Anti-tetanus toxin antibody and use thereof
By optimizing the amino acid sequences of the heavy and light chain variable regions of the anti-tetanus toxin neutralizing antibody, a high-affinity and high-specificity antibody was developed, solving the problems of short half-life and high safety risks of existing formulations. This provides a safer and lower-cost passive immunization agent that meets clinical needs.
Patent Information
- Application Number
- PCT/CN2025/122527
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2025-09-19
- Publication Date
- 2026-03-26
AI Technical Summary
Existing tetanus passive immunization agents have problems such as short half-life, limited sources, high safety risks, and high cost, which cannot meet clinical needs.
A tetanus toxin neutralizing antibody with high affinity and specificity has been developed. By optimizing the amino acid sequences of the complementarity-determining regions (HCDR and LCDR) of the heavy and light chain variable regions, the adverse reactions of animal-derived monoclonal antibodies are avoided, providing a safer and lower-cost passive immunization agent.
This study achieved highly efficient neutralization of tetanus toxin with antibodies, reduced the risk of side effects, improved safety and feasibility for industrial production, and met clinical needs.
Smart Images

Figure CN2025122527_26032026_PF_FP_ABST
Abstract
Description
Anti-tetanus toxin antibodies and uses thereof TECHNICAL FIELD
[0001] The present disclosure belongs to the field of immunology and genetic engineering, and particularly relates to anti-tetanus toxin antibodies and uses thereof. BACKGROUND
[0002] Tetanus is a potentially fatal disease, which is a bacterial infection caused by Clostridium tetani. Clostridium tetani is widely present in the natural environment. Clostridium tetani invades the human body through skin or mucosal breaks, multiplies in an anaerobic environment and produces exotoxin, causing an acute and toxic disease characterized by sustained rigidity and paroxysmal convulsions of skeletal muscles throughout the body. Severe patients can develop laryngeal spasm, asphyxia, pulmonary infection and organ failure. Without medical intervention, the mortality rate of severe patients is close to 100%, and even after active comprehensive treatment, the mortality rate worldwide is still 30% to 50%.
[0003] The passive immunization preparations currently used in clinical practice to prevent and treat tetanus mainly include tetanus antitoxin (TAT), equine tetanus immunoglobulin F(ab')2 and human tetanus immunoglobulin (HTIG). However, the above passive immunization preparations have great defects: HTIG is a blood product, which has limited sources and supply, and has potential risks of blood-borne diseases; TAT and F(ab')2 have short half-lives in the human body, require higher injection doses than HTIG, and have safety risks of allergic reactions and even blood diseases. There is an urgent need in clinical practice for passive immunization preparations for tetanus that are safer, less costly and can be produced industrially. SUMMARY
[0004] To solve at least one of the above problems, the present disclosure provides an anti-tetanus toxin neutralizing antibody and uses thereof. The neutralizing antibody provided by the present disclosure has the advantages of high affinity, high specificity and small toxic side effects, and at the same time avoids the defects of large adverse reactions of animal-derived monoclonal antibodies.
[0005] According to one aspect of the present disclosure, there is provided an anti-tetanus toxin neutralizing antibody or an antigen-binding fragment thereof, comprising: (1) the following 3 heavy chain variable region complementarity determining regions (HCDRs): a HCDR1 having an amino acid sequence of a HCDR1 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR1 contained in the heavy chain variable region; a HCDR2 having an amino acid sequence of a HCDR2 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR2 contained in the heavy chain variable region; a HCDR3 having an amino acid sequence of a HCDR3 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR3 contained in the heavy chain variable region; and / or, (2) the following 3 light chain variable region complementarity determining regions (LCDRs): a LCDR1 having an amino acid sequence of a LCDR1 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR1 contained in the light chain variable region; a LCDR2 having an amino acid sequence of a LCDR2 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR2 contained in the light chain variable region; a LCDR3 having an amino acid sequence of a LCDR3 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR3 contained in the light chain variable region.
[0006] In some embodiments, the CDRs are defined by any numbering system routinely used by those skilled in the art. Exemplary numbering systems include, but are not limited to, Kabat, AbM, Chothia, Contact, IMGT, or a combination thereof.
[0007] In some embodiments, the antibody or antigen-binding fragment thereof comprises: the 3 HCDRs contained in the heavy chain variable region set forth in SEQ ID NO: 7, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the 3 LCDRs contained in the light chain variable region set forth in SEQ ID NO: 8, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.
[0008] In some embodiments, the antibody or antigen-binding fragment thereof comprises: the 3 HCDRs contained in the heavy chain variable region set forth in SEQ ID NO: 15, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the 3 LCDRs contained in the light chain variable region set forth in SEQ ID NO: 16, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.
[0009] In some embodiments, the antibody or antigen-binding fragment thereof comprises: the 3 HCDRs contained in the heavy chain variable region set forth in SEQ ID NO: 23, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the 3 LCDRs contained in the light chain variable region set forth in SEQ ID NO: 24, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.
[0010] In some embodiments, the antibody or antigen-binding fragment thereof comprises: 3 HCDRs contained in a heavy chain variable region set forth in SEQ ID NO: 28, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and 3 LCDRs contained in a light chain variable region set forth in SEQ ID NO: 29, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.
[0011] In some embodiments, the antibody or antigen-binding fragment thereof comprises: 3 HCDRs contained in a heavy chain variable region set forth in SEQ ID NO: 36, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and 3 LCDRs contained in a light chain variable region set forth in SEQ ID NO: 37, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the 3 LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.
[0012] In some embodiments, the antibody or antigen-binding fragment thereof comprises: (1) 3 heavy chain variable region complementarity determining regions (HCDRs) as follows: a HCDR1 having an amino acid sequence as set forth in Formula (1) as follows: X1X2X3X4X5, wherein X1is selected from S, G, or H, X2is selected from S or Y, X3is selected from G or Y, X4is selected from V, W, or M, X5is selected from V, S, or H; a HCDR2 having an amino acid sequence as set forth in Formula (2) as follows: X1IX2X3YX4GX5X6X7X8YX9X 10 X 11 X 12 X 13 X 14 X9, wherein X1is selected from W, Y, G, X2is selected from S, W, F, or Y, X3is selected from T or absent, X4is selected from N, D, G, X5is selected from S or absent, X6is selected from N, K, or absent, X7is selected from T or K, X8is selected from Y, D, N, or H, X9is selected from S, N, A, or D, X 10 X10is selected from K, P, or D, X 11 X11is selected from K or S, X 12 X12is selected from V, L, or A, X 13 X13is selected from Q, K, or R, X 14selected from D, S, or G; a HCDR3 that has an amino acid sequence as shown in the general formula (3) X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 FX 13 X 14 wherein X1is selected from G, D, E, or R, X2is selected from G, K, A, or S, X3is selected from Y, L, or S, X4is selected from D, M, C, or absent, X5is selected from S, T, or G, X6is selected from S or absent, X7is selected from G, A, or absent, X8is selected from Y, R, or absent, X9is selected from S, G, C, or absent, X 10 is selected from H, F, or absent, X 11 is selected from D or absent, X 12 is selected from V, R, or A, X 13 is selected from D or E, X 14 is selected from V, I, F, or L; and / or, (2) the following three light chain variable region complementarity determining regions (LCDRs): a LCDR1 that has an amino acid sequence as shown in the general formula (4) X1X2X3X4X5X6X7X8X9X 10 X 11 LX 12 X 13 wherein X1is selected from R or T, X2is selected from G or A, X3is selected from T or S, X4is selected from Q, S, or T, X5is selected from S, T, or A, X6is selected from I or D, X7is selected from S or V, X8is selected from T, S, D, or G, X9is selected from S, N, G, or absent, X 10 is selected from Y or absent, X 11 is selected from F, D, or absent, X 12 is selected from V, N, or A, X 13 is selected from S or absent; a LCDR2 that has an amino acid sequence as shown in the general formula (5) X1X2X3X4X5X6X7wherein X1is selected from G, A, E, or S, X2is selected from V or A, X3is selected from T or S, X4is selected from A, S, K, or G, X5is selected from L or R, X6is selected from Q, A, or P, X7is selected from S or T; a LCDR3 that has an amino acid sequence as shown in the general formula (6) X1X2X3YX4X5SX6X7X8TX9X 10 X 11 wherein X1is selected from Q or S, X2is selected from H, Q, or absent, X3is selected from A, S, or absent, X4is selected from H or absent, X5is selected from N or absent, X6is selected from P, G, or absent, X7is selected from R, I, or absent, X8is selected from V, S, or absent, X9is selected from L or absent, X 10 is selected from L, V, Y, or absent, X11 is selected from S or is absent.
[0013] In these embodiments, HCDR1-3 and LCDR1-3 are defined by the Kabat system.
[0014] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a HCDR1 having an amino acid sequence as shown in any one of SEQ ID NOs: 1, 9, 17, or 30, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a HCDR2 having an amino acid sequence as shown in any one of SEQ ID NOs: 2, 10, 18, 25, or 31, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a HCDR3 having an amino acid sequence as shown in any one of SEQ ID NOs: 3, 11, 19, or 32, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a LCDR1 having an amino acid sequence as shown in any one of SEQ ID NOs: 4, 12, 20, 26, or 33, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a LCDR2 having an amino acid sequence as shown in any one of SEQ ID NOs: 5, 13, 21, or 34, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a LCDR3 having an amino acid sequence as shown in any one of SEQ ID NOs: 6, 14, 22, 27, or 35, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto.
[0015] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a HCDR1, a HCDR2, and a HCDR3 as set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or a LCDR1, a LCDR2, and a LCDR3 as set forth in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
[0016] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a HCDR1, a HCDR2, and a HCDR3 as set forth in SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or a LCDR1, a LCDR2, and a LCDR3 as set forth in SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
[0017] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a HCDR1, a HCDR2, and a HCDR3 as set forth in SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or a LCDR1, a LCDR2, and a LCDR3 as set forth in SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of said LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
[0018] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 17, SEQ ID NO: 25, and SEQ ID NO: 19, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of the HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 26, SEQ ID NO: 21, and SEQ ID NO: 27, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of the LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
[0019] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 32, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of the HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of the LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
[0020] It is understood by those skilled in the art that the above-mentioned amino acid substitutions are conservative substitutions, and the substituted antibody or antigen-binding fragment thereof still has the activity of specifically binding to tetanus toxin.
[0021] In some embodiments, the heavy chain variable region of the antibody or antigen-binding fragment thereof further comprises a framework region of the heavy chain variable region.
[0022] In some embodiments, the framework region of the heavy chain variable region comprises a framework region of the heavy chain variable region derived from an immunoglobulin of a mouse, a primate, a bovine, a horse, a bovine, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck, or a goose, or a mutant thereof; further comprising a framework region of the heavy chain variable region derived from an immunoglobulin of a human, or a mutant thereof.
[0023] In some embodiments, the light chain variable region of the antibody or antigen-binding fragment thereof further comprises a framework region of the light chain variable region.
[0024] In some embodiments, the framework region of the light chain variable region comprises a framework region of a light chain variable region of an immunoglobulin derived from a murine, primate, bovine, equine, bovine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, mink, chicken, duck, or goose, or a mutant thereof; further comprising a framework region of a light chain variable region of an immunoglobulin derived from a human, or a mutant thereof.
[0025] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 7, 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or, a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 8, 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto.
[0026] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 7, 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 8, 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto.
[0027] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto.
[0028] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 23, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 24, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto.
[0029] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 28, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 29, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto.
[0030] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 36, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 37, an amino acid sequence with one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence with at least 80% sequence identity thereto.
[0031] In some embodiments, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region.
[0032] In some embodiments, the heavy chain constant region comprises at least a portion of a heavy chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, bovine, porcine, ovine, caprine, canine, feline, lagomorph, camelid, donkey, cervid, mink, chicken, duck, or goose, or a mutant thereof; further comprising at least a portion of a heavy chain constant region of an immunoglobulin derived from a human, or a mutant thereof.
[0033] In some embodiments, the light chain constant region comprises at least a portion of a light chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, bovine, porcine, ovine, caprine, canine, feline, lagomorph, camelid, donkey, cervid, mink, chicken, duck, or goose, or a mutant thereof; further comprising a light chain constant region of an immunoglobulin derived from a human, or a mutant thereof.
[0034] In some embodiments, the heavy chain constant region comprises a heavy chain constant region derived from IgAl, IgA2, IgD, IgE, IgGl, IgG2, IgG3, IgG4, or IgM immunoglobulin.
[0035] In some embodiments, the light chain constant region comprises a light chain constant region derived from kappa and lambda type immunoglobulin.
[0036] In some embodiments, the antibody or antigen-binding fragment thereof is a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody; further a fully human antibody.
[0037] In some embodiments, the antibody or antigen-binding fragment can be, but is not limited to, IgA, IgD, IgE, IgG, or IgM type.
[0038] In some embodiments, the light chain of the antibody or antigen-binding fragment comprises a kappa light chain or a lambda light chain.
[0039] In some embodiments, the antibody or antigen-binding fragment can be of IgG type, for example, can be of IgGl, IgG2, IgG3, or IgG4 type.
[0040] In some embodiments, the antibody or antigen-binding fragment comprises, but is not limited to, scFv, Fab, Fab', (Fab')2, Fv fragment, dsFv, linear antibody, bispecific antibody, and multispecific antibody.
[0041] In some embodiments, the antibody or antigen-binding fragment comprises, but is not limited to, murine antibody, chimeric antibody, humanized antibody, or fully human antibody.
[0042] According to yet another aspect of the present disclosure, there is provided a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof.
[0043] In some embodiments, the nucleic acid molecule encodes an antibody heavy chain variable region.
[0044] In some embodiments, the nucleic acid molecule has a nucleotide sequence as set forth in SEQ ID NO: 38, 40, 42, 44, 46, or a nucleotide sequence with substitution, deletion, or addition of one or several nucleotides compared with the nucleotide sequence, or a nucleotide sequence with at least 75% sequence identity thereto.
[0045] In some embodiments, the nucleic acid molecule encodes an antibody light chain variable region.
[0046] In some embodiments, the nucleic acid molecule has a nucleotide sequence as set forth in SEQ ID NO: 39, 41, 43, 45, 47, or a nucleotide sequence having one or several nucleotide substitutions, deletions or additions relative to the nucleotide sequence, or a nucleotide sequence having at least 75% sequence identity thereto.
[0047] In some embodiments, the nucleic acid molecule encodes an antibody heavy chain constant region.
[0048] In some embodiments, the nucleic acid molecule has a nucleotide sequence as set forth in SEQ ID NO: 55, or a nucleotide sequence having one or several nucleotide substitutions, deletions or additions relative to the nucleotide sequence, or a nucleotide sequence having at least 75% sequence identity thereto.
[0049] In some embodiments, the nucleic acid molecule encodes an antibody light chain constant region, preferably a kappa light chain constant region or a lambda light chain constant region.
[0050] In some embodiments, the nucleic acid molecule has a nucleotide sequence as set forth in SEQ ID NO: 56 or 57, or a nucleotide sequence having one or several nucleotide substitutions, deletions or additions relative to the nucleotide sequence, or a nucleotide sequence having at least 75% sequence identity thereto.
[0051] It will be understood by those skilled in the art that nucleotides in the nucleic acid molecule can be replaced according to codon degeneracy. In some embodiments, the nucleotide sequence of the nucleic acid molecule is codon-optimized.
[0052] In some embodiments, the nucleic acid molecule encoding the antibody or antigen binding fragment thereof of the first aspect of the application comprises a nucleic acid molecule encoding the heavy chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application and a nucleic acid molecule encoding the light chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application.
[0053] According to yet another aspect of the present disclosure, there is provided an expression vector comprising the nucleic acid molecule.
[0054] In some embodiments, the expression vector comprises a prokaryotic expression vector and a eukaryotic expression vector.
[0055] In some embodiments, the eukaryotic expression vector comprises a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like. For example, the expression vector can comprise, but is not limited to, a plasmid, a retroviral vector, a lentiviral vector, a bacteriophage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector.
[0056] In some embodiments, the expression vector can be selected from the group consisting of a nanoparticle, a liposome, an exosome, a microvesicle, or a gene gun.
[0057] According to yet another aspect of the present disclosure, a host cell comprising the nucleic acid molecule, and / or the expression vector is provided.
[0058] In some embodiments, the host cell is selected from the group consisting of a prokaryotic cell and a eukaryotic cell.
[0059] In some embodiments, the prokaryotic cell comprises a bacterial cell, an Escherichia coli, a Streptomyces.
[0060] In some embodiments, the eukaryotic cell comprises a yeast cell, a mammalian cell, an insect cell, and the like.
[0061] In some embodiments, the mammal is selected from the group consisting of a human, a monkey, a mouse, a rat, a hamster, a goat, a sheep, a cow, a pig, a dog, or a cat.
[0062] In some embodiments, the mammalian cell comprises a CHO cell, a 293 cell, a Vero cell, a BHK cell, a NS0 cell, a SP2 / 0 cell, a YO myeloma cell, a P3X63 mouse myeloma cell, a PER cell, a PER.C6 cell, or a hybridoma cell.
[0063] According to yet another aspect of the present disclosure, a detection kit comprising the antibody or the antigen-binding fragment thereof is provided.
[0064] According to yet another aspect of the present disclosure, a composition comprising the antibody or the antigen-binding fragment thereof of the present disclosure, the nucleic acid molecule, the expression vector, or the host cell is provided.
[0065] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.
[0066] In some embodiments, the composition further comprises another or more other drugs.
[0067] In some embodiments, the other drugs comprise drugs for preventing and / or treating tetanus or a related disease thereof. In some embodiments, the other drugs comprise drugs for preventing and / or treating Clostridium tetani infection.
[0068] In some embodiments, the antibody or the antigen-binding fragment thereof is provided as an independent component or as a mixed component with the other drugs.
[0069] In some embodiments, the pharmaceutical composition can be administered by, for example, parenteral, subcutaneous injection, sublingual, rectal, nasal, intravenous injection, intramuscular injection, oral, ocular, topical, and the like.
[0070] In some embodiments, the pharmaceutical composition is in the form of, for example, an aqueous solution, a suspension, a powder, a tablet, a capsule, a granule, a dispersion, a pill, a disintegrant, a syrup, a spray, a gel, an emulsion, an injection, an elixir, a lozenge, a suppository, and the like.
[0071] According to yet another aspect of the present disclosure, there is provided a chimeric antigen receptor comprising an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the extracellular antigen binding domain comprises an antibody or antigen binding fragment thereof of the present disclosure.
[0072] It is understood by those skilled in the art that the antibody or antigen binding fragment thereof of the present disclosure can be combined with other antibody or antigen binding fragment(s) to form a multispecific antibody or antigen binding fragment thereof targeting the same antigen but different epitopes, or targeting different antigens.
[0073] According to yet another aspect of the present disclosure, there is provided a modified immune cell comprising the chimeric antigen receptor.
[0074] According to yet another aspect of the present disclosure, there is provided a drug conjugate comprising an antibody or antigen binding fragment thereof of the present disclosure; and a drug covalently attached to the antibody or antigen binding fragment thereof.
[0075] In some embodiments, the conjugating moiety can include, but is not limited to, a detectable label or a therapeutic agent.
[0076] In some embodiments, the detectable label can be any substance that can be detected by fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electricity, optics, chemistry, etc. Such labels are well known in the art and examples include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, beta-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g.,3H,125I,35S,14C, or32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas Red, rhodamine, quantum dot, or a cyanine dye derivative (e.g., Cy7, Alexa 750)), acridinium esters, magnetic beads, calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads, and biotin for use with avidin (e.g., streptavidin) modified to bind the above labels. In some embodiments, such labels can be suitable for use in immunological detection (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescence immunoassay, etc.). In some embodiments, the detectable label is selected from the group consisting of a radioisotope, a fluorescent substance, a luminescent substance, a colored substance, or an enzyme. In some embodiments, the detectable label can be linked to the antibody or antigen-binding fragment thereof of the present disclosure via linkers of varying lengths to reduce potential steric hindrance.
[0077] In some embodiments, the detectable label can include, but is not limited to, an enzyme (e.g., horseradish peroxidase), a radionuclide, a fluorescent dye, a luminescent substance (e.g., a chemiluminescent substance), a colored substance, biotin, etc.
[0078] In some embodiments, the therapeutic agent can include, for example, but is not limited to, a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.
[0079] In some embodiments, the conjugating moiety can be selected from a substance that can improve the biological properties of the antibody (e.g., increase the serum half-life), such as a chemical group, e.g., polyethylene glycol (PEG), methyl, ethyl, or a sugar group.
[0080] According to yet another aspect of the present disclosure, there is provided a diagnostic or therapeutic kit comprising the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the expression vector, the host cell, the composition, the chimeric antibody receptor, or the antibody drug conjugate of the present disclosure.
[0081] In some embodiments, the kit can further comprise an instruction and / or a device for administration.
[0082] In some embodiments, the kit can be used for diagnosing Clostridium tetani infection or a disease caused thereby, detecting Clostridium tetani in a sample, detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanus toxin C fragment, or drug screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.
[0083] In some embodiments, the tetanus toxin C fragment has an amino acid sequence as set forth in SEQ ID NO: 58, or a nucleotide sequence having one or several substitutions, deletions, or additions of nucleotides compared to said nucleotide sequence, or a nucleotide sequence having at least 75% sequence identity thereto.
[0084] In some embodiments, the kit can be used for preventing and / or treating Clostridium tetani infection or a disease caused thereby.
[0085] In the present application, the disease caused by Clostridium tetani infection includes tetanus.
[0086] According to yet another aspect of the present disclosure, there is provided use of the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the expression vector, the host cell, the detection kit, and / or the composition in any one of c1) to c6) for the manufacture of a product for detecting, preventing, and / or treating Clostridium tetani infection:
[0087] According to yet another aspect of the present disclosure, there is provided use of the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the expression vector, the host cell, the detection kit, and / or the composition in any one of c1) to c6) for the manufacture of a product for detecting, preventing, and / or treating Clostridium tetani infection:
[0088] c1) for the manufacture of a product for diagnosing Clostridium tetani infection or a disease caused thereby;
[0089] c2) for the manufacture of a product for preventing and / or treating Clostridium tetani infection or a disease caused thereby;
[0090] c3) for the manufacture of a product for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanus toxin C fragment in a sample;
[0091] c4) for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanus toxin C fragment;
[0092] c5) for the manufacture of a product for drug screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby;
[0093] c6) for drug screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.
[0094] In some embodiments, the use of c4), c6) does not involve the diagnosis, treatment of a disease.
[0095] According to yet another aspect of the present disclosure, there is provided a method for detecting tetanus toxin, the method comprising the step of detecting a sample using the antibody or antigen-binding fragment thereof.
[0096] In some embodiments, the method is for detecting the presence or level of tetanus toxin in a sample.
[0097] In some embodiments, the sample comprises whole blood, red blood cell concentrate, platelet concentrate, white blood cell concentrate, tissue, bone marrow aspirate, plasma, serum, cerebrospinal fluid, fecal matter, urine, cultured cells, saliva, oral secretion and / or nasal secretion of the subject to be tested.
[0098] In some embodiments, the method comprises the steps of: contacting a sample with the antibody or antigen-binding fragment thereof of the first aspect of the present application under conditions that allow the antibody or antigen-binding fragment thereof of the first aspect of the present application to form a complex with tetanus toxin, tetanus toxoid or tetanus toxin C fragment, and detecting the formation of the complex.
[0099] In some embodiments, the subject to be tested comprises a mammal, such as a human, a non-human primate (e.g. chimpanzee, ape), a rodent (e.g. rat, mouse, guinea pig), a pet (e.g. cat, dog), a livestock (e.g. horse, cow, sheep, pig, rabbit).
[0100] In some embodiments, the subject to be tested comprises a human.
[0101] In some embodiments, the method is for any one of f1) - f3):
[0102] f1) diagnosing Clostridium tetani infection or a disease caused thereby;
[0103] f2) detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin C fragment in a sample;
[0104] f3) screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.
[0105] According to yet another aspect of the present disclosure, there is provided a method for preventing and / or treating Clostridium tetani infection, comprising administering to a subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof, the composition, the nucleic acid molecule, the expression vector, the host cell, the chimeric antibody receptor or the antibody-drug conjugate of the present disclosure. Beneficial effects:
[0106] The present disclosure provides an anti-tetanus toxin neutralizing antibody as a new generation of passive immunization preparation for tetanus. The antibody can be fully human, which has high affinity, high specificity, small toxic side effects, avoids the problems of large adverse reactions and short half-life of animal-derived monoclonal antibodies, and can be mass-produced by mammalian cells, and has clear and stable components. Based on the clinical needs, the fully human anti-tetanus toxin neutralizing antibody explored and developed as a new generation of passive immunization preparation for tetanus has important medical value. BRIEF DESCRIPTION OF DRAWINGS
[0107] Figure 1 shows the binding curve of the antibody with the full-length toxin and the C fragment of the toxin.
[0108] Figure 2 shows the affinity kinetic curve of the antibody with the toxin.
[0109] Figure 3 shows the results of the neutralization protection experiment in mice.
[0110] Figure 4 shows the results of the antibody protection experiment 3h after the mice were attacked. DETAILED DESCRIPTION
[0111] Tetanus toxin (Tetanospasmin, TeNT) belongs to neurotoxin, which is extremely toxic, only next to botulinum toxin (BoNT). The toxin has special affinity for the central nervous system, can prevent the release of inhibitory neurotransmitters at the inhibitory synaptic terminal, and can cause the imbalance between muscle activity and inhibition, so that the extensor and flexor muscles contract at the same time, causing muscle rigidity and spasm, and forming the symptoms of tetanus, such as trismus and opisthotonos. TeNT is a polypeptide chain with a molecular weight of 150kD. It is post-translationally cleaved by bacterial or host proteases into an active double-chain form connected by a single disulfide bond: a light chain (A fragment) and a heavy chain (B fragment and C fragment), with molecular weights of 50kD and 100kD, respectively. The A fragment is a zinc metalloprotease that can cleave the membrane proteins related to the transmission of neurotransmitters on the nerve cell membrane, inhibit the release of neurotransmitters, and cause continuous transmission of excitation; the B fragment encodes a translocation domain that mediates the entry of the active site of the toxin into the cell; the C fragment is a receptor binding domain that can be transported into the central nervous system in a retrograde manner. Many studies have shown that antibodies against the C fragment have a high probability of having neutralizing activity.
[0112] The present disclosure isolates peripheral blood mononuclear cells (PBMCs) from the blood of volunteers who have been immunized with a commercial tetanus vaccine and have generated protective antibodies, screens for monoclonal antibodies that can specifically bind to the full-length tetanus toxin and its C fragment, and further screens for five candidate antibodies, the sequences of which are shown in Table 1.
[0113] Table 1. CDR regions and variable region sequences of five antibodies Note: CDRs in the table are defined according to the Kabat numbering system.
[0114] The anti-tetanus toxin fully human neutralizing antibodies provided by the present disclosure can all specifically bind to tetanus toxin, have strong neutralizing activity and high affinity. The anti-tetanus toxin neutralizing antibodies provided by the present disclosure can completely protect mice from tetanus toxin challenge in mouse neutralization and protection experiments. In addition, the anti-tetanus toxin neutralizing antibodies provided by the present disclosure are free of allergens and exogenous virus contamination, have high safety, and can be widely used in various populations.
[0115] Definitions
[0116] Unless otherwise defined, all technical and scientific terms used within the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will include the plural and vice versa.
[0117] As used herein, the expressions "a" and "an" include plural referents unless the context clearly dictates otherwise.
[0118] The expression "about" as used herein is as understood by one of ordinary skill in the art and varies in its scope depending on the context of its usage. If one of ordinary skill in the art is unable to understand the usage of this term in a certain context, then "about" will mean up to plus or minus 10% of a particular value.
[0119] The term "specifically binds" as used herein means having binding selectivity for an antigen and can be distinguished from non-specific or nonspecific binding. The ability of an antigen binding molecule to bind to a particular antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art, such as surface plasmon resonance (SPR) techniques and traditional binding assays.
[0120] The term "affinity" or "binding affinity" as used herein refers to the strength of the non-covalent interaction between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Binding affinity can generally be expressed in terms of an affinity constant (KD), which is the ratio of the dissociation rate constant (kd) to the association rate constant (ka). Thus, equivalent affinities can include different rate constants, as long as the ratio of the rate constants remains the same. Affinity can be measured by conventional methods known in the art, such as surface plasmon resonance (SPR). In some embodiments, the antibody is determined when tetanus toxin C fragment is used as an analyte and the antibody as a ligand, the antibody has an affinity of about less than 10-6 M, about less than 10 -7 M, 10 -8 M, 10 -9 M, or 10 -10 M, even lower equilibrium dissociation constant (KD) binding, and an affinity for binding to a predetermined antigen that is at least twice the affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely related antigen.
[0121] The term "antibody" as used herein encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies or trispecific antibodies), single chain molecules, and antibody fragments, as long as they exhibit the desired antigen-binding activity. Within the light and heavy chains of an antibody, the variable and constant regions are joined by a "J" region of about 12 or more amino acids. The heavy chain also contains a "D" region of about 3 or more amino acids. Each heavy chain is composed of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region is comprised of one domain, CL. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
[0122] Unless otherwise indicated, "antibody active fragment", "antibody fragment", "target binding fragment" and "antigen binding fragment" are interchangeable in the context of the present application and mean an antibody fragment that is capable of specifically binding to an antigen, e.g., a fragment that retains one or more CDR regions. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, e.g., single-chain Fv (ScFv); nanobodies formed from antibody fragments and multispecific antibodies.
[0123] The term "variable region" or "variable domain" as used herein refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs). A single VH or VL domain can be sufficient to confer antigen-binding specificity. The term "variable" refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies, and are used in the binding and specifity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies; it is concentrated in three segments called hypervariable regions (HVRs) both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called framework regions (FRs). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a beta-sheet configuration, connected by three HVRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The HVRs in each chain are held together in part by the FR regions of that chain, and, in part, by interactions with the HVRs of the other chain. The HVRs of each chain are together responsible for binding the antigen. The constant domains are not involved directly in binding an antibody to an antigen, but exhibit other effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity.
[0124] The term "hypervariable region" or "HVR", as used herein, refers to the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops") that are believed to be involved in antigen binding. In general, the six HVRs are referred to as H1, H2, and H3 found in the VH, and L1, L2, and L3 found in the VL. HVRs typically comprise amino acid residues that form the hypervariable loops and / or those from the "complementarity determining regions" (CDRs) that have the highest sequence variability and / or involve in antigen recognition. It is understood by those skilled in the art that the "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., variable region) are understood to encompass the "CDRs" and "complementarity determining regions" as defined by any one of the art-known schemes, unless otherwise specified. It is well known in the art that the CDRs of an antibody can be defined by various methods in the art, such as the Kabat definition rules based on sequence variability, the Chothia definition rules based on the location of structural loop regions, the Martin definition rules based on sequence and framework region, the IMGT definition rules based on amino acid sequence alignment of germline V genes, the reference tool based on CDR grafting for antibody humanization design, etc. It is understood by those skilled in the art that the term "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., variable region) are understood to encompass the CDRs defined by any one of the above-mentioned known schemes described in the present disclosure, unless otherwise specified, and the corresponding amino acid sequences defined by the CDR definition rules should also fall within the scope of the present disclosure.
[0125] The term "chimeric antibody", as used herein, refers to an antibody that combines the antibody fragments from different species. Specifically, for example, a monoclonal antibody from one species (e.g., mouse) whose Fc constant region is replaced by the Fc constant region from one species (e.g., human) via DNA recombination technology.
[0126] The term "humanized antibody", as used herein, refers to an antibody comprising a human immunoglobulin framework region and one or more CDRs from a non-human (e.g., mouse, rat, rabbit, or synthetic) immunoglobulin. Except for the CDRs, all other parts of the humanized antibody are essentially the same as the corresponding parts of the natural human immunoglobulin sequence.
[0127] The term "fully human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The term "fully human antibody" as used herein refers to a protein molecule having virtually all of its individual components (e.g., CDRs, FRs, CL, HC domains (e.g., CHI, CH2, CH3), hinge, VL, VH) nearly immunogenic in humans, with only minor sequence changes or variations relative to a naturally occurring human immunoglobulin. Thus, a fully human antibody is distinguished from a chimeric or humanized antibody. It is noted that a fully human antibody can be produced by a human cell, non-human animal, or prokaryotic or eukaryotic cell that is capable of expressing a functionally rearranged human immunoglobulin (e.g., heavy and / or light chain) gene.
[0128] The term "nucleic acid molecule" as used herein refers to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide.
[0129] "Percent homology," "% homology," or "% sequence identity" as used herein in the context of the present application is used to describe the degree of similarity between two nucleotide sequences or two amino acid sequences, and is synonymous with "percent identity." The percent homology of two sequences can be calculated as the number of positions at which the residues are identical, divided by the total number of positions in the aligned sequences, multiplied by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, e.g., the BLAST suite available on the NCBI website. As used herein, having "at least 80% sequence identity" to a sequence means having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence. As used herein, having "at least 75% sequence identity" to a sequence means having at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence.
[0130] The terms "vector" or "expression vector" as used herein can be used interchangeably with "expression construct" and refer to a DNA molecule that directs the introduction of a particular gene with which it is operably linked into a target cell and directs expression. The vector includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. The expression vectors of the present disclosure comprise an expression cassette. The expression vector can be transcribed to produce a large amount of stable mRNA. Once the expression vector is within the target cell, the ribonucleic acid molecule or protein encoded by the gene is produced by the cellular transcription and / or translation machinery.
[0131] The term "host cell" as used herein is used interchangeably with "transformant" and "transformed cell" and refers to a cell into which an exogenous nucleic acid has been introduced, and also includes the progeny of such a cell. Host cells include "transformants / transformants" and "transformed cells," including primary transformed cells as well as progeny derived therefrom. The nucleic acid of the progeny can not be identical to the parent cell due to mutations. Host cells include cultured cells, e.g., cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, yeast cells, insect cells, and plant cells. Host cells of the present disclosure also include cells contained within a transgenic animal, transgenic plant, or cultured plant or animal tissue.
[0132] The term "pharmaceutical composition" or "composition" as used herein includes the monoclonal antibodies of the present disclosure and a pharmaceutically acceptable carrier. The pharmaceutical composition can be in various oral or parenteral dosage forms. The pharmaceutical composition is formulated using conventional diluents or excipients, including fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Solid oral formulations include tablets, pills, powders, granules, capsules, and the like. These solid formulations can be prepared by mixing at least one compound with one or more excipients, such as starch, calcium carbonate, sucrose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate or talc can also be used. In addition, liquid oral formulations include suspensions, solutions, emulsions, and syrups, and the like. In addition to water and liquid paraffin, which are commonly used as simple diluents, various excipients can be included, such as wetting agents, sweeteners, flavors, preservatives, and the like. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized agents, suppositories, and the like. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used as non-aqueous solvents and suspending agents. The main components of suppositories can include semi-synthetic fatty acid esters, polyethylene glycols, Tween 61, cocoa butter, lauric butter, glycerol gelatin, and the like.
[0133] The pharmaceutical composition or combination can have any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories.
[0134] The pharmaceutical composition of the present disclosure can be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to any medical treatment. The effective dose level of the composition can be determined depending on the type of the subject, the severity of the disease, the age and gender of the subject, the drug activity, the sensitivity to the drug, the administration time, the administration route, the excretion rate, the treatment time, the drugs used in combination with the composition, and other known factors in the medical field. The pharmaceutical composition of the present disclosure can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms. It is important to administer the composition in the minimum amount capable of exhibiting the maximum effect without causing side effects, which can be easily determined by those skilled in the art, taking into account all the above factors.
[0135] The term "pharmaceutically acceptable carrier" used herein means a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. The pharmaceutically acceptable carriers that can be used to formulate the composition of the present disclosure in the form of a liquid solution include physiological saline, sterile water, Ringer's solution, buffered saline solution, glucose solution, maltodextrin solution, glycerol, ethanol, and a mixture of two or more thereof. If necessary, the composition of the present disclosure can also contain other conventional additives such as antioxidants, buffers, and bacteriostats. In addition, the composition of the present disclosure can further include diluents, dispersants, surfactants, binders, and lubricants to configure it into injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, and tablets.
[0136] The term "treatment" of a disease in a subject or "treating" a subject having or suspected of having a disease, as used herein, means administering a drug therapy to the subject, e.g., administering one or more agents, to thereby reduce or prevent the worsening of at least one symptom of the disease. Thus, in one embodiment, "treatment" refers to, inter alia, delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing efficacy of alternative therapies, or decreasing resistance to alternative therapies, or combinations thereof.
[0137] The term "diagnosing" or "detecting" as used herein includes judging whether a subject or a sample to be tested has tetanus toxin. Accordingly, it is possible to judge whether the subject or the subject from which the sample is derived is infected with Clostridium tetani.
[0138] The term "prevention" as used herein is art-recognized and, when used in connection with a condition such as local recurrence, is well-understood in the art and includes administration that reduces or delays the onset of symptoms of a medical condition in a subject relative to a subject who does not receive the composition. The compositions of the present application can be administered as a food product, such as a nutritional supplement. Generally, the compositions of the present application are used to treat humans, although they can be used to treat animals, such as poultry, swine, cats, dogs, horses, or rabbits. If administered to an animal, oral gavage can be used.
[0139] The following examples and figures are provided to aid the understanding of the present disclosure, but should not be construed as limiting. The true scope of the present disclosure is set forth in the appended claims. It should be noted that various alterations and modifications to this inventive concept will become apparent to the skilled artisan once given the benefit of this disclosure. The reagents and / or kits used in the following examples are either commercially available or can be synthesized by known methods.
[0140] Examples
[0141] Example 1 Flow cytometric sorting of B cells and screening and purification of anti-tetanus toxin antibodies
[0142] The screening and method of making antibodies comprises the following steps:
[0143] 1. PBMC isolation and memory B cell sorting
[0144] 10 mL of venous blood was collected from volunteers who were immunized with commercial tetanus vaccine and produced protective antibodies, and placed in an anticoagulant tube containing sodium citrate. 10 mL of blood sample was separated into PBMC (peripheral blood mononuclear cell) by Ficoll (polyfructose). After counting the PBMC, tetanus toxoid (TT full length, obtained by Beijing Sinovac Biotech Co., Ltd. using Clostridium tetani CMCC 64008 fermented culture, refined purification and detoxification, which has the same immunogenicity as tetanus toxin) and tetanus toxin C fragment (synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., sequence is SEQ ID NO: 58: KNLDCWVDNEEDIDVILKKSTILNLDINNDIISDISGFNSSVITYPDAQLVPGINGKAIHLVNNESSEVIVHKAMDIEYNDMFNNFTVSFWLRVPKVSASHLEQYDTNEYSIISSMKKYSLSIGSGWSVSLKGNNLIWTLKDSAGEVRQITFRDLSDKFNAYLANKWVFITITNDRLSSANLYINGVLMGSAEITGLGAIREDNNITLKLDRCNNNNQYVSIDKFRIFCKALNPKEIEKLYTSYLSITFLRDFWGNPLRYDTEYYLIPVAYSSKDVQLKNITDYMYLTNAPSYTNGKLNIYYRRLYSGLKFIIKRYTPNNEIDSFVRSGDFIKLYVSYNNNEHIVGYPKDGNAFNNLDRILRVGYNAPGIPLYKKMEAVKLRDLKTYSVQLKLYDDKDASLGLVGTHNGQIGNDPNRDILIASNWYFNHLKDKTLTCDWYFVPTDEGWIN) were used as sorting antigens, and single antigen-specific memory B cells were sorted from PBMC into 96-well PCR (Polymerase Chain Reaction) plates using SONY SH800 flow cytometry sorter, so that each well contained 1 B cell. The 96-well plate containing B cells was placed in a refrigerator at -80°C for storage.
[0145] 2. Single-cell PCR amplification of fully human monoclonal antibodies
[0146] 1) Reverse transcription PCR:
[0147] Add all IgG1 subtype-specific primers targeting the heavy chain, κ light chain, and λ light chain, along with Maxima H Minus reverse transcriptase (Thermo), to a 96-well PCR plate containing a single B cell. Reverse transcription was performed at 50°C for 30 min, followed by reverse transcriptase inactivation at 85°C for 5 min. The obtained cDNA product was then stored at -80°C.
[0148] 2) Nested PCR:
[0149] First round of reaction: Using 2 μL of cDNA product as a template, add hot-start ultra-high fidelity DNA polymerase for rapid PCR ( FastPfu DNA polymerase (from TransGen Biotech), dNTPs, and nested PCR primers. Reaction conditions: pre-denaturation at 98℃ for 5 min, followed by 40 PCR cycles, each cycle being: 98℃ × 30 s, 55℃ (heavy chain V... H , κ light chain Vκ) / 50℃(λ light chain Vλ)×1min, 72℃×1min, and finally extended at 72℃ for 5min.
[0150] Second round reaction: Using the PCR product from the first round reaction as a template, add hot-start ultra-high fidelity DNA polymerase for rapid PCR ( FastPfu DNA polymerase (from TransGen Biotech), dNTPs, and nested PCR primers. Reaction conditions: pre-denaturation at 98℃ for 5 min, followed by 35 PCR cycles, each cycle being: 98℃ × 30 s, 58℃ (heavy chain V) H The reaction mixture was set at 60℃ (κ light chain Vκ) / 64℃ (λ light chain Vλ) for 1 min, then at 72℃ for 1 min, and finally extended at 72℃ for 5 min to obtain nested PCR amplification products containing variable regions of heavy and light chains.
[0151] The sequences of the IgG1 subtype-specific primers targeting the heavy chain, κ light chain, and λ light chain, as well as the sequences of the nested PCR primers, can be found in Liao HX et al., High-throughput isolation of immunoglobulin genes from single human B cells and expression as monoclonal antibodies. J Virol Methods. 2009 Jun; 158(1-2):171-9.
[0152] 3) Agarose gel electrophoresis
[0153] 5 μL of the nest PCR amplification product was detected by 1.5% agarose gel electrophoresis, and the paired positive clones were sequenced to obtain the antibody variable region sequence, and the sequence was linearly expressed in a frame.
[0154] 3. Constructing a recombinant antibody linear expression frame to express the antibody
[0155]
[0156] Using CMV primer-F: GGCTTGACCGACAATTGCATGAAGAATC (SEQ ID NO: 48) and CMV primer-R: GGCCCTCACCCCAGTCAG (SEQ ID NO: 49), the above-mentioned any plasmid as a template, the enhancer sequence, the promoter sequence and the signal peptide fragment were obtained by PCR amplification.
[0157] Using heavy chain constant region primer-F: GCTAGCACCAAGGGCCCA (SEQ ID NO: 50) and poly(A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 51), the pcDNA3.4-H plasmid as a template, the heavy chain constant region sequence, WPRE and Poly(A) fragment were obtained by PCR amplification.
[0158] Using kappa light chain constant region primer-F: CGTACGGTGGCTGCACCAT (SEQ ID NO: 52) and poly(A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 51), the pcDNA3.4-κ plasmid as a template, the kappa light chain constant region sequence, WPRE and Poly(A) fragment were obtained by PCR amplification.
[0159] Using lambda light chain constant region primer-F: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 53) and poly(A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 51), the pcDNA3.4-λ plasmid as a template, the lambda light chain constant region sequence, WPRE and Poly(A) fragment were obtained by PCR amplification.
[0160] All the above-mentioned amplified fragments were purified by using magnetic beads for PCR product purification. The nested PCR amplification product containing the heavy chain and light chain variable region sequence was used to construct a linear expression frame with the above-mentioned expression elements (enhancer + promoter + signal peptide), constant region (heavy chain, kappa light chain, lambda light chain), WPRE and Poly(A) fragments using overlap PCR technology. After completion, 5 μL of linear expression frame amplification product was detected by 1% agarose gel electrophoresis, and sequencing was performed to identify that the constructed antibody linear expression frame was correctly constructed.
[0161] The correctly constructed and purified heavy chain and light chain linear expression frames were co-transfected into 293 cells using transfection reagent PEI. After incubation at 37℃ in a 5% CO2 incubator for 72 h, the cell supernatant was collected for detection.
[0162] 4. ELISA screening of candidate antibodies with binding activity
[0163] Tetanus toxoid or tetanus C fragment (Wuhan Huamei Bioengineering Co., Ltd.) was used as the antigen, and the antigen was diluted to 2 μg / mL with coating solution to coat a 96-well ELISA plate, each well containing 100 μL of overnight coating at 4°C, and then blocked with blocking solution at 37°C for 2 h. The supernatant containing the antibody was collected as the primary antibody and incubated at 37°C for 1 h, and goat anti-human IgG-HRP (1:20,000 dilution) was used as the secondary antibody and incubated at 37°C for 1 h. After the addition of substrate developing solution, it was incubated at room temperature for 10 min, and the reaction was stopped with 2M sulfuric acid, and detection and analysis were performed at a wavelength of 450 nm. The results showed that no less than 100 monoclonal antibodies could specifically bind to tetanus toxoid (full length) or tetanus C fragment.
[0164] 5. Construction of expression plasmid and preparation of antibody
[0165] After sequence alignment and binding force, affinity, and animal protection experiments, five candidate antibodies, T045 (with κ type light chain), T048 (with κ type light chain), T133 (with λ type light chain), T135 (with λ type light chain), and T154 (with κ type light chain), were finally selected for further study, and the CDR region and variable region sequences are shown in Table 1.
[0166] The expression plasmid of the five candidate antibodies was constructed, and the antibody was prepared. The specific method is as follows: using the seamless cloning kit (One Step Seamless Cloning Mix, Kangwei Century), the linear expression frame amplification product (obtained in step 3 above) containing the heavy chain and light chain of the five antibodies was respectively connected with the reverse PCR amplified pcDNA3.4-H, pcDNA3.4-κ and pcDNA3.4-λ expression vector frame, and the vector frame amplification primers were as follows:
[0167] H-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 49), and heavy chain reverse primer 3.4-R: GCTAGCACCAAGGGCCCA (SEQ ID NO: 50) (pcDNA3.4-H vector frame);
[0168] L-κ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 49), and κ light chain reverse primer 3.4-R: CGTACGGTGGCTGCACCAT (SEQ ID NO: 52) (pcDNA3.4-κ vector frame);
[0169] L-λ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 49) and λ light chain reverse primer 3.4-R: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 53) (pcDNA3.4-λ vector framework).
[0170] Take 1 μL of the linear expression frame fragment and 2 μL of the vector framework corresponding to the linear expression frame fragment (for example, take 1 μL of the heavy chain linear expression frame fragment and 2 μL of the pcDNA3.4-H expression vector framework; take 1 μL of the κ light chain linear expression frame fragment and 2 μL of the pcDNA3.4-κ expression vector framework), add 5 μL of 2x Cloning MasterMix, and supplement with water to 10 μL of the reaction system. The reaction conditions are as follows: 50°C PCR instrument reaction for 15 min, and after the reaction is completed, the reaction system is cooled on ice and then transformed into DH5α competent cells to obtain the expression plasmid. Add PEI transfection reagent to the plasmid DNA (containing both heavy chain plasmid and light chain plasmid) diluted with OPM-293CD05 culture medium, mix well, incubate the complex at room temperature for 10 min, and culture at 37°C at 120 rpm in 6% CO2 for 5-7 days. Centrifuge at 300g for 5 min to collect the supernatant, filter with a 0.22 μm filter, purify with protein A affinity, change the collected antibody with PBS, and detect the antibody concentration.
[0171] Example 2: ELISA detection of antibody binding activity
[0172] 1. Experimental process
[0173] Take tetanus toxoid (TT full-length, obtained by fermentation culture, purification, and detoxification of Clostridium tetani CMCC 64008 by Beijing Tianqi Biotechnology Co., Ltd., which has the same immunogenicity as tetanus toxin) or tetanus toxin C fragment (TTC fragment, synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., with the sequence of SEQ ID NO: 58) as the antigen, and coat a 96-well enzyme-labeled plate with the antigen diluted to 2 μg / mL with coating solution, with a volume of 100 μL per well, and coat overnight at 2-8°C. Block the enzyme-labeled plate with blocking solution at 37°C for 2 h. Dilute the expressed and purified T045, T048, T133, T135, and T154 antibodies into a series of dilutions as the test sample and add them to the blocked enzyme-labeled plate, incubate at 37°C for 1 h, wash the plate, and incubate with goat anti-human IgG-HRP (1:20,000 dilution) at 37°C for 1 h. Add substrate developing solution and incubate at room temperature for 10 min in the dark, stop the reaction with 2M sulfuric acid, and detect and analyze at 450 / 630 nm.
[0174] 2. Results
[0175] The results are shown in Figure 1. The purified antibodies expressed in Example 1 were diluted to a concentration of about 0.0012 μg / mL and still able to bind tetanus toxoid or tetanus toxin C fragment. Therefore, the five candidate antibodies T045, T048, T133, T135 and T154 expressed and purified in Example 1 all have very strong binding activity.
[0176] Example 3 SPR detection of antibody affinity constant and affinity kinetics analysis
[0177] 1. Capture method test
[0178] The antibody affinity test was performed using the capture method, using a Biacore T200 (GE Healthcare) biomacromolecule interaction system, with 1x HBS-EP+ buffer (GE Healthcare) and a CM5 chip first coupled with anti-human Fc (GE Healthcare). Then the five candidate antibodies T045, T048, T133, T135 and T154 prepared in Example 1 were diluted to a concentration of 5 μg / mL, and the binding time was 30 s. The analyte tetanus toxoid (tetanus toxoid from Beijing Sinovac Biotech Co., Ltd. obtained by fermentation culture, purification and detoxification of Clostridium tetani CMCC 64008, which has the same immunogenicity as tetanus toxin) was passed through the chip in gradually increasing concentrations (1.23 nM, 3.70 nM, 11.1 nM, 33.3 nM, 100 nM, 300 nM) to obtain signal curves. Each concentration was a cycle, and after completing a cycle, the chip was regenerated with 3M MgCl2 to restore the original state without capturing antibodies, and the regeneration time was 60 s. The signal curves obtained were analyzed using the GE Healthcare Biacore T-200 system software to obtain the affinity activity detection results of the neutralizing antibodies T045, T048, T133, T135 and T154 prepared in Example 1 and tetanus toxoid.
[0179] 2. Results
[0180] As shown in Table 2 and Figure 2, the affinity of each neutralizing antibody to tetanus toxoid reached the order of 10 -9 M, indicating that the five candidate antibodies T045, T048, T133, T135 and T154 prepared in Example 1 all have very high affinity activity, and the antibody binding / complex has good stability.
[0181] Table 2: Affinity activity detection results of antibody T048 and tetanus toxoid
[0182] Example 4 Mouse in vivo neutralization protection efficacy determination
[0183] 1. Tetanus toxin L+ assay
[0184] Take one tetanus toxin (China Institute for Drug Control), using sterile glycerol and borate buffer solution prepared by mixing equal (volume) dilution of the toxin stock solution. When using, add the appropriate amount of borate buffer in a brown bottle, take the appropriate amount of toxin stock solution into the brown bottle, prepare the toxin application solution, each test dose solution volume 1 mL. Take the tetanus human immunoglobulin (Homologous tetanus immune globulin, hTIG) standard (China Institute for Drug Control), add the appropriate amount of borate buffer to dilute to 0.5 IU / mL, take 1 mL into each toxin application solution of the brown bottle, mix well, seal, 37°C water bath for 1 hour. Immediately subcutaneously injected into the abdomen of mice, 3 mice per test dose, each mouse injected 0.4 mL, observed 5 days, morning and afternoon each 1 time, according to the minimum toxin amount of 72 hours-120 hours mice all died as the test dose (1 / 10 L+).
[0185] 2. In vivo neutralization protection experiment
[0186] The experiment is divided into negative control group, hTIG group (0.5 IU / mL), and 5 antibody groups (6 μg / mL, 5 antibodies T045, T048, T133, T135, T154 prepared in Example 1). Each group was diluted with 1 mL of test toxin containing 5 test amounts (1 / 10 L+) and equal amount of borate buffer diluent, mixed well, incubated at 37°C for 1 h, immediately injected into the abdomen of mice, 6 mice per group. hTIG group, each mouse injected 0.2 mL toxin + 0.2 mL hTIG; antibody group, each mouse injected 0.2 mL toxin + 0.2 mL antibody; negative control group, each mouse injected 0.2 mL toxin + 0.2 mL diluent.
[0187] 3. Results
[0188] The results are shown in Figure 3. Under the same conditions, when challenged with tetanus toxin, the mice in the negative control group all died within 48 h, and the mice in the hTIG group (0.5 IU / mL) and each antibody group (6 μg / mL) all survived within 14 days, indicating that the 5 antibodies T045, T048, T133, T135, T154 prepared in Example 1 can effectively protect animals against lethal dose of tetanus toxin challenge at 1.2 μg, with an effect equivalent to 0.1 IU hTIG. This indicates that the 5 antibodies T045, T048, T133, T135, T154 prepared in Example 1 can effectively neutralize the challenge toxin and protect mice.
[0189] Example 5 Protection test of anti-tetanus toxin monoclonal antibody on animals after 3h of challenge
[0190] 1. Determination of median lethal dose (LD 50 )
[0191] Take one bottle of tetanus toxin, and reconstitute it with a 1:1 mixture of sterilized glycerol and borate buffer solution. Dilute the tetanus toxin: take an appropriate amount of reconstituted tetanus toxin and add it to a brown volumetric flask, and rinse the toxin glass bottle 3 times, make up to 10 mL; dilute multiple gradients according to a ratio of 1.3 times. Inject 10 mice per dilution of tetanus toxin, with each mouse receiving 0.5 mL of tetanus toxin injected subcutaneously in the lumbar lateral abdomen. Observe continuously for 7 days after injection, and record the death of animals regularly every day. According to the number of animal deaths at different dilutions after 7 days of observation, the concentration of tetanus toxin in this bottle is 106152LD 50 / bottle.
[0192] 2. Administration after 3h of challenge
[0193] After the NIH mice were pre-raised and weighed, 192 NIH mice (female) weighing 17-19 g were selected and randomly divided into 32 groups, including a healthy mouse control group, a challenge control group (challenged only without administration of drugs), a tetanus human immunoglobulin hTIG (2.5 mL 250 IU / bottle, Chengdu Rongsheng) administration group with different doses, and different dose administration groups of the 5 antibodies T045, T048, T133, T135, and T154 prepared in Example 1. The test design is shown in Table 3. Each experimental group was challenged by subcutaneous injection of 6 LD 50 of tetanus toxin in the abdomen of the mice, 0.5 mL per mouse; 3h after the challenge, the corresponding drugs were injected intramuscularly according to the following test design. After administration, all NIH mice were observed every day, and the incidence and death within 7 days were recorded continuously. The minimum antibody dose required to protect mice from the lethal effect of tetanus toxin was compared with the minimum dose of the known international unit hTIG required to protect mice from the lethal effect, and the protection effect of the 5 antibodies prepared in Example 1 was evaluated.
[0194] Table 3: Subcutaneous injection of 6 LD 50 tetanus toxin challenge experiment grouping
[0195] 3. Results
[0196] The health mouse control group was set up, all of which survived normally within 7 days. The results of other groups are shown in Figure 4. All animals in the challenge control group died within 48-72h. In the hTIG different dose administration groups, the minimum protective dose for protecting the NIH mice from death was 0.55IU / kg. In the T045 antibody different dose administration groups, the minimum protective dose for protecting the NIH mice from death was 4μg / kg. In the T048 antibody different dose administration groups, the minimum protective dose for protecting the NIH mice from death was 4μg / kg. In the T133 antibody different dose administration groups, the minimum protective dose for protecting the NIH mice from death was 4μg / kg. In the T135 antibody different dose administration groups, the minimum protective dose for protecting the NIH mice from death was 4μg / kg. In the T154 antibody different dose administration groups, the minimum protective dose for protecting the NIH mice from death was also 4μg / kg. Therefore, under the test conditions, the 1.8mg of T045 antibody, T048 antibody, T133 antibody, T135 antibody, and T154 antibody in the different antibody groups were equivalent to one dose of tetanus human immunoglobulin hTIG, all of which had good challenge protection effect.
[0197] The technical solutions of the present disclosure are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present disclosure fall within the protection scope of the present disclosure.
Claims
1. An anti-tetanus toxin neutralizing antibody or antigen-binding fragment thereof, comprising: (1) the following 3 heavy chain variable region complementarity determining regions (HCDRs): a HCDR1 having an amino acid sequence of a HCDR1 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR1 contained in the heavy chain variable region; a HCDR2 having an amino acid sequence of a HCDR2 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR2 contained in the heavy chain variable region; a HCDR3 having an amino acid sequence of a HCDR3 contained in a heavy chain variable region as set forth in any one of SEQ ID NOs: 7, 15, 23, 28, 36, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the HCDR3 contained in the heavy chain variable region; and / or (2) the following 3 light chain variable region complementarity determining regions (LCDRs): a LCDR1 having an amino acid sequence of a LCDR1 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR1 contained in the light chain variable region; a LCDR2 having an amino acid sequence of a LCDR2 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR2 contained in the light chain variable region; a LCDR3 having an amino acid sequence of a LCDR3 contained in a light chain variable region as set forth in any one of SEQ ID NOs: 8, 16, 24, 29, 37, or an amino acid sequence that has one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the LCDR3 contained in the light chain variable region, wherein, the HCDR1-3 and the LCDR1-3 are defined by the numbering system of Kabat, AbM, Chothia, Contact, IMGT, or a combination thereof.
2. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in a heavy chain variable region of SEQ ID NO: 7, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in said heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and three LCDRs contained in a light chain variable region of SEQ ID NO: 8, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in said light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or three HCDRs contained in a heavy chain variable region of SEQ ID NO: 15, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in said heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and three LCDRs contained in a light chain variable region of SEQ ID NO: 16, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in said light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or three HCDRs contained in a heavy chain variable region of SEQ ID NO: 23, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in said heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and three LCDRs contained in a light chain variable region of SEQ ID NO: 24, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in said light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or three HCDRs contained in a heavy chain variable region of SEQ ID NO: 28, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in said heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and three LCDRs contained in a light chain variable region of SEQ ID NO: 29, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in said light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or three HCDRs contained in a heavy chain variable region of SEQ ID NO: 36, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three HCDRs contained in said heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and three LCDRs contained in a light chain variable region of SEQ ID NO: 37, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequence of the three LCDRs contained in said light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or, the antibody or antigen-binding fragment thereof comprises: a HCDR1 having an amino acid sequence of any one of SEQ ID NOs: 1, 9, 17, or 30, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a HCDR2 having an amino acid sequence of any one of SEQ ID NOs: 2, 10, 18, 25, or 31, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a HCDR3 having an amino acid sequence of any one of SEQ ID NOs: 3, 11, 19, or 32, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR1 having an amino acid sequence of any one of SEQ ID NOs: 4, 12, 20, 26, or 33, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR2 having an amino acid sequence of any one of SEQ ID NOs: 5, 13, 21, or 34, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR3 having an amino acid sequence of any one of SEQ ID NOs: 6, 14, 22, 27, or 35, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; or, the antibody or antigen-binding fragment thereof comprises: a HCDR1 having an amino acid sequence of any one of SEQ ID NOs: 1, 9, 17, or 30, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a HCDR2 having an amino acid sequence of any one of SEQ ID NOs: 2, 10, 18, 25, or 31, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a HCDR3 having an amino acid sequence of any one of SEQ ID NOs: 3, 11, 19, or 32, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR1 having an amino acid sequence of any one of SEQ ID NOs: 4, 12, 20, 26, or 33, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR2 having an amino acid sequence of any one of SEQ ID NOs: 5, 13, 21, or 34, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a LCDR3 having an amino acid sequence of any one of SEQ ID NOs: 6, 14, 22, 27, or 35, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto. HCDR1, HCDR2 and HCDR3 as depicted in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as depicted in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2 and HCDR3 as depicted in SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as depicted in SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2 and HCDR3 as depicted in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as depicted in SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 17, SEQ ID NO: 25, and SEQ ID NO: 19, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 26, SEQ ID NO: 21, and SEQ ID NO: 27, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 32, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said HCDR1, HCDR2, and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 33, SEQ ID NO: 34, and SEQ ID NO: 35, or an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared to the amino acid sequences of said LCDR1, LCDR2, and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.
3. The antibody or antigen-binding fragment thereof of claim 1, wherein, the antibody or antigen binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 7, 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 8, 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; or, the antibody or antigen binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 7, 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 8, 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 7, 15, 23, 28, 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 8, 16, 24, 29, 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions compared thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 15, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 16, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 23, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 24, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 28, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 29, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 36, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 37, an amino acid sequence having one or several amino acid substitutions, deletions, or additions in comparison thereto, or an amino acid sequence having at least 80% sequence identity thereto.
4. The antibody or antigen-binding fragment thereof of claim 1, wherein, The antibody comprises an IgA, IgD, IgE, IgG, or IgM type; Alternatively, the antigen binding fragment comprises an scFv, Fab, Fab', (Fab')2, Fv fragment, dsFv, bispecific antibody, and multispecific antibody. Alternatively, the antibody or antigen binding fragment comprises a murine antibody, chimeric antibody, humanized antibody, or fully human antibody.
5. Any one of a1) - a2): a1) a protein comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, the antigen binding domain comprising the antibody or antigen binding fragment thereof of any one of claims 1-4, the protein being a chimeric antigen receptor; a2) a protein comprising two or more antigen binding domains, wherein one of the antigen binding domains comprises the antibody or antigen binding fragment thereof of any one of claims 1-4, the protein being a multispecific antibody or antigen binding fragment thereof.
6. A biological material related to the antibody or antigen-binding fragment thereof of any one of claims 1 to 4, or the protein of claim 5, said biological material comprising any one of n1 ) to n3): n1 ) a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of any one of claims 1 to 4; n2) an expression vector comprising said nucleic acid molecule; n3) a host cell comprising said nucleic acid molecule or said expression vector.
7. A composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1 to 4, the protein of claim 5 or the biological material of claim 6, and a pharmaceutically acceptable carrier, optionally, said composition further comprising another drug or drugs.
8. An antibody drug conjugate comprising the antibody or antigen-binding fragment thereof of any one of claims 1 to 4, and a drug covalently linked to said antibody or antigen-binding fragment thereof.
9. A diagnostic or therapeutic kit comprising one or more of the antibody or antigen-binding fragment thereof of any one of claims 1 to 4, the protein of claim 5, the biological material of claim 6, the composition of claim 7, the antibody drug conjugate of claim 8.
10. Use of the antibody or antigen-binding fragment thereof of any one of claims 1 to 4, the protein of claim 5, the biological material of claim 6, the composition of claim 7, the antibody drug conjugate of claim 8, in any one of c1 ) to c6): c1 ) for the manufacture of a product for the diagnosis of Clostridium tetani infection or a disease caused thereby; c2) for the manufacture of a product for the prevention and / or treatment of Clostridium tetani infection or a disease caused thereby; c3) for the manufacture of a product for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysin C fragment in a sample; c4) for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysin C fragment; c5) for the manufacture of a product for drug screening, said drug being for the prevention and / or treatment of Clostridium tetani infection or a disease caused thereby; c6) for drug screening, said drug being for the prevention and / or treatment of Clostridium tetani infection or a disease caused thereby; the uses c4), c6) not involving the diagnosis, treatment of a disease.
Citation Information
Patent Citations
Fully human monoclonal antibody against tetanus toxin and derivative thereof, and preparation method and application thereof
CN105153305A
Complete human neutralizing antibody for resisting tetanus toxin
CN108218984A
Completely humanized monoclonal neutralizing antibody for tetanus toxin and application of neutralizing antibody
CN108314731A
Antitetanus toxin neutralizing antibody as well as preparation method and application thereof
CN108610417A
Anti-tetanus toxin antibody and application thereof
CN118812707A