via USPTO Patent Center.FIELD

[0003] The present disclosure relates generally to compositions and methods for engineered T cell therapeutics. The disclosure provides engineered immune cells comprising a recombinant receptor and a recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) domain that promote T cell signaling, efficacy and / or in vivo persistence. The expression of an endogenous T cell receptor (TCR) may be knocked out, knocked down, or otherwise modified in these engineered immune cells to improve its safety. The engineered immune cells may contain one or more epitope or mimotope tags for a therapeutic antibody such that, if an adverse event occurs, the therapeutic antibody can be administered to remove the engineered immune cells and mitigate the adverse event. Also provided are recombinant nucleic acid constructs, vectors, particles and cells that comprise such recombinant nucleic acids, methods for preparing immune cells for use in cell therapies, as well as methods of mitigating adverse events in such cell therapies.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074BACKGROUND

[0004] Engineered immune cell therapies, such as adoptive T cell therapies using chimeric antigen receptor (CAR) T cells, have revolutionized cancer therapy. To date, five CD19 targeted CAR-T cell therapies have been approved by the FDA for use against hematological B cell cancers. Despite this success, meaningful responses have not been achieved for many tumors. In solid tumor cancers, the effectiveness of T cell therapies is limited by a complex combination of factors including: fitness of engineered T cells in tumors, T cell exhaustion, poor T cell persistence in vivo, and immunosuppressive environmental factors. Further, severe and sometimes life-threatening adverse events may be associated with engineered immune cell therapies.

[0005] It remains challenging to engineer T cells that have high potency against solid tumors while at the same time ensuring the safety of T cell therapies. This application provide such engineered immune cells, method of using them in therapies, and more.SUMMARY

[0006] This section provides a general summary of the disclosure and is not comprehensive of its full scope or all of its features.

[0007] In one aspect, the present disclosure provides a recombinant nucleic acid encoding a chimeric antigen receptor (CAR) comprising a DLL3 binding region comprising (i) a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and (ii) a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426, wherein the CDRs are assigned according to the Kabat scheme; and wherein: (a) the CAR comprises a tag, wherein the tag comprises or consists of a peptide epitope or mimotope capable of being bound by an anti- CCR4 antibody; and / or (b) the recombinant nucleic acid comprises a nucleic acid sequence encoding a recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof.

[0008] In embodiments, the tag comprises an amino acid sequence of SEQ ID NO: 431. In embodiments, the recombinant polypeptide comprises an amino acid sequence having at least 90%, at least 95%, or 100% identity to SEQ ID NO: 597 or 598. In embodiments, the CAR comprises the tag; and (b) the recombinant nucleic acid comprises the nucleic acid sequenceCooley Ref. No.: MNBI-005 / 02WO 352505-2074 encoding the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof.

[0009] In embodiments, the recombinant nucleic acid comprises, from 5’ to 3’, a left hand homology arm (LHA), the nucleic acid encoding the CAR and / or the nucleic acid encoding CAR and the recombinant polypeptide, and a right hand homology arm (RHA), and wherein the length of the LHA and RHA are each about 300 bp. In embodiments, the LHA comprises a nucleic acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 642, wherein the LHA has an A at postion 297 and a C at postion 300 of SEQ ID NO: 642. In embodiments, the RHA comprises a nucleic acid sequence having at least 90%, at least 95%, or 100% identity to SEQ ID NO: 643.

[0010] In one aspect, the present disclosure provides a T cell, comprising the recombinant nucleic acid of claim 1 inserted into a TRAC locus. In embodiments, the T cell is a primary T cell. In embodiments, the cell surface expression of endogenous T cell receptor (TCR) in the T cell is reduced or eliminated relative to a control cell. In embodiments, the TRAC locus comprises (i) a T to A mutation at postion chrl4:22,547,690, (ii) a G to C mutation at chrl4:22,547,693, or (iii) a T to A mutation at postion chrl4:22,547,690 and a Gto C mutation at chrl4:22,547,693.

[0011] In one aspect, the present disclosure provides a method of treating cancer in a subject in need thereof, comprising administering an effective amount of a cell disclosed herein or a population of cells disclosed herein.

[0012] In one aspect, the present disclosure provides a recombinant polypeptide comprising a DLL3 binding region. In embodiments, the recombinant polypeptide is a chimeric antigen receptor (CAR). In embodiments, (a) the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426, wherein the CDRs are assigned according to the Kabat scheme; or (b) the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 580, a CDRH2 comprising SEQ ID NO: 581, and a CDRH3 comprising SEQ ID NO: 582; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 583, a CDRL2 comprisingCooley Ref. No.: MNBI-005 / 02WO 352505-2074SEQ ID NO: 584, and a CDRL3 comprising SEQ ID NO: 585, wherein the CDRs are assigned according to the enhanced Chothia scheme.

[0013] In embodiments, the VH comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 419, and / or the VL comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 415. In embodiments, the CAR comprises, from N-terminus to C-terminus, the binding region, a hinge region, a transmembrane region, and an intracellular region. In embodiments, the hinge region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 420. In embodiments, the transmembrane region region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 421. In embodiments, the intracellular region comprises an intracellular signaling domain derived from 4- IBB and / or an intracellular signaling domain derived from CD3zeta; optionally, the intracellular region comprises, from N-term to C-term, the intracellular signaling domain derived from 4- IBB and the intracellular signaling domain derived from CD3zeta. In embodiments, the intracellular region comprises the intracellular signaling domain derived from 4-1BB comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 422. In embodiments, the intracellular region comprises the intracellular signaling domain derived from CD3zeta comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 423. In embodiments, the CAR comprises a hinge region comprising SEQ ID NO: 420, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423. In embodiments, the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 597 and 598.

[0014] In one aspect, the present disclosure provides a recombinant polypeptide comprising (i) a T cell receptor (TCR) having antigenic specificity for an antigen derived from human p53 protein, or (ii) an antigen-binding fragment thereof; optionally, wherein the TCR or the antigen-binding fragment thereof has antigenic specificity for a human p53R175Hamino acid sequence. In embodiments, (a) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1Cooley Ref. No.: MNBI-005 / 02WO 352505-2074(CDRal) comprising SEQ ID NO: 527. a CDRa2 comprising SEQ ID NO: 528, and a CDRa3 comprising SEQ ID NO: 529; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 530, a CDRb2 comprising SEQ ID NO: 531, and a CDRb3 comprising SEQ ID NO: 532; or (b) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 533, a CDRa2 comprising SEQ ID NO: 534, and a CDRa3 comprising SEQ ID NO: 535; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 536, a CDRb2 comprising SEQ ID NO: 537, and a CDRb3 comprising SEQ ID NO: 538; or (c) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 539, a CDRa2 comprising SEQ ID NO: 540, and a CDRa3 comprising SEQ ID NO: 541; and / or wherein the TCR or the antigenbinding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 542, a CDRb2 comprising SEQ ID NO: 543, and a CDRb3 comprising SEQ ID NO: 544; or (d) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain complementarity determining region 1 (CDRal) comprising SEQ ID NO: 545, a CDRa2 comprising SEQ ID NO: 546, and a CDRa3 comprising SEQ ID NO: 547; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 548, a CDRb2 comprising SEQ ID NO: 549, and a CDRb3 comprising SEQ ID NO: 550; or (e) the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 557, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 558.

[0015] In embodiments, the recombinant polypeptide further comprises a tag, wherein the tag comprises or consists of a peptide epitope or a mimotope that mimics an epitope, and wherein the peptide epitope or mimotope is capable of being bound by a monoclonal antibody. In embodiments, the peptide epitope or mimotope is capable of being bound by an anti-CCR4 antibody; optionally, wherein the anti-CCR4 antibody is mogamulizumab. In embodiments, the peptide epitope is a modified peptide epitope, and wherein the modified peptide epitopeCooley Ref. No.: MNBI-005 / 02WO 352505-2074 comprises or consists of any one of SEQ ID NO: 430-438; preferably, the modified peptide epitope consists of SEQ ID NO: 431. In embodiments, the peptide epitope or mimotope is located in an extracellular region of the recombinant polypeptide. In embodiments, the peptide epitope or mimotope is located within the binding domain or the antigen-binding fragment of the CAR or T cell receptor. In embodiments, the peptide epitope or mimotope is located between the VL and the VH, or the variable region of a TCR a chain and the variable region of TCR P chain. In embodiments, the DLL3 binding region comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical, or 100% identical to SEQ ID NO: 627.

[0016] In one aspect, the present disclosure provides a recombinant nucleic acid encoding a recombinant polypeptide disclosed herein. In embodiments, the polynucleotide sequence encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 649. In embodiments, the recombinant nucleic acid further comprises a polynucleotide sequence encoding a second recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof. In embodiments, the CARD containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622-716 of SEQ ID NO: 2. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-4; preferably, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2.

[0017] In embodiments, the polynucleotide sequence encoding the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 647. In embodiments, the recombinant nucleic acid further comprises one or more polynucleotide sequences encoding one or more cleavable linkers, optionally wherein the one or more cleavable linkers comprise a P2A, E2A, F2A, or T2A self-cleaving peptide. In embodiments, the self-cleaving peptide comprises a sequenceCooley Ref. No.: MNBI-005 / 02WO 352505-2074 at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 376-379.

[0018] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding the recombinant polypeptide of any one of claims 13-33, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, and (5) a cleavable linker encoding sequence. In embodiments, the CARD-containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622-716 of SEQ ID NO: 2. In embodiments, the recombinant nucleic acid comprises a polynucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 652. In embodiments, the cleavable linker comprises a P2A self-cleaving peptide comprising the amino acid sequence of SEQ ID NO: 377.

[0019] In one aspect, the present disclosure provides a vector comprising a recombinant nucleic acid disclosed herein. In embodiments, the vector is a viral vector. In embodiments, the viral vector is an adeno-associated virus (AAV) vector. In embodiments, the AAV vector is an AAV6 vector. In embodiments, the AAV vector comprises two homology arms flanking the nucleic acid encoding the recombinant polypeptide and / or the CARD-containing protein or a functional fragment thereof, and wherein the length of at least one of the two homology arms is about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp.

[0020] In embodiments, the lengths of both of the homology arms about 300 bp. In embodiments, the homology arm 5’ to the nucleic acid encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 642; optionally, wherein the homology arm has an A at postion 297 and a C at postion 300 of SEQ ID NO: 642. In embodiments, the homology arm 3’ to the nucleic acid encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 643.

[0021] In embodiments, the recombinant nucleic acid is less than 4.8 kb in length. In embodiments, the recombinant nucleic acid is less than 4.5 kb in length.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0022] In one aspect, the present disclosure provides a particle comprising a recombinant nucleic acid or vector disclosed herein. In embodiments, the particle is an AAV viral particle.

[0023] In one aspect, the present disclosure provides an engineered cell, wherein the engineered cell (i) comprises arecombinant nucleic acid disclosed herein or (ii) is transfected or transduced by a vector disclosed herein, or (iii) expresses arecombinant polypeptide disclosed herein. In embodiments, the chimeric antigen receptor (CAR) comprising the DLL3 binding region. In embodiments, the recombinant polypeptide comprising the caspase- associated recruitment domain (CARD) containing protein or the functional fragment thereof, wherein cell surface expression of the endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

[0024] In embodiments of the engineered cell, the recombinant nucleic acid encodes the caspase-associated recruitment domain (CARD) containing protein comprising a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150. In embodiments of the engineered cell, the recombinant nucleic acid encodes the caspase-associated recruitment domain (CARD) containing protein comprising a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4; optionally, the CARD containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2. In embodiments of the engineered cell, the recombinant nucleic acid encodes a CAR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 597 or 598. In embodiments the recombinant polypeptide is under the control of an endogenous promoter. In embodiments the endogenous promoter controls expression of TRAC in a non-engineered cell that the engineered cell is derived from. In embodiments the nucleic acid is inserted in a T-cell receptor (TCR) alpha (TRA) locus. In embodiments the TRA locus is a TRAC locus. In embodiments the TRAC locus is a TRAC exon 1 locus. In embodiments the nucleic acid is inserted in the region of chrl4:22,547,677- 22,547,696 according to GRCh38 / hg38. In embodiments the engineered cell comprises a genomic mutation corresponding to (i) a T to A mutation at postion chrl4:22,547,690, according to GRCh38 / hg38, (ii) a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38, or (iii) a T to A mutation at postion chrl4:22,547,690 and a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38. In embodiments the cell surface expression of an endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region. In embodiments the cell is a T cell. In embodiments the cell is a human cell.

[0025] In embodiments the cell has reduced exhaustion, increased proliferative capacity, enhanced replicative lifespan, decreased replicative senescence, enhanced anti-tumor effect, enhanced tissue resident memory T cell phenotype, reduced dysfunction, enhanced persistence, and / or increase intratumoral presence in vivo. In embodiments the cell, or a population of the cells, expresses one or more of GPR25, CD27, and CCL5 at a level that is at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-fold greater, at least 4-fold greater, at least 4.5-fold greater, or at least 5-fold greater compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell comprising a recombinant nucleic acid encoding a TGFbR2-DNR.

[0026] In embodiments, upon stimulation of an antigen, the cell, or a population of the cells, expresses: (a) one or more of AK4, P4HA2, PPFIA4, VLDLR, LDHA, MIR210HG, PGK1, TPI1, PGAM1, CXCL10, CXCR4, VEGFA, AIF1, ATF3, MKI67, ICOS, CD69, EBB, IL2RA, P2RY14, SELL, and CAPG at a level that is greater compared to a control cell; and / or (b) one or more of ATM, PHC3, EOMES, FOXP1, and TOX at a level that is lower compared to a control cell; optionally, wherein the control cell is a wildtype cell, an unmodified cell, or a cell that does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof; optionally, wherein the control cell is a cell that expresses the CAR, but does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof.

[0027] In embodiments, the level is mRNA expression level; optionally, wherein the mRNA expression level is determined by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR), PCR, RNAseq, microarray, gene chip, nCounter Gene Expression Assay, Serial Analysis of Gene Expression (SAGE), Rapid Analysis of Gene Expression (RAGE), nuclease protection assays, Northern blotting, nucleic acid hybridization, or any other equivalent gene expression detection techniques. In embodiments, the level is protein expression level; optionally, wherein the protein expression level is determined by antibody - based testing, immunoassay, radioimmunoassay (RIA), immunohistochemistry, immunofluorescence, chemiluminescence, phosphorescence, proteomics techniques, surface plasmon resonance (SPR), mass spectrometry, protein microarray, or any other equivalent protein expression detection techniques.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0028] In embodiments, the cell, or the population of the cells, expresses AK4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4- fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or the population of the cells, expresses P4HA2 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or the population of the cells, expresses PPFIA4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or the population of the cells, expresses VLDLR at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses LDHA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses MIR210HG at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or the population of the cells, expresses PGK1 at a level that is at least1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses TPI1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses PGAM1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses CXCL10 at a level that is at least 1.5-fold, at least 2- fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses CXCR4 at a level that isCooley Ref. No.: MNBI-005 / 02WO 352505-2074 at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4- fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses VEGFA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses AIF1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses ATF3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5- fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses MKI67 at a level that is at least1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses P2RY14 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses ICOS at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses CD69 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5- fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses EBI3 at a level that is at least1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses IL2RA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses CAPG at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, cell, or the population of the cells, expresses ATM at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5- fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or the population of the cells, expresses PHC3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or the population of the cells, expresses EOMES at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or the population of the cells, expresses SELL at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or the population of the cells, expresses FOXP1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or the population of the cells, expresses TOX at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.

[0029] In one aspect, the present disclosure provides a composition comprising a vector disclosed herein, a particle disclosed herein, an engineered cell or a population of engineered cells disclosed herein.

[0030] In one aspect, the present disclosure provides a method of preparing an engineered cell, wherein the method comprises contacting the cell with a recombinant nucleic acid disclosed herein, a vector disclosed herein, or a particle disclosed herein. In one aspect, the present disclosure provides a method of preparing an engineered cell, wherein the method comprises expressing in the cell a recombinant polypeptide disclosed herein. In embodiments, the cell is prepared in vivo. In embodiments, the cell is prepared in the body of a subject in need of treatment. In embodiments, the cell is prepared ex vivo or outside of the body of a subject in need of treatment. In embodiments, recombinant nucleic acid is introduced via an adeno-associated virus (AAV) vector. In embodiments, the AAV vector is an AAV6 vector.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0031] In embodiments, the method comprises introducing into the cell (i) a Cas9 nuclease or a nucleic acid encoding the Cas9 nuclease and / or (ii) a sgRNA. In embodiments, the sgRNA comprises a polynucleotide sequence of AGAGCAACAGUGCUGUGGCC (SEQ ID NO: 520).

[0032] In embodiments, the recombinant nucleic acid is inserted into an endogenous locus of the cell. In embodiments, the endogenous locus is or comprises a TRAC gene locus. In embodiments, the recombinant nucleic acid is inserted between chrl4:22, 547, 677-22, 547, 696 according to GRCh38 / hg38. In embodiments, the method thereby produces an engineered cell comprising: (i) the recombinant polypeptide; (ii) the immune receptor (e.g., CAR); and (iii) the modified TRAC gene locus. In embodiments, the modified TRAC gene locus comprises a mutation corresponding to (i) a T to A mutation at postion chrl4:22,547,690, according to GRCh38 / hg38, (ii) a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38, or (iii) a T to A mutation at postion chrl4:22,547,690 and a Gto C mutation at chrl4:22,547,693, according to GRCh38 / hg38.

[0033] In one aspect, the present disclosure provides a method of treating cancer in a subject disclosed herein, a vector disclosed herein, a particle disclosed herein, an engineered cell or a population of the engineered cells disclosed herein, or a composition disclosed herein, to the subject. In embodiments, a subject is not administered a lymphodepletive agent within 7 days prior to administration of the recombinant nucleic acid, the vector, the particle, or the cell, or wherein the subject is not lymphodepleted at the time of the administration. In embodiments, the subject is not administered cyclophosphamide, fludarabine, or bendamustine within 7 days prior to administration of the cell. In embodiments, cancer is small cell lung cancer (SCLC), neuroendocrine prostate cancer, or gastroenteropancreatic neuroendocrine tumor. In embodiments, cancer is a relapsed and / or refractory cancer. In embodiments, cancer expresses DLL3. In embodiments, the method further comprises administering an antibody to the subject, wherein the antibody binds the tag.

[0034] In one aspect, the present disclosure provides a method of reducing or eliminating at least one symptom of an adverse event caused by the engineered cells disclosed herein in a subject in need thereof, comprising administering to the subject an antibody that binds to a tag expressed on the surface of the engineered cells. In embodiments, antibody is mogamulizumab.

[0035] In one aspect, the present disclosure provides recombinant polypeptides comprising a DLL3 binding region. In embodiments, the recombinant polypeptide is a chimeric antigenCooley Ref. No.: MNBI-005 / 02WO 352505-2074 receptor (CAR). In embodiments, the DLL3 binding region binds the epidermal growth factor (EGF)-like repeat 6 (EGF6) domain of DLL3.

[0036] In embodiments, the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426, wherein the CDRs are assigned according to the Kabat scheme. In embodiments, the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 580, a CDRH2 comprising SEQ ID NO: 581, and a CDRH3 comprising SEQ ID NO: 582; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 583, a CDRL2 comprising SEQ ID NO: 584, and a CDRL3 comprising SEQ ID NO: 585, wherein the CDRs are assigned according to the Chothia scheme.

[0037] In embodiments, the VH comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 419, and / or the VL comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 415. In embodiments, the VH comprises the amino acid sequence of SEQ ID NO: 419, and / or the VL comprises the amino acid sequence of SEQ ID NO: 415. In embodiments, the DLL3 binding region is a single chain Fv (scFv), a single domain antibody (sdAb), a fragment antigen binding moiety (Fab), a tandem scFv (bivalent and / or bispecific), a tandem single domain antibody (sdAb), or a bi-specific Fab.

[0038] In embodiments, the CAR is or comprises a single-chain CAR, a multi-chain CAR, a single-targeted CAR, a multi-targeted CAR, a bivalent tandem CAR, a bivalent loop CAR, a multi ci str onic CAR, a bicistronic CAR, a dimerizing agent regulated immune-receptor complex (DARIC), an antibody tethered orthogonal multiplexing compatible (ATOMIC), a T cell receptor fusion construct (TruC), an HLA-independent T cell (HIT) receptor, a synthetic T cell receptor and antigen receptor (STAR), a synNotch-CAR circuit, a synthetic intramembrane proteolysis receptor (SNIPR), a rapamycin inducible TCR, a rapamycin inducible Fc receptor, a constitutive TCR-like receptor, a multi-chain DAP-CAR, a TREM1 / DAP12 CAR, or a DAP12 / TREM1 CAR.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0039] In embodiments, the CAR comprises the binding region, a hinge region, a transmembrane region, and / or an intracellular region. In embodiments, the CAR comprises, from N-terminus to C-terminus, the binding region, a hinge region, a transmembrane region. In embodiments, the hinge region is derived from CD8alpha, CD28, or IgG4, or comprises an IgG4 hinge-CH2-CH3 domain. In embodiments, the hinge region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NOs: 355-360, 420, and 487.

[0040] In embodiments, the transmembrane region is derived from TCR^, CD2, CD3(^, CD3s, CD3y, CD35, CD4, CD5, CD8, CD8a, CD8P, CD9, CD16, CD27, CD28, CD34, CD45, CD22, CD32, CD33, CD37, CD40, CD40L / CD154, CD64, CD80, CD86, CD134, CD137, CD154, VEGFR2, FAS, FGFR2B, 4-1BB / CD137, FcsRIy, OX40 / CD134, ICOS, MyD88, TCRa, TCRbeta, TLR2, TLR4, or TNFR2. In embodiments, the transmembrane region region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NOs: 397, 398, 421, and 509.

[0041] In embodiments, the CAR further comprises an intracellular region, wherein the intracellular region comprises one or more intracellular signaling domains. In embodiments, the one or more intracellular signaling domains are derived from a protein selected from the group consisting of CD3zeta, lxxCD3zeta, CD28, 4- IBB, 0X40, IL2Rb turbodomains, MYD88 / CD40, MYD88 / CD40 inducible costimulatory domain, CD2, B7-1 / CD80, B7- 2 / CD86, B7-H1 / PD-L1, B7-H2, B7-H3, B7-H4, B7-H6, B7-H7, BTLA / CD272, CD28, CTLA-4, Gi24 / VISTA / B7-H5, ICOS / CD278, PD-1, PD-L2 / B7-DC, PDCD6, 4- 1BB / TNFSF9 / CD137, 4-1BB Ligand / TNFSF9, BAFF / BLyS / TNFSF13B, BAFF R / TNFRSF13C, CD27 / TNFRSF7, CD27 Ligand / TNFSF7, CD30 / TNFRSF8, CD30 Ligand / TNFSF8, CD40 / TNFRSF5, CD40 / TNFSF5, CD40 Ligand / TNFSF5, DR3 / TNFRSF25, GITR / TNFRSF18, GITR Ligand / TNFSF18, HVEM / TNFRSF14, LIGHT / TNFSF14, Lymphotoxin-alpha / TNF-beta, OX40 / TNFRSF4, 0X40 Ligand / TNFSF4, RELT / TNFRSF19L, TACI / TNFRSF13B, TL1A / TNFSF15, TNF-alpha, TNF RII / TNFRSF1B, 2B4 / CD244 / SLAMF4, BLAME / SLAMF8, CD2, CD2F-10 / SLAMF9, CD48 / SLAMF2, CD58 / LFA-3, CD84 / SLAMF5, CD229 / SLAMF3, CRACC / SLAMF7, NTB- A / SLAMF6, SLAM / CD150, CD2, CD7, CD53, CD82 / Kai-1, CD90 / Thyl, CD96, CD 160, CD200, CD300a / LMIRl, HLA Class I, HLA-DR, Ikaros, Integrin alpha 4 / CD49d, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-l, LAG-3, TCL1A, TCL1B, CRTAM, DAP12, Dectin- 1 / CLEC7A, DPPIV / CD26, EphB6, TIM- 1 / KIM- 1 / HA VCR, TIM-4,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074TSLP, TSLP R, lymphocyte function associated antigen-1 (LFA-1), NKG2C, an immunoreceptor tyrosine based activation motif (ITAM), CD27, CD134 / OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD7, LIGHT, NKG2C, TNFR2, 2B4 / CD244, and any combinations thereof.

[0042] In embodiments, the intracellular region comprises an intracellular signaling domain derived from 4- IBB and / or an intracellular signaling domain derived from CD3zeta; optionally, the intracellular region comprises, from N-term to C-term, the intracellular signaling domain derived from 4- IBB and the intracellular signaling domain derived from CD3zeta. In embodiments, the intracellular region comprises the intracellular signaling domain derived from 4-1BB comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 422.

[0043] In embodiments, the intracellular region comprises the intracellular signaling domain derived from CD3zeta comprising:a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 423; or a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 488 wherein the amino acid corresponding to position 14 of SEQ ID NO: 488 is lysine.

[0044] In embodiments, the CAR comprises a hinge region comprising SEQ ID NO: 420, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423. In embodiments, the CAR comprises a binding region comprising SEQ ID NOs: 424-429, a hinge region comprising SEQ ID NO: 420, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

[0045] In embodiments, the CAR comprises an amino acid sequence wherein the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 395, 401, 521, 523, 597, and 598; optionally, wherein the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 597 and 598.

[0046] In one aspect, the present disclosure provides recombinant polypeptides comprising (i) a T cell receptor (TCR) having antigenic specificity for an antigen derived from human p53 protein, or (ii) an antigen-binding fragment thereof. In embodiments, the TCR or the antigenbinding fragment thereof has antigenic specificity for a human p53R175Hamino acid sequence.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074In embodiments, the human p53R175Hamino acid sequence is HMTEVVRHC (SEQ ID NO: 399). In embodiments, the TCR or the antigen-binding fragment thereof does not have antigenic specificity for the wild-type human p53 amino acid sequence of HMTEVVRRC (SEQ ID NO: 400).

[0047] In embodiments, the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 527. a CDRa2 comprising SEQ ID NO: 528, and a CDRa3 comprising SEQ ID NO: 529; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 530, a CDRb2 comprising SEQ ID NO: 531, and a CDRb3 comprising SEQ ID NO: 532.

[0048] In embodiments, the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 533, a CDRa2 comprising SEQ ID NO: 534, and a CDRa3 comprising SEQ ID NO: 535; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 536, a CDRb2 comprising SEQ ID NO: 537, and a CDRb3 comprising SEQ ID NO: 538.

[0049] In embodiments, the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 539, a CDRa2 comprising SEQ ID NO: 540, and a CDRa3 comprising SEQ ID NO: 541; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 542, a CDRb2 comprising SEQ ID NO: 543, and a CDRb3 comprising SEQ ID NO: 544.

[0050] In embodiments, the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain complementarity determining region 1 (CDRal) comprising SEQ ID NO: 545, a CDRa2 comprising SEQ ID NO: 546, and a CDRa3 comprising SEQ ID NO: 547; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 548, a CDRb2 comprising SEQ ID NO: 549, and a CDRb3 comprising SEQ ID NO: 550.

[0051] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 at least 98%, or at least 99% identical to SEQ ID NO: 557, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 558.

[0052] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 559, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 560. In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 561, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 562. In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 563, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 564.

[0053] In embodiments, the TCR comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NO: 573-576.

[0054] In embodiments, the TCR comprises a TCR a chain (TCRalpha) and / or a TCR P chain (TCRbeta). In embodiments, the TCR a chain and / or the TCR P chain comprises a constant region, a transmembrane domain and / or a cytoplasmic tail. In embodiments, the TCR a chain and / or the TCR P chain comprises, from N-term to C-term, the variable domain, the constant domain, the transmembrane region, and the cytoplasmic tail.

[0055] In embodiments, the constant domain is a human constant domain or a murine constant domain. In embodiments, the human constant domain comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 592. In embodiments, the murine constant domain comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 593.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0056] In embodiments, the constant domain comprises one or more mutations that improve pairing of the recombinant TCR a chain to the recombinant TCR P chain compared to a constant domain without the one or more mutations. In embodiments, the constant domain comprises one or more mutations that reduces pairing of the recombinant TCR a chain to the endogenous TCR P chain compared to a constant domain without the one or more mutations. In embodiments, the constant domain comprises one or more mutations that reduces pairing of the recombinant TCR P chain to the endogenous TCR a chain compared to a constant domain without the one or more mutations.

[0057] In embodiments, the transmembrane domain is a human constant domain or a murine constant domain. In embodiments, the human transmembrane domain comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 596. In embodiments, the murine transmembrane domain comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 596.

[0058] In embodiments, the transmembrane domain comprises one or more mutations that improve pairing of the recombinant TCR a chain to the recombinant TCR P chain compared to a transmembrane domain without the one or more mutations. In embodiments, the transmembrane domain comprises one or more mutations that reduces pairing of the recombinant TCR a chain to the endogenous TCR P chain compared to a transmembrane domain without the one or more mutations. In embodiments, the transmembrane domain comprises one or more mutations that reduces pairing of the recombinant TCR P chain to the endogenous TCR a chain compared to a transmembrane domain without the one or more mutations.

[0059] In embodiments, the variable domain comprises one or more mutations that improve pairing of the recombinant TCR a chain to the recombinant TCR P chain compared to a variable domain without the one or more mutations. In embodiments, the variable domain comprises one or more mutations that reduces pairing of the recombinant TCR a chain to the endogenous TCR P chain compared to a variable domain without the one or more mutations. In embodiments, the variable domain comprises one or more mutations that reduces pairing of the recombinant TCR P chain to the endogenous TCR a chain compared to a variable domain without the one or more mutations.

[0060] In embodiments, a recombinant polypeptide described herein further comprises a tag, wherein the tag comprises or consists of a peptide epitope or a mimotope that mimics anCooley Ref. No.: MNBI-005 / 02WO 352505-2074 epitope, and wherein the peptide epitope or mimotope is capable of binding to a monoclonal antibody. In embodiments, the the peptide epitope or mimotope is capable of binding to an anti-CCR4 antibody. In embodiments, the anti-CCR4 antibody is mogamulizumab. In embodiments, the peptide epitope comprises or consists of SEQ ID NO: 430.

[0061] In embodiments, the peptide epitope or mimotope is a modified peptide epitope or mimotope comprising or consisting of an amino acid sequence having 1, 2, 3, 4, or 5 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the unmodified peptide epitope or mimotope comprises or consists of no more than 10, no more than 15, no more than 20, no more than 25, no more than 30, no more than 35, no more than 40, no more than 45, or no more than 50 consecutive amino acids in an autoimmune-associated antigen or a cancer-associated antigen. In embodiments, the unmodified peptide epitope or mimotope is SEQ ID NO: 430.

[0062] In embodiments, the modified peptide epitope or mimotope does not comprise the cysteine that is present at the C-terminus of SEQ ID NO: 430. In embodiments, the modified peptide epitope comprises or consists of any one of SEQ ID NO: 431-438; preferably, the modified peptide epitope consists of SEQ ID NO: 431.

[0063] In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence: having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 475, and wherein the peptide epitope or mimotope is capable of binding to rituximab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 476, and wherein the peptide epitope or mimotope is capable of binding to Palivizumab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 477, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 478, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 479, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 480, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 481, and wherein the peptide epitope or mimotope is capable of binding to Nivolumab;having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 482, and wherein the peptide epitope or mimotope is capable of binding to Nivolumab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 and / or deletions) compared to SEQ ID NO: 483, and wherein the peptide epitope is capable or mimotope of binding to QBend-10; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 484, and wherein the peptide epitope or mimotope is capable of binding to Alemtuzumab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 469, and wherein the peptide epitope or mimotope is capable of binding to Sacituzumab; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to any one of SEQ ID NO:470-474, and wherein the peptide epitope or mimotope is capable of binding to an anti- GUCY2C antibody; having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 439, and wherein the peptide epitope or mimotope is capable of binding to Tarlatamab; or having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to any one of SEQ ID NO: 441-468, and wherein the peptide epitope or mimotope is capable of binding to an anti-DLL3 antibody.

[0064] In embodiments, the mutation(s) are substitutions; preferably, the mutation(s) are conservative substitutions. In embodiments, the cysteine(s) in the unmodified peptide epitope or mimotope are substituted or deleted. In embodiments, the N-terminus of the unmodified peptide epitope or mimotope contains a cysteine. In embodiments, the C-terminus of the unmodified peptide epitope or mimotope contains a cysteine. In embodiments, the unmodified peptide epitope or mimotope comprises at least one cysteine between the N-terminus and the C-terminus.

[0065] In embodiments, the cysteine(s) in the unmodified peptide epitope or mimotope are substituted with serine, glycine, threonine, alanine, or valine; preferably, serine or valine; more preferably, serine. In embodiments, the cysteine(s) in the unmodified peptide epitope or mimotope are substituted with valine. In embodiments, the modified peptide epitope or mimotope does not comprise any cysteine.

[0066] In embodiments, the mutation(s) comprise deleting or substituting one or more amino acids that facilitate polypeptide crosslinking in the unmodified peptide epitope or mimotope. In embodiments, the mutation(s) comprise deleting or substituting one or more cysteine(s), lysine(s), aspartic acid(s), glutamic acid(s), or any combination thereof.

[0067] In embodiments, the modified peptide epitope or mimotope is capable of binding to the corresponding antibody with a dissociation constant (Kd) of less than 1 pM, less than 100 nM, less than 10 nM, or less than 1 nM, as measured by surface plasmon resonance (SPR) method using a sensor chip that contains the immobilized antibody.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0068] In embodiments, the peptide epitope or mimotope is capable of binding to an anti- DLL3 antibody. In embodiments, the peptide epitope comprises or consists of any one of SEQ ID NO: 439-468. In embodiments, the anti-DLL3 antibody is tarlatamab.

[0069] In embodiments, the peptide epitope or mimotope is located in an extracellular region of the recombinant polypeptide. In embodiments, the peptide epitope or mimotope is located within the binding domain. In embodiments, the peptide epitope or mimotope is located between the VL and the VH. In embodiments, the peptide epitope or mimotope is located between the TCR a chain and the TCR P chain.

[0070] In embodiments, the recombinant polypeptide does not comprise a cysteine at the C- terminus of the modified peptide epitope or mimotope, and / or does not comprise a cysteine immediately after the C-terminus of the modified peptide epitope or mimotope. In embodiments, the recombinant polypeptide does not comprise a cysteine at the N-terminus of the modified peptide epitope or mimotope, and / or does not comprise a cysteine immediately before the N-terminus of the modified peptide epitope or mimotope.

[0071] In embodiments, an immune cell expressing the CAR or TCR described herein exhibits one or more of the following: improved binding to the antigen expressed on the surface of the target cell; reduced CAR-induced or TCR-induced antigen-independent signaling and / or activation of the immune cell; and / or reduced cross-linking between the CARs or TCRs expressed on the cell surface of the immune cell; compared to an immune cell expressing a CAR or TCR comprising the unmodified peptide epitope or mimotope.

[0072] In embodiments, the immune cell expressing the CAR or TCR exhibits one or more of the following: comparable levels of binding to the antigen expressed on the surface of the target cell; comparable levels of CAR-induced or TCR-induced antigen-independent signaling and / or activation of the immune cell; and / or comparable levels of cross-linking between the CARs or TCRs expressed on the cell surface of the immune cell; compared to an immune cell expressing a CAR or TCR that does not comprise a peptide epitope or mimotope.

[0073] In one aspect, the present disclosure provides recombinant nucleic acids encoding any of the recombinant polypeptides described herein. In embodiments, the recombinant nucleic acid encodes (i) the TCRalpha comprising the peptide epitope or mimotope and a TCRbeta, or (ii) a TCRalpha and the TCRbeta comprising the peptide epitope or mimotope. In embodiments, the recombinant nucleic acid encodes a TCRalpha, a TCRbeta, and the peptide epitope or mimotope located in between the TCRalpha and the TCRbeta. In embodiments, the TCRalpha and the TCRbeta are encoded by the same coding region; optionally, wherein the TCRalpha and the TCRbeta are separated by a cleavage site.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0074] In one aspect, the present disclosure provides recombinant nucleic acids encoding (i) a recombinant receptor that comprises a binding region for an antigen, and (ii) a recombinant polypeptide comprising a tag in its extracellular region, wherein the tag comprises a peptide epitope or a mimotope that mimics an epitope.

[0075] In embodiments, the recombinant nucleic acid is less than 4.8 kb in length. In embodiments, the recombinant nucleic acid further comprises a polynucleotide sequence encoding a second recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof.

[0076] In embodiments, the CARD containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622-716 of SEQ ID NO: 2. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-4; preferably, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150; preferably, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:3. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150; preferably, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:4.

[0077] In embodiments, the second recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof comprises no more than 500, no more than 550, no more than 600, no more than 650, or no more than 700 amino acids. In embodiments, the polynucleotide sequence encoding the recombinant polypeptide is operably linked to a promoter. In embodiments, the promoter is or comprises a minimal TATA promoter, pGK promoter, actin promoter, CD4 promoter, CD8a promoter, CD8b promoter, TCRa promoter, TCRb promoter, CD3d promoter, CD3g promoter, CD3e promoter, CD3z promoter, CARD9 promoter, CARDIO promoter, CARD 11 promoter, CARD 14 promoter,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074PIK3R3 promoter, CD25 promoter, IL2 promoter, IL7 promoter, IL 15 promoter, KLRG-1 promoter, HLA-DR promoter, CD38 promoter, CD69 promoter, Ki-67 promoter, CDl la promoter, CD58 promoter, CD99 promoter, CD62L promoter, CD 103 promoter, CCR4 promoter, CCR5 promoter, CCR6 promoter, CCR9 promoter, CCR10 promoter, CXCR3 promoter, CXCR4 promoter, CLA promoter, Granzyme A promoter, Granzyme B promoter, Perforin promoter, CD57 promoter, CD161 promoter, IL-18Ra promoter, CD69 promoter, GzmB promoter, T-bet promoter, IFNgamma promoter, TIM3 promoter, IL4 promoter, GAT A3 promoter, IL1 promoter, IL5 promoter, IL6 promoter, IL 13 promoter, IL 10 promoter, IL17A promoter, IL6 promoter, IL21 promoter, IL23R promoter, FoxP3 promoter, CTLA4 promoter, CD25 promoter, PD1 promoter, CD45RO promoter, CCR7 promoter, CD28 promoter, CD95 promoter, CD28 promoter, CD27 promoter, CD 127 promoter, PD-1 promoter, CD122 promoter, CD132 promoter, c-Kit promoter, nuclear factor of activated T cells (NF AT) promoter, programmed death 1 (PD-1) promoter, T cell immunoglobulin mucin- 3 (TIM-3) promoter, cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, lymphocyteactivation protein 3 (LAG-3) promoter, tumor necrosis factor (TNF)-related apoptosisinducing ligand (TRAIL) promoter, B- and T-lymphocyte attenuator (BTLA) promoter, CD25 promoter, CD69 promoter, Fas ligand (FasL) promoter, TIGIT promoter, TGF-beta promoter, T-bet promoter, Eomes promoter, GATA3 promoter, CD45RA promoter, 2B4 promoter, Type I interferon (IFN) alpha, Type I IFN beta promoter, IFN gamma promoter, IRF3 promoter, IRF7 promoter, NFkB promoter, AP-1 promoter, TNF-alpha promoter, CD130 promoter, NR4A1 promoter, NR4A2, NR4A3 promoter, MND promoter, EF-1 alpha promoter, short EFlalpha promoter, CAG promoter, ubiquitin / S27a promoter, SV40 promoter, SV40 early promoter, adenovirus major late promoter, mouse metallothionein-I promoter, Moloney murine leukemia virus (MMLV) long terminal repeat (LTR) region, CMV promoter, immunoglobulin promoter, heat shock promoter, polyoma virus promoter, fowlpox virus promoter, bovine papilloma virus promoter, avian sarcoma virus promoter, retrovirus promoter, hepatitis-B virus promoter, PGK promoter, vaccinia virus 7.5K promoter, TK promoter of HS V, mouse mammary tumor virus (MMTV) promoter, murine stem cell virus (MSCV) promoter, murine leukemia virus (MLV) promoter, LTR promoter of HIV, promoter of moloney virus, Epstein Barr virus (EBV) promoter, Rous sarcoma virus (RSV) promoter, U6 promoter, or UBC promoter.

[0078] In embodiments, the promoter is a constitutive promoter, optionally wherein the constitutive promoter is or comprises a CD4 promoter, CD8a promoter, CD8b promoter, TCRa promoter, TCRb promoter, CD3d promoter, CD3g promoter, CD3e promoter, CD3zCooley Ref. No.: MNBI-005 / 02WO 352505-2074 promoter, CARD9 promoter, CARDIO promoter, CARD 11 promoter, CARD 14 promoter, PIK3R3 promoter, MND promoter or a short EFla promoter. In embodiments, the polynucleotide sequence encoding the recombinant polypeptide is not operably linked to a promoter.

[0079] In embodiments, the recombinant nucleic acid further comprises a polynucleotide sequence encoding one or more cleavable linkers, optionally wherein the one or more cleavable linkers comprise a P2A, E2A, F2A, or T2A self-cleaving peptide. In embodiments, the self-cleaving peptide comprises a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 376-379.

[0080] In embodiments, the recombinant nucleic acid further comprises one or more additional nucleic acid control sequences, optionally wherein the one or more additional control sequences is or comprises ribosomal binding sites, enhancer elements, activator elements, translational start sequences, translational termination sequences, transcription start sequences, transcription termination sequences, polyadenylation signal sequences, a 70 bp poly(A) tract, a 100 bp poly(A) tract, a 172 bp poly(A) tract, a 200 bp poly(A) tract, a 300 bp poly(A) tract, a 325 bp poly(A) tract, replication elements, RNA processing and export elements, transposon sequences, transposase sequences, insulator sequences, internal ribosome entry sites (IRES), 5’UTRs, 3’UTRs, mRNA 3’ end processing sequences, boundary elements, locus control regions (LCR), matrix attachment regions (MAR), recombination or cassette exchange sequences, linker sequences, cleavable linker sequences, secretion signals, resistance markers, anchoring peptides, localization signals, fusion tags, affinity tags, chaperonins, proteases, or any combination thereof.

[0081] In embodiments, the recombinant nucleic acid further comprises a polynucleotide sequence encoding one or more additional polypeptides and / or a non-coding RNA, optionally wherein the non-coding RNA comprises a shRNA or a microRNA. In embodiments, the one or more additional polypeptides comprise an additional potency enhancement polypeptide, a tolerogenic factor, a cytokine, a chemokine, a growth factor, or any combination thereof. In embodiments, the additional potency enhancement polypeptide is or comprises a dominant negative form of an inhibitor of a cell-mediated immune response of the immune cell (e.g., TGFPR2 DNR), c-Jun, CCL19, CCL21, IL2R, IL7, IL7Ralpha, IL15, IL15RA, IL18, decoyresistant IL18 (DR-18), MyD88 / CD40, PD1-CD28 switch receptor, PD1-41BB switch receptor, CD40L-CD28 switch receptor, CTBR12 switch receptor, or CD8alpha / beta. In embodiments, the tolerogenic factor is or comprises A20 / TNFAIP3, B2M-HLA-E, CD16,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074CD16 Fc receptor, CD24, CD27, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL21, CCL22, CTLA4-Ig, Cl inhibitor, CR1, DUX4, FASL, HLA-C, HLA-E, HLA-E heavy chain, HLA-F, HLA-G, H2-M3, IDO1, IL-10, IL15-RF, IL-35, IL-39, MANF, Mfge8, PD-L1, Serpinb9, or any combination thereof.

[0082] In embodiments, the recombinant nucleic acid is less than 10 kb, less than 9 kb, less than 8 kb, less than 7 kb, less than 6 kb, less than 5 kb, less than 4 kb, or less than 3 kb in length. In embodiments, the recombinant nucleic acid is less than about 4.7 kb in length.

[0083] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a promoter, (2) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (3) a cleavable linker encoding sequence, and (4) a polynucleotide sequence encoding any recombinant polypeptide described herein.

[0084] In one aspect, the present disclosure provides recombinant nucleic acid comprising, from 5’ to 3’: (1) a promoter, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence, and (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof.

[0085] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a promoter, (2) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding any recombinant polypeptide described herein, (5) a cleavable linker encoding sequence, and (6) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor.

[0086] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’: (1) a promoter, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (5) a cleavable linker encoding sequence, and (6) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor.

[0087] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’: (1) a promoter, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (5) a cleavable linker encoding sequence, and (6) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0088] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a promoter, (2) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding any recombinant polypeptide described herein, (5) a cleavable linker encoding sequence, and (6) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof.

[0089] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a promoter, (2) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (5) a cleavable linker encoding sequence, and (6) a polynucleotide sequence encoding any recombinant polypeptide described herein.

[0090] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding any recombinant polypeptide described herein, and (5) a cleavable linker encoding sequence.

[0091] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence,(4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, and (5) a cleavable linker encoding sequence.

[0092] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding any recombinant polypeptide described herein, (5) a cleavable linker encoding sequence, (6) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, and(7) a cleavable linker encoding sequence.

[0093] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (3) a cleavable linkerCooley Ref. No.: MNBI-005 / 02WO 352505-2074 encoding sequence, (4) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (5) a cleavable linker encoding sequence, (6) a polynucleotide sequence encoding any recombinant polypeptide described herein, and (7) a cleavable linker encoding sequence.

[0094] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof,(5) a cleavable linker encoding sequence, (6) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, and (7) a cleavable linker encoding sequence.

[0095] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (5) a cleavable linker encoding sequence, (6) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, and (7) a cleavable linker encoding sequence.

[0096] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (5) a cleavable linker encoding sequence,(6) a polynucleotide sequence encoding any recombinant polypeptide described herein, and(7) a cleavable linker encoding sequence. In embodiments, the recombinant nucleic acid further comprises a pre-mRNA cleavage and polyadenylation sequence at the 3’ end.

[0097] In one aspect, the present disclosure provides a recombinant nucleic acid comprising, from 5’ to 3’ : (1) a cleavable linker encoding sequence, (2) a polynucleotide sequence encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, (3) a cleavable linker encoding sequence, (4) a polynucleotide sequence encoding any recombinant polypeptide described herein, (5) a cleavable linker encoding sequence, (6) a polynucleotide sequence encoding a CARD-containing protein or a functionalCooley Ref. No.: MNBI-005 / 02WO 352505-2074 fragment thereof, and (7) a cleavable linker encoding sequence. In embodiments, the recombinant nucleic acid further comprises a pre-mRNA cleavage and polyadenylation sequence at the 3’ end.

[0098] In one aspect, the present disclosure provides a recombinant nucleic acid comprising: (1) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, and (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, wherein the recombinant nucleic acid is an RNA construct.

[0099] In one aspect, the present disclosure provides a recombinant nucleic acid comprising: (1) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, (2) a polynucleotide sequence encoding any recombinant polypeptide described herein, and (3) a polynucleotide encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, wherein the nucleic acid is an RNA construct.

[0100] In one aspect, the present disclosure provides a combination of recombinant nucleic acid constructs comprising: (1) a first nucleic acid construct encoding a CARD-containing protein or a functional fragment thereof, and (2) a second nucleic acid construct encoding any recombinant polypeptide described herein, wherein the first and the second nucleic acid constructs are both RNA constructs.

[0101] In one aspect, the present disclosure provides a combination of recombinant nucleic acid constructs comprising: (1) a first nucleic acid construct encoding a CARD-containing protein or a functional fragment thereof, (2) a second nucleic acid construct encoding any recombinant polypeptide described herein, and (3) a third nucleic acid construct encoding a polynucleotide encoding an additional potency enhancement polypeptide, a cytokine, a chemokine, or a growth factor, and wherein the first, second, and third nucleic acid constructs are each RNA constructs.

[0102] In embodiments, the CARD-containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622-716 of SEQ ID NO: 2. In embodiments, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-4.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0103] In embodiments, the second recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof comprises no more than 500, no more than 550, no more than 600, no more than 650, or no more than 700 amino acids.

[0104] In one aspect, the present disclosure provides a vector comprising any recombinant nucleic acid described herein. In embodiments, the vector is a plasmid. In embodiments, the vector is a synthetic DNA vector. In embodiments, the vector is a linear DNA vector; optionally a closed linear DNA vector. In embodiments, the vector is an RNA vector; optionally an mRNA vector. In embodiments, the vector is a phagemid vector. In embodiments, the vector is a viral vector. In embodiments, the viral vector is selected from a retrovirus vector, an adenovirus vector, and an adeno-associated virus (AAV) vector. In embodiments, the retrovirus is a lentivirus. In embodiments, the lentivirus is a VSV-G pseudotyped lentivirus. In embodiments, the AAV vector is AAV6 vector. In embodiments, the AAV vector is AAV9 vector. In embodiments, the AAV vector is a split-intein dual AAV vector. In embodiments, the vector is a redirected lentiviral vector. In embodiments, the vector is a fusosome. In embodiments, the vector is a lentiviral particle engineered with the anti-CD3 Cocal glycoprotein. In embodiments, the vector is an enveloped delivery vehicle. In embodiments, the vector is self-replicating RNA virus. In embodiments, the vector is a mRNA-packaging virus-like particle. In embodiments, the vector is a RNP-packaging viruslike particle.

[0105] In one aspect, the present disclosure provides a particle comprising any recombinant nucleic acid or vector described herein. In embodiments, the particle is a lipid nanoparticle (LNP). In embodiments, the particle is a selective organ targeting (SORT) LNP. In embodiments, the particle is an antibody targeted LNP. In embodiments, the LNP comprises: (i) an ionizable lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a noncationic helper lipid or phospholipid, and (iv) a PEG-lipid (e.g., a PEG-modified lipid). In embodiments, the particle is a polymer nanoparticle. In embodiments, the particle is a protein nanoparticle.

[0106] In one aspect, the present disclosure provides an engineered cell, wherein the engineered cell (i) comprises any recombinant nucleic acid described herein, (ii) is transfected or transduced by any vector disclosed herein, or (iii) is contacted by any particle described herein.

[0107] In one aspect, the present disclosure provides an engineered cell expressing any recombinant polypeptide described herein.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0108] In one aspect, the present disclosure provides an engineered cell comprising a first recombinant nucleic acid encoding a chimeric antigen receptor (CAR) or a T cell receptor (TCR), and a second recombinant nucleic acid encoding a recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof, wherein cell surface expression of the endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

[0109] In embodiments, the first recombinant nucleic acid encodes a CAR comprising a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426; and the second recombinant nucleic acid encodes a caspase- associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3 , or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a CAR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 489; and the second recombinant nucleic acid encodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3 , or SEQ ID NO: 4.

[0110] In embodiments, the first recombinant nucleic acid encodes a TCR comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 527. a CDRa2 comprising SEQ ID NO: 528, and a CDRa3 comprising SEQ ID NO: 529; and wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 530, a CDRb2 comprising SEQ ID NO: 531, and a CDRb3 comprising SEQ ID NO: 532; the second recombinant nucleic acid encodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acidCooley Ref. No.: MNBI-005 / 02WO 352505-2074 encodes a TCR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 573; and the second recombinant nucleic acidencodes a caspase- associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a TCR comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 533, a CDRa2 comprising SEQ ID NO: 534, and a CDRa3 comprising SEQ ID NO: 535; and wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 536, a CDRb2 comprising SEQ ID NO: 537, and a CDRb3 comprising SEQ ID NO: 538; the second recombinant nucleic acid encodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a TCR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 574; and the second recombinant nucleic acidencodes a caspase- associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a TCR comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 539, a CDRa2 comprising SEQ ID NO: 540, and a CDRa3 comprising SEQ ID NO: 541; and wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 542, a CDRb2 comprising SEQ ID NO: 543, and a CDRb3 comprising SEQ ID NO: 544; the second recombinant nucleic acid encodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.[OHl] In embodiments, the first recombinant nucleic acid encodes a TCR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 575; and the second recombinant nucleic acid encodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a TCR comprising aCooley Ref. No.: MNBI-005 / 02WO 352505-2074 variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 545, a CDRa2 comprising SEQ ID NO: 546, and a CDRa3 comprising SEQ ID NO: 547; and the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 548, a CDRb2 comprising SEQ ID NO: 549, and a CDRb3 comprising SEQ ID NO: 550; the second recombinant nucleic acid encodes a caspase- associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In embodiments, the first recombinant nucleic acid encodes a TCR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 576; and the second recombinant nucleic acidencodes a caspase-associated recruitment domain (CARD) containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0112] In embodiments, the first recombinant nucleic acid encodes any recombinant polypeptide described herein. In embodiments, the first recombinant nucleic acid further comprises any peptide epitope or mimotope described herein. In embodiments, the second recombinant nucleic acid is any recombinant nucleic acid described herein.

[0113] In one aspect, the present disclosure provides an engineered cell expressing (i) a recombinant receptor that comprises a binding region for an antigen, and (ii) a recombinant polypeptide comprising a tag in its extracellular region, wherein the tag comprises a peptide epitope or a mimotope that mimics an epitope. In embodiments, the recombinant polypeptide or the recombinant nucleic acid are any disclosed herein. In embodiments, the engineered cell further expresses a second recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof. In embodiments, the second recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof comprises no more than 500, no more than 550, no more than 600, no more than 650, or no more than 700 amino acids.

[0114] In embodiments, the engineered cell comprises one or more additional peptide epitope(s) or mimotope(s) presented on the cell surface, wherein the one or more additional peptide epitope(s) or mimotope(s) are the same as the peptide epitope or mimotope or different from the peptide epitope or mimotope. In embodiments, activating the engineered cell results in the secretion of IL-2 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or atCooley Ref. No.: MNBI-005 / 02WO 352505-2074 least 100-fold higher than the IL-2 secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of IFNgamma by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100- fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of CCL5 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5- fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of CXCL10 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of CCL3 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of CCL4 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, activating the engineered cell results in the secretion of IL- 10 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2- fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IFNgamma secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide.

[0115] In embodiments, expression of the recombinant polypeptide is under the control of an endogenous promoter. In embodiments, the endogenous promoter is a TCRa promoter, a TCRb promoter, a CD3d promoter, a CD3g promoter, a CD3e promoter, a CD3z promoter, aCooley Ref. No.: MNBI-005 / 02WO 352505-2074CARD9 promoter, a CARDIO promoter, a CARD 11 promoter, a CARD 14 promoter, a PIK3R3 promoter, a B2 microglobulin (B2M) promoter, or a class II transactivator (CIITA) promoter. In embodiments, the expression of the recombinant polypeptide is under the control of an exogenous promoter. In embodiments, the exogenous promoter is or comprises a minimal TATA promoter, pGK promoter, actin promoter, CD4 promoter, CD8a promoter, CD8b promoter, TCRa promoter, TCRb promoter, CD3d promoter, CD3g promoter, CD3e promoter, CD3z promoter, CARD9 promoter, CARDIO promoter, CARD 11 promoter, CARD14 promoter, PIK3R3 promoter, CD25 promoter, IL2 promoter, IL7 promoter, IL15 promoter, KLRG-1 promoter, HLA-DR promoter, CD38 promoter, CD69 promoter, Ki-67 promoter, CDl la promoter, CD58 promoter, CD99 promoter, CD62L promoter, CD103 promoter, CCR4 promoter, CCR5 promoter, CCR6 promoter, CCR9 promoter, CCR10 promoter, CXCR3 promoter, CXCR4 promoter, CLA promoter, Granzyme A promoter, Granzyme B promoter, Perforin promoter, CD57 promoter, CD161 promoter, IL18Ra promoter, CD69 promoter, GzmB promoter, T-bet promoter, IFNgamma promoter, TIM3 promoter, IL4 promoter, GAT A3 promoter, IL1 promoter, IL5 promoter, IL6 promoter, IL 13 promoter, IL 10 promoter, IL17A promoter, IL6 promoter, IL21 promoter, IL23R promoter, FoxP3 promoter, CTLA4 promoter, CD25 promoter, PD1 promoter, CD45RO promoter, CCR7 promoter, CD28 promoter, CD95 promoter, CD28 promoter, CD27 promoter, CD 127 promoter, PD-1 promoter, CD122 promoter, CD132 promoter, c-Kit promoter, nuclear factor of activated T cells (NF AT) promoter, programmed death 1 (PD-1) promoter, T cell immunoglobulin mucin-3 (TIM-3) promoter, cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, lymphocyte-activation protein 3 (LAG-3) promoter, tumor necrosis factor (TNF)- related apoptosis-inducing ligand (TRAIL) promoter, B- and T-lymphocyte attenuator (BTLA) promoter, CD25 promoter, CD69 promoter, Fas ligand (FasL) promoter, TIGIT promoter, TGF-beta promoter, T-bet promoter, Eomes promoter, GATA3 promoter, CD45RA promoter, 2B4 promoter, Type I interferon (IFN) alpha, Type I IFN beta promoter, IFN gamma promoter, IRF3 promoter, IRF7 promoter, NFkB promoter, AP-1 promoter, TNF- alpha promoter, CD 130 promoter, NR4A1 promoter, NR4A2, NR4A3 promoter, MND promoter, EF-lalpha promoter, short EF-lalpha promoter, CAG promoter, ubiquitin / S27a promoter, SV40 promoter, SV40 early promoter, adenovirus major late promoter, mouse metallothionein- 1 promoter, Moloney murine leukemia virus (MMLV) long terminal repeat (LTR) region, CMV promoter, immunoglobulin promoter, heat shock promoter, polyoma virus promoter, fowlpox virus promoter, bovine papilloma virus promoter, avian sarcoma virus promoter, retrovirus promoter, hepatitis-B virus promoter, PGK promoter, vaccinia virusCooley Ref. No.: MNBI-005 / 02WO 352505-20747.5K promoter, TK promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, murine stem cell virus (MSCV) promoter, murine leukemia virus (MLV) promoter, promoter of moloney virus, Epstein Barr virus (EBV) promoter, Rous sarcoma virus (RSV) promoter, U6 promoter, or UBC promoter.

[0116] In embodiments, the nucleic acid is inserted in a T-cell receptor (TCR) alpha (TRA) locus, a TCR beta (TRB) locus, a CD3 locus, a B2 microglobulin (B2M) locus, a class II transactivator (CIITA) locus, or a safe harbor locus. In embodiments, the nucleic acid is inserted the by a method comprising use of a DNA-PK inhibitor selected from AZD7648, M3814, VX984, and BAY840. In embodiments, the TRA locus is or comprises a TRAC locus or a TRAJ locus. In embodiments, the TRB locus is or comprises a TRBC1 locus, a TRBC2 locus, or a TRBJ locus. In embodiments, the TRAC locus is or comprises a TRAC exon 1 locus, a TRAC intron 1 locus, a TRAC exon 2 locus, a TRAC intron 2 locus, a TRAC exon 3 locus, a TRAC intron 3 locus, a TRAC exon 4 locus, and / or a TRAC 3’ UTR locus. In embodiments, the nucleic acid is inserted at any one of: the TRAC exon 1 locus, the TRAC intron 1 locus, the TRAC exon 2 locus, the TRAC intron 2 locus, the TRAC exon 3 locus, the TRAC intron 3 locus, the TRAC exon 4 locus, or the TRAC 3’ UTR locus; preferably, the TRAC exon 1 locus. In embodiments, the nucleic acid is inserted in the region of chrl4:22, 547, 677-22, 547, 696 according to GRCh38 / hg38.

[0117] In embodiments, the TCR locus is or comprises a splice acceptor locus of the TRAJ locus. In embodiments, the TRAJ intron locus is or comprises a TRAJ intron splice acceptor locus. In embodiments, the TRAJ intron locus is or comprises a TRAJ intron splice acceptor locus. In embodiments, the nucleic acid is inserted in the region of chrl4:22,547,502- 22,547,520 according to GRCh38 / hg38. In embodiments, the nucleic acid is inserted in the region of chrl4:22, 547, 504-22, 547, 505 according to GRCh38 / hg38.

[0118] In embodiments, cell surface expression of the endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region. In embodiments, expression of a functional gene product of an endogenous TRAC locus is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

[0119] In embodiments, cell surface expression of one or more of the following is reduced or absent: TCRalpha, TCRbeta, TCRgamma, TCRdelta, CD3y, CD35, CD3s, and CD3zeta.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074In embodiments, expression of a functional gene product of an endogenous TRBC1 locus is reduced or eliminated. In embodiments, expression of a functional gene product of an endogenous TRBC2 locus is reduced or eliminated. In embodiments, the CD3 locus is or comprises: a CD3d locus, a CD3g locus, a CD3e locus, or CD3z locus. In embodiments, expression of a functional gene product of an endogenous CD3d locus is reduced or eliminated. In embodiments, expression of a functional gene product of an endogenous CD3g locus is reduced or eliminated. In embodiments, expression of a functional gene product of an endogenous CD3e locus is reduced or eliminated. In embodiments, expression of a functional gene product of an endogenous CD3z locus is reduced or eliminated. In embodiments, the safe harbor locus is or comprises an AAVS1 locus, an ABO locus, a CCR5 locus, a CLYBL locus, a CXCR4 locus, a F3 locus, a FUT1 locus, a GAPDH locus, a HMGB1 locus, a KDM5D locus, a LRP1 locus, a MICA locus, a MICB locus, a RHD locus, a ROSA26 locus, or a SHS231 locus.

[0120] In embodiments, the nucleic acid construct is inserted is an exon, an intron, between an intron and an exon, or a regulatory region. In embodiments, the nucleic acid construct is inserted randomly or is inserted at a targeted locus. In embodiments, the first recombinant polylnucleotide is inserted at a first locus and the second recombinant polynucleotide is inserted at a second locus. In embodiments, the first recombinant polylnucleotide and the second recombinant polynucleotide are inserted at the same locus.

[0121] In embodiments, the cell is selected from the group of consisting of a T cell, a CD4+ T cell, a CD8+ T cell, a regulatory T cell (Treg), a gamma delta T cell (yST), an invariant natural killer T (iNKT) cell, a mucosal associated invariant T (MAIT) cell, a macrophage, a monocyte, a natural killer (NK) cell, a tumor infiltrating lymphocyte (TIL), a cytotoxic T cell, a T helper cell, a memory T cell, a central memory T (TCM) cell, a stem memory T (TSCM) cell, a stem-cell-like memory T cell (or stem-like memory T cells), an effector memory T (TEM) cell, a TEMRA (CD45RA+) cell, an effector T cell, a Thl cell, a Th2 cell, a Th9 cell, a Th 17 cell, a Th22 cell, a Tfh (follicular helper) cell, a natural killer T (NKT) cell, a transitional memory T (TTM) cell, a terminal effector T (TTE) cell, a naive T (TN) cell, a hematopoietic stem cell, and a progenitor cell of the lymphoid lineage. In embodiments, the cell is selected from the group consisting of a T cell, a macrophage, a monocyte, and a natural killer (NK) cell. In embodiments, the cell is a T cell. In embodiments, the T cell is selected from the group consisting of a regulatory T cell (Treg), a gamma delta T cell, a CD8+ T cell, an invariant iNKT cell, a MAIT cell, a CAR T cell, a tumor-infiltrating lymphocyte, and an engineered T cell comprising a transcriptional receptor. In embodiments, the cell is anCooley Ref. No.: MNBI-005 / 02WO 352505-2074 autologous cell. In embodiments, the cell is an allogeneic cell. In embodiments, the cell is a primary cell. In embodiments, the cell is derived from a stem cell. In embodiments, the cell is genetically modified. In embodiments, the cell has reduced or eliminated cell surface expression of an endogenous T cell receptor.

[0122] In embodiments, the cell is more prone to display central memory phenotype than a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the recombinant polypeptide. In embodiments, the cell further comprises one or more modifications that inactivate or disrupt one or more alleles of TGFbeta, Regnase-1, FAS, PTPN2, NR4A3, CD52, PD-1, B2M, CIITA, SOCS1, CBLB, DGKalpha, and / or DGI< In embodiments, the cell is a mammalian cell. In embodiments, the cell is selected from the group consisting of a human cell, a mouse cell, and a canine cell.

[0123] In embodiments, the cell further comprises a sequence specific nuclease, a nucleic acid programmable DNA binding protein, an RNA guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding entity, a transcription activator-like effector (TALE) nucleic acid binding entity, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient-Cas protein, an enzymatically inactive Cas protein, a CRISPR- associated transposase (CAST), a Type II or Type V Cas protein, or a functional portion thereof. In embodiments, the cell further comprises Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, CaslO, Casl2, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl 2d (CasY), Casl2e (CasX), Casl2f (C2cl0), Cas 12g, Casl2h, Casl2i, Cas 12k (C2c5), Casl3, Casl3a (C2c2), Casl3b, Casl3c, Casl3d, C2c4, C2c8, C2c9, Cmrl, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csdl, Csd2, Cas5d, Csel, Cse2, Cse3, Cse4, Cas5e, Csfl, Csml, Csm2, Csm3, Csm4, Csm5, Csnl, Csn2, Cstl, Cst2, Cas5t, Cshl, Csh2, Cas5h, Csal, Csa2, Csa3, Csa4, Csa5, Cas5a, CsxlO, Csxl 1, Csyl, Csy2, Csy3, Csy4, Mad7, SpCas9, eSpCas9, SpCas9-HFl, HypaSpCas9, HeFSpCas9, evoSpCas9 high-fidelity variants of SpCas9, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCasl2a, AsCasl2a, AacCasl2b, BhCasl2b v4, TnpB, dCas (D10A), dCas (H840A), dCasl3a, dCasl3b, or a functional fragment thereof. In embodiments, the RNA-guided nuclease is a Life Edit nuclease (LEG), optionally a LEG14 nuclease.

[0124] In embodiments, the cell has reduced exhaustion, increased proliferative capacity, enhanced replicative lifespan, decreased replicative senescence, enhanced anti-tumor effect, enhanced tissue resident memory T cell phenotype, reduced dysfunction, enhanced persistence, and / or increase intratumoral presence in vivo. In embodiments, the cell hasCooley Ref. No.: MNBI-005 / 02WO 352505-2074 increased or decreased signaling through the CARD11-BCL10-MALT1 complex, NF-KB, AP-1, NF AT, JAK / STAT, and / or MEKZERK pathways. In embodiments, the cell has reduced exhaustion, increased proliferative capacity, enhanced replicative lifespan, decreased replicative senescence, enhanced anti-tumor effect, enhanced tissue resident memory T cell phenotype, reduced dysfunction, enhanced persistence, increased intratumoral presence in vivo, reduced endogenous TCR activation, reduced antigen independent signaling, enhanced antigen-specific signaling, increased IL-2 secretion, increased IFN-y secretion, enhanced expansion in the presence of antigen, enhanced retraction in the absence of antigen, and / or reduced GVHD in vivo. In embodiments, wherein the cell, or a population of cells, expresses one or more of GPR25, CD27, and CCL5 at a level that is at least 1.5-fold greater, at least 2- fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-fold greater, at least 4- fold greater, at least 4.5-fold greater, or at least 5-fold greater compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell comprising a recombinant nucleic acid encoding a TGFbR2-DNR.

[0125] In embodiments, the cell, or a population of cells, expresses one or more of AK4, P4HA2, PPFIA4, VLDLR, LDHA, MIR210HG, PGK1, TPI1, PGAM1, CXCL10, CXCR4, VEGFA, AIF1, ATF3, MKI67, ICOS, CD69, EBI3, IL2RA, P2RY14, SELL, and CAPG at a level that is greater compared to a control cell; and / or or more of ATM, PHC3, EOMES, FOXP1, and TOX at a level that is lower compared to a control cell; optionally, wherein the control cell is a wildtype cell, an unmodified cell, or a cell that does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof; optionally, wherein the control cell is a cell that expresses the CAR, but does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof.

[0126] In embodiments, the level is mRNA expression level; optionally, wherein the mRNA expression level is determined by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR), PCR, RNAseq, microarray, gene chip, nCounter Gene Expression Assay, Serial Analysis of Gene Expression (SAGE), Rapid Analysis of Gene Expression (RAGE), nuclease protection assays, Northern blotting, nucleic acid hybridization, or any other equivalent gene expression detection techniques. In embodiments, the 1 level is protein expression level; optionally, wherein the protein expression level is determined by antibody - based testing, immunoassay, radioimmunoassay (RIA), immunohistochemistry, immunofluorescence, chemiluminescence, phosphorescence, proteomics techniques, surfaceCooley Ref. No.: MNBI-005 / 02WO 352505-2074 plasmon resonance (SPR), mass spectrometry, protein microarray, or any other equivalent protein expression detection techniques.

[0127] In embodiments, the cell, or a population of cells, expresses AK4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses P4HA2 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses PPFIA4 at a level that is at least 1.5-fold, at least 2-fold, at least2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses VLDLR at a level that is at least 1.5- fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses LDHA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20- fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses MIR210HG at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses PGK1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5- fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses TPI1 at a level that is at least 1.5- fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses PGAM1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20- fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses CXCL10 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at leastCooley Ref. No.: MNBI-005 / 02WO 352505-207415-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses CXCR4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses VEGFA at a level that is at least 1.5- fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses AIF1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses ATF3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3- fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, MKI67 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses P2RY14 at a level that is at least 1.5-fold, at least 2- fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses ICOS at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses EBI3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5- fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses IL2RA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3- fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses CAPG at a level that is at least 1.5-fold, at least 2-fold, at least2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0128] In embodiments, the cell, or a population of cells, expresses ATM at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4- fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or a population of cells, expresses PHC3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or a population of cells, expresses EOMES at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or a population of cells, expresses SELL at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5- fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell. In embodiments, the cell, or a population of cells, expresses FOXP1 at a level that is at least1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or a population of cells, expresses TOX at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5- fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell. In embodiments, the cell, or a population of cells, expresses TOX2 at a level that is less than 0.9-fold, less than 0.8-fold, less than 0.7-fold, less than 0.6-fold, less than 0.5-fold, less than 0.4-fold, or less than 0.3-fold compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell comprising a recombinant nucleic acid encoding a TGFbR2-DNR.

[0129] In embodiments, the cell has reduced or eliminated cell surface expression of TCRalpha, TCRbeta, and / or CD3zeta compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of TCRalpha, TCRbeta, and / or CD3zeta, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region; optionally, wherein the cell surface expression of TCRalpha, TCRbeta, and / or CD3zeta is knocked-out, knocked-down (e.g., via shRNA, miRNA, or RNAi), or reduced via retention in the endoplasmic reticulum, or reduced via expression of a dominant negative form of a TCR component. In embodiments, the cell surface expression of TCRalpha is reduced by at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 at least 99%, or 100%, compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of TCRalpha, TCRbeta, and / or CD3zeta, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region; the cell surface expression of TCRbeta is reduced by at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%, compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of TCRalpha, TCRbeta, and / or CD3zeta, or a cell comprising an intact TCRalpha, and / or CD3zeta encoding genomic region; and / or the cell surface expression of CD3zeta is reduced by at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%, compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of TCRalpha, TCRbeta, and / or CD3zeta, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

[0130] In one aspect, the present disclosure provides a composition comprising any vector of disclosed herein, any particle disclosed herein, or any engineered cell disclosed herein. In embodiments, the composition further comprises a pharmaceutically acceptable excipient. In embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition express the recombinant polypeptide. In embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition express the recombinant polypeptide. In embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition do not express a functional gene product of an endogenous TRAC locus. In embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition express a recombinant polypeptide disclosed herein; at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition express a CAR or recombinant TCR disclosed herein; and / or at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition do not express a functional gene product of an endogenous TRAC locus. In embodiments, the composition comprises CD4+ T cells and CD8+ T cells, and the percentage of CD4+ T cells in the composition is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the total cells in the composition; and / or the percentage of CD8+ T cells in the composition is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the totalCooley Ref. No.: MNBI-005 / 02WO 352505-2074 cells in the composition; and / or the ratio of CD4+ T cells to CD8+ T cells is from at or about 1 :3 to at or about 3: 1, optionally at or about 1 : 1.

[0131] In one aspect, the present disclosure provides a method of preparing an engineered cell, wherein the method comprises contacting the cell with any recombinant nucleic acid disclosed herein, any vector disclosed herein, or any particle disclosed herein.

[0132] In embodiments, the method comprises expressing in the cell any recombinant polypeptide disclosed herein. In embodiments, the method further comprises expressing a recombinant polypeptide comprising at least one tag in its extracellular region, wherein the at least one tag comprises a peptide epitope or a mimotope that mimics an epitope. In embodiments, the method comprises enriching the engineered cells expressing the recombinant polypeptide using a binding agent that binds to the peptide epitope or mimotope; optionally, wherein the binding agent comprises a monoclonal antibody. In embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered cells, or of the total cells, in the composition express the recombinant polypeptide.

[0133] In embodiments, the cell is in vivo. In embodiments, the cell is prepared in vivo. In embodiments, the cell is prepared in the body of a subject in need of treatment.

[0134] In some embodiments, the recombinant polypeptide is expressed in the cell, and / or the nucleic acid construct is introduced into the cell, by contacting the cell with a vector or a particle. In embodiments, the vector is a plasmid, a synthetic DNA vector, a linear DNA vector, a closed linear DNA vector, a phagemid vector, an RNA vector, an mRNA vector, or a viral vector. In embodiments, the viral vector is selected from a retrovirus vector, an adenovirus vector, and an adeno-associated virus (AAV) vector. In embodiments, the retrovirus is a lentivirus, optionally a VSV-G pseudotyped lentivirus. In embodiments, the AAV vector is an AAV6 vector or an AAV9 vector. In embodiments, the AAV vector comprises two homology arms flanking the nucleic acid encoding the recombinant polypeptide and / or the CARD-containing protein or a functional fragment thereof, and wherein the lengths of the two homology arms are between about 150 bp and about 1500 bp. In embodiments, the length of at least one of the two homology arms is about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp; optionally, wherein the lengths of both of the homology arms are about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp.

[0135] In embodiments, the vector is a fusosome, a lentiviral particle engineered with the anti-CD3 Cocal glycoprotein, or an enveloped delivery vehicle. In embodiments, the vector is a self-replicating RNA virus, an mRNA-packaging virus-like particle, or a ribonucleoproteinCooley Ref. No.: MNBI-005 / 02WO 352505-2074(RNP)-packaging virus-like particle. In embodiments, the particle is a lipid nanoparticle (LNP), a selective organ targeting (SORT) LNP, or an antibody targeted LNP.

[0136] The method of claim 226, wherein the LNP comprises: (i) an ionizable lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a non-cationic helper lipid or phospholipid, and (iv) a PEG-lipid (e.g., a PEG-modified lipid). In embodiments, the particle is a polymer nanoparticle or a protein nanoparticle.

[0137] In embodiments, the cell is ex vivo. In embodiments, the cell is prepared ex vivo. In embodiments, the cell is prepared outside of the body of a subject in need of treatment. In embodiments, the nucleic acid construct is introduced into the cell by electroporation or transfection. In embodiments, the transfection is lipofection. In embodiments, the nucleic acid construct is a plasmid, a synthetic DNA vector, a linear DNA vector, a closed linear DNA vector, a phagemid vector, an RNA vector, or an mRNA vector. In embodiments, the nucleic acid construct is introduced via a viral vector. In embodiments, the viral vector is selected from a retrovirus vector, an adenovirus vector, and an adeno-associated virus (AAV) vector. In embodiments, the retrovirus is a lentivirus, optionally a VSV-G pseudotyped lentivirus. In embodiments, the AAV vector is an AAV6 vector or an AAV9 vector. In embodiments, the AAV vector comprises two homology arms flanking the nucleic acid encoding the recombinant polypeptide and / or the CARD-containing protein or a functional fragment thereof, and wherein the lengths of the two homology arms are between about 150 bp and about 1500 bp. In embodiments, the length of at least one of the two homology arms is about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp; optionally, wherein the lengths of both of the homology arms are about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp.

[0138] In one aspect, the present disclosure provides a method of preparing an engineered cell, wherein the method comprises contacting the cell with an AAV vector comprising a recombinant nucleic acid encoding any recombinant polypeptide disclosed herein.

[0139] In one aspect, the present disclosure provides a method of preparing an engineered cell, wherein the method comprises contacting the cell with a particle comprising a recombinant nucleic acid encoding: the recombinant polypeptide of any one of claims 1-66; or at least the following three polypeptides: (i) a recombinant receptor that comprises a binding region for an antigen, (ii) a recombinant polypeptide comprising at least one tag in its extracellular region, wherein the at least one tag comprises a peptide epitope or a mimotope that mimics an epitope; and (iii) a potency enhancement polypeptide; optionally, wherein the particle is a lipid nanoparticle (LNP).Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0140] In embodiments, the cell further expresses (i) a recombinant polypeptide comprising at least one tag in its extracellular region, wherein the at least one tag comprises a peptide epitope or a mimotope that mimics an epitope; or (ii) a potency enhancement polypeptide. In embodiments, the cell further expresses (i) a recombinant polypeptide comprising at least one tag in its extracellular region, wherein the at least one tag comprises a peptide epitope or a mimotope that mimics an epitope; or (ii) a potency enhancement polypeptide. In embodiments, the method comprises genetically modifying the cell for expression of the recombinant polypeptide. In embodiments, the method comprises introducing into the cell one or more nucleic acids encoding a sequence specific nuclease or a nucleic acid programmable DNA binding protein. In embodiments, the method additionally comprises introducing into the cell one or more guide RNAs.

[0141] In embodiments, the sequence-specific nuclease is an RNA guided nuclease. In embodiments, the sequence-specific nuclease or nucleic acid programmable DNA binding domain is a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding entity, a transcription activator-like effector (TALE) nucleic acid binding entity, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient-Cas protein, an enzymatically inactive Cas protein, a CRISPR- associated transposase (CAST), a Type II or Type V Cas protein, or a functional portion thereof. In embodiments, the Cas nuclease is Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, CaslO, Casl2, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl 2d (CasY), Casl2e (CasX), Casl2f (C2cl0), Cas 12g, Casl2h, Casl2i, Cas 12k (C2c5), Casl3, Casl3a (C2c2), Casl3b, Casl3c, Casl3d, C2c4, C2c8, C2c9, Cmrl, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csdl, Csd2, Cas5d, Csel, Cse2, Cse3, Cse4, Cas5e, Csfl, Csml, Csm2, Csm3, Csm4, Csm5, Csnl, Csn2, Cstl, Cst2, Cas5t, Cshl, Csh2, Cas5h, Csal, Csa2, Csa3, Csa4, Csa5, Cas5a, CsxlO, Csxl 1, Csyl, Csy2, Csy3, Csy4, Mad7, SpCas9, eSpCas9, SpCas9-HFl, HypaSpCas9, HeFSpCas9, and evoSpCas9 high- fidelity variants of SpCas9, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCasl2a, AsCasl2a, AacCasl2b, BhCasl2b v4, TnpB, dCas (D10A), dCas (H840A), dCasl3a, dCasl3b, or a functional portion thereof. In embodiments, the RNA-guided nuclease is a Life Edit nuclease (LEG), optionally a LEG14 nuclease.

[0142] In embodiments, the method comprises introducing into the cell a ribonucleoprotein (RNP) complex comprising the sequence-specific nuclease or nucleic acid programmable DNA binding. In embodiments, the ribonucleoprotein (RNP) complex comprises a Cas9 nuclease and a sgRNA. In embodiments, the sgRNA comprises a polynucleotide sequence of AGAGCAACAGUGCUGUGGCC (SEQ ID NO: 520). In embodiments, the sgRNACooley Ref. No.: MNBI-005 / 02WO 352505-2074 comprises a polynucleotide sequence of CAGGGUUCUGGAUAUCUGU (SEQ ID NO: 519).

[0143] In embodiments of the method, introducing the nucleic acid construct comprises contacting the cell with any particle disclosed herein or any vector disclosed herein. In embodiments, the recombinant nucleic acid is introduced via electroporation. In embodiments, the recombinant nucleic acid is introduced via AAV. In embodiments, the recombinant nucleic acid is introduced via lentivirus, optionally a VSV-G pseudotyped lentivirus. In embodiments, the recombinant nucleic acid is introduced via LNP. In embodiments, the recombinant nucleic acid is inserted into an endogenous locus of the cell. In embodiments, the endogenous locus is or comprises a T-cell receptor (TCR) alpha (TRA) locus, a TCR beta (TRB) locus, a CD3 locus, a B2 microglobulin (B2M) locus, a class II transactivator (CIITA) locus, or a safe harbor locus. In embodiments, the TRA locus is or comprises a TRAC locus or a TRAJ locus. In embodiments, the TRB locus is or comprises a TRBC1 gene locus, a TRBC2 gene locus, or a TRBJ locus. In embodiments, the endogenous locus is or comprises a TRAC gene locus. In embodiments, the endogenous locus is or comprises a TRAJ locus. In embodiments, the safe harbor locus is an AAVS1 locus, an ABO locus, a CCR5 locus, a CLYBL locus, a CXCR4 locus, a F3 locus, a FUT1 locus, a GAPDH locus, a HMGB1 locus, a KDM5D locus, a LRP1 locus, a MICA locus, a MICB locus, a RHD locus, a ROSA26 locus, or a SHS231 locus.

[0144] In embodiments, the first insertion site is an exon. In embodiments, the insertion site is between chrl4:22, 547, 677-22, 547, 696 according to GRCh38 / hg38. In embodiments, the first insertion site is an intron. In embodiments, the insertion site is between chrl4:22,547,502- 22,547,520 according to GRCh38 / hg38. In embodiments, the insertion site is between chrl4:22, 547, 504-22, 547, 505 according to GRCh38 / hg38. In embodiments, the first insertion site is between an intron and an exon. In embodiments, the first insertion site is in a regulatory region. In embodiments, the first insertion site is 25 nucleotides or less from a protospacer adjacent motif (PAM) sequence, wherein the PAM sequence is ngg, nag, ngrrt, ngrm, nnnngatt, nnnnryac, nnagaaw, naaaac, tttv, ttn, attn, tttn, gttn, or yttn and wherein: (i) r = a or g, (ii) y = c or t, (iii) w = a or t, (iv) v = a or c or g, and (v) n = a, c, t, or g.

[0145] In embodiments, the cell comprises a modified TRAC gene locus. In embodiments, cell surface expression of an endogenous TCR is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region. In embodiments, cell surface expression of TCRalpha, TCRbeta, and / or CD3zeta is knocked-out, knocked-down (e.g., via shRNA,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 miRNA, or RNAi), reduced via retention in the endoplasmic reticulum, or reduced via expression of a dominant negative form of a TCR component.

[0146] In embodiments, the method further comprises introducing a gene editing machinery into the cell. In embodiments, the step of introducing comprises homology-directed repair (HDR)-mediated insertion using the gene editing machinery. In embodiments, the (HDR)- mediated insertion uses a template comprising two homology arms flanking the nucleic acid encoding the recombinant polypeptide and / or the CARD-containing protein or a functional fragment thereof, and wherein the lengths of the two homology arms are between about 150 bp and about 1500 bp. In embodiments, the length of at least one of the two homology arms is about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp; optionally, wherein the lengths of both of the homology arms are about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp.

[0147] In embodiments, the gene editing machinery is CRISPR / Cas9. In embodiments, the gene editing machinery comprises a sgRNA comprising a polynucleotide sequence of AGAGCAACAGUGCUGUGGCC (SEQ ID NO: 520). In embodiments, the gene editing machinery comprises a sgRNA comprising a polynucleotide sequence of CAGGGUUCUGGAUAUCUGU (SEQ ID NO: 519). In embodiments, the gene editing machinery is introduced via electroporation. In embodiments, the nucleic acid construct is introduced via AAV. In embodiments, the nucleic acid construct is introduced via LNP.

[0148] In embodiments, the method thereby produces an engineered cell comprising: (i) the recombinant polypeptide; (ii) the immune receptor (e.g., CAR); and (iii) the modified TRAC gene locus. In embodiments, the method produces an engineered cell that expresses one or more of GPR25, CD27, and CCL5 at a level that is at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-fold greater, at least 4-fold greater, at least 4.5-fold greater, or at least 5-fold greater compared to TGFbR2-DNR DLL3 CAR T cells. In embodiments, the method produces a cell expresses TOX2 at a level that is less than 0.9-fold, less than 0.8-fold, less than 0.7-fold, less than 0.6-fold, less than 0.5-fold, less than 0.4-fold, or less than 0.3-fold compared to TGFbR2-DNR DLL3 CAR T cells. In embodiments of the method, the cell is for use in a cell therapy.

[0149] The present disclosure also provides a method of treating cancer in a subject in need thereof, comprising administering an effective amount of a recombinant nucleic acid disclosed herein, a vector disclosed herein, a particle disclosed herein, an engineered cell disclosed herein, or a composition disclosed herein, to the subject. In embodiments, the subject is not administered a lymphodepletive agent within 7 days prior to administration of the cell. InCooley Ref. No.: MNBI-005 / 02WO 352505-2074 embodiments, the subject is not administered cyclophosphamide, fludarabine, or bendamustine within 7 days prior to administration of the cell. In embodiments, the peptide epitope or mimotope specifically binds to an antibody for an antigen associated with the cancer. In embodiments, the cancer is a hematological cancer. In embodiments, the cancer is myeloid neoplasm, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), blast crisis chronic myelogenous leukemia (bcCML), B-cell acute lymphoid leukemia (B-ALL), T-cell acute lymphoid leukemia (T-ALL), T-cell lymphoma, or B-cell lymphoma. In embodiments, the cancer is a solid tumor. In embodiments, the cancer is small cell lung cancer, colorectal cancer, testicular cancer, ovarian cancer, melanoma, lymphoma, leukemia, multiple myeloma, prostate cancer, breast cancer, non-small cell lung cancer, gastric cancer, esophageal cancer, liver cancer, kidney cancer, head & neck cancer, glioblastoma, neuroblastoma, soft tissue sarcoma, uterine cancer, brain cancer, skin cancer, renal cancer, bladder cancer, pancreatic cancer, thyroid cancer, eye cancer, gastrointestinal cancer, carcinoma, or sarcoma. In embodiments, the cancer is is small cell lung cancer (SCLC), neuroendocrine prostate cancer, large cell neuroendocrine carcinoma, high grade neuroendocrine tumors, Glioma, Glioblastoma, or Melanoma. In embodiments, the cancer is cervical squamous cell and endocervical adenocarcinoma, LUSC (lung squamous cell carcinoma), LU AD (lung adenocarcinoma), HNSC (head and neck squamous cell carcinoma), BLCA (bladder carcinoma), PRAD (prostate adenocarcinoma), UCEC (uterine corpus endometrial carcinoma), KIRP (kidney renal papillary cell carcinoma), THCA (thyroid carcinoma), COAD (colon adenocarcinoma), READ (rectum adenocarcinoma), or BRCA (breast carcinoma). In embodiments, the cancer is colorectal cancer, breast cancer, ovarian cancer, brain cancer, esophageal cancer, stomach adenocarcinoma, acute myeloid leukemia, multiple myeloma, bladder cancer, NSCLC, pancreatic cancer, head and neck squamous cell carcinoma, liver cancer, sarcomas, prostate cancer, biliary tract cancer, melanoma, uterine cancer, cervical cancer, or renal cell carcinoma. In embodiments, the cancer expresses CD1, CD la, CD lb, CDlc, CDld, CDle, CD2, CD3d, CD3e, CD3g, CD3s, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD 152, CD 154, CD 158, CD171, CD 178, CD 179, CD 179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, p53R175H, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, ggcc, signal regulatory protein a (SIRPa), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-l lRa, PSCA, PRSS21, VEGFR2, LewisY, PDGFRP, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF -I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o- acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Poly sialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-A1, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-l / Galectin 8, MelanA / MARTl, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIRl, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, or any combination thereof. In embodiments, the cancer expresses B7H3, BCMA, CD 19, CD20, CD22, CD70, CD79a, CD79b, CLDN6, CLDN18.2, DLL3, GCC, GD2, GD3, GPC3, GPRC5D, KLK3, LY6G6D, p53R175H, PRAME, ROPN1, STEAP1, or STEAP2.

[0150] In embodiments, the cancer expresses DLL3. In embodiments, the cancer expresses p53R175H. In embodiments, the cancer is selected from Table 2. In embodiments, the cancer and the corresponding cancer-associated antigen are selected from Table 2. In embodiments, the peptide epitope or mimotope specifically binds to an antibody for a cancer-associated antigen of T cell lymphoma. In embodiments, the cancer-associated antigen of T cell lymphoma is CCR4 or CD3.

[0151] In embodiments, the method further comprises administering an antibody to the subject, wherein the monoclonal antibody binds the tag. In embodiments, the method furtherCooley Ref. No.: MNBI-005 / 02WO 352505-2074 comprises monitoring the subject for an adverse event. In embodiments, the method further comprises monitoring the subject for treatment outcomes.

[0152] In one aspect, the present disclosure provides a method of depleting engineered cells in a subject in need thereof, comprising administering to the subject an antibody that binds to a tag expressed on the surface of the engineered cells. In one aspect, the present disclosure provides a method of reducing or eliminating at least one symptom of an adverse event caused by engineered cells in a subject in need thereof, comprising administering to the subject an antibody that binds to a tag expressed on the surface of the engineered cells. In embodiments, the subject has been administered the engineered cells within 1, 2, 3, 4, 5, or 6 days, or within 1, 2, 3, or 4 weeks, or within 1, 2, 3, 6, or 12 months prior to administration of the antibody. In embodiments, the subject has been administered any recombinant nucleic acid disclosed herein, any vector disclosed herein, or any particle disclosed herein, within 1, 2, 3, 4, 5, or 6 days, or within 1, 2, 3, or 4 weeks, or within 1, 2, 3, 6, or 12 months prior to administration of the antibody.

[0153] In embodiments, administration of the antibody depletes at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 99.5%, or at least 99.9% of the engineered cells expressing the tag in the subject. In embodiments, the antibody is administered after the detection or occurrence of an adverse event, and administration of the antibody reduces or eliminates at least one symptom of the adverse event. In embodiments, the method additionally comprises administration of corticosteroids, tocilizumab, and / or anakyrin. In embodiments, the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder, splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma.

[0154] In embodiments, the antibody is administered after the detection or occurrence of a treatment outcome, optionally wherein the treatment outcome is reduction or elimination of the cancer. In embodiments, the method additionally comprises monitoring the subject for reduction or elimination of at least one symptom of the adverse event, optionally wherein the monitoring comprises one or more of: clinical laboratory tests of ferritin, C-reactive protein (CRP), creatinine, alanine transaminase (ALT), aspartate transaminase (AST), fibrinogen, lactose dehydrogenase (LDH), absolute or relative white blood cell count, and / or absolute orCooley Ref. No.: MNBI-005 / 02WO 352505-2074 relative T cell count; imaging, wherein the imaging is PET, CT, MRI, and / or x-ray; clinical assessment of body temperature, blood pressure, blood oxygenation, heart rate, cognitive status, and / or organ function; and standardized assessment used for detecting or monitoring one or more adverse events, optionally wherein the standardized assessment comprises the Immune Effector Cell-Associated Encephalopathy (ICE) assessment, the Cornell Assessment, and / or the Pediatric Delirium (CAPD) assessment.

[0155] In embodiments, the method results in at least one of: depletion of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the engineered cells in the subject; depletion of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of regulatory T cells in the subject; clinical laboratory results within the normal range for ferritin, C-reactive protein (CRP), creatinine, alanine transaminase (ALT), aspartate transaminase (AST), fibrinogen, lactose dehydrogenase (LDH), absolute or relative white blood cell count, and / or absolute or relative T cell count; imaging results indicating a reduction in cancer or reduction in at least one symptoms of an adverse event; reduction or absence of fever, hypotension, hypoxia, tachycardia, aphasia, cognitive impairment, coagulopathy, respiratory failure, lymphadenopathy, and / or splenomegaly; improved score on a standardized assessment used for detecting or monitoring one or more adverse events; or ability to reduce or eliminate administration of corticosteroids, tocilizumab, and / or anakyrin.

[0156] In embodiments, the method results in at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% higher depletion of the engineered cell than a control method to reduce or eliminate the at least one symptom of the adverse event, optionally wherein the control method comprises administering corticosteroids, tocilizumab, and / or anakyrin. In embodiments, the method results in higher therapeutic efficacy than a control method to reduce or eliminate the at least one symptom of the adverse event, optionally wherein the control method comprises administering corticosteroids, tocilizumab, and / or anakyrin. In embodiments, the adverse event is an acute adverse event.

[0157] In embodiments, the antibody is a bi-specific or multi-specific antibody that is capable of specifically binding to the peptide epitope or the mimotope. In embodiments, the antibody is a bi-specific or multi-specific antibody that is capable of specifically binding to (i)Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 the peptide epitope or the mimotope; and (ii) CD3. In embodiments, the antibody is a bi- specific or multi-specific antibody that is capable of specifically binding to (i) the peptide epitope or the mimotope; and (ii) CD 16. In embodiments, the e antibody is a tri-specific or multi-specific antibody that is capable of specifically binding to (i) the peptide epitope or the mimotope; (ii) 41BB or albumin, and (ii) CD3. In embodiments, the antibody is tarlatamab. In embodiments, the antibody is mogamulizumab.

[0158] In embodiments, between about 0.003 mg / kg and about 10 mg / kg, between 0.01 mg / kg and 10 mg / kg, between 0.003 mg / kg and 0.3 mg / kg, between 0.05 mg / kg and 5 mg / kg, or between 0.1 mg / kg and 1 mg / kg of the antibody is administered to the subject. In embodiments, the antibody is administered to the subject once, or wherein the antibody is administered more than once with an interval of about 1, 2, 3, or 4 weeks. In embodiments, both the antibody and the binding region of the recombinant polypeptide can specifically bind the same antigen. In embodiments, the antibody is mogamulizumab, and wherein the method further comprises administering one or more of: at least one retinoid; interferon alpha; and / or extracorporeal photopheresis (ECP); optionally, wherein the retinoid and / or interferon alpha is delivered systemically.

[0159] In one aspect, the present disclosure provides a method of isolating or enriching any engineered cells disclosed herein, comprising contacting the engineered cells with a binding agent that that binds to the epitope or the mimotope. In embodiments, the binding agent comprises an antibody. In embodiments, the binding agent comprises a purification marker; optionally, wherein the purification marker comprises biotin, avidin, a myc tag, an influenza hemagglutinin (HA) tag, a FLAG tag, a glutathione-S transferase (GST) tag, a V5 tag, a poly- Histidine (His) tag, a Fc tag, calmodulin binding protein (CBP), maltose-binding protein (MBP), thioredoxin, or a chitin-binding protein. In embodiments, the binding agent is bound to a solid substrate or a purification bead. In embodiments, the method results in a population of purified engineered cells in which at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the engineered cell expresses the recombinant polypeptide.

[0160] In one aspect, the present disclosure provides a method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of engineered cells isolated or enriched by any method disclosed herein.

[0161] In one aspect, the present disclosure provides a method of ex vivo or in vivo measuring the number of any engineered cells disclosed herein, comprising administering, orCooley Ref. No.: MNBI-005 / 02WO 352505-2074 contacting the engineered cells with, a binding agent that binds to the epitope or the mimotope; optionally, wherein the binding agent comprises an antibody.BRIEF DESCRIPTION OF THE DRAWINGS

[0162] FIGs. 1A-1D show show cell surface expression of two different DLL3 CARs (FIG. 1A) and CAR mean fluorescent intensity (MFI; FIG. IB) on T cells as measured by flow cytometry, and levels of IFNy (FIG. 1C) and IL-2 (FIG. ID) secreted by T cells co-cultured with DLL3-negative target tumor cells (A-549) or DLL3-positive target tumor cells (SHP-77 and DMS-273), following lentiviral delivery of a construct comprising a the CARD11- PIK3R3 Fusion alone (Cl 1P3), a DLL3 CAR alone (CAR), a DLL3 CAR with the CARD11- PIK3R3 fusion (CAR+C11P3), a benchmark DLL3 CAR alone (Benchmark CAR), a benchmark DLL3 CAR with the CARD11-PIK3R3 fusion (Benchmark CAR+C11P3), compared to untransduced T cells (UTD).

[0163] FIGs. 2A-2E show surface expression of a DLL3 CAR (FIGs. 2A and 2B) and CD3 (FIG. 2C) on T cells, measured by flow cytometry, and levels of IFNy (FIG. 2D) and IL-2 (FIG. 2E) secreted by T cells co-cultured with DLL3-negative target tumor cells (A-375) or DLL3-positive target tumor cells (SHP-77), following AAV6 knock-in or lentiviral vector (LVV) delivery of a construct comprising a DLL3 CAR alone (LW.CAR or AAV.CAR) or a DLL3 CAR with a CARD11-PIK3R3 fusion (LVV.CAR.C11P3, LVV or AAV.CAR.C11P3), compared to untransduced T cells (UTD).

[0164] FIGs. 3A-3B show tumor volumes in immunodeficient mice bearing DLL3 -positive SHP-77 small cell lung cancer (SCLC) tumors following administration of 1 x 106untransduced T cells (UTD, FIG. 3 A), or 1 x 106or 0.2 x 106CAR+ T cells transduced with AAV6 knock-in or LVV-delivered DLL3 CAR (CAR, FIG. 3B). FIGs. 3C-3F show surface expression of an anti-DLL3 CAR (FIGs. 3C and 3D) measured by flow cytometry, and levels of IFNy (FIG. 3E) and IL-2 (FIG. 3F) secreted by T cells co-cultured with DLL3-negative target tumor cells (A-549) or DLL3-positive target tumor cells (SHP-77), following AAV6 knock-in of a construct comprising a DLL3 CAR with a full-length CARD11-PIK3R3 fusion (CAR.C11P3), compared to untransduced T cells (UTD).

[0165] FIGs. 4A and 4B show surface expression of a DLL3 CAR (FIG. 4A) and CAR mean fluorescent intensity (MFI; FIG. 4B), measured by flow cytometry, in T cells transduced with AAV6 delivering an HDR template comprising a DLL3 CAR with a CARD11-PIK3R3 fusion, where the HDR template had homology arm lengths of 250 base pairs or 300 base pairs flanking both ends of the transgene.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0166] FIGs. 5A-5C show surface expression of a DLL3 CAR (FIGs. 5 A and 5B) and CD3 (FIG. 5C) measured by flow cytometry, on T cells transduced with AAV6 that delivered an HDR template construct targeting TRAC exon 1 or TRAJ at the indicated MOIs.

[0167] FIGs. 6A and 6B show levels of antigen-dependent release of ZFNy (FIG. 6A) and IL-2 (FIG. 6B) by T cells co-cultured with DLL3-negative target tumor cells (A-375), DLL3- low target tumor cells (DMS273), or DLL3-high target tumor cells (SHP-77), following insertion of the CAR plus CARD11-PIK3R3 fusion construct into TRAC exon 1 or TRAJ.

[0168] FIGs. 7A-7D show surface expression (FIG. 7A) and mean fluorescent intensity (MFI; FIG. 7B) of the DLL3 CAR and functional antigen-dependent cytokine release (FIG. 7C and 7D) of T cells co-cultured with DLL3-negative target tumor cells (A-549) or DLL3- positive target tumor cells (SHP-77) following lentiviral vector (LVV) delivery of a transgene with the DLL3 CAR (CAR) or the DLL3 CAR and the CARD11-PIK3R3 fusion protein (CAR.C11P3), compared to untransduced T cells (UTD).

[0169] FIGs. 8A-8F show tumor volumes (FIGs. 8A-8C) and peripheral T cell pharmacokinetics as measured by hCD45+ flow cytometric staining (FIGs. 8D-8F) in immunodeficient mice bearing DLL3-positive SHP-77 small cell lung cancer (SCLC) tumor xenografts following administration of untransduced T cells (UTD, FIGs. 8A and 8D), T cells transduced with an LVV-delivered DLL3 CAR transgene (CAR, FIGs. 8B and 8E), or T cells transduced with an LVV to deliver DLL3 CAR plus CARD11-PIK3R3 fusion (CAR.C11P3, FIGs. 8C and 8F) transgenes.

[0170] FIGs. 9A-9C show flow cytometry analyses of untransduced T cells (UTD) and T cells following AAV6-mediated DLL3 CAR + CARD11-PIK3R3 knock-in. Flow cytometry analysis of T cells transduced with AAV6 to knock-in a DLL3-specific CAR containing a full- length CARD11-PIK3R3 fusion (CAR.C11P3) at the TRAC locus, compared to untransduced T cells (UTD). Shown are expression levels of the DLL3 CAR (FIGs 9A and 9B) as well as CD3 (FIG. 9C).

[0171] FIGs. 10A and 10B show IFN-y (FIG. 10A) and IL-2 (FIG. 10B) secretion following in vitro co-culture of untransduced T cells (UTD) and CAR.C11P3 T cells (CAR.C11P3) with tumor cells comprising varying levels of DLL3 expression. Specifically, the target cell lines included DLL3-negative controls (A-375, A-549, SNU387), a high DLL3- expressing engineered cell line (A-375. hDLL3), and DLL3-positive lines with endogenous DLL3 expression (SHP-77 and DMS-273).

[0172] FIGs. 11A-11C show the cytotoxicity of T cells comprising the DLL3 CAR + CARD11-PIK3R3 fusion transgene (CAR.C11P3) against DLL3 -expressing target cells.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Specifically, the figures show CAR.C11P3 T cell (CAR.C11P3) and untransduced T cell (UTD) cytotoxicity against DLL3-negative A-375 cells (FIG. 11 A), DLL3-positive SHP-77 cells (FIG. 1 IB), and DLL3-positive DMS-273 cells (FIG. 11C).

[0173] FIGs. 12A-12C show the proliferation of T cells comprising the DLL3 CAR + CARD11-PIK3R3 fusion transgene (CAR.C11P3) after repeated stimulation with DLL3 negative and DLL3 positive cells. The data shows the proliferation of CAR.C11P3 T cells after repeated stimulation with the DLL3 -negative A-375 cell line (FIG. 12 A), the DLL3- positive SHP-77 cell line (FIG. 12B), and the DLL3-positive DMS-273 cell line (FIG. 12C).

[0174] FIGs. 13A-13H show the tumor curves (FIGs. 13A, 13C, 13E, and 13G) and Kaplan-Meier curves (FIGs. 13B, 13D, 13F, and 13H) of mice with SHP-77 tumors treated with untransduced T cells (UTD, FIGs. 13A and 13B), IxlO6CAR.C11P3 T cells (CAR.C11P3 IxlO6, FIGs. 13C and 13D), 2xl05CAR.C11P3 T cells (CAR.C11P3 2xl05, FIGs. 13E and 13F), and 4xl04CAR.C11P3 T cells (CAR.C11P3 4xl04, FIGs. 13G and 13H).

[0175] FIGs. 14A-14F show the tumor curves (FIGs. 14A and 14B), engineered T cell counts from blood samples (FIGs. 14C and 14D), and fFNy secretion in plasma samples from engineered T cells (FIGs. 14E and 14F) of mice with SHP-77 tumors treated with untransduced T cells (UTD, FIGs. 14A, 14C, and 14E) and 2xl05CAR.C11P3 T cells (CAR.C11P3, FIGs. 14B, 14D, and 14F).

[0176] FIGs. 15A-15D show tumor volumes in immunodeficient mice bearing DLL3- positive SHP-77 small cell lung cancer (SCLC) tumor xenografts following administration of DLL3+ CAR T cells engineered with either the CARD11-PIK3R3 fusion (CAR.C11P3) or a dominant negative TGFB Receptor II (CAR.TGFbR2-DNR). Mice received either 2 x 105CAR+ T cells (FIGs. 15A and 15B) or 1 x 106CAR+ T cells (FIGs. 15C and 15D). Tumor growth curves for individual mice are shown.

[0177] FIGs. 16A-16C show tumor volumes (FIG. 16A) and T-cell infiltration in tumors and spleens (FIG. 16B) of immunodeficient mice bearing DLL3-positive SHP-77 SCLC xenografts following infusion with DLL3+ CAR T cells engineered with either the CARD11- PIK3R3 fusion (CAR.C11P3) or a dominant-negative TGFB receptor II (CAR.TGFBR2- DNR). T cell infilitration is quantified (FIG. 16B, bottom) and visualized by representative flow cytometry plots (FIG. 15C).

[0178] FIGs. 17 shows the transcriptomic profile of the tumor-infiltrating DLL3 CAR T cells with the CARD11-PIK3R3 fusion (CAR.C11P3) or TGFbR2-DNR (CAR.TGFbR2- DNR) of FIG. 16.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0179] FIGs 18A-18E show surface expression (FIGs. 18A and 18B), functional antigendependent cytokine release (FIGs. 18C and 18D), and NK cell mediated depletion of tagged T cells by incorporation of a depletion tag (FIG. 18E). FIGs 18A and 18B show surface expression of a DLL3 CAR as assessed by CAR staining (CAR Expression or CAR MFI, FIG. 18 A) and depletion tag staining (CCR4 Expression or CCR4 MFI, FIG. 18B) on T cells, measured by flow cytometry, and secretion of fFNy (FIG. 18C) and IL-2 (FIG. 18D) in supernatants of T cells co-cultured with DLL3-low target tumor cells (DMS273) or DLL3- high target tumor cells (SHP-77). FIG. 18E shows NK cell mediated cytotoxicity of tagged (Moga-CAR) versus untagged (CAR) T cells.

[0180] FIGs 19A-19F show functionality of T cells expressing a CAR that incorporates a depletion tag. FIGs 19A and 19B show surface expression of a DLL3 CAR as assessed by CAR staining (CAR Expression or CAR MFI, FIG. 19 A) and depletion tag staining (CCR4 Expression or CCR4 MFI, FIG. 19B) on T cells, measured by flow cytometry, and levels of fFNy (FIG. 19C) and IL-2 (FIG. 19D) in supernatants of T cells co-cultured with DLL3-low target tumor cells (DMS273), or DLL3-high target tumor cells (SHP-77). FIGs. 19E and 19F show tumor volumes in immunodeficient mice bearing DLL3-positive SHP-77 small cell lung cancer (SCLC) tumors following administration of 1 x 106(FIG. 19E) or 5 x 106(FIG. 19F) DLL3 CAR T cells (CAR) or DLL3 CAR T cells with the incorporated depletion tag (Moga- CAR), compared to untransduced T cells (UTD).

[0181] FIGs. 20A-20E show tumor volumes (FIGs. 20A-20D) and Kaplan-Meier curves (FIG. 20E) of syngeneic mice bearing B16-F10 cells engineered to express the human DLL3 antigen following administration of cyclophosphamide (Cy only; FIG. 20A), DLL3-CAR T cells (CAR T cells; FIG. 20B), cyclophosphamide and DLL3-CAR T cells (Cy+CAR T cells; FIG. 20C), or DLL3-CAR+CARD11-PIK3R3 fusion T cells (CAR.C11P3 T cells; FIG. 20D).

[0182] FIGs. 21A and 21B show the percentage of CAR positive T cells that are positive for the CARD11-PIK3R3 fusion as assessed by flow cytometry (FIG. 21 A) and the effective dose of CAR positive (CAR+) and CAR positive and CARD11-PIK3R3 positive (CAR+;C11P3+) for each treatment group (FIG. 2 IB).

[0183] FIGs. 22A-22H show the results comparing the transcriptomic profiles of T cells expressing the DLL3 CAR and the CARD11-PIK3R3 fusion (CAR-C11P3) to T cells expressing the DLL3 CAR alone (CAR) in different conditions. FIG. 22A shows a graphical depiction showing the different treatment conditions for the T cells included in the transcriptomic profiling analysis. FIG 22B shows two pricincipal compontent analysis (PCA) plots comparing the global transcriptomic profiles of CAR-C11P3 T cells and CAR only TCooley Ref. No.: MNBI-005 / 02WO 352505-2074 cells in different conditions. FIG. 22C shows a Manhattan plot detailing the number of differentially expressed genes for each of the conditions tested. FIGs 22D-22H show differentially expressed genes involved in cell metabolism (FIG. 22D), cell migration (FIG. 22E), cell cycle (FIG. 22F), differentiation (FIG. 22G), and activation / exhaustion (FIG. 22H) for CAR-CI 1P3 T cells and CAR only T cells in each of the different conditions tested.

[0184] FIGs. 23A and 23B show levels of IFNy (FIG. 23A) and IL-2 (FIG. 23B) in supernatants of T cells from three donors transduced with a lentiviral vector encoding a P53R175H / A2 TCR alone (TCR Benchmark, TCR#1, TCR#2, or TCR#3), co-transduced with a lentiviral vector encoding the CARD11-PIK3R3 fusion (TCR Benchmark+Cl 1P3, TCR#1+C11P3, TCR#2+C11P3, or TCR#3+C11P3), or untransduced T cells (Untransduced) co-cultured with p53R175H-positive target tumor cells (KLE).

[0185] FIGs. 24A and 24B show levels of IFNy and IL-2 in supernatants of T cells from a single donor transduced with a lentiviral vector encoding a P53R175H / A2 TCR alone (TCR #3) or co-transduced with a lentiviral vector encoding the CARD11-PIK3R3 fusion (TCR#3+C11P3), compared to a Benchmark p53R175H TCR (TCR Benchmark), co-cultured at T cell to target ratios (E:T ratios) of 1 : 1, 0.5: 1, or 0.25: 1 with p53R175H-positive KLE (FIG. 24A) or p53R175H-positive KMS-26 (FIG. 24B) target tumor cells.

[0186] FIGs. 25A-25C show cell purity of sorted CD4 (FIG. 25A) and CD8 (FIG. 25B) p53R175H TCR T cell populations (TCR Benchmark, TCR #1, TCR #2, TCR #3, or TCR #3+Cl 1P3), and the percentage of each that are positive for TCR expression (FIG. 25C).

[0187] FIGs. 26A-26D show levels of IFNy in supernatants of the sorted CD4 (FIGs. 26A and 26C) and CD8 (FIGs. 26B and 26D) p53R175H TCR T cell populations (TCR Benchmark, TCR #1, TCR #2, TCR #3, or TCR #3+Cl 1P3) of FIG. 25, with (FIGs. 26C and 26D) or without (FIGs. 26A and 26B) the CARD11-PIK3R3 fusion (Cl 1P3), co-cultured with T2 cells pulsed with the indicated concentrations of p53R175H peptides.

[0188] FIGs. 27A and 27B show tumor volume (FIG. 27A) and survival (FIG. 27B) of HLA-A2+ KMS-26 cell line xenograft model mice administered p53R175RH TCR T cells (TCR #3), p53R175RH TCR T cells with the CARD11-PIK3R3 fusion (TCR #3+Cl lP3), compared to mice administered a Benchmark p53R175H TCR (TCR Benchmark).

[0189] FIGs. 28A and 28B show knock-in efficiency (FIG. 28A) in T cells and tumor volume in KLE xenograft model mice (FIG. 28B) administered AAV6 knock-in p53R175H TCR #3 T cells (AAV.TCR #3), AAV knock-in p53R175H TCR #3 T cells with the CARD11- PIK3R3 fusion (AAV.TCR #3 +C11P3), or untransduced T cells (UTD).Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0190] FIGs. 29A-29C show CD4+ and CD8+ T cell expansion in KLE xenograft model mice administered untransduced T cells (UTD, FIG. 29A), AAV6 knock-in p53R175H TCR #3 T cells (AAV.TCR #3, FIG. 29B), or AAV6 knock-in p53R175H TCR #3 T cells with the CARD1 1-PIK3R3 fusion (AAV.TCR #3 + Cl 1P3, FIG. 29C) 20 days (D20) or 29 days (D29) after tumor inoculation.

[0191] In the following detailed description, reference is made to the Figures, which form a part hereof. In the Figures, similar symbols generally identify similar components, unless context dictates otherwise.

[0192] The illustrative alternatives described in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used and other changes may be made without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects and embodiments, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, and designed in a wide variety of different configurations (for example, combined with other aspects and / or embodiments described herein), all of which are explicitly contemplated and make part of this application.DETAILED DESCRIPTION OF THE DISCLOSURE

[0193] In general, the present disclosure relates, inter alia, to compositions and methods for improving adoptive immune cell therapy. The disclosers have discovered ways to improve the control and safety of engineered immune cells by introducing to the surface of the engineered immune cells at least one depletion tag (e.g., an epitope or a mimotope) that is capable of binding to another molecule (e.g., an antibody) to facilitate the depletion of the engineered immune cells when needed. The depletion tag may contain an epitope or mimotope derived from the same antigen that the engineered receptor binds to (e.g., a DLL3 derived depletion tag for engineered immune cells that bind to DLL3). This strategy allows the use of the corresponding antigen-binding therapeutic antibody to simultaneously deplete the engineered immune cell and at the same time exert its anti-cancer effect. The depletion tag may be incorporated to the extracellular region of an engineered receptor (e.g., a chimeric antigen receptor or a T cell receptor) or be presented separately on the cell surface. Upon the occurrence of an adverse event in the subject, the engineered cells can be depleted as needed by administering the corresponding tag-binding molecule (e.g., the corresponding antibody).Cooley Ref. No.: MNBI-005 / 02WO 352505-2074The presence of such tag can also facilitate the sorting and / or enrichment of the engineered cells (e.g., during cell manufacturing).

[0194] The disclosure provides engineered cells comprising an engineered receptor disclosed herein and a recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof. The engineered cells may further have reduced or eliminated expression of the endogenous T cell receptor (TCR) relative to control cells.

[0195] A person skilled in the art will readily recognize proper control cells to be used for comparison. In embodiments, a control cell is a wild-type cell. In embodiments, a control cell is an unmodified cell. In embodiments, the control cell contains the same genetical modifications, except the particular modification in question. In embodiments, a control cell is a cell that does not comprise a specific transgene. In embodiments, a control cell is a cell with unmodified expression of the endogenous TCR. In embodiments, a control cell is a cell that comprises an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

[0196] In embodiments, the engineered immune cells comprise, on their cell surface, a depletion tag (e.g., an epitope or a mimotope) that is capable of binding to another molecule (e.g., an antibody) to facilitate the depletion of the engineered immune cells when needed. The depletion tag may contain an epitope or mimotope that is derived from CCR4. This strategy allows the use of the corresponding antigen-binding therapeutic antibody to simultaneously deplete the engineered immune cell and at the same time exert its anti-cancer effect. The depletion tag may be incorporated to the extracellular region of an engineered receptor (e.g., a chimeric antigen receptor or a T cell receptor) or be presented separately on the cell surface. Upon the occurrence of an adverse event in the subject, the engineered cells can be depleted as needed by administering the corresponding tag-binding molecule (e.g., the corresponding antibody). The presence of such tag can also facilitate the sorting and / or enrichment of the engineered cells (e.g., during cell manufacturing). In embodiments, the present disclosure relates to exploiting such depletion tags to improve the effectiveness of immune cell therapeutics.

[0197] The engineered cells disclosed herein may offer improved potency, safety and / or enhanced in vivo persistence compared to cells not expressing such engineered receptors and recombinant polypeptides.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074I. Definitions

[0198] Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. In embodiments, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art. All publications, patent applications, patents, GenBank or other accession numbers and other references mentioned herein are incorporated by reference in their entirety for all purposes.

[0199] The singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B.”

[0200] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0201] Certain ranges are presented herein with numerical values being preceded by the term “approximately” or “about.” The terms “approximately” and “about” are used interchangeably and mean a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1%, of a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length, inclusive of the endpoints. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth, unless otherwise apparent from context that it is impossible to extend the boundary beyond certain points (e.g., below 0% or above 100% in some cases).Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0202] As used herein, the term “comparable level” refers to a level that is in between 50% and 200%, inclusive of end points, of the reference level in the control set of conditions or circumstances, unless otherwise apparent from context that it is impossible to extend the boundary beyond certain points. In embodiments, a comparable level may be preferably between 60% and 170%, more preferably between 70% and 140%, even more preferably between 80% and 125%, or more preferably still between 90% and 110%, of the reference level. Those of ordinary skill in the art will appreciate the appropriate control set in obtaining the reference level. In general, the appropriate control set shares identifical features with the test set except the feature(s) of interest, so that the observed results warrant a reasonable conclusion that any changes in the level observed are caused by or indicative of the variation in the feature(s) that are varied.

[0203] As will be understood by one having ordinary skill in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0204] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments. As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of’ excludes any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, “consisting essentially of’ does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term “comprising”, particularly in a description of components of a composition or in a description of steps of a method, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or step.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0205] The terms “sequence identity”, “percent identity,” or “identity” as used herein in the context of two or more nucleic acids or proteins, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST 2.0 sequence comparison algorithm with default parameters, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. . See e.g., the NCBI web site at ncbi.nlm.nih.gov / BLAST. Such sequences are said to be “substantially identical.” This definition also refers to, or may be applied to, the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. Generally, sequence identity can exist over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence

[0206] As used herein, the term “mutation” refers to a point mutation, a gene fusion, a substitution, a gain-of-function mutation, a stop-gain mutation, an insertion mutation, a deletion mutation, a duplication mutation and / or a translocation. The mutation may be in one or more genes. The mutation may be naturally occurring. Alternatively, the mutation may be induced or engineered. As used herein, the term “vector” refers to a recombinant nucleic acid designed for transfer between host cells, and that may be used for the purpose of transformation, e.g., the introduction of heterologous DNA into a host cell. As such, in embodiments, the vector can be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. In embodiments, the expression vector can be an integrating vector.

[0207] As used herein, the term “viral vector” refers either to a nucleic acid molecule (e.g., a transfer plasmid) that includes virus-derived nucleic acid elements that generally facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer. Viral particles will generally include various viral components and sometimes also host cell components in addition to nucleic acid(s). The term viral vector may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. ViralCooley Ref. No.: MNBI-005 / 02WO 352505-2074 vectors that can be used in the disclosure include, for example, retrovirus vectors, adenovirus vectors, and adeno-associated virus vectors, lentivirus vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, N. Y.). For example, a recombinant polypeptide as disclosed herein can be produced in a eukaryotic host, such as a mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, VA). In selecting an expression system, care should be taken to ensure that the components are compatible with one another. Artisans or ordinary skill are able to make such a determination. Furthermore, if guidance is required in selecting an expression system, skilled artisans may consult P. Jones, “Vectors: Cloning Applications”, John Wiley and Sons, New York, N.Y., 2009).

[0208] As used herein, the term “retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The retroviral vector can be a lentiviral vector.

[0209] As used herein, the term “lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, including LTRs that are primarily derived from a lentivirus, which is a genus of retrovirus. Lentiviral vectors offer several attractive properties as gene-delivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) the capability of infecting both dividing and non-dividing cells; (iii) broad tissue tropisms, including important gene- and celltherapy -target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (vi) a potentially safer integration site profile; and (vii) a relatively easy system for vector manipulation and production.

[0210] As used herein, the term “pharmaceutically acceptable carrier” as used herein means any suitable carriers, diluents or excipients. These include all aqueous and non-aqueous isotonic sterile injection solutions, which may contain anti-oxidants, buffers and solutes, which render the composition isotonic with the blood of the intended recipient; aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents, dispersion media, antifungal and antibacterial agents, isotonic and absorption agents and the like. It will be understood that compositions of the present disclosure may also include other supplementary physiologically active agents. The carrier must be pharmaceutically “acceptable” in the sense of being compatible with the other ingredients of the composition and not injurious to the subject.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0211] As used herein, the term “PEGylation” refers to modifying a protein by covalently attaching polyethylene glycol (PEG) to the protein, with “PEGylated” referring to a protein having a PEG attached. A range of PEG, or PEG derivative sizes with optional ranges of from about 10,000 Daltons to about 40,000 Daltons may be attached to the recombinant polypeptides of the disclosure using a variety of chemistries. In embodiments, the average molecular weight of the PEG, or PEG derivative, is about 1 kD to about 200 kD such as, e.g., about 10 kD to about 150 kD, about 50 kD to about 100 kD, about 5 kD to about 100 kD, about 20 kD to about 80 kD, about 30 kD to about 70 kD, about 40 kD to about 60 kD, about 50 kD to about 100 kD, about 100 kD to about 200 kD, or about 150 kD to about 200 kD. In embodiments, the average molecular weight of the PEG, or PEG derivative, is about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, or about 80 kD. In embodiments, the average molecular weight of the PEG, or PEG derivative, is about 40 kD.

[0212] As used herein, the terms “administration” and “administering” refer to the delivery of a bioactive composition or formulation by an administration route including, but not limited to, oral, intravenous, intra-arterial, intramuscular, intraperitoneal, subcutaneous, intramuscular, and topical administration, or combinations thereof. The term includes, but is not limited to, administering by a medical professional and self-administering.

[0213] As used herein, the term “injection” includes intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrastemal injection and infusion.

[0214] The term “cancer” generally refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Cancer cells can be in the form of a tumor, but such cells can exist alone within an animal subject, or can be a non-tumorigenic cancer cell, such as a leukemia cell. These terms include a solid tumor, a soft tissue tumor, or a metastatic lesion. As used herein, the term “cancer” includes premalignant, as well as malignant cancers. In embodiments, the cancer is a solid tumor, a soft tissue tumor, or a metastatic lesion.

[0215] As used herein, and unless otherwise specified, a “therapeutically effective” or “pharmaceutically effective” amount or number of a subject construct, nucleic acid, cell, or composition of the disclosure generally refer to an amount or number sufficient for a construct, nucleic acid, cell, or composition to accomplish a stated purpose relative to the absence of theCooley Ref. No.: MNBI-005 / 02WO 352505-2074 composition, e.g., to provide a therapeutic benefit in the treatment or management of the cancer, or to delay or minimize one or more symptoms associated with the cancer. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapeutic agents, which provides a therapeutic benefit in the treatment or management of the cancer. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the cancer, or enhances the therapeutic efficacy of another therapeutic agent. An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). The exact amount of a composition including a “therapeutically effective amount” will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins)

[0216] As used herein, a “subject” or an “individual” includes animals, such as human (e.g., human subjects) and non-human animals. In embodiments, a “subject” or “individual” is a patient under the care of a physician. Thus, the subject can be a human patient or an individual who has, is at risk of having, or is suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease. The subject can also be an individual who is diagnosed with a risk of the condition of interest at the time of diagnosis or later. The term “non-human animals” includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, e.g. non-human primates, and non- mammals, e.g., sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0217] The term “antibody” herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab’)2 fragments, Fab’ fragments, Fv fragments, recombinant IgG (rlgG) fragments, heavy chain variable (VH) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies ( e.g ., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 e.g., bispecific or trispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di- scFv, tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof also referred to herein as “antigen-binding fragments.” The term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.

[0218] The terms “complementarity determining region,” and “CDR,” synonymous with “hypervariable region” or “HVR,” are known in the art to refer to non-contiguous sequences of amino acids within antibody variable regions, which confer antigen specificity and / or binding affinity. In general, there are three CDRs in each heavy chain variable region (CDR- Hl, CDR- H2, CDR-H3) and three CDRs in each light chain variable region (CDR-L1, CDR- L2, CDR- L3). “Framework regions” and “FR” are known in the art to refer to the non-CDR portions of the variable regions of the heavy and light chains. In general, there are four FRs in each full- length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4), and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).

[0219] The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al- Lazikani et al, (1997) JMB 273,927-948 (“Chothia” numbering scheme); MacCallum et al, J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732-745.” (“Contact” numbering scheme); Lefranc MP el ah, “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003 Jan;27(l):55-77 (“IMGT” numbering scheme); Honegger A and Pliickthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657- 70, (“Aho” numbering scheme); Martin et al, “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272, (“AbM” numbering scheme); Abhinandan and Martin, “Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains,” Mol Immunol, 2008 Aug 45(14): 3832-9 (“enhanced Chothia” numbering scheme); and identification of the minimal set of amino acids comprising of the putative antigen binding interface using structural modeling applications, for example AlphaFold (“structural modeling” approach).

[0220] The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignments, while theCooley Ref. No.: MNBI-005 / 02WO 352505-2074Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels”) at different positions, resulting in differential numbering. The Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme.

[0221] The AbM scheme is a compromise between Kabat and Chothia definitions based on that used by Oxford Molecular’s AbM antibody modeling software.

[0222] Table 1, below, lists exemplary position boundaries of CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as identified by Kabat, Chothia, AbM, and Contact schemes, respectively. For CDR-H1, residue numbering is listed using both the Kabat and Chothia numbering schemes. FRs are located between CDRs, for example, with FR-L1 located before CDR-L1, FR-L2 located between CDR-L1 and CDR-L2, FR-L3 located between CDR-L2 and CDR-L3 and so forth. It is noted that because the shown Kabat numbering scheme places insertions at H35A and H35B, the end of the Chothia CDR-H1 loop when numbered using the shown Kabat numbering convention varies between H32 and H34, depending on the length of the loop.Table 1. Boundaries of CDRs according to various numbering schemes1 - Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD 2 - Al-Lazikani et al, (1997) JMB 273,927-948

[0223] Thus, unless otherwise specified, a “CDR” or “complementary determining region,” or individual specified CDRs ( e.g ., CDR-H1, CDR-H2, CDR-H3), of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) complementary determining region as defined by any of the aforementioned schemes, or other known schemes. For example, where it is stated that a particular CDR (e.g.,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 a CDR-H3) contains the amino acid sequence of a corresponding CDR in a given VH or VL region amino acid sequence, it is understood that such a CDR has a sequence of the corresponding CDR (e.g., CDR-H3) within the variable region, as defined by any of the aforementioned schemes, or other known schemes. In embodiments, specific CDR sequences are specified. Exemplary CDR sequences of provided antibodies are described using various numbering schemes, although it is understood that a provided antibody can include CDRs as described according to any of the other aforementioned numbering schemes or other numbering schemes known to a skilled artisan.

[0224] Likewise, unless otherwise specified, a FR or individual specified FR(s) (e.g., FR- Hl, FR-H2, FR-H3, FR-H4), of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) framework region as defined by any of the known schemes. In some instances, the scheme for identification of a particular CDR, FR, or FRs or CDRs is specified, such as the CDR as defined by the Kabat, Chothia, AbM, IMGT, Contact method, enhanced Chothia, or structural modeling approach, or other known schemes. In other cases, the particular amino acid sequence of a CDR or FR is given.

[0225] The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable regions of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et ah, J. Immunol. 150:880-887 (1993); Clarkson et al, Nature 352:624-628 (1991).

[0226] An “antibody fragment” or “antigen-binding fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab’, Fab’-SH, F(ab’)2; diabodies; linear antibodies; heavy chain variable (VH) regions, single-chain antibody molecules such as scFvs and single-domain antibodies comprising only the VH region; and multispecific antibodies formed from antibody fragments. In particular embodiments, the antibodies from which the CARs are derived are single-chain antibody fragments comprising a heavy chain variable (VH) region and / or a light chain variable (VL) region, such as scFvs.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0227] Single-domain antibodies (sdAbs) are antibody fragments comprising all or a portion of the heavy chain variable region or all or a portion of the light chain variable region of an antibody. In certain embodiments, a single-domain antibody is a human single-domain antibody.

[0228] A “humanized” antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs. A humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody. A “humanized form” of a non-human antibody, refers to a variant of the non-human antibody that has undergone humanization, typically to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. In embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g ., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.

[0229] A “human antibody” is an antibody with an amino acid sequence corresponding to that of an antibody produced by a human or a human cell, or non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences, including human antibody libraries. The term excludes humanized forms of non-human antibodies comprising non-human antigen-binding regions, such as those in which all or substantially all CDRs are non-human. The term includes antigen-binding fragments of human antibodies. Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal’s chromosomes. In such transgenic animals, the endogenous immunoglobulin loci have generally been inactivated. Human antibodies also may be derived from human antibody libraries, including phage display and cell-free libraries, containing antibody-encoding sequences derived from a human repertoire.

[0230] The term “monoclonal antibody” as used herein refers to an antibody obtained from or within a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical, except for possible variants containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibodyCooley Ref. No.: MNBI-005 / 02WO 352505-2074 preparations, which typically include different antibodies directed against different epitopes, each monoclonal antibody of a monoclonal antibody preparation is directed against a single epitope on an antigen. The term is not to be construed as requiring production of the antibody by any particular method. A monoclonal antibody may be made by a variety of techniques, including but not limited to generation from a hybridoma, recombinant DNA methods, phagedisplay and other antibody display methods.

[0231] The term “engineered cell” as used herein refers to a cell that has been altered in at least some way by human intervention, including, for example, by genetic alterations or modifications such that the engineered cell differs from a wild-type cell.

[0232] The terms “decrease,” “reduced,” “reduction,” and “decreased” are all used herein generally to mean a lowering by a statistically significant amount. However, for avoidance of doubt, “decrease,” “reduced,” “reduction,” “decreased” means a lowering by at least 10% as compared to a reference level, for example a lowering by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% lowering (i.e. absent level as compared to a reference sample), or any lowering between 10-100% as compared to a reference level. In embodiments, the cells are engineered to have reduced expression of one or more targets relative to an unaltered or unmodified wild-type cell.

[0233] The terms “increase” and “increased” are all used herein generally to mean an increase by a statistically significant amount. However, for avoidance of doubt, “increase” and “increased” mean an increase by at least 10% as compared to a reference level, for example an increase by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least 1-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 50-fold, at least 100-fold, at least 200-fold, at least 500-fold, or at least 1000-fold, or any increase between 10% and 1000-fold as compared to a reference level. In embodiments, the cells are engineered to have increased expression of one or more targets relative to an unaltered or unmodified wild-type cell.

[0234] As used herein, the term “mimotope” refers to a molecule, or a part of a biomolecule, that mimics the structure of an epitope and is capable of binding to the same antigen-binding region of an antibody that recognize the epitope. The mimotope may act as a competitor for the corresponding epitope in in vitro assays (e.g., ELISA) and / or elicit an immunological response in a host that is reactive to the epitope of which it is a mimic. In embodiments, the mimotope of the disclosure is a peptide.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0235] As used herein, the terms “conservative amino acid substitution” and “conservative substitution” refer to amino acid substitutions in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0236] Headings, e.g., (a), (b), (i) etc., are presented merely for ease of reading the specification and claims. The use of headings in the specification or claims does not require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented. It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub- combination was individually and explicitly disclosed herein.IL Epitope or Mimitope Tag

[0237] In one aspect, the disclosure provides a recombinant polypeptide further comprising a tag. In embodiments, the tag comprises or consists of a peptide epitope. In embodiments, the tag comprises or consists of a mimotope that mimics an epitope.

[0238] In embodiments, the peptide epitope is derived from an autoimmune-associated antigen. In embodiments, the peptide epitope is derived from a cancer-associated antigen.

[0239] In embodiments, the peptide epitope or mimotope is capable of binding to a monoclonal antibody. In embodiments, the mimotope mimics an epitope of an autoimmune-Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 associated antigen that binds to a monoclonal antibody. In embodiments, the mimotope mimics an epitope of a cancer-associated antigen that binds to a monoclonal antibody.

[0240] In embodiments, the peptide epitope or mimotope is capable of binding to an anti- CCR4 antibody. In embodiments, the anti-CCR4 antibody is mogamulizumab.

[0241] In embodiments, the autoimmune-associated antigen or cancer-associated antigen is selected from the group consisting of CD1, CDla, CDlb, CDlc, CDld, CDle, CD2, CD3d, CD3e, CD3g, CD3s, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD 154, CD 158, CD171, CD 178, CD 179, CD 179a, CD181 (CXCR1), CD 182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, p53R175H, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein a (SIRPa), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-l lRa, PSCA, PRSS21, VEGFR2, LewisY, PDGFRp, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF -I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE- Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-l / Galectin 8, MelanA / MARTl, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP- 4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIRl, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0242] In embodiments, the cancer-associated antigen is a cancer-ssociated antigen for a hematologic cancer. In embodiments, the cancer is selected from B cell lymphoma, T cell lymphoma, chronic lymphocytic leukemia, and acute myeloid leukemia.

[0243] In embodiments, the cancer-associated antigen is a cancer-associated antigen for a solid tumor. In embodiments, the cancer is a solid tumor selected from the group consisting of small cell lung cancer, prostate cancer, colorectal cancer, head and neck squamous cell carcinoma, breast cancer, melanoma, ovarian cancer, lung cancer, pancreatic cancer, stomach cancer, cervical cancer, hepatocellular carcinoma, glioma cancer, neuroblastoma cancer, and renal cell carcinoma. In embodiments, the cancer is is small cell lung cancer (SCLC), neuroendocrine prostate cancer, large cell neuroendocrine carcinoma, high grade neuroendocrine tumors, Glioma, Glioblastoma, or Melanoma. In embodiments, the cancer is cervical squamous cell and endocervical adenocarcinoma, LUSC (lung squamous cell carcinoma), LU AD (lung adenocarcinoma), HNSC (head and neck squamous cell carcinoma), BLCA (bladder carcinoma), PRAD (prostate adenocarcinoma), UCEC (uterine corpus endometrial carcinoma), KIRP (kidney renal papillary cell carcinoma), THCA (thyroid carcinoma), COAD (colon adenocarcinoma), READ (rectum adenocarcinoma), or BRCA (breast carcinoma). In embodiments, the cancer is colorectal cancer, breast cancer, ovarian cancer, brain cancer, esophageal cancer, stomach adenocarcinoma, acute myeloid leukemia, multiple myeloma, bladder cancer, NSCLC, pancreatic cancer, head and neck squamous cell carcinoma, liver cancer, sarcomas, prostate cancer, biliary tract cancer, melanoma, uterine cancer, cervical cancer, or renal cell carcinoma.

[0244] In embodiments, the cancer-associated antigen for the solid tumor comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5 1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin al 1 1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-la, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Ra, EGFRv3, EGFR806, GD2, or CA9. In embodiments, the cancer-associated antigen for the solid tumor comprises or consists of KIR2D, NRP1, CD221,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074VEGFR, HGF, integrin a5bl, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin al ipi.

[0245] In embodiments, the cancer-associated antigen is DLL3 and the cancer is small cell lung cancer (SCLC), neuroendocrine prostate cancer, large cell neuroendocrine carcinoma, high grade neuroendocrine tumors, Glioma, Glioblastoma, or Melanoma. In embodiments, the cancer-associated antigen is DLL3 and the cancer is cervical squamous cell and endocervical adenocarcinoma, LUSC (lung squamous cell carcinoma), LU AD (lung adenocarcinoma), HNSC (head and neck squamous cell carcinoma), BLCA (bladder carcinoma), PRAD (prostate adenocarcinoma), UCEC (uterine corpus endometrial carcinoma), KIRP (kidney renal papillary cell carcinoma), THCA (thyroid carcinoma), COAD (colon adenocarcinoma), READ (rectum adenocarcinoma), or BRCA (breast carcinoma). In embodiments, the cancer- associated antigen is p53R175H and the cancer is colorectal cancer, breast cancer, ovarian cancer, brain cancer, esophageal cancer, stomach adenocarcinoma, acute myeloid leukemia, multiple myeloma, bladder cancer, NSCLC, pancreatic cancer, head and neck squamous cell carcinoma, liver cancer, sarcomas, prostate cancer, biliary tract cancer, melanoma, uterine cancer, cervical cancer, or renal cell carcinoma.

[0246] In embodiments, the cancer-associated antigen is selected from one listed in Table 2 below.Table 2. Cancers and Associated AntigensCooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0247] In embodiments, the antigen is not CD19. In embodiments, the antigen is not CCR4.

[0248] In embodiments, the antigen is Delta-like protein 3 (DLL3). Human DLL3 (Uniprot Accession No. Q9NYJ7) is a biomarker for small cell lung cancer. In embodiments, the DLL3 protein comprises an amino acid sequence at least at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 486. In embodiments, the epitope comprises at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50, consecutive amino acids in SEQ ID NO: 486, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the epitope comprises about 10Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, or about 45 to about 50, consecutive amino acids in SEQ ID NO: 486, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the peptide epitope comprises or consists of any one of SEQ ID NO: 439-468, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto.

[0249] In embodiments, the peptide epitope comprises or consists of SEQ ID NO: 439, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the peptide epitope comprises or consists of SEQ ID NO: 439.

[0250] In embodiments, the epitope is derived from a cancer-associated antigen of adult T- cell lymphoma (ATL) and / or cutaneous T-cell lymphoma (CTCL). In embodiments, the epitope is derived from a cancer-associated antigen of a Th2 cell, a cutaneous lymphocyte antigen-positive skin-homing T cell, and / or a Treg cell.

[0251] In embodiments, the epitope is derived from C-C chemokine receptor type 4 (CCR4) (i.e., the cancer associated antigen is CCR4). C-C chemokine receptor type 4 (CCR4), also known as CD194, is a biomarker for T cell lymphoma. Further information of human CCR4 protein is described in Uniprot Accession No. P51679. In embodiments, the CCR4 protein comprises an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 485. In embodiments, the epitope comprises at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50, consecutive amino acids in SEQ ID NO: 485, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the epitope comprises about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, or about 45 to about 50, consecutive amino acids in SEQ ID NO: 485, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the peptide epitope comprises or consists of an amino acid sequence of any one of SEQ ID NO: 430-438, or an amino acid sequence having at most 1, at most 2, at most 3, at most 4, or at most 5 amino acid mutations thereto. In embodiments, the peptide epitope comprises or consists of an amino acid sequence of SEQ ID NO: 431.

[0252] In embodiments, the peptide epitope comprises or consists of SEQ ID NO: 430. In embodiments, the peptide epitope or mimotope is a modified peptide epitope or mimotopeCooley Ref. No.: MNBI-005 / 02WO 352505-2074 comprising or consisting of an amino acid sequence having 1, 2, 3, 4, or 5 mutations compared to the unmodified peptide epitope or mimotope.

[0253] In embodiments, the the unmodified peptide epitope or mimotope comprises or consists of no more than 10, no more than 15, no more than 20, no more than 25, no more than 30, no more than 35, no more than 40, no more than 45, or no more than 50 consecutive amino acids in an autoimmune-associated antigen or a cancer-associated antigen. In embodiments, the unmodified peptide epitope or mimotope is SEQ ID NO: 430.

[0254] In embodiments, the peptide epitope or the mimotope is about 5 to about 10, about 10 to about 20, about 15 to about 25, about 20 to about 30, about 25 to about 35, about 30 to about 40, about 35 to about 45, or about 40 to about 50 amino acids in length. In embodiments, the peptide epitope or the mimotope is no more than 10, no more than 15, no more than 20, no more than 25, no more than 30, no more than 35, no more than 40, no more than 45, or no more than 50 amino acids in length. In embodiments, the peptide epitope does not comprise any mutation compared to the native epitope derived from the antigen. In embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the peptide epitope or the mimotope is capable of forming an alpha-helical conformation.

[0255] In embodiments, the epitope or mimotope is capable of binding to the antigenbinding molecule (e.g., antibody) with a dissociation constant (Kd) of less than 100 pM, less than 10 pM, less than 1 pM, less than 100 nM, less than 10 nM, less than 1 nM, less than 100 pM, less than 10 pM, or less than 1 pM, as measured by surface plasmon resonance (SPR) method using a sensor chip that contains the immobilized the antigen-binding molecule (e.g., antibody). In embodiments, the modified peptide epitope or mimotope is capable of binding to the antigen-binding molecule (e.g., antibody) with a dissociation constant (Kd) of about 100 pM to about 10 pM, about 10 pM to about 1 pM, about 1 pM to about 100 nM, about 100 nM to about 10 nM, about 10 nM to about 1 nM, about 1 nM to about 100 pM, about 100 pM to about 10 pM, or about 10 pM to about 1 pM, as measured by surface plasmon resonance (SPR) method using a sensor chip that contains the immobilized antigen-binding molecule (e.g., antibody).

[0256] In embodiments, the epitope or mimotope is that of an antibody. In embodiments, the antibody is [fam-]trastuzumab deruxtecan, (fam-trastuzumab deruxtecan-nxki), Adebrelimab, Ado-trastuzumab emtansine, Alemtuzumab, Amivantamab, Atezolizumab, Avelumab, Belantamab mafodotin (belantamab mafodotin-blmf), Bevacizumab, Blinatumomab, Brentuximab vedotin, Cadonilimab, Camrelizumab, Catumaxomab,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cemiplimab (cemiplimab-rwlc), Cetuximab, Cetuximab saratolacan, Cosibelimab, Daratumumab, Dinutuximab, Disitamab vedotin, Dostarlimab, Durvalumab, Edrecolomab, Elotuzumab, Elranatamab, Emapalumab (emapalumab-lzsg), Enfortumab vedotin (enfortumab vedotin-ejfv), Enlonstobart, Envafolimab, Epcoritamab, Gemtuzumab ozogamicin, Glofitamab, Ibritumomab tiuxetan, Inotuzumab ozogamicin, Ipilimumab, Isatuximab (isatuximab-irfc), Loncastuximab tesirine, Margetuximab-cmkb, Mirvetuximab soravtansine, Mogamulizumab (mogamulizumab-kpkc), Mosunetuzumab, Moxetumomab pasudotox (moxetumomab pasudotox-tdfk), Naxitamab-gqgk, Necitumumab, Nimotuzumab, Nivolumab, Cipterbin, Obinutuzumab, Ofatumumab, Olaratumab, Panitumumab, Pembrolizumab, Penpulimab, Pertuzumab, Polatuzumab vedotin (polatuzumab vedotin-piiq), Prolgolimab, Pucotenlimab, Racotumomab, Ramucirumab, Relatlimab, Retifanlimab, Ripertamab, Rituximab, Sacituzumab govitecan (sacituzumab govitecan-hziy), Serplulimab, Sintilimab, Socazolimab, Sugemalimab, Tafasitamab (tafasitamab-cxix), Tagitanlimab, Talquetamab (talquetamab-tgvs), Tebentafusp, Teclistamab, Tislelizumab, Tisotumab vedotin, tisotumab vedotin-tftv, Toripalimab, Tositumomab-1131, Trastuzumab, Trastuzumab duocarmazine, Tremelimumab, Zimberelimab, Zolbetuximab, Zuberitamab, Odronextamab, Ivonescimab, Benmelstobart, Trastuzumab botidotin, Iparomlimab, tuvonralimab, Tarlatamab, Patritumab deruxtecan, Sacituzumab tirumotecan, Zanidatamab, Linvoseltamab, Datopotamab deruxtecan, Anbenitamab, Anvatabart opadotin, Apamistamab-Iodine (1311), Bemarituzumab, Cetrelimab, Cobolimab, Domvanalimab, Emactuzumab, Erfonrilimab, Favezelimab, Felzartamab, Fianlimab, Finotonlimab, ABBV-383, Geptanolimab, Gotistobart, Ivuxolimab, Izalontamab, Lemzoparlimab, Luveltamab tazevibulin, Magrolimab, Mecbotamab vedotin, Monalizumab, Nofazinlimab, Nurulimab, Ociperlimab, Oleclumab, Onfekafusp alfa, Oregovomab, Ozekibart, Pivekimab sunirine, Quavonlimab, Retlirafusp alfa, Rosopatamab (177Lu-DOTA), Rulonilimab, Sasanlimab, Telisotuzumab vedotin, Tiragolumab, IKS014, LCB14-0110, FS-1502, Trastuzumab mafodotin, Trastuzumab rezetecan, Vibostolimab, Vobramitamab duocarmazine, Zilovertamab vedotin, Suvemcitug, APX003, BD0801, TK001, sevacizumab, CTX-009, ES104, TR009, NOV1501, ABL001, DP303c, IAH0968, Kintuximab, gentuximab, cintuximab, MIL62, MRG002, MRG003, PM8002, MEDI5752, MCLA-128, AGEN1181, L19-IL2, L19-TNF, IMC-F106C, JMT101, BL-B01D1, BAT1308, AZD2936, JS004, TAB004, FG-M108, M108, 9MW2821, BMS- 986349, CC-93269, EM801, ABBV-181, ABBV-151, ARGX-115, DS-7300a, IBI343, SHR- A1921, or ASKB589. In embodiments, the antibody is tarlatamab. In embodiments, the antibody is mogamulizumab.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Modified Epitope or Mimotope

[0257] In embodiments, the peptide epitope or mimotope of the disclosure comprises or consists of an amino acid sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations compared to an unmodified peptide epitope or mimotope and is capable of binding to the corresponding monoclonal antibody that the unmodified epitope or mimotope binds to. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 1, 2, 3, 4, or 5 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 5 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 4 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 3 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 2 mutations compared to the unmodified peptide epitope or mimotope. In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence having 1 mutation compared to the unmodified peptide epitope or mimotope.

[0258] In embodiments, the antibody binding affinity of the modified epitope or mimotope is at a comparable level as the antibody binding affinity of the unmodified epitope or mimotope. In embodiments, the modified peptide epitope or mimotope is capable of binding to the corresponding antibody with a dissociation constant (Kd) of less than 100 pM, less than 10 pM, less than 1 pM, less than 100 nM, less than 10 nM, less than 1 nM, less than 100 pM, less than 10 pM, or less than 1 pM, as measured by surface plasmon resonance (SPR) method using a sensor chip that contains the immobilized antibody. In embodiments, the modified peptide epitope or mimotope is capable of binding to the corresponding antibody with a dissociation constant (Kd) of about 100 pM to about 10 pM, about 10 pM to about 1 pM, about 1 pM to about 100 nM, about 100 nM to about 10 nM, about 10 nM to about 1 nM, about 1 nM to about 100 pM, about 100 pM to about 10 pM, or about 10 pM to about 1 pM, as measured by surface plasmon resonance (SPR) method using a sensor chip that contains the immobilized antibody.

[0259] In embodiments, the peptide epitope or mimotope of the disclosure comprises or consists of an amino acid sequence having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutationsCooley Ref. No.: MNBI-005 / 02WO 352505-2074 compared to an unmodified peptide epitope or mimotope and is capable of binding to the corresponding monoclonal antibody that the unmodified epitope or mimotope binds to.

[0260] In embodiments, the peptide epitope or mimotope of the disclosure comprises or consists of an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations compared to an unmodified peptide epitope or mimotope and is capable of binding to the corresponding monoclonal antibody that the unmodified epitope or mimotope binds to. In embodiments, the peptide epitope or mimotope of the disclosure comprises or consists of an amino acid sequence having 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, or 9-10 mutations compared to an unmodified peptide epitope or mimotope and is capable of binding to the corresponding monoclonal antibody that the unmodified epitope or mimotope binds to.

[0261] In embodiments, the one or more mutations in the modified epitope or mimotope comprise or consist of substitutions, insertions, deletions, or any combination thereof. In embodiments, the one or more mutations in the modified epitope or mimotope comprise or consist of substitutions and / or deletions.

[0262] In embodiments, the one or more mutations in the modified epitope or mimotope comprise or consist of substitutions. In embodiments, the substitution(s) are conservative amino acid substitutions.

[0263] In embodiments, the mutation comprises addition and / or deletion of one or more amino acids at the N-term or C-term of the unmodified epitope or mimotope. In embodiments, the mutation comprises deleting 1, 2, 3, 4, or 5, amino acids at the N-terminus of the unmodified epitope or mimotope. In embodiments, the mutation comprises deleting 1, 2, 3, 4, or 5, amino acids at the C-terminus of the unmodified epitope or mimotope. In embodiments, the mutation comprises inserting 1, 2, 3, 4, or 5, amino acids at the N-terminus of the unmodified epitope or mimotope. In embodiments, the mutation comprises inserting 1, 2, 3, 4, or 5, amino acids at the C-terminus of the unmodified epitope or mimotope. In embodiments, the mutation comprises deleting 1, 2, 3, 4, or 5, amino acids at the N-terminus of the unmodified epitope or mimotope and inserting 1, 2, 3, 4, or 5, amino acids at the C- terminus of the unmodified epitope or mimotope. In embodiments, the mutation comprises inserting 1, 2, 3, 4, or 5, amino acids at the N-terminus of the unmodified epitope or mimotope and deleting 1, 2, 3, 4, or 5, amino acids at the C-terminus of the unmodified epitope or mimotope.

[0264] In embodiments, the cysteine(s) in the unmodified peptide epitope or mimotope are substituted. In embodiments, the cysteine(s) in the unmodified peptide epitope or mimotope are deleted. In embodiments, the N-terminus of the unmodified peptide epitope or mimotopeCooley Ref. No.: MNBI-005 / 02WO 352505-2074 contains cysteine. In embodiments, the C-terminus of the unmodified peptide epitope or mimotope contains cysteine. In embodiments, the unmodified peptide epitope or mimotope comprises at least one cysteine between the N-terminus and the C-terminus. In embodiments, the cysteine(s) are substituted with serine, glycine, threonine, alanine, valine, or any combination thereof. In embodiments, the cysteine(s) are substituted with serine and / or valine. In embodiments, the cysteine(s) are substituted with serine(s). In embodiments, the cysteine(s) are substituted with valine(s). In embodiments, the modified epitope or mimotope does not comprise any cysteines.

[0265] In embodiments, the mutation(s) comprise deleting or substituting one or more amino acids that facilitate polypeptide crosslinking in the unmodified peptide epitope. In embodiments, the mutation(s) comprise deleting and / or substituting one or more cysteine(s), lysine(s), aspartic acid(s), glutamic acid(s), or any combination thereof, in the unmodified peptide epitope or mimotope.

[0266] In embodiments, the unmodified peptide epitope or mimotope comprises or consists of no more than 10, no more than 15, no more than 20, no more than 25, no more than 30, no more than 35, no more than 40, no more than 45, or no more than 50, consecutive amino acids in an autoimmune-associated antigen or a cancer-associated antigen. In embodiments, the unmodified peptide epitope or mimotope comprises or consists of about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, or about 45 to about 50, consecutive amino acids in an autoimmune-associated antigen or a cancer-associated antigen.

[0267] In embodiments, the epitope or mimotope is capable of binding to a monoclonal antibody that targets a biomarker for a hematologic cancer. In embodiments, the epitope or mimotope is capable of binding to an anti-CCR4 monoclonal antibody. In embodiments, the CCR4 protein comprises an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 485. In embodiments, the unmodified epitope or mimotope comprises at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50, consecutive amino acids in SEQ ID NO: 485. In embodiments, the unmodified epitope or mimotope comprises about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, or about 45 to about 50, consecutive amino acids in SEQ ID NO: 485.

[0268] In embodiments, the epitope or mimotope is capable of binding to mogamulizumab, a humanized, afucosylated monoclonal antibody targeting CCR4. The unmodified epitope ofCooley Ref. No.: MNBI-005 / 02WO 352505-2074 mogamulizumab has the amino acid sequence of DESIYSNYYLYESIPKPC (SEQ ID NO: 430). In embodiments, the modified epitope does not comprise the cysteine that is present at the C-terminus of SEQ ID NO: 430. In embodiments, the modified epitope comprises a serine, glycine, threonine, alanine, or valine substitution of the cysteine at the C-term of SEQ ID NO: 430.

[0269] In embodiments, the modified epitope comprises or consists of any one of SEQ ID NO: 432-436. In embodiments, the modified epitope comprises the deletion of 1, 2, 3, 4, or 5 amino acids at the C-term of SEQ ID NO: 430. In embodiments, the modified epitope comprises or consists of SEQ ID NO: 431. In embodiments, the modified epitope comprises or consists of SEQ ID NO: 438. In embodiments, the modified epitope comprises the insertion of 1, 2, 3, 4, or 5, amino acid from the corresponding position of CCR4 (SEQ ID NO: 485) before the N-term of SEQ ID NO: 430. In embodiments, the modified epitope comprises or consists of SEQ ID NO: 437.

[0270] In embodiments, the modified peptide epitope or mimotope comprises or consists of an amino acid sequence having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to any one of the unmodified epitopes and mimotopes listed in Table 3 below and is capable of binding to the corresponding monoclonal antibody that binds to that unmodified epitope or mimotope.

[0271] In embodiments, the peptide epitope or mimotope comprises or consists of an amino acid sequence:(a) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 475, and wherein the peptide epitope or mimotope is capable of binding to rituximab;(b) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 476, and wherein the peptide epitope or mimotope is capable of binding to Palivizumab;(c) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 477, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab;(d) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 478, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab;Cooley Ref. No.: MNBI-005 / 02WO 352505-2074(e) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 479, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab;(f) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 480, and wherein the peptide epitope or mimotope is capable of binding to Cetuximab;(g) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 481, and wherein the peptide epitope or mimotope is capable of binding to Nivolumab;(h) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 482, and wherein the peptide epitope or mimotope is capable of binding to Nivolumab;(i) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 483, and wherein the peptide epitope is capable or mimotope of binding to QBend-10;(j) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 484, and wherein the peptide epitope or mimotope is capable of binding to Alemtuzumab;(k) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 469, and wherein the peptide epitope or mimotope is capable of binding to Sacituzumab;(l) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to any one of SEQ ID NO:470-474, and wherein the peptide epitope or mimotope is capable of binding to an anti-GUCY2C antibody;(m) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to SEQ ID NO: 439, and wherein the peptide epitope or mimotope is capable of binding to Tarlatamab; or(n) having 1, 2, 3, 4 or 5 mutations (substitutions, insertions, and / or deletions) compared to any one of SEQ ID NO: 441-468, and wherein the peptide epitope or mimotope is capable of binding to an anti-DLL3 antibody.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Table 3. Epitopes and MimotopesCooley Ref No.: MNBI-005 / 02WO 352505-2074

[0272] In embodiments, the modified peptide epitope or mimotope is capable of binding to [fam-]trastuzumab deruxtecan, (fam-trastuzumab deruxtecan-nxki), Adebrelimab, Ado- trastuzumab emtansine, Alemtuzumab, Amivantamab, Atezolizumab, Avelumab, Belantamab mafodotin (belantamab mafodotin-blmf), Bevacizumab, Blinatumomab, Brentuximab vedotin, Cadonilimab, Camrelizumab, Catumaxomab, Cemiplimab (cemiplimab-rwlc), Cetuximab, Cetuximab saratolacan, Cosibelimab, Daratumumab, Dinutuximab, Disitamab vedotin, Dostarlimab, Durvalumab, Edrecolomab, Elotuzumab, Elranatamab, Emapalumab (emapalumab-lzsg), Enfortumab vedotin (enfortumab vedotin-ejfv), Enlonstobart, Envafolimab, Epcoritamab, Gemtuzumab ozogamicin, Glofitamab, Ibritumomab tiuxetan, Inotuzumab ozogamicin, Ipilimumab, Isatuximab (isatuximab-irfc), Loncastuximab tesirine, Margetuximab-cmkb, Mirvetuximab soravtansine, Mogamulizumab (mogamulizumab-kpkc), Mosunetuzumab, Moxetumomab pasudotox (moxetumomab pasudotox-tdfk), Naxitamab- gqgk, Necitumumab, Nimotuzumab, Nivolumab, Cipterbin, Obinutuzumab, Ofatumumab, Olaratumab, Panitumumab, Pembrolizumab, Penpulimab, Pertuzumab, Polatuzumab vedotinCooley Ref. No.: MNBI-005 / 02WO 352505-2074(polatuzumab vedotin-piiq), Prolgolimab, Pucotenlimab, Racotumomab, Ramucirumab, Relatlimab, Retifanlimab, Ripertamab, Rituximab, Sacituzumab govitecan (sacituzumab govitecan-hziy), Serplulimab, Sintilimab, Socazolimab, Sugemalimab, Tafasitamab (tafasitamab-cxix), Tagitanlimab, Talquetamab (talquetamab-tgvs), Tebentafusp, Teclistamab, Tislelizumab, Tisotumab vedotin, tisotumab vedotin-tftv, Toripalimab, Tositumomab-1131, Trastuzumab, Trastuzumab duocarmazine, Tremelimumab, Zimberelimab, Zolbetuximab, Zuberitamab, Odronextamab, Ivonescimab, Benmel Stobart, Trastuzumab botidotin, Iparomlimab, tuvonralimab, Tarlatamab, Patritumab deruxtecan, Sacituzumab tirumotecan, Zanidatamab, Linvoseltamab, Datopotamab deruxtecan, Anbenitamab, Anvatabart opadotin, Apamistamab-Iodine (1311), Bemarituzumab, Cetrelimab, Cobolimab, Domvanalimab, Emactuzumab, Erfonrilimab, Favezelimab, Felzartamab, Fianlimab, Finotonlimab, ABBV-383, Geptanolimab, Gotistobart, Ivuxolimab, Izalontamab, Lemzoparlimab, Luveltamab tazevibulin, Magrolimab, Mecbotamab vedotin, Monalizumab, Nofazinlimab, Nurulimab, Ociperlimab, Oleclumab, Onfekafusp alfa, Oregovomab, Ozekibart, Pivekimab sunirine, Quavonlimab, Retlirafusp alfa, Rosopatamab (177Lu-DOTA), Rulonilimab, Sasanlimab, Telisotuzumab vedotin, Tiragolumab, IKS014, LCB14-0110, FS-1502, Trastuzumab mafodotin, Trastuzumab rezetecan, Vibostolimab, Vobramitamab duocarmazine, Zilovertamab vedotin, Suvemcitug, APX003, BD0801, TK001, sevacizumab, CTX-009, ES104, TR009, NOV1501, ABL001, DP303c, IAH0968, Kintuximab, gentuximab, cintuximab, MIL62, MRG002, MRG003, PM8002, MEDI5752, MCLA-128, AGEN1181, L19-IL2, L19-TNF, IMC-F106C, JMT101, BL-B01D1, BAT1308, AZD2936, JS004, TAB004, FG-M108, M108, 9MW2821, BMS-986349, CC-93269, EM801, ABBV-181, ABBV-151, ARGX-115, DS-7300a, IBI343, SHR-A1921, or ASKB589. In embodiments, the modified peptide epitope or mimotope comprises or consists of an amino acid sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations (substitutions, insertions, and / or deletions) compared to an unmodified peptide epitope or mimotope of one of these antibodies but is capable of binding to that antibody.In embodiments, the modified epitope or mimotope is capable of binding to an anti-DLL3 monoclonal antibody. In embodiments, the modified epitope or mimotope comprises 1, 2, 3, 4, or 5, mutations compared to the epitope or mimotope of the anti-DLL3 monoclonal antibody. In embodiments, the anti-DLL3 monoclonal antibody is tarlatamab. In embodiments, the unmodified epitope or mimotope comprises or consists of SEQ ID NO: 439.

[0273] In embodiments, the peptide epitope or mimotope is expressed on the surface of a cell. In embodiments, the peptide epitope or mimotope is located in an extracellular region ofCooley Ref. No.: MNBI-005 / 02WO 352505-2074 the recombinant polypeptide. In embodiments, the peptide epitope or mimotope is located within the binding domain. In embodiments, peptide epitope or mimotope is located between the VL and the VH. In embodiments, peptide epitope or mimotope is located between the TCR a chain and the TCR P chain.

[0274] In embodiments, the peptide epitope or mimotope within the recombinant polypeptide is capable of binding to the corresponding binder (e.g., an antibody) when expressed on the surface of an engineered cell.

[0275] In embodiments, the epitope or mimotope is derived from the group consisting of CCR4, DLL3, TROP2, GUCY2C, CD20, RSV protein F, EGFR, PD-1, CD34, and CD52, or is capable of binding to an antigen-binding molecule (e.g., antibody) that specifically binds to one of these proteins. In embodiments, the recombinant polypeptide comprises or consists of CCR4, DLL3, TROP2, GUCY2C, CD20, RSV protein F, EGFR, PD-1, CD34, or CD52, or a functional fragment thereof that comprises the epitope or mimotope. In embodiments, the epitope or mimotope is derived from CCR4, DLL3, TROP2, GUCY2C, CD20, RSV protein F, EGFR, PD-1, CD34, or CD52 but incorporated into a different polypeptide to form the recombinant polypeptide; that is, other than the epitope or mimotope, the recombinant polypeptide is not derived from that protein. In embodiments, the recombinant polypeptide comprises an epitope or mimotope that is derived from capable of binding to an anti-CCR4 antibody but is otherwise not derived from CCR4.

[0276] In embodiments, the epitope or mimotope within the recombinant polypeptide does not comprise a cysteine at its N-terminus. In embodiments, the recombinant polypeptide does not comprise a cysteine immediately before the N-terminus of the modified peptide epitope or mimotope.

[0277] In embodiments, the epitope or mimotope within the recombinant polypeptide does not comprise a cysteine at its C-terminus. In embodiments, the recombinant polypeptide does not comprise a cysteine immediately after the C-terminus of the modified peptide epitope or mimotope.

[0278] In embodiments, the recombinant polypeptide comprises one or more additional peptide epitope(s) or mimotope(s). In some embodimetns, the one or more additional peptide epitope(s) or mimotope are the same as the modified peptide epitope. In some embodimetns, the one or more additional peptide epitope(s) or mimotope are different from the modified peptide epitope. In embodiments, the recombinant polypeptide comprises 1, 2, 3, or 4 additional peptide epitopes or mimotopes.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074III. CARs Comprising a DLL3 Binding Region

[0279] In one aspect, the disclosure provides recombinant polypeptides comprising a DLL3 binding region. In embodiments, the recombinant polypeptides are engineered receptors, such as Chimeric Antigen Receptors (CARs), T Cell Receptors (TCRs), T cell receptor fusion constructs (TRuCs), and other synthetic Receptors. In embodiments, the recombinant polypeptide is a CAR.

[0280] In embodiments, the CAR is selected from the group consisting of a first generation CAR, a second generation CAR, a third generation CAR, and a fourth generation CAR. In embodiments, the CAR is or comprises a first generation CAR comprising an antigen binding region, a transmembrane domain, and at least one signaling domain (e.g., one, two or three signaling domains). In embodiments, the CAR is or comprises a second generation CAR comprising an antigen binding region, a transmembrane domain, and at least two signaling domains. In embodiments, the CAR is or comprises a third generation CAR comprising an antigen binding region, a transmembrane domain, and at least three signaling domains. In embodiments, the CAR is or comprises a fourth generation CAR comprising an antigen binding region, a transmembrane domain, three or four signaling domains, and a domain which upon successful signaling of the CAR induces expression of a cytokine gene.

[0281] In embodiments, the CAR is or comprises a first generation CAR. In embodiments, a first generation CAR comprises an antigen binding region, a transmembrane domain, and signaling domain. In embodiments, a signaling domain mediates downstream signaling during T cell activation.

[0282] In embodiments, the CAR is or comprises a second generation CAR. In embodiments, a second generation CAR comprises an antigen binding region, a transmembrane domain, and two signaling domains. In embodiments, a signaling domain mediates downstream signaling during T cell activation. In embodiments, a signaling domain is a costimulatory domain. In embodiments, a costimulatory domain enhances cytokine production, CAR T cell proliferation, and / or CAR T cell persistence during T cell activation.

[0283] In embodiments, the CAR is or comprises a third generation CAR. In embodiments, a third generation CAR comprises an antigen binding region, a transmembrane domain, and at least three signaling domains. In embodiments, a signaling domain mediates downstream signaling during T cell activation. In embodiments, a signaling domain is a costimulatory domain. In embodiments, a costimulatory domain enhances cytokine production, CAR T cell proliferation, and or CAR T cell persistence during T cell activation. In embodiments, a thirdCooley Ref. No.: MNBI-005 / 02WO 352505-2074 generation CAR comprises at least two costimulatory domains. In embodiments, the at least two costimulatory domains are not the same.

[0284] In embodiments, the CAR is or comprises a fourth generation CAR. In embodiments, a fourth generation CAR comprises an antigen binding region, a transmembrane domain, and at least two, three, or four signaling domains. In embodiments, a signaling domain mediates downstream signaling during T cell activation. In embodiments, a signaling domain is a costimulatory domain. In embodiments, a costimulatory domain enhances cytokine production, CAR T cell proliferation, and or CAR T cell persistence during T cell activation.

[0285] In embodiments, the CAR comprises an antigen binding region and a transmembrane domain, but does not comprise any signaling domain. In embodiments, the transmembrane domain of such CARs binds to another signaling protein. In embodiments, such CARs comprise a domain that interacts with another signaling protein. In embodiments, such CARs are capable of activating the signaling protein it interacts with in the presence of the antigen.

[0286] In embodiments, the antigen binding region of the CAR is or comprises an antigenbinding fragment of an antibody. In embodiments, the antibody is a human antibody or humanized antibody. In some embodiment, the antibody is a monoclonal antibody.

[0287] In embodiments, the antigen is DLL3. In embodiments, the DLL3 binding region binds the epidermal growth factor (EGF)-like repeat 6 (EGF6) domain of DLL3. In some embedments, the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1), a CDRH2, and a CDRH3; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1), a CDRL2, and a CDRL3. In embodiments, the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and / or CDRL3 are selected from those in Table 4.Table 4. Exemplary Anti-DLL3 sequencesCooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0288] In embodiments, the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426.

[0289] In embodiments, the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 580, a CDRH2 comprising SEQ ID NO: 581, and a CDRH3 comprising SEQ IDCooley Ref. No.: MNBI-005 / 02WO 352505-2074NO: 582; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 583, a CDRL2 comprising SEQ ID NO: 584, and a CDRL3 comprising SEQ ID NO: 585.

[0290] In some embedments, the DLL3 binding region comprises a heavy chain variable region (VH) and / or a light chain variable region (VL) selected from those in Table 4. In embodiments, the VH comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 419, and / or the VL comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 415.

[0291] In embodiments, the VH comprises the amino acid sequence of SEQ ID NO: 419, and / or the VL comprises the amino acid sequence of SEQ ID NO: 415.

[0292] In embodiments, the DLL3 binding region is a single-chain antibody fragment (scFv) derived from the variable heavy (VH) and variable light (VL) chains of a monoclonal antibody (mAh), or a single domain antibody (sdAb), such as sdFv, nanobody, VHH and VNAR. In embodiments, the DLL3 binding region is a tandem scFv (bivalent and / or bispecific), a tandem single domain antibody (sdAb), or a bi-specific Fab. In embodiments, an antigen binding fragment comprises antibody-derived variable regions joined by a flexible linker.

[0293] In embodiments, the DLL3 binding region is a single chain antibody fragment, such as a single chain variable fragment (scFv) or a diabody or a single domain antibody (sdAb). In embodiments, the DLL3 binding region is a single domain antibody comprising only the VH region. In embodiments, the DLL3 binding region is an scFv comprising a heavy chain variable (VH) region and a light chain variable (VL) region.

[0294] In embodiments, the DLL3 binding region comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical, or 100% identical to SEQ ID NO: 627.

[0295] In embodiments, the nucleotide sequence encoding a CAR may be derived from a mammalian sequence, for example, a mouse sequence, a primate sequence, a human sequence, or combinations thereof. In the cases where the nucleotide sequence encoding a CAR is nonhuman, the sequence of the CAR may be humanized. The nucleotide sequence encoding a CAR may also be codon-optimized for expression in a mammalian cell, for example, a human cell. In any of these embodiments, the nucleotide sequence encoding a CAR may be at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the nucleotide sequencesCooley Ref. No.: MNBI-005 / 02WO 352505-2074 disclosed herein. The sequence variations may be due to codon-optimalization, humanization, restriction enzymebased cloning scars, and / or additional amino acid residues linking the functional domains, etc.

[0296] In embodiments, the CAR is or comprises a single-chain CAR, a multi-chain CAR, a single-targeted CAR, a multi-targeted CAR, a bivalent tandem CAR, a bivalent loop CAR, a multi ci str onic CAR, a bicistronic CAR, a dimerizing agent regulated immune-receptor complex (DARIC), an antibody tethered orthogonal multiplexing compatible (ATOMIC), a T cell receptor fusion construct (TruC), an HLA-independent T cell (HIT) receptor, a synthetic T cell receptor and antigen receptor (STAR), a synNotch-CAR circuit, a synthetic intramembrane proteolysis receptor (SNIPR), a rapamycin inducible TCR, a rapamycin inducible Fc receptor, a constitutive TCR-like receptor, a multi-chain DAP-CAR, a TREM1 / DAP12 CAR, or a DAP12 / TREM1 CAR.

[0297] In embodiments, the CAR is a bicistronic CAR. In embodiments, the immune cell of the disclosure comprises a bicistronic CAR. Bicistronic CARs can comprise two CARs that bind different targets and are encoded by a single vector. A bicistronic CAR may comprise a first CAR sequence and a second CAR sequence expressed as a single polypeptide comprising a cleavable linker between the first and second CARs. Non-limiting examples of first and / or second CAR sequences include CD 19, CD20, BCMA, CD22, CD70, DLL3, LY6G6D, Claudin 6, GCC, p53R175H, and PRAME. An exemplary cleavable linker is Furin-GSG-T2A (see, e.g., Chng et al. MAbs. 2015 Mar-Apr; 7(2): 403-412, which is herein incorporated by reference with respect to cleavable linkers; see also Guedan et al. Mol Ther Methods Clin Dev. 2019 Mar 15; 12: 145-156, which is incorporated herein by reference with respsect to bicistronic CAR design).

[0298] In embodiments, the CAR is a bispecific CAR. In embodiments, the immune cell of the disclosure comprises a bispecific CAR. In embodiments, a first binding motif and a second binding motif (e.g., distinct anti-CD20 and anti-CD19 binding motifs) are both comprised in single bispecific CAR. In such bispecific CARs, a CAR molecule itself may be engineered to recognize more than one antigen. In tandem bispecific CARs, the first and second binding motifs are extracellular and may be characterized as a membrane-proximal binding motif and a membrane-distal binding motif.

[0299] In embodiments, the CAR further comprises a domain which upon successful signaling of the CAR induces expression of a cytokine gene. In embodiments, a cytokine gene is endogenous or exogenous to a target cell comprising a CAR which comprises a domain which upon successful signaling of the CAR induces expression of a cytokine gene. InCooley Ref. No.: MNBI-005 / 02WO 352505-2074 embodiments, a cytokine gene encodes a pro-inflammatory cytokine. In embodiments, a cytokine gene encodes IL-1, IL-2, IL-9, IL- 12, IL- 18, TNF, or IFN-gamma, or functional fragment thereof. In embodiments, a domain which upon successful signaling of the CAR induces expression of a cytokine gene is or comprises a transcription factor or functional domain or fragment thereof. In embodiments, a domain which upon successful signaling of the CAR induces expression of a cytokine gene is or comprises a transcription factor or functional domain or fragment thereof. In embodiments, a transcription factor or functional domain or fragment thereof is or comprises a nuclear factor of activated T cells (NF AT), an NF-kB, or functional domain or fragment thereof. See, e.g., Zhang. C. et al., Engineering CAR-T cells. Biomarker Research. 5:22 (2017); WO 2016126608; Sha, H. et al. Chimaeric antigen receptor T-cell therapy for tumour immunotherapy. Bioscience Reports Jan 27, 2017, 37 (1).

[0300] A skilled artisan is familiar with CARs and different components and configurations of CARs. Any known CAR can be employed in connection with the provided embodiments. In addition to the CARs described herein, various CARs and nucleotide sequences encoding the same are known in the art and would be suitable for engineering cells as described herein. See, e.g., W02013040557; W02012079000; W02016030414; Smith T, et al., Nature Nanotechnology. 2017. DOI: 10.1038 / NNAN0.2017.57, the disclosures of which are herein incorporated by reference. Exemplary features and components of a CAR are described in the following subsections. a. Antigen Binding Region

[0301] In embodiments, a CAR antigen binding region is or comprises an antibody or antigen-binding portion thereof. In embodiments, a CAR antigen binding region is or comprises an scFv or Fab.

[0302] In embodiments, an antigen binding region binds to a cell surface antigen of a cell. In embodiments, a cell surface antigen is characteristic of (e.g., expressed by) a particular or specific cell type. In embodiments, a cell surface antigen is characteristic of more than one type of cell.

[0303] In embodiments, the antigen may be an antigen that is expressed on tumor cells, or an antigen that is characteristic of an autoimmune or inflammatory disease. In embodiments, the antigen may be an antigen that is exclusively or preferentially expressed on tumor cells, or an antigen that is characteristic of an autoimmune or inflammatory disease. In embodiments, the antigen binding region targets an antigen characteristic of a neoplastic cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074For instance, the antigen binding region targets an antigen expressed by a neoplastic or cancer cell. In embodiments, the antigen binding region binds a tumor associated antigen. In embodiments, the antigen characteristic of a neoplastic cell (e.g., antigen associated with a neoplastic or cancer cell) or a tumor associated antigen is selected from a cell surface receptor, an ion channel-linked receptor, an enzyme-linked receptor, a G protein-coupled receptor, receptor tyrosine kinase, tyrosine kinase associated receptor, receptor-like tyrosine phosphatase, receptor serine / threonine kinase, receptor guanylyl cyclase, histidine kinase associated receptor.

[0304] In embodiments, the CAR is a DLL3 CAR. In embodiments, the extracellular binding domain of the DLL3 CAR comprises an antibody that specifically binds to DLL3, for example, human DLL3. In embodiments, the DLL3 CAR comprises any one of SEQ ID NOs: 395, 401, 521, 523, 597, and 598. In embodiments, the extracellular binding domain of the DLL3 CAR comprises an antibody light chain sequence comprising SEQ ID NO: 415. In embodiments, the extracellular binding domain of the DLL3 CAR comprises an antibody heavy chain sequence comprising SEQ ID NO: 419. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a light chain comprising a CDR1 comprising SEQ ID NO: 424, a CDR2 comprising SEQ ID NO: 425, and a CDR3 comprising SEQ ID NOs: 426. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a heavy chain comprising a CDR1 comprising SEQ ID NO: 427, a CDR2 comprising SEQ ID NO: 428, and a CDR3 comprising SEQ ID NOs: 429. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a light chain comprising a CDR1 comprising SEQ ID NO: 580, a CDR2 comprising SEQ ID NO: 581, and a CDR3 comprising SEQ ID NOs: 582. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a heavy chain comprising a CDR1 comprising SEQ ID NO: 583, a CDR2 comprising SEQ ID NO: 584, and a CDR3 comprising SEQ ID NOs: 585. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a light chain comprising a CDR1 comprising SEQ ID NO: 424, a CDR2 comprising SEQ ID NO: 425, and a CDR3 comprising SEQ ID NOs: 426. In embodiments, the extracellular binding domain of the DLL3 CAR comprises a heavy chain comprising a CDR1 comprising SEQ ID NO: 427, a CDR2 comprising SEQ ID NO: 428, and a CDR3 comprising SEQ ID NOs: 429.

[0305] In any of these embodiments, the extracellular binding domain of the CAR can be codon-optimized for expression in a host cell or have variant sequences to increase functions of the extracellular binding domain.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0306] In embodiments, the CAR is bispecific to two target antigens (e.g., comprising binding region(s) for two target antigens). In embodiments, the target antigens are different target antigens. In some of any such embodiments, the two different target antigens are any two different antigens described above. In embodiments, each of the two different antigen binding regions is an scFv. In embodiments, the C-terminus of one variable domain (VH or VL) of a first scFv is tethered to the N-terminus of the second scFv (VL or VH, respectively) via a polypeptide linker. In embodiments, the linker connects the N-terminus of the VH with the C-terminus of VL or the C-terminus of VH with the N-terminus of VL. These scFvs lack the constant regions (Fc) present in the heavy and light chains of the native antibody. The scFvs, specific for at least two different antigens, are arranged in tandem and linked to the costimulatory domain and the intracellular signaling domain via a transmembrane domain. In embodiments, an extracelluar spacer domain may be linked between the antigen-specific binding region and the transmembrane domain.

[0307] In embodiments, each antigen-specific targeting region of the CAR comprises a divalent (or bivalent) single-chain variable fragment (di-scFvs, bi-scFvs). In CARs comprising di-scFVs, two scFvs specific for each antigen are linked together by producing a single peptide chain with two VH and two VL regions, yielding tandem scFvs. (Xiong, Cheng- Yi; Natarajan, A; Shi, X B; Denardo, G L; Denardo, S J (2006). “Development of tumor targeting anti-MUC-1 multimer: effects of di-scFv unpaired cysteine location on PEGylation and tumor binding”. Protein Engineering Design and Selection 19 (8): 359-367; Kufer, Peter; Lutterbiise, Ralf; Baeuerle, Patrick A. (2004). “A revival of bispecific antibodies”. Trends in Biotechnology 22 (5): 238-244). CARs comprising at least two antigen-specific targeting regions would express two scFvs specific for each of the two antigens. The resulting antigenspecific targeting region, specific for at least two different antigens, is joined to the costimulatory domain and the intracellular signaling domain via a transmembrane domain. In embodiments, an extracelluar spacer domain may be linked between the antigen-specific binding domain and the transmembrane domain.

[0308] In embodiments, each antigen-specific targeting region of the CAR comprises a diabody. In a diabody, the scFvs are created with linker peptides that are too short for the two variable regions to fold together, driving the scFvs to dimerize. Still shorter linkers (one or two amino acids) lead to the formation of trimers, the so-called triabodies or tribodies. Tetrabodies may also be used.

[0309] In embodiments, the cell is engineered to express more than one CAR, such as two different CARs, in which each CAR has an antigen binding region directed to a different targetCooley Ref. No.: MNBI-005 / 02WO 352505-2074 antigen. In some of any such embodiments, the two different target antigens are any two different antigens described above. In embodiments, the extracellular binding domains are different and bind two different antigens from (i) CD 19 and CD20, (ii) CD20 and LI -CAM, (iii) LI -CAM and GD2, (iv) EGFR and LI -CAM, (v) CD 19 and CD22, (vi) EGFR and C- MET, (vii) EGFR and HER2, (viii) C-MET and HER2, or (ix) EGFR and ROR1.

[0310] In embodiments, two different engineered cells are prepared that contain the provided modifications with each engineered with a different CAR. In embodiments, each of the two different CARs has an antigen binding region directed to a different target antigen. In some of any such embodiments, the two different target antigens are any two different antigens described above. In embodiments, the extracellular binding domains are different and bind two different antigens from (i) CD 19 and CD20, (ii) CD20 and LI -CAM, (iii) LI -CAM and GD2, (iv) EGFR and LI -CAM, (v) CD 19 and CD22, (vi) EGFR and C-MET, (vii) EGFR and HER2, (viii) C-MET and HER2, or (ix) EGFR and ROR1. In embodiments, a population of engineered cells expressing a first CAR directed against a first target antigen and a population of engineered cells expressing a second CAR directed against a second target antigen are separately administered to the subject. In embodiments, the first and second population of cells are administered sequentially in any order. For instance, the population of cells expressing the second CAR is administered a after administration of the population of cells expressing the first CAR. b. Linker Sequences

[0311] In embodiments, the antigen binding region of the CAR may comprise one or more linker sequences. In embodiments, the antigen binding region of the CAR may comprise one or more linker sequences connecting a heavy chain variable region (VH) and a light chain variable region (VL). The VH and the VL may be connected in either order, i.e., VH-linker- VL or VL-linker-VH. Nonlimiting examples of linkers include Whitlow linker, (G4S)n (n can be a positive integer, e.g., 1, 2, 3, 4, 5, 6, etc.) linker, and variants thereof.

[0312] Examples of exemplary linker sequences are described in Table 5. In provided aspects, the sequences of each linker in Table 5 can be combined with any of the other CAR component sequences described here.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Table 5. Exemplary Linker Sequencesc. Spacer (Hinge) Sequences

[0313] In embodiments, the CAR further comprises one or more spacers, e.g., wherein the spacer is a first spacer between the antigen binding region and the transmembrane domain. In embodiments, the first spacer includes at least a portion of an immunoglobulin constant region or variant or modified version thereof. In embodiments, the spacer is a second spacer between the transmembrane domain and a signaling domain. In embodiments, the second spacer is an oligopeptide, e.g., wherein the oligopeptide comprises glycine and serine residues such as but not limited to glycine-serine doublets. In embodiments, the CAR comprises two or more spacers, e.g., a spacer between the antigen binding region and the transmembrane domain and a spacer between the transmembrane domain and a signaling domain. The terms “hinge” and “spacer” may be used interchangeably in the present disclosure. Non-limiting examples of hinge domains include CD8a hinge domain, CD28 hinge domain, IgG4 hinge domain, IgG4 hinge-CH2-CH3 domain, and variants thereof. In embodiments, the hinge region is derived from CD8alpha, CD28, or IgG4, or comprises an IgG4 hinge-CH2-CH3 domain. In embodiments, the hinge region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NOs: 355-360, 420, and 487.Cooley Ref No.: MNBI-005 / 02WO 352505-2074

[0314] Examples of exemplary spacer (hinge) sequences are described in Table 6. In provided aspects, the sequences of each spacer (hinge) in Table 6 can be combined with any of the other CAR component sequences described here. Table 6. Exemplary Spacer (Hinge) Sequencesd. Transmembrane Domain

[0315] In embodiments, the CAR transmembrane region is derived from TCR^, CD5, CD8, CD9, CD45, CD22, CD32, CD33, CD37, CD40, CD40L / CD154, CD64, CD80, CD86, CD134, CD137, CD154, VEGFR2, FAS, FGFR2B, CD8a, CD8P, 4-1BB / CD137, CD28,CD34, CD4, FcsRIy, CD16, OX40 / CD134, CD3< CD3s, CD3y, CD35, TCRa, or TCRbeta. In embodiments, the CAR transmembrane domain comprises at least a transmembrane regionCooley Ref. No.: MNBI-005 / 02WO 352505-2074 of the TCR alpha chain, TCR beta chain, TCR zeta chain, CD28, CD3 epsilon, CD3 zeta, l.xxCD3 zeta, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD64, CD80, CD86, CD134, CD 137, CD 154, or functional variant thereof. In embodiments, the transmembrane domain comprises at least a transmembrane region(s) of CD8a, CD8P, 4- 1BB / CD137, CD28, CD34, CD4, FcsRIy, CD16, OX40 / CD134, CD3< CD3s, CD3y, CD38, TCRa, TCRb, TCRA, CD32, CD64, CD64, CD45, CD5, CD9, CD22, CD37, CD80, CD86, CD40, CD40L / CD154, VEGFR2, FAS, and FGFR2B, or functional variant thereof.

[0316] In embodiments, the CAR transmembrane region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NOs: 397, 398, 421, or 509.

[0317] Examples of exemplary transmembrane domain sequences are described in Table 7. In provided aspects, the sequences of each transmembrane domain in Table 7 can be combined with any of the other CAR component sequences described here.Table 7. Exemplary Transmembrane Domain Sequencese. Signaling Domain(s)

[0318] In embodiments, a CAR described herein comprises one or more intracellular signaling domains. A CAR may comprise a costimulatory signaling domain, e.g., to increase signaling potency. See U.S. Pat. Nos. 7,741,465, and 6,319,494, as well as Krause et al. and Finney et al. (supra), Song et al., Blood 119:696-706 (2012); Kalos et al, Sci Transl. Med. 3:95 (2011); Porter et al, N. Engl. J. Med. 365:725-33 (2011), and Gross et al, Annu. Rev.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Pharmacol. Toxicol. 56:59-83 (2016). Signals generated through a TCR alone may be insufficient for full activation of a T cell and a secondary or co-stimulatory signal may increase activation. Thus, In embodiments, an intracellular signaling domain further comprises one or more additional signaling domains (e.g., costimulatory signaling domains) that activate one or more immune cell effector functions (e.g. , a native immune cell effector function described herein). In embodiments, a portion of such costimulatory signaling domains may be used, as long as the portion transduces the effector function signal. In embodiments, a cytoplasmic domain described herein comprises one or more cytoplasmic sequences of a T cell co-receptor (or fragment thereof). Non-limiting examples of such T cell co-receptors comprise CD27, CD28, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA- 1), MYD88, CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that binds with CD83. An exemplary costimulatory protein has the amino acid sequence of a costimulatory protein found naturally on T cells, the complete native amino acid sequence of which costimulatory protein is described in NCBI Reference Sequence: NP 006130.1.

[0319] In embodiments, a CAR described herein comprises one or more intracellular signaling domains selected from one or more of CD3zeta, lxxCD3zeta, CD28, 4- IBB, 0X40, IL2Rb turbodomains, MYD88 / CD40, MYD88 / CD40 inducible costimulatory domain, CD2, B7-1 / CD80; B7-2 / CD86; B7-H1 / PD-L1; B7-H2; B7-H3; B7-H4; B7-H6; B7-H7; BTLA / CD272; CD28; CTLA-4; Gi24 / VISTA / B7-H5; ICOS / CD278; CARD11; PD-1; PD- L2 / B7-DC; PDCD6); 4-1BB / TNFSF9 / CD137; 4-1BB Ligand / TNFSF9;BAFF / BLyS / TNFSF13B; BAFF R / TNFRSF13C; CD27 / TNFRSF7; CD27 Ligand / TNFSF7; CD30 / TNFRSF8; CD30 Ligand / TNFSF8; CD40 / TNFRSF5; CD40 / TNFSF5; CD40 Ligand / TNFSF5; DR3 / TNFRSF25; GITR / TNFRSF18; GITR Ligand / TNFSF18; HVEM / TNFRSF14; LIGHT / TNFSF14; Lymphotoxin-alpha / TNF-beta; OX40 / TNFRSF4; 0X40 Ligand / TNFSF4; RELT / TNFRSF19L; TACI / TNFRSF13B; TL1A / TNFSF15; TNF- alpha; TNF RII / TNFRSF1B); 2B4 / CD244 / SLAMF4; BLAME / SLAMF8; CD2; CD2F- 10 / SLAMF9; CD48 / SLAMF2; CD58 / LFA-3; CD84 / SLAMF5; CD229 / SLAMF3; CRACC / SLAMF7; NTB- A / SLAMF6; SLAM / CD150); CD2; CD7; CD53; CD82 / Kai-1; CD90 / Thyl; CD96; CD160; CD200; CD300a / LMIRl; HLA Class I; HLA-DR; Ikaros; Integrin alpha 4 / CD49d; Integrin alpha 4 beta 1; Integrin alpha 4 beta 7 / LPAM-l; LAG-3; TCL1A; TCL1B; CRTAM; DAP12; Dectin- 1 / CLEC7A; DPPIV / CD26; EphB6; TIM- 1 / KIM- 1 / HA VCR; TIM-4; TSLP; TSLP R; lymphocyte function associated antigen-1 (LFA-1); NKG2C, an immunoreceptor tyrosine based activation motif (ITAM), CD27, CD134 / OX40, CD30,Cooley Ref. No.: MNBI-005 / 02WO 352505-2074CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD7, LIGHT, NKG2C, and any combinations thereof .

[0320] In embodiments, a CAR comprises an intracellular signaling domain which is a costimulatory domain. In embodiments, a CAR comprises a second costimulatory domain. In embodiments, a CAR comprises at least two costimulatory domains. In embodiments, a CAR comprises at least three costimulatory domains. In embodiments, a CAR comprises a costimulatory domain selected from one or more of CD3zeta, l.xxCD3zeta, CD27, CD28, 4- 1BB, CD134 / OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83. In embodiments, if a CAR comprises two or more costimulatory domains, two costimulatory domains are different. In embodiments, if a CAR comprises two or more costimulatory domains, two costimulatory domains are the same.

[0321] In embodiments, the at least one intracellular signaling domain comprises (i) a 4- 1BB domain, or functional variant thereof; and (ii) a CD3 zeta domain, or functional variant thereof. In embodiments, the at least one signaling domain comprises (i) a CD28 domain, or functional variant thereof; and (ii) a CD3 zeta domain, or functional variant thereof. In embodiments, the at least one signaling domain comprises (i) a CD28 domain, or functional variant thereof; and (ii) a 1 ,xxCD3 zeta domain, or functional variant thereof.

[0322] In embodiments the intracellular region comprises an intracellular signaling domain derived from 4- IBB and / or an intracellular signaling domain derived from CD3zeta. In embodiments the intracellular region, from N-term to C-term, the intracellular signaling domain derived from 4- IBB and the intracellular signaling domain derived from CD3zeta.

[0323] In embodiments the intracellular region comprises the intracellular signaling domain derived from 4-1BB comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 422. In embodiments, the intracellular region comprises an intracellular signaling domain derived from CD3zeta comprising: (a) a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 423; or (b) a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 488 wherein the amino acid corresponding to position 14 of SEQ ID NO: 488 is lysine.

[0324] In embodiments, the CAR comprises an extracellular antigen binding region (e.g., antibody or antibody fragment, such as an scFv) that binds to an antigen (e.g., tumor antigen), a spacer (e.g., containing a hinge domain, such as any as described herein), a transmembraneCooley Ref. No.: MNBI-005 / 02WO 352505-2074 domain (e.g., any as described herein), and one or more intracellular signaling domains (e.g., any intracellular signaling domain, such as a primary signaling domain or costimulatory signaling domain as described herein). In embodiments, the one or more intracellular signaling domains is or comprises a primary cytoplasmic signaling domain. In embodiments, the one or more intracellular signaling domains additionally comprises an intracellular signaling domain of a costimulatory molecule (e.g., a costimulatory domain). Any of such components can be any as described above.

[0325] Examples of exemplary signaling domain sequences are described in Table 8A. In provided aspects, the sequences of each signaling domain in Table 8A can be combined with any of the other CAR component sequences described here.Table 8A. Exemplary Signaling Domain Sequencesf Signal Peptide

[0326] In certain embodiments, the CAR may further comprise one or more signal peptides. In certain embodiments, the CAR may comprise a signal peptide at the N-terminus. Nonlimiting examples of signal peptides include CD8a signal peptide, IgK signal peptide, and granulocyte-macrophage colony-stimulating factor receptor subunit alpha (GMCSFR-a, alsoCooley Ref. No.: MNBI-005 / 02WO 352505-2074 known as colony stimulating factor 2 receptor subunit alpha (CSF2RA)) signal peptide, and variants thereof, the amino acid sequences of which are provided in Table 8B below.

[0327] Examples of exemplary signal peptide sequences are described in Table 8B. In provided aspects, the sequences of each signal peptide in Table 8B can be combined with any of the other CAR component sequences described here.Table 8B. Exemplary Signal Peptide Sequences

[0328] In certain embodiments, the CAR comprises a hinge region comprising SEQ ID NO: 414, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

[0329] In certain embodiments, the CAR comprises a binding region comprising SEQ ID NO: 424-429, a hinge region comprising SEQ ID NO: 414, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

[0330] In certain embodiments, the CAR comprises a binding region comprising SEQ ID NO: 580-585 a hinge region comprising SEQ ID NO: 414, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

[0331] In certain embodiments, the CAR comprises a binding region comprising SEQ ID NO: 424-429), a hinge region comprising SEQ ID NO: 414, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

[0332] In certain embodiments, the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 395, 401, 521, 523, 597, and 598.

[0333] In certain embodiments, the CAR comprises one or more sequences in Table 9A. In embodiments, the CAR comprises, from N-terminus to C-terminus, a VL, a linker, a CCR4Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 epitope, a linker, a VH, a CD8 hinge, a CD8 transmembrane, a 4- IBB costimulatory domain, a CD3(^ signaling domain, a P2A sequence, and a CARD11-PI3KR3 fusion protein. In embodiments, the CAR comprises, from N-terminus to C-terminus, a VL comprising SEQ ID NO: 415, a linker comprising “GGS”, a CCR4 epitope comprising SEQ ID NO: 431, a linker comprising SEQ ID NO: 650, a VH comprising SEQ ID NO: 419, a CD8 hinge comprising SEQ ID NO: 420, a CD8 transmembrane comprising SEQ ID NO: 421, a 4-1BB costimulatory domain comprising SEQ ID NO: 422 , a CD3(^ signaling domain comprising SEQ ID NO: 423, a P2A sequence comprising SEQ ID NO: 377, and a CARD11-PI3KR3 fusion protein comprising SEQ ID NO: 2. In embodiments, the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 598. In embodiments, the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 597.

[0334] In certain embodiments, the CAR is encoded by a nucleic acid sequence comprising one or more sequences in Table 9B. In embodiments, the CAR is encoded by a nucleic acid sequence comprising, from 5’ to 3’, a VL nucleic acid sequence, a linker nucleic acid sequence, a CCR4 epitope nucleic acid sequence, a linker nucleic acid sequence a VH nucleic acid sequence, a CD8 hinge nucleic acid sequence, a CD8 transmembrane nucleic acid sequence, a 4-1BB costimulatory domain nucleic acid sequence, a CD3(^ signaling domain nucleic acid sequence, a P2A nucleic acid sequence, a CARD11-PIK3R3 fusion nucleic acid sequence, and a P2A nucleic acid sequence. In embodiments, the CAR is encoded by a nucleic acid sequence comprising, from 5’ to 3’, a VL nucleic acid sequence comprising SEQ ID NO: 605, a linker nucleic acid sequence comprising “GGCGGTTCT”, a CCR4 epitope nucleic acid sequence comprising SEQ ID NO: 644, a linker nucleic acid sequence comprising SEQ ID NO: 645, a VH nucleic acid sequence comprising SEQ ID NO: 604, a CD8 hinge nucleic acid sequence comprising SEQ ID NO: 646, a CD8 transmembrane nucleic acid sequence comprising SEQ ID NO: 655, a 4-1BB costimulatory domain nucleic acid sequence comprising SEQ ID NO: 635 , a CD3(^ signaling domain nucleic acid sequence comprising SEQ ID NO: 636, a P2A nucleic acid sequence comprising SEQ ID NO: 637, a CARD11- PIK3R3 fusion nucleic acid sequence comprising SEQ ID NO: 647, and a P2A nucleic acid sequence comprising SEQ ID NO: 639. In embodiments, the CAR is encoded by a nucleic acid sequence comprising at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 649.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Table 9A. Non-Limiting CAR Amino Acid SequencesCooley Ref. No.: MNBI-005 / 02WO 352505-2074Table 9B. Non-Limiting CAR Nucleotide SequencesCooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074IV. Anti-p53 R175H T Cell Receptors (TCRs)

[0335] In embodiments, the recombinant polypeptide of the disclosure comprises (i) a T cell receptor (TCR) having antigenic specificity for an antigen derived from human p53 protein, or (ii) an antigen-binding fragment thereof. In embodiments, wherein the TCR or the antigen-binding fragment thereof has antigenic specificity for a human p53R175Hamino acid sequence.

[0336] In embodiments, the TCR or the antigen-binding fragment thereof has antigenic specificity for a human p53R175Hamino acid sequence. In embodiments, the human p53R175Hamino acid sequence is HMTEVVRHC (SEQ ID NO: 399). In embodiments, the TCR or the antigen-binding fragment thereof does not have antigenic specificity for the wild-type human p53 amino acid sequence of HMTEVVRRC (SEQ ID NO: 400).

[0337] A TCR as known by the skilled in the art can be composed of two different, an alpha chain and a beta chain, each consisting of a constant region that anchors the chain inside the T cell surface membrane, and a variable region which can recognize and bind an antigen presented by MHCs. The TCR complex can be associated with six polypeptides forming two heterodimers, CD3ys and CD35s, and one homodimer, CD3(^, which together forms the CD3 complex. TCRs can be engineered to utilize the modification of T cells that retain these complexes to specifically target the antigens expressed by particular tumor cells. As used herein, a TCR can be a naturally-occurring or an engineered TCR.

[0338] TCRs are disulfide-linked membrane anchored heterodimeric proteins, typically comprising highly variable alpha (a) and beta (P) chains expressed as a complex with invariant CD3 chain molecules. T cells expressing these types of TCRs are referred to as a:P (or aP) T cells. A minority of T cells express an alternative TCR comprising variable gamma (y) and delta (5) chains and are referred to as y5 T cells. TCR is not able to mediate signal transduction itself due to its short cytoplasmic tail, so TCR still requires CD3 and zeta to carry out the signal transduction in its place. A TCR receptor complex is an octomeric complex of variable TCR receptor a and P chains with three dimeric signaling modules CD35 / s, CD3y / s and

[0339] According to embodiments of the application, suitable TCRs bind specifically to a major histocompatibility complex (MHC) on the surface of cancer cells that displays a peptide fragment of a tumor antigen. An MHC is a set of cell-surface proteins which allow the acquired immune system to recognize ‘foreign’ molecules. Proteins are intracellularly degraded andCooley Ref. No.: MNBI-005 / 02WO 352505-2074 presented on the surface of cells by the MHC. MHCs displaying “foreign” peptides, such a viral or cancer associated peptides, are recognized by T cells with the appropriate TCRs, prompting cell destruction pathways. MHCs on the surface of cancer cells can display peptide fragments of tumor antigen i.e. an antigen which is present on a cancer cell but not the corresponding non-cancerous cell. T cells which recognize these peptide fragments can exert a cytotoxic effect on the cancer cell.

[0340] According to embodiments of the application, the T cells can be modified to express a heterologous TCR that binds specifically to MHCs displaying peptide fragments of a tumor antigen expressed by the cancer cells in a specific cancer patient. Tumor antigens expressed by cancer cells in the cancer patient may be identified using standard techniques. For example, a polypeptide, such as an FSH fragment, which binds specifically to an FSHR, is fused to CD3 epsilon, CD3 gamma or CD3 delta chain. The fusion protein forms a TCR complex on T cells through the interaction of CD3 with TCR a / p chains. The TCR complex binds specifically to FSHR on tumor cells via the FSH fragment, and the binding initiates TCR signaling against the tumor cells. According to yet another embodiment of the invention, the heterologous TCR is expressed together with a CAR that binds specifically to mesothelin. Heterologous TCRs can include aPTCR heterodimers.

[0341] The TCR can be engineered to increase its affinity or avidity for a tumor antigen (i.e., an affinity enhanced TCR). The affinity enhanced TCR can comprise one or more mutations relative to a naturally occurring TCR, for example, one or more mutations in the hypervariable complementarity determining regions (CDRs) of the variable regions of the TCR a and P chains. These mutations increase the affinity of the TCR for MHCs that display a peptide fragment of a tumor antigen expressed by cancer cells. Suitable methods of generated affinity enhanced TCRs include screening libraries of TCR mutants using phage or yeast display and are well known in the art (see for example Robbins et al J Immunol (2008) 180 (9) : 6116; San Miguel et al (2015) Cancer Cell 28 (3) 281-283; Schmitt et al (2013) Blood 122 348-256; Jiang et al (2015) Cancer Discovery 5 901).

[0342] In some of embodiments, the cell comprises a recombinant nucleic acid encoding a TCRa and / or TCRb chain or a portion thereof that has been codon-optimized. In embodiments, the transgene encodes a portion of a TCRa and / or TCRb chain with less than 100% amino acid sequence identity to a corresponding portion of a native or endogenous TCRa and / or TCRb chain. In embodiments, the encoded TCRa and / or TCRb chain contains an amino acid sequence with, with about, or with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or greater than 99% identity but less than 100% identity to a corresponding native or endogenousCooley Ref. No.: MNBI-005 / 02WO 352505-2074TCRa and / or TCRb chain. In particular embodiments, the transgene encodes a TCRa and / or TCRb constant domain or portion thereof with less than 100% amino acid sequence identity to a corresponding native or endogenous TCRa and / or TCRb constant domain. In embodiments, the TCRa and / or TCRb constant domain contains an amino acid sequence with, with about, or with at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or greater than 99% identity but less than 100% identity to a corresponding native or endogenous TCRa and / or TCRb chain.

[0343] In embodiments, the recombinant nucleic acid contains one or more modifications(s) to introduce one or more cysteine residues that are capable of forming one or more non-native disulfide bridges between the TCRa chain and TCRB chain. In embodiments, the one or more non-native cysteine residues are capable of forming non-native disulfide bonds, e.g., with a TCRa chain encoded by the transgene.

[0344] In embodiments, the transgene encodes all or a portion of a TCRa constant domain (Ca) and / or a TCRb constant domain (Cb) with one or more modifications to remove or prevent a native disulfide bond, e.g., between the TCRb chain encoded by the transgene and the endogenous TCRa chain. In embodiments, one or more native cysteines that form and / or are capable of forming a native interchain disulfide bond are substituted to another residue, e.g., serine or alanine. In embodiments, the portion of a TCRa constant domain (Ca) and / or a TCRb constant domain (Cb) is modified to replace one or more non-cysteine residues to a cysteine. Exemplary of modified encoded TCRa constant domain (Ca) and / or TCRb constant domain (Cb) include any of those described herein, for example, in Section III. A, and those described in W02006 / 000830, WO 2006 / 037960 and Kuball et al. (2007) Blood, 109:2331- 2338.

[0345] In embodiments, the TCRa constant region comprises 1, 2, 3, or 4 amino acid substitutions selected from P90S, E91D, S92V, and S93P according to SEQ ID NO: 592 In embodiments, the TCRa constant region comprises all four amino acid substitutions of P90S, E91D, S92V, and S93P according to SEQ ID NO: 592. In embodiments, the TCRP constant region comprises 1, 2, 3, 4, or 5 amino acid substitutions selected from E18K, S22A, F 1331, E136A, and Q139H according to SEQ ID NO: 593. In embodiments, the TCRP constant region comprises all five amino acid substitutions E18K, S22A, F133I, E136A, and Q139H according to SEQ ID NO: 593. In embodiments, these amino acid substitution(s) enhance the expression of a TCR (e.g., by supporting preferential pairing of transferred TCR chains and a more stable association with the CD3 proteins) and improve the function of the transduced T cells in comparison with cells with wildtype TCR constant regions. Further description ofCooley Ref. No.: MNBI-005 / 02WO 352505-2074 these paring enhancement mutations can be found, for example, in Sommermeyer and Uckert, J Immunol. 2010 Jun 1 ; 184(11):6223-31, the content of which is incorporated by reference in its entirety.

[0346] In embodiments, the TCRa transmembrane domain comprises 1, 2, or 3 amino acid substitutions corresponding to S2L, G5L and F6L in LSVIGFRILLLKVVGFNLLMT (SEQ ID NO: 596). In embodiments, the TCRa transmembrane region comprises all three amino acid substitutions corresponding to S2L, G5L and F6L in SEQ ID NO: 596. In embodiments, these amino acid substitution(s) enhance the surface expression of a TCR and improve the functional avidity of the resultant T cells. Further description of these mutations can be found, for example, in Haga-Friedman et al., J Immunol. 2012 Jun 1 ; 188(11):5538-46, the content of which is incorporated by reference in its entirety.

[0347] Among such recombinant TCRs or antigen-binding fragments thereof are TCRs or antigen-binding fragments thereof that contain any of the variable alpha (Va) regions and / or a variable beta (Vb) regions as described, individually, or a sufficient antigen-binding portion of such chain(s). In some embodiment, the provided recombinant TCRs comprise a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRb) chain comprising a variable beta (Vb) region. In embodiments, the variable region of the TCR alpha (TCRa) chain comprises a variable alpha (Va) region selected from those in Table 10 and / or disclosed in PCT / US2024 / 021425. In embodiments, the variable region of the TCR alpha (TCRb) chain comprises a variable alpha (Vb) region selected from those in Table 10 and / or disclosed in PCT / US2024 / 021425.

[0348] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 557. In embodiments, the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 558. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 557 and a variable region of the TCR P chain (Vb) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 558. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising or consisting of SEQ ID NO: 557 and a variable region of the TCR P chain (Vb) comprising or consisting of SEQ ID NO: 558.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0349] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 559. In embodiments, the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 560. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 559 and a variable region of the TCR P chain (Vb) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 560. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising or consisting of SEQ ID NO: 559 and a variable region of the TCR P chain (Vb) comprising or consisting of SEQ ID NO: 560.

[0350] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 561. In embodiments, the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 562. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 561 and a variable region of the TCR P chain (Vb) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 562. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising or consisting of SEQ ID NO: 561 and a variable region of the TCR P chain (Vb) comprising or consisting of SEQ ID NO: 562.

[0351] In embodiments, the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 563. In embodiments, the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 564. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 563 and aCooley Ref. No.: MNBI-005 / 02WO 352505-2074 variable region of the TCR P chain (Vb) comprising an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 564. In embodiments, the TCR comprises a variable region of the TCR a chain (Va) comprising or consisting of SEQ ID NO: 563 and a variable region of the TCR P chain (Vb) comprising or consisting of SEQ ID NO: 564.

[0352] In embodiments, the variable region of the TCR a chain (Va) and / or the variable region of the TCR P chain (Vb) comprise an amino acid substitution at the amino acid position 44 according to the IMGT numbering. In embodiments, the amino acid substitution(s) improve pairing of desired chains. In embodiments, the variable region of the TCR a chain (Va) comprise an amino acid substitution selected from Q44R, Q44K, Q44D, and Q44E. In embodiments, the variable region of the TCR P chain (Vb) comprise an amino acid substitution selected from Q44R, Q44K, Q44D, and Q44E. In embodiments, the substituted amino acids at position 44 of Va and Vb have the opposite charges. In embodiments, the variable region of the TCR a chain (Va) and the variable region of the TCR P chain (Vb) have the combination of amino acid substitutions selected from aQ44D / pQ44R, aQ44D / pQ44K, aQ44E / pQ44R, aQ44E / pQ44K, aQ44K / pQ44D, aQ44K / pQ44E, aQ44R / pQ44D, and aQ44R / pQ44E, according to IMGT numbering. In embodiments, the variable region of the TCR a chain (Va) and the variable region of the TCR P chain (Vb) have the combination of amino acid substitutions selected from aQ44R / pQ44D, aQ44D / pQ44K, and aQ44K / pQ44D, according to IMGT numbering. Further descriptions of such amino acid substitutions in the TCR variable domains can be found, for example, in US 2018 / 0162922, the content of which is incorporated by reference in its entirety.Table 10. Exemplary Anti-p53R175HsequencesCooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074Cooley Ref. No.: MNBI-005 / 02WO 352505-2074

[0353] In embodiments, the TCR or antigen-binding fragment thereof is isolated or purified or is recombinant. In particular embodiments, any of the provided TCR or antigenbinding fragment thereof is recombinant. In aspects, the TCR or antigen-binding fragment thereof is human. In embodiments, the recombinant TCR is monoclonal. In aspects, the recombinant TCR is a single chain. In embodiments, the recombinant TCR contains two chains. In embodiments, the TCR or antigen-binding fragment thereof is expressed on the surface of a cell.

[0354] Unless otherwise stated, the term “TCR” should be understood to encompass full TCRs as well as antigen-binding portions or antigen-binding fragments thereof. In embodiments, the TCR is an intact or full-length TCR, such as a TCR containing the a chain and b chain. In embodiments, the TCR is an antigen-binding portion that is less than a full- length TCR but that binds to a specific peptide bound in an MHC molecule, such as binds to an MHC-peptide complex. In embodiments, an antigen-binding portion or fragment of a TCR can contain only a portion of the structural domains of a full-length or intact TCR, but yet is able to bind the peptide epitope, such as MHC-peptide complex, to which the full TCR binds. In embodiments, an antigen-binding portion contains the variable domains of a TCR, such as variable a (Va) chain and variable b (Vb) chain of a TCR, or antigen-binding fragments thereof sufficient to form a binding site for binding to a specific MHC-peptide complex.

[0355] In embodiments, the variable domains of the TCR contain complementarity determining regions (CDRs), which generally are the primary contributors to antigen recognition and binding capabilities and specificity of the peptide, MHC and / or MHC-peptide complex. In embodiments, a CDR of a TCR or combination thereof forms all or substantially all of the antigen-binding site of a given TCR molecule. The various CDRs within a variableCooley Ref. No.: MNBI-005 / 02WO 352505-2074 region of a TCR chain generally are separated by frame...

Claims

1. Cooley Ref. No.: MNBI-005 / 02WO 352505-2074CLAIMS1. A recombinant nucleic acid encoding a chimeric antigen receptor (CAR) comprising a DLL3 binding region comprising (i) a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and (ii) a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprising SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426, wherein the CDRs are assigned according to the Kabat scheme; and wherein:(a) the CAR comprises a tag, wherein the tag comprises or consists of a peptide epitope or mimotope capable of being bound by an anti-CCR4 antibody; and / or(b) the recombinant nucleic acid comprises a nucleic acid sequence encoding a recombinant polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof.

2. The recombinant nucleic acid of claim 1, wherein the tag comprises an amino acid sequence of SEQ ID NO: 431.

3. The recombinant nucleic acid of claim 1, wherein the recombinant polypeptide comprises an amino acid sequence having at least 90%, at least 95%, or 100% identity to SEQ ID NO: 597 or 598.

4. The recombinant nucleic acid of claim 1, wherein (a) the CAR comprises the tag; and (b) the recombinant nucleic acid comprises the nucleic acid sequence encoding the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof.

5. The recombinant nucleic acid of claim 1, wherein the recombinant nucleic acid comprises, from 5’ to 3’, a left hand homology arm (LHA), the nucleic acid encoding the CAR and / or the nucleic acid encoding CAR and the recombinant polypeptide, and a right hand homology arm (RHA), and wherein the length of the LHA and RHA are each about 300 bp.Cooley Ref. No.: MNBI-005 / 02WO 352505-20746. The recombinant nucleic acid of claim 5, wherein the LHA comprises a nucleic acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 642, wherein the LHA has an A at postion 297 and a C at postion 300 of SEQ ID NO: 642.

7. The recombinant nucleic acid of claim 5, wherein the RHA comprises a nucleic acid sequence having at least 90%, at least 95%, or 100% identity to SEQ ID NO: 643.

8. A T cell, comprising the recombinant nucleic acid of claim 1 inserted into a TRAC locus.

9. The T cell of claim 8, wherein the T cell is a primary T cell.

10. The T cell of claim 8 or claim 9, wherein cell surface expression of endogenous T cell receptor (TCR) in the T cell is reduced or eliminated relative to a control cell.

11. The T cell of any one of claims 8-10, wherein the TRAC locus comprises (i) a T to A mutation at postion chrl4:22,547,690, (ii) a G to C mutation at chrl4:22,547,693, or (iii) a T to A mutation at postion chrl4:22,547,690 and a G to C mutation at chrl4:22,547,693.

12. A method of treating cancer in a subject in need thereof, comprising administering an effective amount of the cell of claim 8.

13. A recombinant polypeptide comprising a DLL3 binding region.

14. The recombinant polypeptide of claim 13, wherein the recombinant polypeptide is a chimeric antigen receptor (CAR).

15. The recombinant polypeptide of any one of claim 13 or claim 14, wherein:(a) the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 427, a CDRH2 comprising SEQ ID NO: 428, and a CDRH3 comprising SEQ ID NO: 429; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 424, a CDRL2 comprisingCooley Ref. No.: MNBI-005 / 02WO 352505-2074SEQ ID NO: 425, and a CDRL3 comprising SEQ ID NO: 426, wherein the CDRs are assigned according to the Kabat scheme; or(b) the DLL3 binding region comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (CDRH1) comprising SEQ ID NO: 580, a CDRH2 comprising SEQ ID NO: 581, and a CDRH3 comprising SEQ ID NO: 582; and / or wherein the DLL3 antigen binding region comprises a light chain variable region (VL) comprising a light chain CDR1 (CDRL1) comprising SEQ ID NO: 583, a CDRL2 comprising SEQ ID NO: 584, and a CDRL3 comprising SEQ ID NO: 585, wherein the CDRs are assigned according to the enhanced Chothia scheme.

16. The recombinant polypeptide of claim 15, wherein the VH comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 419, and / or the VL comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 415.

17. The recombinant polypeptide of any one of claims 14-16, wherein the CAR comprises, from N-terminus to C-terminus, the binding region, a hinge region, a transmembrane region, and an intracellular region.

18. The recombinant polypeptide of claim 17, wherein the hinge region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 420.

19. The recombinant polypeptide of claim 17 or claim 18, wherein the transmembrane region region comprises a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 421.

20. The recombinant polypeptide of any one of claims 17-19, wherein the intracellular region comprises an intracellular signaling domain derived from 4- IBB and / or an intracellular signaling domain derived from CD3zeta; optionally, the intracellular region comprises, from N-term to C-term, the intracellular signaling domain derived from 4- IBB and the intracellular signaling domain derived from CD3zeta.Cooley Ref. No.: MNBI-005 / 02WO 352505-207421. The recombinant polypeptide of any one of claims 17-20, wherein the intracellular region comprises the intracellular signaling domain derived from 4-1BB comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 422.

22. The recombinant polypeptide of any one of claims 17-20, wherein the intracellular region comprises the intracellular signaling domain derived from CD3zeta comprising a polypeptide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 423.

23. The recombinant polypeptide of any one of claims 14-22 wherein the CAR comprises a hinge region comprising SEQ ID NO: 420, a transmembrane region comprising SEQ ID NO: 421, and an intracellular signaling region comprising SEQ ID NOs: 422 and 423.

24. The recombinant polypeptide of any one of claims 14-23, wherein the CAR comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 597 and 598.

25. A recombinant polypeptide comprising (i) a T cell receptor (TCR) having antigenic specificity for an antigen derived from human p53 protein, or (ii) an antigen-binding fragment thereof; optionally, wherein the TCR or the antigen-binding fragment thereof has antigenic specificity for a human p53R175Hamino acid sequence.

26. The recombinant polypeptide of claim 25 wherein:(a) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO:

527. a CDRa2 comprising SEQ ID NO: 528, and a CDRa3 comprising SEQ ID NO: 529; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 530, a CDRb2 comprising SEQ ID NO: 531, and a CDRb3 comprising SEQ ID NO: 532; orCooley Ref. No.: MNBI-005 / 02WO 352505-2074(b) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 533, a CDRa2 comprising SEQ ID NO: 534, and a CDRa3 comprising SEQ ID NO: 535; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 536, a CDRb2 comprising SEQ ID NO: 537, and a CDRb3 comprising SEQ ID NO: 538; or(c) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain comprising a complementarity determining region 1 (CDRal) comprising SEQ ID NO: 539, a CDRa2 comprising SEQ ID NO: 540, and a CDRa3 comprising SEQ ID NO: 541; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 542, a CDRb2 comprising SEQ ID NO: 543, and a CDRb3 comprising SEQ ID NO: 544; or(d) the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR a chain complementarity determining region 1 (CDRal) comprising SEQ ID NO: 545, a CDRa2 comprising SEQ ID NO: 546, and a CDRa3 comprising SEQ ID NO: 547; and / or wherein the TCR or the antigen-binding fragment thereof comprises a variable region of a TCR P chain comprising a complementarity determining region 1 (CDRbl) comprising SEQ ID NO: 548, a CDRb2 comprising SEQ ID NO: 549, and a CDRb3 comprising SEQ ID NO: 550; or(e) the variable region of the TCR a chain (Va) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 557, and / or wherein the variable region of the TCR P chain (Vb) comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 558.

27. The recombinant polypeptide of any one of claims 13-26, further comprising a tag, wherein the tag comprises or consists of a peptide epitope or a mimotope that mimics an epitope, and wherein the peptide epitope or mimotope is capable of being bound by a monoclonal antibody.Cooley Ref. No.: MNBI-005 / 02WO 352505-207428. The recombinant polypeptide of claim 27, wherein the peptide epitope or mimotope is capable of being bound by an anti-CCR4 antibody; optionally, wherein the anti-CCR4 antibody is mogamulizumab.

29. The recombinant polypeptide of claim 27 or claim 28, wherein the peptide epitope is a modified peptide epitope, and wherein the modified peptide epitope comprises or consists of any one of SEQ ID NO: 430-438; preferably, the modified peptide epitope consists of SEQ ID NO: 431.

30. The recombinant polypeptide of any one of claims 27-29, wherein the peptide epitope or mimotope is located in an extracellular region of the recombinant polypeptide.

31. The recombinant polypeptide of any one of claims 27-29, wherein the peptide epitope or mimotope is located within the binding domain or the antigen-binding fragment of the CAR or T cell receptor.

32. The recombinant polypeptide of any one of claims 27-29, wherein the peptide epitope or mimotope is located between the VL and the VH, or the variable region of a TCR a chain and the variable region of TCR P chain.

33. The recombinant polypeptide of any one of claims 27-29, wherein the DLL3 binding region comprises an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical, or 100% identical to SEQ ID NO: 627.

34. A recombinant nucleic acid encoding the recombinant polypeptide of any one of claims 13-33.

35. The recombinant nucleic acid of claim 34 wherein the polynucleotide sequence encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 649.

36. The recombinant nucleic acid of claim 34 or claim 35, wherein the recombinant nucleic acid further comprises a polynucleotide sequence encoding a second recombinantCooley Ref. No.: MNBI-005 / 02WO 352505-2074 polypeptide comprising a caspase-associated recruitment domain (CARD) containing protein or a functional fragment thereof.

37. The recombinant nucleic acid of claim 36, wherein the CARD containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622- 716 of SEQ ID NO: 2.

38. The recombinant nucleic acid of claim 36 or 37, wherein the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150.

39. The recombinant nucleic acid of any one of claims 36-38, wherein the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-4; preferably, the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2.

40. The recombinant nucleic acid of any one of claims 36-39, wherein the polynucleotide sequence encoding the CARD containing protein comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 647.

41. The recombinant nucleic acid of any one of claims 34-40, wherein the recombinant nucleic acid further comprises one or more polynucleotide sequences encoding one or more cleavable linkers, optionally wherein the one or more cleavable linkers comprise a P2A, E2A, F2A, or T2A self-cleaving peptide.

42. The recombinant nucleic acid of claim 41, wherein the self-cleaving peptide comprises a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to any one of SEQ ID NO: 376-379.Cooley Ref. No.: MNBI-005 / 02WO 352505-207443. A recombinant nucleic acid comprising, from 5’ to 3’:(1) a cleavable linker encoding sequence,(2) a polynucleotide sequence encoding the recombinant polypeptide of any one of claims 13- 33,(3) a cleavable linker encoding sequence,(4) a polynucleotide sequence encoding a CARD-containing protein or a functional fragment thereof, and(5) a cleavable linker encoding sequence.

44. The recombinant nucleic acid of claim 43, wherein the CARD-containing protein comprises (i) a CARD domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 11-103 of SEQ ID NO: 2 and (ii) a Src Homology region 2 (SH2) domain comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to amino acids 622- 716 of SEQ ID NO: 2.

45. The recombinant nucleic acid of claim 43 or 44, comprising a polynucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 652.

46. The recombinant nucleic acid of any one of claims 43-45, wherein the cleavable linker comprises a P2A self-cleaving peptide comprising the amino acid sequence of SEQ ID NO: 377.

47. A vector comprising the recombinant nucleic acid of any one of claims 34-46.

48. The vector of claim 47, wherein the vector is a viral vector.

49. The vector of claim 48, wherein the viral vector is an adeno-associated virus (AAV) vector.

50. The vector of claim 49, wherein the AAV vector is an AAV6 vector.

51. The vector of claim 49 or 50, wherein the AAV vector comprises two homology arms flanking the nucleic acid encoding the recombinant polypeptide and / or the CARD-Cooley Ref. No.: MNBI-005 / 02WO 352505-2074 containing protein or a functional fragment thereof, and wherein the length of at least one of the two homology arms is about 225 bp, about 250 bp, about 275 bp, about 300 bp, or about 325 bp.

52. The vector of claim 51, wherein the lengths of both of the homology arms about 300 bp.

53. The vector of claim 51 or claim 52, wherein the homology arm 5’ to the nucleic acid encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 642; optionally, wherein the homology arm has an A at postion 297 and a C at postion 300 of SEQ ID NO: 642.

54. The vector of any one of claims 51-53, wherein the homology arm 3’ to the nucleic acid encoding the recombinant polypeptide comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 643.

55. The recombinant nucleic acid of any one of claims 34-46 or the vector of any one of claims 47-54, wherein the recombinant nucleic acid is less than 4.8 kb in length.

56. The recombinant nucleic acid of any one of claims 34-46 or the vector of any one of claims 47-54, wherein the recombinant nucleic acid is less than 4.5 kb in length.

57. A particle comprising the recombinant nucleic acid or vector of any one of claims 34-56.

58. The particle of claim 57, wherein the particle is an AAV viral particle.

59. An engineered cell, wherein the engineered cell (i) comprises the recombinant nucleic acid of any one of claims 34-46 or (ii) is transfected or transduced by the vector of any one of claims 47-54, or (iii) expressing the recombinant polypeptide of any one of claims 13- 33.Cooley Ref. No.: MNBI-005 / 02WO 352505-207460. The engineered cell of claim 59, expressing the chimeric antigen receptor (CAR) comprising the DLL3 binding region.

61. The engineered cell of claim 59 or 60, expressing the recombinant polypeptide comprising the caspase-associated recruitment domain (CARD) containing protein or the functional fragment thereof, wherein cell surface expression of the endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

62. The engineered cell of any one of claims 59-61, wherein the recombinant nucleic acid encodes the caspase-associated recruitment domain (CARD) containing protein comprising a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 1-150.

63. The engineered cell of any one of claims 59-62, wherein the recombinant nucleic acid encodes the caspase-associated recruitment domain (CARD) containing protein comprising a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4; optionally, the CARD containing protein comprises a sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2.

64. The engineered cell of any one of claims 59-63, wherein the recombinant nucleic acid encodes a CAR comprising a sequence at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 597 or 598.

65. The engineered cell of any one of claims 59-64, wherein expression of the recombinant polypeptide is under the control of an endogenous promoter.

66. The engineered cell of claim 65, wherein the endogenous promoter controls expression of TRAC in a non-engineered cell that the engineered cell is derived from.Cooley Ref. No.: MNBI-005 / 02WO 352505-207467. The engineered cell of any one of claims 59-66, wherein the nucleic acid is inserted in a T-cell receptor (TCR) alpha (TRA) locus.

68. The engineered cell of claim 67, wherein the TRA locus is a TRAC locus.

69. The engineered cell of claim 68 , wherein the TRAC locus is a TRAC exon 1 locus.

70. The engineered cell of any one of claims 59-69, wherein the nucleic acid is inserted in the region of chrl4:22, 547, 677-22, 547, 696 according to GRCh38 / hg38.

71. The engineered cell of any one of claim 59-70, wherein the engineered cell comprises a genomic mutation corresponding to (i) a T to A mutation at postion chrl4:22,547,690, according to GRCh38 / hg38, (ii) a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38, or (iii) a T to A mutation at postion chrl4:22,547,690 and a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38.

72. The engineered cell of any one of claims 59-71, wherein cell surface expression of an endogenous T cell receptor (TCR) is reduced or eliminated relative to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, a cell with unmodified expression of the endogenous TCR, or a cell comprising an intact TCRalpha, TCRbeta, and / or CD3zeta encoding genomic region.

73. The engineered cell of any one of claims 59-72, wherein the cell is a T cell.

74. The engineered cell of any one of claims 59-73, wherein the cell is a human cell.

75. The engineered cell of any one of claims 59-74, wherein the cell has reduced exhaustion, increased proliferative capacity, enhanced replicative lifespan, decreased replicative senescence, enhanced anti-tumor effect, enhanced tissue resident memory T cell phenotype, reduced dysfunction, enhanced persistence, and / or increase intratumoral presence in vivo.

76. The engineered cell of any one of claims 59-75, wherein the cell, or a population of the cells, expresses one or more of GPR25, CD27, and CCL5 at a level that is at least 1.5-fold greater, at least 2-fold greater, at least 2.5-fold greater, at least 3-fold greater, at least 3.5-foldCooley Ref. No.: MNBI-005 / 02WO 352505-2074 greater, at least 4-fold greater, at least 4.5-fold greater, or at least 5-fold greater compared to a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell comprising a recombinant nucleic acid encoding a TGFbR2-DNR.

77. The engineered cell of any one of claims 59-76, wherein, upon stimulation of an antigen, the cell, or a population of the cells, expresses:(a) one or more of AK4, P4HA2, PPFIA4, VLDLR, LDHA, MIR210HG, PGK1, TPI1, PGAM1, CXCL10, CXCR4, VEGFA, AIF1, ATF3, MKI67, ICOS, CD69, EBI3, IL2RA, P2RY14, SELL, and CAPG at a level that is greater compared to a control cell; and / or(b) one or more of ATM, PHC3, EOMES, FOXP1, and TOX at a level that is lower compared to a control cell; optionally, wherein the control cell is a wildtype cell, an unmodified cell, or a cell that does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof; optionally, wherein the control cell is a cell that expresses the CAR, but does not express the recombinant polypeptide comprising the CARD containing protein or the functional fragment thereof78. The engineered cell of any one of claims 76-77, wherein the level is mRNA expression level; optionally, wherein the mRNA expression level is determined by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR), PCR, RNAseq, microarray, gene chip, nCounter Gene Expression Assay, Serial Analysis of Gene Expression (SAGE), Rapid Analysis of Gene Expression (RAGE), nuclease protection assays, Northern blotting, nucleic acid hybridization, or any other equivalent gene expression detection techniques.

79. The engineered cell of any one of claims 76-77, wherein the level is protein expression level; optionally, wherein the protein expression level is determined by antibody - based testing, immunoassay, radioimmunoassay (RIA), immunohistochemistry, immunofluorescence, chemiluminescence, phosphorescence, proteomics techniques, surface plasmon resonance (SPR), mass spectrometry, protein microarray, or any other equivalent protein expression detection techniques.Cooley Ref. No.: MNBI-005 / 02WO 352505-207480. The engineered cell of any one of claims 59-79, wherein the cell, or the population of the cells, expresses AK4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

81. The engineered cell of any one of claims 59-80, wherein the cell, or the population of the cells, expresses P4HA2 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

82. The engineered cell of any one of claims 59-81, wherein the cell, or the population of the cells, expresses PPFIA4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

83. The engineered cell of any one of claims 59-82, wherein the cell, or the population of the cells, expresses VLDLR at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

84. The engineered cell of any one of claims 59-83, wherein the cell, or the population of the cells, expresses LDHA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

85. The engineered cell of any one of claims 59-84, wherein the cell, or the population of the cells, expresses MIR210HG at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

86. The engineered cell of any one of claims 59-85, wherein the cell, or the population of the cells, expresses PGK1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-207487. The engineered cell of any one of claims 59-86, wherein the cell, or the population of the cells, expresses TPI1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

88. The engineered cell of any one of claims 59-87, wherein the cell, or the population of the cells, expresses PGAM1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

89. The engineered cell of any one of claims 59-88, wherein the cell, or the population of the cells, expresses CXCL10 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

90. The engineered cell of any one of claims 59-89, wherein the cell, or the population of the cells, expresses CXCR4 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

91. The engineered cell of any one of claims 59-90, wherein the cell, or the population of the cells, expresses VEGFA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

92. The engineered cell of any one of claims 59-91, wherein the cell, or the population of the cells, expresses AIF1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

93. The engineered cell of any one of claims 59-92, wherein the cell, or the population of the cells, expresses ATF3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-207494. The engineered cell of any one of claims 59-93, wherein the cell, or the population of the cells, expresses MKI67 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

95. The engineered cell of any one of claims 59-94, wherein the cell, or the population of the cells, expresses P2RY14 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

96. The engineered cell of any one of claims 59-95, wherein the cell, or the population of the cells, expresses ICOS at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

97. The engineered cell of any one of claims 59-96, wherein the cell, or the population of the cells, expresses CD69 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

98. The engineered cell of any one of claims 59-97, wherein the cell, or the population of the cells, expresses EBI3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

99. The engineered cell of any one of claims 59-98, wherein the cell, or the population of the cells, expresses IL2RA at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

100. The engineered cell of any one of claims 59-99, wherein the cell, or the population of the cells, expresses CAPG at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074101. The engineered cell of any one of claims 59-100, wherein the cell, or the population of the cells, expresses ATM at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.

102. The engineered cell of any one of claims 59-101, wherein the cell, or the population of the cells, expresses PHC3 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.

103. The engineered cell of any one of claims 59-102, wherein the cell, or the population of the cells, expresses EOMES at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.

104. The engineered cell of any one of claims 59-103, wherein the cell, or the population of the cells, expresses SELL at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, greater compared to the control cell.

105. The engineered cell of any one of claims 59-104, wherein the cell, or the population of the cells, expresses FOXP1 at a level that is at least 1.5-fold, at least 2-fold, at least 2.5- fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.

106. The engineered cell of any one of claims 59-105, wherein the cell, or the population of the cells, expresses TOX at a level that is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold, lower compared to the control cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074107. A composition comprising the vector of any one of claims 47-54, the particle of any one of claims 57-58, or the engineered cell or the population of the engineered cells of any one of claims 59-106.

108. A method of preparing an engineered cell, wherein the method comprises contacting the cell with the recombinant nucleic acid of any one of claims 34-46, the vector of any one of claims 47-54, or the particle of any one of claims 57-58.

109. A method of preparing an engineered cell, wherein the method comprises expressing in the cell the recombinant polypeptide of any one of claims 13-33.

110. The method of any one of claims 108-109, wherein the cell is prepared in vivo.

111. The method of any one of claims 108-110, wherein the cell is prepared in the body of a subject in need of treatment.

112. The method of any one of claims 108-109, wherein the cell is prepared ex vivo or outside of the body of a subject in need of treatment.

113. The method of any one of claims 108-112, wherein the recombinant nucleic acid is introduced via an adeno-associated virus (AAV) vector.

114. The method of claim 113, wherein the AAV vector is an AAV6 vector.

115. The method of any one of claims 108-114, wherein the method comprises introducing into the cell (i) a Cas9 nuclease or a nucleic acid encoding the Cas9 nuclease and / or (ii) a sgRNA.

116. The method of claim 115, wherein the sgRNA comprises a polynucleotide sequence of AGAGCAACAGUGCUGUGGCC (SEQ ID NO: 520).

117. The method of any one of claims 108-115, wherein the recombinant nucleic acid is inserted into an endogenous locus of the cell.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074118. The method of claim 117, wherein the endogenous locus is or comprises a TRAC gene locus.

119. The method of any one of claism 108-118, wherein the recombinant nucleic acid is inserted between chrl4:22, 547, 677-22, 547, 696 according to GRCh38 / hg38.

120. The method of any one of claims 108-119, wherein the method thereby produces an engineered cell comprising: (i) the recombinant polypeptide; (ii) the immune receptor (e.g., CAR); and (iii) the modified TRAC gene locus.

121. The method of claim 120, wherein the modified TRAC gene locus comprises a mutation corresponding to (i) a T to A mutation at postion chrl4:22,547,690, according to GRCh38 / hg38, (ii) a G to C mutation at chrl4:22,547,693, according to GRCh38 / hg38, or (iii) a T to A mutation at postion chrl4:22,547,690 and a Gto C mutation at chrl4:22,547,693, according to GRCh38 / hg38.

122. A method of treating cancer in a subject in need thereof, comprising administering an effective amount of the recombinant nucleic acid of any one of claims 34-46, the vector of any one of claims 47-54, the particle of any one of claims 57-58, the engineered cell or the population of the engineered cells of any one of claims 59-106, or the composition of claim 107, to the subject.

123. The method of claim 122, wherein the subject is not administered a lymphodepletive agent within 7 days prior to administration of the recombinant nucleic acid, the vector, the particle, or the cell, or wherein the subject is not lymphodepleted at the time of the administration.

124. The method of any one of claims 122 or 123, wherein the subject is not administered cyclophosphamide, fludarabine, or bendamustine within 7 days prior to administration of the cell.

125. The method of any one of claims 122-124, wherein the cancer is small cell lung cancer (SCLC), neuroendocrine prostate cancer, or gastroenteropancreatic neuroendocrine tumor.Cooley Ref. No.: MNBI-005 / 02WO 352505-2074126. The method of any one of claims 122-125, wherein the cancer is a relapsed and / or refractory cancer.

127. The method of any one of claims 122-126, wherein the cancer expresses DLL3.

128. The method of any one of claims 122-127, wherein the method further comprises administering an antibody to the subject, wherein the antibody binds the tag.

129. A method of reducing or eliminating at least one symptom of an adverse event caused by the engineered cells of any one of claims 59-106 in a subject in need thereof, comprising administering to the subj ect an antibody that binds to a tag expressed on the surface of the engineered cells.

130. The method of claim 129, wherein the antibody is mogamulizumab.

Citation Information

Patent Citations

  • Anti-tissue factor monoclonal antibody

    US20160333113A1

  • Antibody molecules which bind CD79

    US20180201678A1

  • Antibody for neutralizing substance having coagulation factor viii (f.viii) function-substituting activity

    US20230183376A1

  • Compositions and methods for enhancing adoptive t cell therapeutics

    US20240165161A1

  • DLL3 targeting chimeric antigen receptors and binding agents

    WO2020180591A1