Polypeptide for promoting plant anthocyanin synthesis and use thereof
By point mutation of the R2 and/or R3 motifs of MYB transcription factors and optimization of gene expression, anthocyanin synthesis capacity was enhanced, the problem of low binding efficiency of MYB transcription factors was solved, and a significant increase in anthocyanin synthesis was achieved.
Patent Information
- Application Number
- PCT/CN2024/126043
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2024-10-21
- Publication Date
- 2026-03-26
AI Technical Summary
In existing technologies, the efficiency of MYB transcription factors in binding to DNA is limited, which means that the efficiency of anthocyanin biosynthesis needs to be improved.
By point mutations in the R2 and/or R3 motifs of the MYB transcription factor, its binding ability to the promoter of anthocyanin synthesis structural genes was enhanced, and an overexpression vector was constructed to express the optimized gene in plants, thereby promoting anthocyanin synthesis.
It significantly improved the biosynthetic capacity and accumulation of anthocyanins. The anthocyanin synthesis capacity of the mutant sequence was stronger than that of the wild type, especially the m2 mutation, which had the most significant effect.
Smart Images

Figure PCTCN2024126043-FTAPPB-I100001 
Figure 00000011_0000 
Figure 00000012_0000
Abstract
Description
Polypeptide for promoting anthocyanin synthesis in plants and application TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a polypeptide for promoting anthocyanin synthesis in plants and application. BACKGROUND
[0002] Anthocyanins are a class of bioactive flavonoids accumulated in different tissues and organs of plants and have different biological functions, such as attracting pollinators, protecting plants against ultraviolet rays and pests and diseases. In addition, anthocyanins have strong antioxidant and anti-mutagenic functions as plant nutrients and have important effects on human health.
[0003] Anthocyanin biosynthesis is mainly controlled by two types of genes, namely structural genes and regulatory genes. The structural genes encode enzymes directly involved in anthocyanin synthesis, including two important gene groups: the upstream gene group (CHS, CHI, F3H, F3'H) and the downstream gene group (DFR, LAR, ANS, LDOX, ANR, GT). The upstream genes usually encode related enzymes involved in the synthesis of orange ketones and other substances at the starting point of the pathway; the expression pattern of the downstream genes is significantly different from that of the upstream genes, and they mainly encode enzymes for synthesizing anthocyanins and proanthocyanidins. The main reason for this difference is that the functions of flavonoids are species and tissue specific. The regulatory genes mainly include three types of transcription factors, namely MYB, bHLH and WD40, which can form an MBW complex to bind to the promoters of structural genes for precise regulation. At present, overexpression of MYB transcription factors can improve the biosynthesis and accumulation of anthocyanins, but due to the limited efficiency of MYB transcription factors in binding to DNA, the efficiency of promoting anthocyanin biosynthesis needs to be improved.
[0004] SUMMARY
[0005] The present application provides a polypeptide for promoting anthocyanin synthesis in plants and application, which promotes anthocyanin synthesis in plants.
[0006] The present application provides a polypeptide for promoting anthocyanin synthesis in plants, which includes a mutation of a key site of a key domain for regulating anthocyanin synthesis.
[0007] In one specific embodiment of the present application, the key site of the key domain for regulating anthocyanin synthesis includes an R2 and / or R3 motif of a MYB transcription factor.
[0008] In one specific embodiment of the present application, the mutation includes a point mutation of one or more sites of an R2 and / or R3 motif of a MYB transcription factor.
[0009] The present application also provides a gene encoding the above-mentioned polypeptide.
[0010] The application also provides an optimized gene obtained by codon optimization of the above-mentioned gene with a target plant as a host.
[0011] The application also provides an overexpression vector containing the above-mentioned gene or the above-mentioned optimized gene and expressing the above-mentioned polypeptide.
[0012] The application also provides a recombinant engineering bacterium containing the above-mentioned overexpression vector.
[0013] The application also provides an application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector or the above-mentioned recombinant engineering bacterium in increasing the synthesis amount of anthocyanin of a plant.
[0014] The application also provides an application of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector or the above-mentioned recombinant engineering bacterium in creating an anthocyanin-accumulating plant germplasm.
[0015] The application also provides a method for creating an anthocyanin-accumulating hairy root, comprising the following steps: transforming the above-mentioned overexpression vector into Agrobacterium rhizogenes to obtain a recombinant Agrobacterium rhizogenes; and infecting a plant explant with the recombinant Agrobacterium rhizogenes and culturing to obtain an anthocyanin-accumulating hairy root.
[0016] Beneficial effects: the application provides a polypeptide for promoting the synthesis of anthocyanin of a plant, which comprises a mutation of a key site of a key domain for regulating the synthesis of anthocyanin. The application promotes the biosynthesis of anthocyanin by mutating and optimizing the key site of the existing sequence. The application can significantly improve the regulation ability of the transcription factor in the biosynthesis of anthocyanin by mutating the key amino acid site of the original sequence.
[0017] The application also constructs an overexpression vector based on the coding gene or the optimized gene of the polypeptide, and can significantly promote the accumulation amount of anthocyanin of a transgenic material by overexpressing the gene or the optimized gene in a plant cell. BRIEF DESCRIPTION OF DRAWINGS
[0018] FIG. 1 is a comparison diagram of a wild-type MYB transcription factor and a mutant sequence;
[0019] FIG. 2 is a comparison diagram of a wild-type MYB transcription factor and a m2 mutant sequence;
[0020] FIG. 3 is an HPLC result diagram of anthocyanin detected by referring to the method of NY / T 2640-2014;
[0021] FIG. 4 is a qPCR expression amount result diagram of M2 positive lines;
[0022] FIG. 5 is a PCR result diagram of M2 positive lines;
[0023] FIG. 6 is a diagram of anthocyanin accumulated in a hairy root of an Antirrhinum majus M2 mutant. DETAILED DESCRIPTION
[0024] The present application provides a polypeptide for promoting anthocyanin synthesis in plants, which comprises a mutation of a key site of a key domain for regulating anthocyanin synthesis.
[0025] In the present application, the major effective gene in the MBW protein complex is MYB, and some MYB transcription factors have the ability to regulate anthocyanin biosynthesis alone. MYB transcription factors with the ability to regulate anthocyanin biosynthesis are usually R2R3-type MYB transcription factors, and the R2R3 domain of which can bind to the promoter of anthocyanin synthesis structural genes to promote their transcription, thereby achieving the purpose of regulating their expression. In the present application, the R2R3 domain is artificially designed and modified to enhance its binding ability to the promoter, thereby further improving the anthocyanin synthesis ability.
[0026] In one specific embodiment of the present application, the key site of the key domain for regulating anthocyanin synthesis comprises the R2 and / or R3 motif of a MYB transcription factor, wherein the MYB transcription factor is Arabidopsis thaliana MYB75 (AT1G56650, NP_176057.1). One or more sites of the R2 and / or R3 motif of the MYB transcription factor are subjected to point mutations as shown in FIG. 1, wherein WT is the amino acid sequence of the wild-type MYB transcription factor, and m1 to m11 are mutated polypeptides obtained after point mutation, wherein m1 represents mutation of L at position 20 to R (L20R), m2 represents mutation of L at position 20 to K (L20K), m3 represents mutation of L at position 20 to F (L20F), m4 represents mutation of L at position 57 to F (L57F), m5 represents mutation of L at position 57 to R (L57R), m6 represents mutation of L at position 57 to K (L57K), m7 represents mutation of D at position 99 to K (D99K), m8 represents mutation of D at position 99 to F (D99F), m9 represents mutation of D at position 99 to W (D99W), m10 represents mutation of N at position 102 to W (N102W), and m11 represents mutation of L at position 22 to R, mutation of L at position 57 to K, and mutation of D at position 99 to K (L22R / L57K / D99K). After verification, it is found that the mutated sequences have stronger anthocyanin synthesis ability than the wild-type gene, and the synthesis ability of mutation m2 is the strongest.
[0027] In the specific embodiments of the present application, the major effective gene in the MBW protein complex is MYB, and some MYB transcription factors have the ability to regulate anthocyanin biosynthesis independently. The MYB transcription factors having the ability to regulate anthocyanin biosynthesis are usually R2R3-type MYB transcription factors, and the R2R3 domain of the MYB transcription factors can bind to the promoter of the anthocyanin biosynthesis structural gene to promote the transcription thereof, thereby achieving the purpose of regulating the expression thereof. In the present application, the R2R3 domain is artificially designed and modified to enhance the binding ability to the promoter, thereby further improving the anthocyanin biosynthesis ability.
[0028] The present application also provides a gene encoding the polypeptide.
[0029] The gene is not particularly limited in the present application, and can be translated based on the correspondence between the nucleotide sequence and the amino acid sequence.
[0030] The present application also provides an optimized gene obtained by codon optimization of the above-mentioned gene using a target plant as a host.
[0031] The optimized gene described in the present application is optimized based on the codon bias of the host, and the optimized gene of the m2 mutant polypeptide obtained after codon optimization has a nucleotide sequence as shown in SEQ ID No. 1 to SEQ ID No. 7, and of course can also be other more nucleotide sequences.
[0032] The present application also provides an overexpression vector containing the above-mentioned gene or the above-mentioned optimized gene and expressing the above-mentioned polypeptide.
[0033] The overexpression vector described in the present application, in one specific embodiment, is a pCAMBIA1301-based backbone vector, and the nucleic acid sequence optimized by codon is inserted into the backbone vector, thereby forming the above-mentioned overexpression vector. In the examples, the nucleic acid sequence optimized by codon is inserted into the linearized pCAMBIA1301 vector digested by BamH I.
[0034] The present application also provides a recombinant engineering bacterium containing the above-mentioned overexpression vector.
[0035] In one specific embodiment of the present application, Agrobacterium rhizogenes is used as a base strain, and the overexpression vector is transformed into the Agrobacterium rhizogenes, thereby obtaining a recombinant engineering bacterium.
[0036] The present application also provides the use of the above-mentioned gene, the above-mentioned optimized gene, the above-mentioned overexpression vector, or the above-mentioned recombinant engineering bacterium in improving the amount of anthocyanin synthesis in plants.
[0037] The recombinant engineering bacterium described in the present application can be used to transform plants by the method of Agrobacterium rhizogenes mediation, thereby promoting the amount of anthocyanin synthesis in the transformed plants.
[0038] The application also provides application of the gene, the optimized gene, the overexpression vector or the recombinant engineering bacteria in creating anthocyanin-accumulating plant germplasm.
[0039] In one specific embodiment of the application, the plant germplasm can be induced expression-generated hairy roots of Antirrhinum majus or Solanum lycopersicum. In one specific embodiment of the application, the plant germplasm can also be a genetically transformed plant.
[0040] The application also provides a method for creating anthocyanin-accumulating hairy roots, comprising the following steps: transforming the overexpression vector into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes; using the Agrobacterium rhizogenes to infect plant explants, and culturing to obtain anthocyanin-accumulating hairy roots.
[0041] In one specific embodiment of the application, the plant material can be Antirrhinum majus or Solanum lycopersicum, and the explants can be stems of Antirrhinum majus or cotyledons of Solanum lycopersicum. The application uses Agrobacterium rhizogenes bacterial solution to infect the plant explants, and after absorbing the excess bacterial solution, the plant explants are placed on a co-culture medium (MS basic medium + 30 g / L sucrose + 100 μM acetosyringone; 27°C, 60% humidity) for dark culture for 2 days; the bacteria are eluted, and after absorbing the water, the plant explants are placed on a bacteria-free medium (MS basic medium + 30 g / L sucrose + 200 mg / L timentin, 27°C, 60% humidity) for induction culture under dark conditions to obtain anthocyanin-accumulating hairy roots.
[0042] In order to further illustrate the application, the polypeptide for promoting anthocyanin synthesis of plants and the application provided by the application are described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.
[0043] In the examples of the application, the anthocyanin content is detected by HPLC according to the national standard method NY / T 2640-2014.
[0044] In the examples of the application, high-fidelity enzyme (Bao Biological Max DNA Polymerase); E. coli and Agrobacterium rhizogenes competent cells (Weidi Biology); Antirrhinum majus (collected in the wild); LB, TY and MS (Qingdao Haibo); acetosyringone and antibiotics (Merck Biology).
[0045] Example 1
[0046] 1. Obtaining and optimizing mutant sequences
[0047] According to the published amino acid sequence of MYB transcription factor R2R3 motif (AT1G56650, NCBI Reference Sequence: NP_176057.1), the mutated amino acid sequence was artificially designed (Fig. 1 and Fig. 2). The amino acid sequence was codon-optimized according to the codon bias of Antirrhinum majus and Solanum lycopersicum hosts, and the optimized nucleic acid sequence was obtained.
[0048] 2. Construction of overexpression vector
[0049] 2.1 Synthesis of the optimized nucleic acid sequence to obtain a template.
[0050] 2.2 Linearization of the vector
[0051] F (SEQ ID No. 8): ATGGAAGGATCTTCAAAAGGACTTCGAA;
[0052] R: (SEQ ID No. 9): ATCGAACTTGACAGTCTCCCCATC.
[0053] 50 μL reaction system: 50-100 ng of template, 2 μL of 10 μM upstream and downstream primers, 25 μL of Mix, and the rest of ddH2O;
[0054] PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 50 s, 72℃ extension for 1 kb / 5 s, 35 cycles; 72℃ final extension for 5 min; 4℃ holding.
[0055] After the PCR, agarose gel electrophoresis and gel recovery were performed.
[0056] 2.2 Linearization of the vector
[0057] The empty vector (pCAMBIA1301) was digested using restriction enzyme BamH I.
[0058] 50 μL digestion system: 1 μg of plasmid, 1 μL of BamH I enzyme, 5 μL of 10×buffer, and the rest of ddH2O.
[0059] After 37℃ constant temperature water bath digestion for 15 min, the sample was placed on ice, and 1.5% agarose gel electrophoresis was performed for recovery.
[0060] Gel recovery: the target fragment was recovered according to the instructions.
[0061] 2.3 Homologous recombination of the target fragment: the homologous recombination of the target fragment was performed according to the instructions
[0062] Calculation of the amount of vector fragment used:
[0063] The optimal amount of ClonExpress II recombinant reaction system is 0.03 pmol for the cloning vector and 0.06 pmol for the insert (mole ratio of vector to insert is 1:2). The corresponding DNA mass can be roughly calculated by the following formula:
[0064] Optimal amount of cloning vector = [0.02 x number of base pairs of cloning vector] ng (0.03 pmol)
[0065] Optimal amount of insert = [0.04 x number of base pairs of insert] ng (0.06 pmol)
[0066] For example, when an insert of 2 kb is cloned into a cloning vector of 5 kb, the optimal amount of cloning vector should be 0.02 x 5,000 = 100 ng, and the optimal amount of insert should be 0.04 x 2,000 = 80 ng.
[0067] Prepare 20 μL system on ice: linearized vector X μL, insert y μL, 5x buffer 2 μL, BamH I enzyme 1 μL, and the rest ddH2O;
[0068] Gently mix and centrifuge briefly to collect the reaction solution at the bottom of the tube. React at 37°C for 30 min; cool at 4°C or immediately on ice.
[0069] 3. Transform E. coli
[0070] Dissolve E. coli competent DH5a cells on ice; add 10 μL recombinant product to 100 μL competent cells, gently mix, stand on ice for 5 min, heat shock at 42°C for 45 sec, stand on ice for 2 min; add 700 μL LB liquid medium without antibiotics, shake at 37°C for 30 min; centrifuge at 2000 rpm for 2 min, discard the supernatant, resuspend the bacterial cells with the remaining medium, and spread on a plate containing kanamycin, and incubate for 14-18 h.
[0071] Colony positive clone identification: after overnight culture, use a gun head to pick a well-growing colony for positive clone PCR identification.
[0072] 25 μL PCR reaction system: template 1 μL, 10 μM upper and lower primers each 1 μL, Mix 12.5 μL, and the rest ddH2O; the sequences of the upper and lower primers are SEQ ID No. 8 and SEQ ID No. 9;
[0073] PCR amplification procedure: 98℃ pre-denaturation 5 min; 98℃ denaturation 30 s, 58℃ annealing 50 s, 72℃ extension 1 kb / 1 min, 35 cycles; 72℃ final extension 5 min; 4℃ holding.
[0074] After PCR, agarose gel electrophoresis was performed, and the colonies with clear bands and correct size were selected for expansion and sequencing.
[0075] 4. Plasmid extraction
[0076] The monoclonal with correct sequencing was expanded, and plasmid extraction was performed according to the instructions.
[0077] 5. Transformation of Agrobacterium rhizogenes
[0078] The Agrobacterium rhizogenes competent cells MSU440 were dissolved on ice; 10 μL plasmid was added to 100 μL competent cells, gently mixed, and incubated on ice for 5 min, liquid nitrogen for 5 min, 37℃ heat shock for 5 min, and ice for 5 min; 700 μL of antibiotic-free LB liquid medium was added, and the bacteria were shaken at 28℃ for 2-3 h; centrifuged at 6000 rpm for 6 min, the supernatant was discarded, and the bacteria were resuspended with the remaining medium and plated on plates containing the corresponding antibiotics, and incubated for 48-72 h.
[0079] Agrobacterium colony positive clone identification: the method was the same as above for E. coli colony positive clone identification. The results are shown in Figure 5.
[0080] 6. Anthocyanin-accumulating hairy root induction
[0081] The positive Agrobacterium strain was expanded, and the stems and cotyledon plant explants of Antirrhinum majus and Solanum lycopersicum were infected, respectively. After absorbing the excess bacteria solution, they were placed on co-culture medium (MS basic medium + 30 g / L sucrose + 100 μM acetosyringone, 27℃, 60% humidity) for dark culture for 2 days. After sterilization and elution, the water was absorbed and placed on the sterilization medium (MS basic medium + 30 g / L sucrose + 200 mg / L timentin, 27℃, 60% humidity) for 15 days of induction culture in dark conditions to obtain anthocyanin-accumulating hairy roots.
[0082] 7. Positive strain identification
[0083] DNA extraction: Take 0.1 g of hairy root material, wash with double distilled water, and dry with filter paper. Cut the plant material into 1 cm long sections, place them in a grinding tube with grinding beads, quickly place them in liquid nitrogen, and grind them into fine powder with a tissue grinder. Add 1 mL of CTAB extraction buffer and 1% β-mercaptoethanol to the grinding tube, and incubate at 65°C for 30 min, inverting and mixing every 5 min. After incubation, allow the sample to stand at room temperature for 2-3 min, and centrifuge at 10000 rpm for 5 min. Transfer the supernatant to a clean centrifuge tube, add 1 mL of chloroform, mix by vortexing, and centrifuge at 13000 rpm for 10 min. Transfer 900 μL of the supernatant to a clean centrifuge tube, add 900 μL of chloroform, vortex for 1 min, and centrifuge at 13000 rpm for 10 min. Transfer 600 μL of the supernatant to a clean centrifuge tube, add an equal volume of 8M LiCl, mix well, and precipitate at 4°C for 3 h. Centrifuge at 13000 rpm for 10 min, remove the supernatant, wash with 75% ethanol, centrifuge at 8000 rpm for 3 min, remove the supernatant, and repeat this step once. Dry the sample on a clean bench, resuspend the DNA with RNase-ddH2O, and determine the concentration and purity.
[0084] PCR identification: PCR verification was performed using the Agrobacterium rhizogenes marker genes RolA, RolB, RolC, RolD and the target gene. The reaction system and reaction procedure are shown in (3).
[0085] rolA-F (SEQ ID No. 10): ATGGAATTAGCCGGACTAAACG;
[0086] rolA-R (SEQ ID No. 11): TTAATCCCGTAGGTTTGTTTCGA;
[0087] rolB-F (SEQ ID No. 12): gcaggcttcatatcaccctcttcac;
[0088] rolB-R (SEQ ID No. 13): caccctcccatgcttgtcg;
[0089] rolC-F (SEQ ID No. 14): ggcggaatttgacctatgtgctc;
[0090] rolC-R (SEQ ID No. 15): ccattccaaatttgcattcgccat;
[0091] rolD-F (SEQ ID No. 16): ggctcgttatttcggcagtagc;
[0092] rolD-R (SEQ ID No. 17): ccaacaggaccttgccaattgc.
[0093] The results are shown in Figures 4 and 5. The gene expression of the obtained hairy root material with anthocyanin accumulation was detected, and the results showed that the mutant sequence promoted the accumulation of anthocyanin by increasing the expression of anthocyanin synthesis structural genes.
[0094] 8. Anthocyanin detection: Anthocyanin content HPLC detection was performed according to the national standard method
[0095] The results are shown in Figures 3 and 6. The hairy roots in the Antirrhinum majus m2 mutant can accumulate anthocyanin.
[0096] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. A polypeptide that promotes anthocyanin synthesis in a plant, characterized in that, The polypeptide is formed after mutating a key site of a key domain regulating anthocyanin synthesis.
2. The polypeptide of claim 1, wherein, The key site of the key domain regulating anthocyanin synthesis comprises an R2 and / or R3 motif of a MYB transcription factor.
3. The polypeptide of claim 2, wherein, The mutation comprises a point mutation to one or more sites of the R2 and / or R3 motif of the MYB transcription factor.
4. The polypeptide of claim 3, wherein, The MYB transcription factor is derived from Arabidopsis thaliana, gene ID AT1G56650.
5. The polypeptide of claim 4, wherein, The point mutation comprises one or more of the following: mutating L at position 20 to R, K or F; mutating L at position 57 to F, R or K; mutating D at position 99 to K, F or W; mutating N at position 102 to W.
6. A gene encoding the polypeptide of any one of claims 1-5.
7. An optimized gene obtained by codon optimization of the gene of claim 6 in a host plant.
8. The optimized gene of claim 7, wherein, The host plant comprises Antirrhinum majus or Solanum lycopersicum.
9. The optimized gene of claim 7, wherein, The optimized gene comprises a nucleotide sequence as shown in any one of SEQ ID No. 1-7.
10. An overexpression vector comprising the gene of claim 6 or the optimized gene of any one of claims 7-9 and expressing the polypeptide of any one of claims 1-5.
11. The method for constructing the overexpression vector according to claim 10, wherein, The overexpression vector is obtained by inserting the gene of claim 6 or the optimized gene of any one of claims 7-9 into a linearized basic backbone vector.
12. The method of construction according to claim 11, wherein, The basic backbone vector comprises pCAMBIA1301.
13. The method of claim 11, wherein: The optimized gene is obtained by amplification, and a primer pair for amplifying the optimized gene comprises F with a nucleotide sequence as shown in SEQ ID No. 8 and R with a nucleotide sequence as shown in SEQ ID No.
9.
14. The method of construction according to claim 13, wherein, The amplification procedure comprises: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 30 s, annealing at 58℃ for 50 s, elongation at 72℃ for 1 kb / 5 s, 35 cycles; final elongation at 72℃ for 5 min; and keeping at 4℃.
15. The construction method according to any one of claims 12 to 14, characterized in that, The overexpression vector comprises connecting the amplification product to a linearized pCAMBIA1301 vector digested by BamH I.
16. A recombinant engineering bacterium comprising the overexpression vector of claim 10 or constructed by the construction method of any one of claims 11-15.
17. The recombinant engineering bacteria of claim 16, characterized in that, The basic strain of the recombinant engineering bacterium comprises Agrobacterium rhizogenes.
18. Use of the gene of claim 6, the optimized gene of any one of claims 7-9, the overexpression vector of claim 10, the overexpression vector constructed by the construction method of any one of claims 11-15, or the recombinant engineering bacterium of claim 16 or 17 in increasing the amount of anthocyanin synthesis in a plant.
19. Use of the gene of claim 6, the optimized gene of any one of claims 7-9, the overexpression vector of claim 10, the overexpression vector constructed by the construction method of any one of claims 11-15, or the recombinant engineering bacterium of claim 16 or 17 in creating an anthocyanin-accumulating plant germplasm.
20. A method of creating a hairlike root that accumulates anthocyanins, characterized in that, The method comprises the following steps: transforming Agrobacterium rhizogenes with the overexpression vector of claim 10 or the overexpression vector constructed by the construction method of any one of claims 11-15 to obtain recombinant Agrobacterium rhizogenes; infecting plant explants with the recombinant Agrobacterium rhizogenes, and culturing to obtain anthocyanin-accumulating hairy roots.
21. The method of claim 20, wherein, The plant explants comprise stems or cotyledons of Antirrhinum majus or Solanum lycopersicum.
22. The method of claim 20 or 21, wherein, The culturing comprises dark culturing on a co-cultivation medium for 2 days; performing a bacteria-removing elution, and then placing the elution on a bacteria-removing medium for induction culturing under dark conditions after water absorption; The co-cultivation medium is an MS medium as a base medium, and further comprises 30 g / L sucrose and 100 μM acetosyringone. The bacteria-removing medium is an MS medium as a base medium, and further comprises 30 g / L sucrose and 200 mg / L timentin.
23. The method of claim 22, wherein, The temperature of the culturing is 27°C, and the relative humidity is 60%.
Citation Information
Patent Citations
Transgenic method for improving salvianolic acid B content in root of red-rooted salvia
CN102061297A
Anthocyanin synthesis regulation transcription factor and application thereof
CN111909249A
Strawberry MYB10AG-insert gene and application thereof
CN113186196A
MYB transcription factor for regulating and controlling synthesis of plant procyanidine as well as coding gene and application of MYB transcription factor
CN113845578A
Transgenic plants for enhancing anthocyanin biosynthesis
US20170211079A1