Method and compound for regulating SCN1a gene mRNA and protein expression
By using agRNA-mediated RNA editing technology, the problem of NaV1.1 protein expression deficiency in Dravet syndrome was solved, and NaV1.1 protein expression was improved, which has potential therapeutic effects.
Patent Information
- Application Number
- PCT/CN2025/125638
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-30
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Current treatments for Dravet syndrome cannot directly address the defective expression of the NaV1.1 protein in the SCN1A gene, leading to uncontrollable seizures.
Using agRNA-mediated RNA editing technology, guide agRNA binds to the precursor mRNA of the SCN1A gene, recruits ADAR protein, and edits splice sites to alter the expression level of NaV1.1 protein, thereby increasing the expression of the SCN1A gene in cells.
Altering the expression of NaV1.1 protein may be an effective treatment for Dravet syndrome, reducing seizures and improving patient prognosis.
Smart Images

Figure CN2025125638_02042026_PF_FP_ABST
Abstract
Description
Methods and compounds for modulating SCN1A gene mRNA and protein expression TECHNICAL FIELD
[0001] The present disclosure belongs to the field of biological medicine, and relates to a method and compounds for modulating SCN1A gene mRNA and protein expression. BACKGROUND
[0002] Dravet syndrome, also known as severe myoclonic epilepsy of infancy, is a progressive disease with few effective treatments. It usually first appears in infants and young children, and patients have frequent, long seizures; behavioral problems; developmental delays; movement and balance problems; and other issues. People with the disease often require constant care and face a higher risk of sudden death. It is believed that approximately one in 15,700 people are affected. It is currently widely believed that the SCN1A gene, which encodes the Nav1.1 ion channel protein (voltage-gated sodium channel alpha 1-subunit, SCN1A), is one of the genes most clinically relevant to epilepsy.
[0003] Currently, the pathogenic mechanism of SCN1A gene mutation in Dravet syndrome and other epilepsies is that the copy of the gene is lost or cannot function as normal due to mutations, resulting in a haploinsufficiency effect. Usually, one of the pair of SCN1A alleles in Dravet syndrome patients is normal, and the other is mutated. The normal SCN1A allele undergoes alternative splicing at exon 20, one of which is a normal splicing pattern that generates mRNA that can be translated into the Nav1.1 protein, which can be referred to as productive splicing, generating productive SCN1A mRNA. Another splicing pattern retains 64 bases in intron 20, which generates mRNA that cannot be translated into the Nav1.1 protein, and these 64 bases are referred to as pseudo-exon (Exon20N), which can be referred to as non-productive splicing, generating non-productive SCN1A mRNA.
[0004] Existing treatments for Dravet syndrome include anti-epileptic drugs, vagus nerve stimulation, and the use of a very low carbohydrate ketogenic diet. However, none of these treatments directly addresses the root cause of the disease, which is to change the expression defect of the NaV1.1 protein in the intermediate nerve cells. Seizures in Dravet syndrome are usually difficult to control, and anti-epileptic drugs can reduce seizures but cannot control seizures, and whether anti-epileptic drugs and ketogenic diets can improve prognosis is still under discussion. SUMMARY
[0005] In some embodiments, the present disclosure aims to overcome the deficiencies of the prior art and provide a method and a compound for repairing or inhibiting abnormal splicing of the SCN1A gene.
[0006] In some embodiments, the present disclosure provides a guide agRNA (ADAR guide RNA, agRNA) that employs agRNA-mediated RNA editing technology to regulate SCN1A gene alternative splicing, and the expression level of the SCN1A gene in cells is increased by the agRNA, which can be used as a potential therapeutic means.
[0007] In some embodiments, the present disclosure provides a use of a guide agRNA in the preparation of a drug for changing the expression of a target protein in cells of a subject, wherein the cells have a precursor mRNA encoding the target protein, and the precursor mRNA comprises an intron, an exon flanking a 5' splice site of the intron, and an exon flanking a 3' splice site or a pseudo 3' splice site of the intron; the guide agRNA can bind to the precursor mRNA to form a structure capable of recruiting ADAR in cells, thereby forming a complex containing ADAR protein; and the target protein is a Nav1.1 protein.
[0008] In some embodiments, the present disclosure provides a method for changing the expression of a target protein in cells of a subject, wherein the method comprises contacting the cells with the guide agRNA; the cells have a precursor mRNA encoding the target protein, and the precursor mRNA comprises an intron, an exon flanking a 5' splice site of the intron, and an exon flanking a 3' splice site or a pseudo 3' splice site of the intron; the guide agRNA can bind to the precursor mRNA to form a structure capable of recruiting ADAR in cells, thereby forming a complex containing ADAR protein; and the target protein is a Nav1.1 protein.
[0009] In some embodiments, the guide agRNA is used to change the expression of a target protein Nav1.1 protein in cells of a subject, thereby for treating Dravet syndrome.
[0010] In some embodiments, the guide agRNA can recruit ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby splicing the entire exon flanking the 3' splice site or the pseudo 3' splice site of the intron from the precursor mRNA to skip the exon, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cells.
[0011] In some embodiments, the guide agRNA is unmodified or has a modification.
[0012] In some embodiments, the guide agRNA sequence comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 303-428.
[0013] In some embodiments, the guide agRNA comprises at least 2 domains connected by a linker between the domains. In some embodiments, the linker is a polyethylene glycol. In some embodiments, the polyethylene glycol is selected from a dimeric ethylene glycol.
[0014] In some embodiments, the modification comprises one or more of a backbone modification, a sugar modification, and a base modification.
[0015] In some embodiments, the backbone modification comprises one or more of a phosphorothioate linkage modification, an alkylphosphonate modification, a phosphoramidate modification, a peptide nucleic acid modification, and a 2’-5’ linked phosphate linkage modification.
[0016] In some embodiments, the phosphoramidate modification comprises a guanidinophosphoramidate modification or a methanesulfonylphosphoramidate modification.
[0017] In some embodiments, the sugar modification comprises one or more of a deoxyribose modification (DNA), a ribose modification (RNA), an arabinose modification (ANA), a threose modification (TNA), a hexitol modification (HNA), an L-DNA, a cyclopentane modification (Car-NA), a cyclohexane modification (CHNA), or a modified sugar analog thereof.
[0018] In some embodiments, the modified sugar analog comprises a derivative or isomer of a sugar.
[0019] In some embodiments, the sugar modification comprises one or more of a 2'-substituted modification, a 3'-substituted modification, a 4'-substituted modification, and a 5'-substituted modification; in some embodiments, the sugar modification comprises one or more of a 2'-O-methyl, 2'F, 2'-O-methoxyethyl, 2'-O-C16 modification, 2'-deoxy-2'-fluoro-arabinose modification, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-formamide, 4'-O-methyl, 2',4'-bifluoro, and 2',2'-bifluoro.
[0020] In some embodiments, the sugar modification of the 2',2'-bifluoro is selected from 2',2'-difluoro-2'-deoxycytidine.
[0021] In some embodiments, the sugar modification comprises a ring-opening modification, a bicyclic modification, a tricyclic modification, an INV modification, or a derivative or isomer thereof. In some embodiments, the INV modification comprises an INV or a derivative or isomer thereof at the C1' position, alpha or beta. In some embodiments, the ring-opening modification comprises a GNA modification or a UNA modification. In some embodiments, the GNA modification is selected from an S-GNA modification. In some embodiments, the bicyclic modification comprises a LNA modification, a cEt modification, a BNA modification, or a bcDNA modification. In some embodiments, the tricyclic modification comprises a tcDNA modification.
[0022] In some embodiments, the base comprises a modified adenine, guanine, cytosine, uracil, thymine, hypoxanthine, 5-methylcytosine, or a base analog.
[0023] In some embodiments, the base modification comprises an alkyl modification.
[0024] In some embodiments, the base modification comprises: (a) an isomerization modification of the glycosidic bond linkage site, including N7 position of purine, N3 position of pyrimidine linkage, or pyrimidine 5 / 6 carbon glycosidic bond linkage; the N3 position of pyrimidine linkage can be isoU; or the pyrimidine 5 / 6 carbon glycosidic bond linkage can be pseudouridine;
[0025] (b) an oxidation modification, which can be 8-oxo-purine or 6-oxo-pyrimidine; or
[0026] (c) an alkyl or halo modification, which can be one or more of 5-halo / alkyl pyrimidine, 8 halo or alkyl purine.
[0027] In some embodiments, the base analog comprises: (a) an aza, deaza, or deaminated base, which can be 6-azapyrimidine, 8-azapurine, 3-deazapurine, 6-deaminoadenine, etc.; or
[0028] (b) a base analog having an aromatic ring system, which can be benzene or 2,4- difluorobenzene, nitroindole, benzimidazole, isoquinoline, or a derivative thereof.
[0029] In some embodiments, the guide agRNA, wherein at least 20%, 30%, 40%, 50%, or 60% of the nucleotides are fluorine modified at the 2' position of the sugar residue, or wherein the oligonucleotide comprises 3 to 20 2'-F modifications.
[0030] In some embodiments, the guide agRNA, wherein at least 10%, in some embodiments 10-80%, more in some embodiments 30-70% of the chemical modifications are 2'-O-methyl substituents.
[0031] In some embodiments, the guide agRNA, wherein at least 10%, in some embodiments 10-80%, more in some embodiments 30-70% of the chemical modifications are 2'-O-methoxyethyl substituents.
[0032] In some embodiments, the guide agRNA, wherein at least 0%, 10%, 20%, 30%, or 40% of the nucleotides have a bicyclic modification at the 2' position of the sugar residue.
[0033] In some embodiments, the bicyclic modification comprises a LNA modification or a cEt modification.
[0034] In some embodiments, the guide agRNA comprises one or more internucleoside linkages that are one or more of a phosphoramidate, a guanidyl phosphate, a phosphodiester, and a phosphorothioate.
[0035] In some embodiments, the guide agRNA, wherein one or more of the internucleoside linkages are phosphorothioate linkages, optionally wherein at least 30% of the linkages are phosphorothioate linkages, in some embodiments wherein 40% to 95% of the linkages are phosphorothioate linkages.
[0036] In some embodiments, the guide agRNA, wherein (i) less than 60%, 50%, 45%, 40%, or 30% of the internucleoside linkages are phosphodiester linkages; and / or (ii) no more than 95%, 80%, 70%, 60%, 50%, 40%, 30%, or 20% of the internucleoside linkages are phosphodiester linkages.
[0037] In some embodiments, the 5' splice site has the consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0038] In some embodiments, the 3' splice site or pseudo 3' splice site has the consensus NAG / N motif.
[0039] In some embodiments, the "N" is one of A, U, G, C, or I base, and " / " is an exon-intron boundary.
[0040] In some embodiments, the adenine in the 3' splice site or pseudo 3' splice site NAG / N sequence is edited by ADAR.
[0041] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0042] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0043] In some embodiments, the guide agRNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA to I.
[0044] In some embodiments, the guide agRNA is fully complementary paired or incompletely complementary paired to the pre-mRNA.
[0045] In some embodiments, the incomplete base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region.
[0046] In some embodiments, the guide agRNA has at least one mismatch to the pre-mRNA.
[0047] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.
[0048] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C, or a base derivative thereof.
[0049] In some embodiments, the guide agRNA forms a double-stranded RNA with the pre-mRNA that is incompletely base complementary paired.
[0050] In some embodiments, the complementary strands are base complementary paired at non-mismatch or non-deletion or non-bulge or non-internal loop or non-wobble base pairing sites.
[0051] In some embodiments, the proportion of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%.
[0052] In some embodiments, the ratio of complementary paired bases in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%.
[0053] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and the editing efficiency of the pre-mRNA is greater than 1% after the binding.
[0054] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0055] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0056] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0057] In some embodiments, the sequence length of the guide agRNA is 10-300 bp. In some embodiments, the sequence length of the guide agRNA is 20-150 bp. In some embodiments, the sequence length of the guide agRNA is 20-100 bp. In some embodiments, the sequence length of the guide agRNA is 20-70 bp.
[0058] In some embodiments, the sequence of the guide agRNA is selected from a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences contained in the guide agRNA sequences as set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or expressed by a vector containing any one of the sequences of SEQ ID NOs: 201-203.
[0059] In some embodiments, the drug is a drug for treating Dravet syndrome.
[0060] In some embodiments, the disclosure provides a guide agRNA, wherein the guide agRNA comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to the sequence of any one of SEQ ID NOs: 303-428.
[0061] In some embodiments, the guide agRNA comprises at least 2 domains connected by a linker between the domains. In some embodiments, the linker is a polyethylene glycol. In some embodiments, the polyethylene glycol is selected from a group consisting of a dimeric ethylene glycol.
[0062] In some embodiments, the guide agRNA has a modification comprising one or more of a backbone modification, a sugar modification, and a base modification.
[0063] In some embodiments, the backbone modification comprises one or more of a phosphorothioate linkage modification, an alkylphosphonate modification, a phosphoramidate modification, a peptide nucleic acid modification, and a 2’-5’ linked phosphate linkage modification.
[0064] In some embodiments, the phosphoramidate modification comprises a guanyl phosphate amidite modification or a methanesulfonyl phosphate amidite modification.
[0065] In some embodiments, the sugar modification comprises one or more of a deoxyribose modification, a ribose modification, an arabinose modification, a threose modification, a hexitol modification, an L-DNA, a cyclopentane modification, a cyclohexane modification, or a modified sugar analog thereof.
[0066] In some embodiments, the modified sugar analog comprises a derivative or isomer of a sugar.
[0067] In some embodiments, the sugar modification comprises one or more of a 2’-substitution modification, a 3’-substitution modification, a 4’-substitution modification, and a 5’-substitution modification. In some embodiments, the sugar modification comprises one or more of a 2’-O-methyl, 2’F, 2’-O-methoxyethyl, 2’-O-C16 modification, 2'-deoxy-2'-fluoroarabinose modification, 2’-O-[2-(methylamino)-2-oxoethyl], 2’-formamide, 4’-O-methyl, 2’,4’-difluoro, and 2’,2’-difluoro.
[0068] In some embodiments, the 2',2'-difluoro sugar modification is selected from 2',2'-difluoro-2'-deoxycytidine.
[0069] In some embodiments, the sugar modification comprises a ring opening modification, a bicyclic modification, a tricyclic modification, an INV modification, or a derivative or isomer thereof. In some embodiments, the INV modification comprises an INV or a derivative or isomer thereof at the C1' position, alpha or beta. In some embodiments, the ring opening modification comprises a GNA modification or a UNA modification. In some embodiments, the GNA modification is selected from an S-GNA modification. In some embodiments, the bicyclic modification comprises a LNA modification, a cEt modification, a BNA modification, or a bcDNA modification; in some embodiments, the tricyclic modification comprises a tcDNA modification.
[0070] In some embodiments, the base comprises a modified adenine, guanine, cytosine, uracil, thymine, hypoxanthine 5-methylcytosine, or a base analog.
[0071] In some embodiments, the base modification comprises an alkyl modification.
[0072] In some embodiments, the base modification comprises: (a) an isomerization modification of the glycosidic bond linkage site, including N7 position of purine, N3 position linkage of pyrimidine, or pyrimidine 5 / 6 carbon glycosidic bond linkage; the N3 position linkage of the pyrimidine can be isoU; or the pyrimidine 5 / 6 carbon glycosidic bond linkage can be pseudouridine;
[0073] (b) an oxidation modification, which can be 8-oxo-purine or 6-oxo-pyrimidine; or
[0074] (c) an alkyl or halo modification, which can be one or more of 5-halo / alkyl pyrimidine, 8 halo or alkyl purine.
[0075] In some embodiments, the base analog comprises: (a) an aza, deaza, or deaminated base, which can be 6-azapyrimidine, 8-azapurine, 3-deazapurine, 6-deaminoadenine, etc.; or
[0076] (b) a base analog with an aromatic ring system, which can be benzene or 2,4- difluorobenzene, nitroindole, benzimidazole, isoquinoline, or a derivative thereof.
[0077] In some embodiments, the guide agRNA comprises a sequence as set forth in SEQ ID NOs: 10-200, a sequence as set forth in SEQ ID NOs: 217-302, or,
[0078] a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with any one of the sequences contained in a guide agRNA sequence contained in a sequence expressed by a vector containing any one of SEQ ID NOS: 201-203.
[0079] In some embodiments, the present disclosure provides a vector comprising a polynucleotide encoding the guide agRNA.
[0080] In some embodiments, the vector is a recombinant expression vector.
[0081] In some embodiments, the vector comprises a plasmid or a viral vector. In some embodiments, the vector is a delivery vector. In some embodiments, the vector is a plasmid or a viral vector for expression in a higher eukaryotic cell or a prokaryotic cell.
[0082] In some embodiments, the present disclosure provides a composition comprising a viral vector comprising a polynucleotide encoding or comprising a guide agRNA that binds to a targeting portion of a pre-mRNA encoding a Nav1.1 protein; the guide agRNA comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with at least any one of the sequences set forth as SEQ ID NOS: 10-200, the sequences set forth as SEQ ID NOS: 217-302, or a guide agRNA sequence contained in a sequence expressed by a vector containing any one of SEQ ID NOS: 201-203.
[0083] In some embodiments, when the guide agRNA is introduced into a cell having a pre-mRNA encoding the Nav1.1 protein, the guide agRNA increases the expression level of the processed Nav1.1 protein-encoding in the cell.
[0084] In some embodiments, the present disclosure provides a host cell comprising the guide agRNA, the vector, or the composition.
[0085] In some embodiments, the present disclosure provides a pharmaceutical composition comprising the guide agRNA or a complement thereof and a pharmaceutically acceptable excipient.
[0086] In some embodiments, the present disclosure provides a method of treating a disease in a subject in need thereof by altering expression of a target protein or functional RNA in a cell of the subject, comprising contacting a cell of the subject with the guide agRNA, the vector, or the composition, or the host cell or the pharmaceutical composition.
[0087] In some embodiments, the present disclosure provides use of the guide agRNA, the vector, or the composition, or the host cell or the pharmaceutical composition in the manufacture of a medicament for treating a disease in a subject in need thereof by altering expression of a target protein or functional RNA in a cell of the subject.
[0088] In some embodiments, the disease in the subject in need thereof comprises a disease or disorder associated with a loss-of-function mutation in the SCN1A gene.
[0089] In some embodiments, the disease comprises Dravet syndrome, but is not limited thereto.
[0090] In some embodiments, the present disclosure provides a method of treating Dravet syndrome, comprising administering to a patient or individual the guide agRNA, the vector, or the composition, or the host cell or the pharmaceutical composition.
[0091] In some embodiments, the cell has a precursor mRNA encoding a target protein Nav1.1, wherein the precursor mRNA comprises an intron, an exon flanked by a 5’ splice site of the intron, and an exon flanked by a 3’ splice site or a pseudo 3’ splice site of the intron.
[0092] In some embodiments, the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR within the cell, thereby forming a complex containing the ADAR protein.
[0093] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo 3' splice site to edit the A base of the 3' splice site or pseudo 3' splice site, thereby splicing out the entire exon flanked by the 3' splice site or pseudo 3' splice site of the intron from the pre-mRNA, causing the exon to skip, thereby altering the level or sequence of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.
[0094] In some embodiments, the 5' splice site has the consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0095] In some embodiments, the 3' splice site or pseudo 3' splice site has the consensus N / AGN motif.
[0096] In some embodiments, the "N" is any base, and " / " is the exon-intron boundary.
[0097] In some embodiments, the adenine in the 3' splice site or pseudo 3' splice site N / AGN sequence is edited by ADAR.
[0098] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0099] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0100] In some embodiments, the guide agRNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A to I in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA. BRIEF DESCRIPTION OF DRAWINGS
[0101] FIG. 1 shows the map of the human SCN1A gene reporter plasmid.
[0102] FIG. 2 shows the map of the murine SCN1A gene reporter plasmid.
[0103] FIG. 3 shows the map of the SCN1A expression vector. (A) pCAG-mSCNA-WPRE plasmid map. (B) pCMV(CAT)T7-SB100 plasmid map.
[0104] FIG. 4 shows the verification results of the SCN1A gene transcription expression of the mSCN1A-Hela stable cell strain.
[0105] FIG. 5 shows the verification results of the SCN1A gene transcription expression of the human SCN1A gene reporter plasmid.
[0106] Figure 6 shows the results of the verification of the transcriptional expression of the SCN1A gene of the mouse-derived SCN1A gene reporter plasmid.
[0107] Figure 7 shows the expression of the SCN1A gene in the brain tissue of wild-type C57BL / 6 mice on the second day after birth.
[0108] Figure 8 shows the expression results of the SCN1A gene in the brain tissue of adult wild-type C57BL / 6 mice.
[0109] Figure 9 shows the editing efficiency of agRNA in Hela cells.
[0110] Figure 10 shows the plasmid maps of pC0043-U6-SCN1A-51nt-circle (A), pC0043-U6-SCN1A-101nt-circle (B) and pC0043-U6-SCN1A-151nt-circle (C).
[0111] Figure 11 shows the functional verification of the plasmid expressing agRNA targeting the 3' splice site of the pseudo-exon of the SCN1A gene. (A) is the transcriptional expression results of the SCN1A gene. (B) is the expression of the productive transcription product of the SCN1A gene detected by fluorescence quantitative PCR. (C) is the expression of the non-productive transcription product of the SCN1A gene detected by fluorescence quantitative PCR. (D) is the editing efficiency results. (E) is the original map of Sanger sequencing.
[0112] Figure 12 shows the splicing jump effect of the pseudo-exon after the 3' splice site is mutated from AG to GG. (A) is the transcriptional expression results of the SCN1A gene. (B) is the expression of the productive transcription product of the SCN1A gene detected by fluorescence quantitative PCR. (C) is the expression of the non-productive transcription product of the SCN1A gene detected by fluorescence quantitative PCR. DETAILED DESCRIPTION
[0113] The technical solutions of the present disclosure are further illustrated below by specific examples, which do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others according to the concept of the present disclosure still fall within the protection scope of the present disclosure.
[0114] Certain definitions
[0115] In the present disclosure, the term "guide agRNA", also known as "Antisense Oligonucleotide guide RNA", abbreviated as "agRNA", generally refers to an oligonucleotide in single-stranded or double-stranded form which is artificially synthesized. The structure, binding site, etc. of the agRNA can be changed by modifying the agRNA. In the present disclosure, the agRNA can be in single-stranded form, and its function can be to complementarily pair with a specific sequence of the target RNA and edit it.
[0116] In the present disclosure, the term "pseudo 3' splice site" generally has the same splice recognition sequence as the true splice site, but is not used in the splicing reaction. The pseudo 3' splice site has the same NAG / N motif as the 3' splice site, where N is any nucleotide, and / is the exon-intron boundary. The number of pseudo 3' splice sites is an order of magnitude greater than the number of true splice sites in the human genome, and is generally suppressed by molecular mechanisms that have not yet been fully understood. The activation of the pseudo 3' splice site is positively affected by the surrounding nucleotides, which make the pseudo 3' splice site more similar to the optimal consensus sequence YAG / G of the true splice site, where Y is C or U.
[0117] In the present disclosure, the term "modification" generally refers to modification of a natural or artificially synthesized component. The modification can include modification of a base, modification of a nucleoside, modification of a sugar, modification of an internucleotide linkage; can include chemical modification and non-chemical modification.
[0118] In the present disclosure, the term "nucleotide" refers to a respective nucleobase- ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate or a unit containing any chemical modification in the nucleobase, sugar, and phosphate linkage. Therefore, non-limiting examples of nucleotides include locked nucleic acid (LNA) with modification in the sugar moiety, unlocked nucleic acid (UNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), arabino nucleic acid (ANA), cyclopentane nucleic acid (Car-NA), tricyclo-DNA (tcDNA), constrained ethyl modification (cET), bridged nucleic acid (BNA), bicyclo-DNA (bcDNA), morpholino (PMO), etc., also including 2'-F / OMe / MOE / NMA modified nucleotides, also including phosphorothioate, alkylphosphonate, phosphoramidate, etc. with modification in the phosphate linkage; also including 5-methylcytosine, 8-OXO-adenine, pseudouridine, isouridine, etc. with modification in the nucleobase moiety. In the present disclosure, the terms "adenosine" and "adenine" (abbreviation "A"), "guanosine" and "guanine" (abbreviation "G"), "cytidine" and "cytosine" (abbreviation "C"), "uridine" and "uracil" (abbreviation "U"), "thymidine" and "thymine" (abbreviation "T"), "inosine" and "inosine" (abbreviation "I") are used interchangeably.
[0119] In the present disclosure, the term “complementary pairing” is used interchangeably with “complementarity” and generally refers to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. In the present disclosure, base pairing can refer to A-T, C-G, T*A / T, C*G / C. In the present disclosure, complementary pairing can be perfect complementary pairing, or there can be one or more bulges, wobbles, deletions, and / or mismatches between nucleic acid molecules. In the present disclosure, an agRNA can form a duplex complex with a target RNA through complementary pairing.
[0120] In the present disclosure, the term “bulge” generally refers to a region where the upstream and downstream bases of the bulge region are both complementary paired to the target RNA strand and the corresponding two bases of the target RNA strand are consecutive.
[0121] In the present disclosure, the term “wobble” generally refers to G-U, I-C pairing.
[0122] In the present disclosure, the term “deletion” generally refers to a region where the upstream and downstream bases of the deletion region are consecutive and there are corresponding number of bases of the target RNA strand in the deletion region.
[0123] In the present disclosure, the term “mismatch” generally refers to a situation where the opposing nucleotides in a duplex RNA complex are not perfect base pairs according to Watson-Crick base pairing rules. The type of mismatch can be one of A-A, A-G, A-C, U-U, U-C, G-G, G-A, C-A, C-C, C-U, I-A, I-U, I-G.
[0124] In the present disclosure, the term “perfect complementary pairing” generally refers to a situation where there are only strict Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. There are no bulges, wobbles, deletions, and / or mismatches in perfect complementary pairing.
[0125] In the present disclosure, the term “treatment” generally refers to: (1) preventing a disease, disorder, and / or condition from occurring in a patient that can be predisposed to the disease, disorder, and / or condition, but has not yet been diagnosed as having it; (2) inhibiting the disease, disorder, or condition, i.e., arresting its development; and (3) relieving the disease, disorder, or condition, i.e., causing the disease, disorder, and / or condition and / or symptoms associated with the disease, disorder, and / or condition to regress.
[0126] In the present disclosure, the term “delivery vector” generally refers to a vector that delivers one or more nucleotides to a cell. The vector can include a viral vector, a non-viral vector. The viral vector can include a lentivirus (LV) vector, an adenovirus (AdV) vector, and an adeno-associated virus (AAV) vector, etc. The non-viral vector can include a liposome, a molecular conjugate, a polymer, a complex vector, and a nanoparticle vector, etc. In the present disclosure, the delivery vector can deliver the agRNA or the isolated nucleic acid molecule described in the present disclosure into a cell.
[0127] In the present disclosure, the term “subject” generally refers to a human or a non-human animal, including but not limited to a cat, a dog, a horse, a pig, a cow, a sheep, a rabbit, a mouse, a rat, or a monkey.
[0128] In the present disclosure, the term “RNA editing” generally refers to a co-transcriptional or post-transcriptional modification process that introduces changes in a genomic-encoded RNA sequence, resulting in RNA mutations. Adenosine editing in double-stranded RNA (dsRNA) from adenosine to inosine (A-to-I) is catalyzed by adenosine deaminases of the RNA-acting (ADAR) enzyme family, and is a common type of RNA editing in mammals. In vertebrates, a family of three ADAR proteins, ADAR1, ADAR2, and ADAR3, has been previously characterized. ADAR1 and ADAR2 (ADARs) catalyze all currently known A-to-I editing sites. ADAR3 has no known deaminase activity. Inosine (I) mimics guanosine (G), so ADAR proteins introduce a virtual A-to-G substitution in the transcript. This change can result in specific amino acid substitutions, alternative splicing, miRNA-mediated gene silencing, or changes in transcript localization and stability.
[0129] In the present disclosure, the term “cell” generally includes prokaryotic cells and eukaryotic cells. A nucleic acid can be transfected in a cell, a plasmid can be propagated in a prokaryotic cell, and a nucleic acid can be expressed, encoding a polypeptide, in a eukaryotic cell. For example, a cell can include an agRNA and / or a delivery vector. A cell can be a cell from any organ, such as skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, etc. For example, a cell can be a human cell or a mouse cell. For example, a cell can be an immune cell. For example, an immune cell can be a T cell, a B cell, a natural killer cell (NK cell), a macrophage, an NKT cell, a monocyte, a dendritic cell, a granulocyte, a lymphocyte, a leukocyte, a peripheral blood mononuclear cell, an embryonic stem cell, a lymphoid progenitor cell, and / or a pluripotent stem cell. For example, an immune cell can be a T cell.
[0130] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes multiple such methods, and reference to “the fragment” includes reference to one or more fragments and equivalents thereof known to those skilled in the art, and so forth.
[0131] The term “and / or,” as used herein, refers to and encompasses any and all possible combinations of one or more of the associated listed items. The term “and / or” when used in a list of two or more items, means that any one of the listed items can be employed by itself, or any combination of two or more of the listed items can be employed. For example, if a composition, combination, method, etc. is described as comprising (or containing or including) components A, B, C, and / or D, the composition can comprise A alone; B alone; C alone; D alone; a combination of A and B; a combination of A and C; a combination of A and D; a combination of B and C; a combination of B and D; a combination of C and D; a combination of A, B, and C; a combination of A, B, and D; a combination of A, C, and D; a combination of B, C, and D; or a combination of A, B, C, and D.
[0132] It is further understood that where the term “comprising” is used in the description of the various embodiments, it is to be understood that the embodiments can alternatively be described using the language “consisting essentially of” or “consisting of.”
[0133] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although many methods and reagents are similar or identical to those described herein, exemplary methods and materials are disclosed.
[0134] It is to be understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments or aspects only and is not intended to limit the scope of the present disclosure.
[0135] Herein, pre-mRNA (pre-messenger RNA) refers to the primary transcription product produced during the process of gene transcription, which contains a mixed sequence composed of exon and intron sequences.
[0136] As used herein, a mature mRNA is a pre-mRNA molecule that has been processed during splicing. Intronic sequences are removed from the pre-mRNA, while exonic sequences are joined together, resulting in a mature mRNA molecule that contains only the information needed to encode a protein. This mature mRNA molecule can be translated into a protein that participates in the biological activities of a cell.
[0137] The term "pharmaceutically acceptable" as used herein means those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients without causing additional toxicity, irritation, allergic response, or other problem or complication (i.e., commensurate with a reasonable risk / benefit ratio).
[0138] As used herein, a "pharmaceutical composition" refers to a therapeutically effective amount of a drug in combination with a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant, and / or carrier. As used herein, a "therapeutically effective amount" refers to an amount that provides a therapeutic effect for a given disorder and dosing regimen. In some embodiments, these compositions are liquid or lyophilized formulations, or otherwise dry formulations, containing various buffered contents (e.g., Tris-HCl, acetate, phosphate), diluents of various pH and ionic strength, additives such as albumin or gelatin to prevent adsorption to surfaces, denaturants (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts). Solubilizers (e.g., glycerol, polyethylene glycol), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., thimerosal, benzyl alcohol, parabens), bulking agents or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to proteins, complexation with metal ions, or incorporation of the material into or onto particular preparations of polymeric compounds (e.g., polylactic acid, polyglycolic acid, hydrogels, etc.), or onto liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions would influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance. Controlled release or sustained release compositions include formulations in lipophilic depots (e.g., fatty acids, waxes, oils).
[0139] The terms "oligonucleotide," "nucleotide sequence," and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs.
[0140] In some embodiments, the ADAR is naturally present in a host cell, such as a eukaryotic cell (preferably a mammalian cell, more preferably a human cell). In some embodiments, the ADAR is introduced into the host cell.
[0141] The experimental methods used in the examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available unless otherwise specified.
[0142] Herein, the sequence of human SCN1A gene (5'-3') is referenced to NCBI Reference Sequence: NC_000002.12. Herein, the sequence of murine SCN1A gene (5'-3') is referenced to NCBI Reference Sequence: NC_000068.7.
[0143] Herein, for the sequence with base modification, the modification of the base is as specified in the description herein. Herein, "base derivative" refers to modification on the base, for example, C base can be replaced by 5mC (5-methylcytosine) and the like.
[0144] Herein, for example, the description of "the sequence as shown in SEQ ID NO: 10", the sequence includes unmodified and modified, which means that the base and modification are the same as SEQ ID NO: 10: LC*LA*LA*G*U*U*G*G*A*G*C*A*A*G*A*U*U*A*U*C*C*C*A*U*A*C*A*A*LA*LA*LT, and the like.
[0145] In the following examples herein, dN in sequences SEQ ID NO: 9-SEQ ID NO: 200 and SEQ ID NO: 217-SEQ ID NO: 302, etc. (sequences containing modifications) represents a DNA base; d5mC refers to a 5-methyl-modified C base of DNA; the remaining N represents an RNA base; I base represents inosine, dI represents an inosine base of DNA, and rI or I represents an inosine base of RNA; “eN” represents a 2’-O-methoxyethyl (2’-MOE)-modified base; wherein “eI” represents a 2’-MOE-modified I base; “*” represents a phosphorothioate bond (unless otherwise specified, it refers to a monophosphorothioate bond); “L” is LNA, and “LN” represents a locked nucleic acid (LNA)-modified base; “fN” represents a 2’-F-modified base; wherein “fI” represents a 2’-F-modified I base; “e5mN”: 2’-MOE-modified 5-methyl base; “m5mN”: 2’-OMe-modified 5-methyl base; “mN” represents a 2’-O-methyl (2’-OMe)-modified base; “5mN” represents a 5-methyl-modified base; “L5mN” represents a LNA-modified 5-methyl base; “f5mN” represents a 2’-F-modified 5-methyl base; SEQ ID NO: 173 contains a cET modification (constrained ethylbridged nucleic acid), which is represented as “cETN” in the original sequence.
[0146] Herein, PEG2 refers to a PEG2 (dimeric ethylene glycol)-modification, specifically refers to using PEG2 as a linker to connect the two bases upstream and downstream in the agRNA. Sequences SEQ ID NO: 258-SEQ ID NO: 270, etc. have PEG2 modification, which is represented as “PEG2” in the original sequence.
[0147] In addition, some of the sequences in SEQ ID NO: 124-SEQ ID NO: 302, etc. also contain rare modifications, which are as follows:
[0148] SEQ ID NO: 124 contains an S-GNA modification (see DOI: 10.1261 / rna.079526.122), which is represented as “sgN” in the original sequence;
[0149] SEQ ID NO: 133, 142, 144, 146, 162, 195, 241, etc. contain a 2’F-ANA modification (see DOI: 10.1021 / acs.accounts.1c00125), which is represented as “FN” in the original sequence;
[0150] The sequences SEQ ID NO: 149, 168, 170, 175, 247, 248, 249, etc. contain INV modification (see DOI: 10.1089 / ard.1992.2.129), the modified base is C base or A base of DNA, which is represented as "idC" or "idA" in the original sequence;
[0151] The sequences SEQ ID NO: 153, 163, etc. contain L-DNA modification (DOI: 10.1021 / bi00191a015), the modified base is C base of DNA, which is represented as "LdC" in the original sequence;
[0152] The sequences SEQ ID NO: 242, 243, 245, 246, 249, 250, 251, 252, 254, etc. contain TNA modification (DOI: 10.1021 / acs.joc.5b02768), the modified base is A base or C base of DNA, which is represented as "TNA-A" or "TNA-C" in the original sequence;
[0153] The sequences SEQ ID NO: 240 and SEQ ID NO: 254, etc. contain 2',2'-difluoro-2'-deoxycytidine (diFC) modification (Chem. Eur. J. 2021, 27, 7351–7355, DOI: 10.1002 / chem.202100503). The sequences SEQ ID NO: 255 to SEQ ID NO: 257, etc. contain C16 modification (or 2'-O-C16 modification) (DOI: 10.1038 / s41587-022-01334-x), which is represented as C16 in the original sequence. The sequences SEQ ID NO: 271 to SEQ ID NO: 285, etc. contain Mesyl Phosphoramidate modification, which is represented as "&" in the original sequence (DOI: 10.1007 / 978-981-19-9776-1_19). The sequences SEQ ID NO: 286 to SEQ ID NO: 302, etc. contain Phosphoryl Guanidine (PN) modification, which is represented as "^" in the original sequence (DOI: 10.1016 / j.omtn.2021.11.025).
[0154] In this document, the sequence is 5'→3' from left to right, unless otherwise specified.
[0155] In this paper, the relevant sequences of SCN1A gene are shown in Table 1, SEQ ID NO: 1 is the pre-mRNA sequence of human SCN1A gene exon 20; SEQ ID NO: 5 is the pre-mRNA sequence of mouse SCN1A gene exon 21. SEQ ID NO: 4 is the pre-mRNA of human SCN1A gene pseudo-exon; SEQ ID NO: 8 is the pre-mRNA of mouse SCN1A gene pseudo-exon.
[0156] Table 1 Human and mouse SCN1A sequences
[0157] In the examples herein, the unmodified sequence corresponding to the guide agRNA involved is shown in Table 2 as follows:
[0158] Table 2
[0159] Example 1 Construction of SCN1A gene reporter plasmid
[0160] 1. Human SCN1A gene reporter plasmid:
[0161] Using human genomic DNA as a template, three fragments of SCN1A gene were amplified by PCR, and homologous arms were added. The first fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166866129-166866451; the second fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166863640-166863903; and the third fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166858882-166859363. The pcDNA3.1 vector was linearized by Nhe I and Hind III double digestion, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The map of the human SCN1A gene reporter plasmid is shown in Figure 1.
[0162] 2. Mouse SCN1A gene reporter plasmid:
[0163] The genomic DNA of C57BL / 6 mice was used as a template to amplify three fragments of the SCN1A gene by PCR, and homologous arms were added. The first fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66126997-66127319; the second fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66123676-66124739; and the third fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66119118-66119599. The pcDNA3.1 vector was linearized by NheI and HindIII double digestion, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The map of the murine SCN1A gene reporter plasmid is shown in FIG. 2.
[0164] Example 2 Construction of mSCN1A-Hela stable cell strain and detection of gene expression
[0165] Construction of pCAG-mSCN1A-WPRE plasmid: The sequence of the SCN1A gene in the murine SCN1A gene reporter plasmid was amplified by PCR and homologous arms were added to obtain an insertion fragment. The pCAG-WPRE was linearized by NheI and SpeI double digestion, and the insertion fragment was connected into the vector by homologous recombination to obtain the pCAG-mSCNA-WPRE plasmid.
[0166] According to the conventional cell passage and transfection procedures, the SCN1A expression vector pCAG-mSCNA-WPRE (FIG. 3A) and pCMV(CAT)T7-SB100 (FIG. 3B) plasmids were co-transfected into Hela cells. After 48 hours of transfection, the selection drug G418 was added, and the medium was changed every two days. When there were no living cells in the untransfected group, the selection of the Hela cell strain stably expressing the murine SCN1A gene was completed, and the mSCN1A-Hela stable cell strain was obtained.
[0167] The obtained mSCN1A-Hela stable cell strain was inoculated in a 24-well cell culture plate, and after 12 hours, Lipofectamine TM RNAiMAX was used to transfect 20 pmol of positive drug ASO into cells. 48 hours after transfection of ASO, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Norgen, catalog number: RC101-01) according to the instructions. Then the RNA was reverse transcribed to obtain cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Norgen, catalog number: R312-02) according to the instructions. Then 2 x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit was used to perform PCR amplification with cDNA as template using primer pair Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 204) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 205) according to the instructions. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.
[0168] The results are shown in Figure 4. The mSCN1A-Hela stable cell strain can stably express the mouse SCN1A gene fragment, and there are two transcription products, one is a non-productive transcription product containing a pseudo-exon, and the other is a productive transcription product not containing a pseudo-exon. After treatment with the positive drug (SEQ ID NO: 11, the specific sequence is shown in Table 3), the non-productive transcription product decreased, and the productive transcription product significantly increased, indicating that the mSCN1A-Hela stable cell strain constructed in the present disclosure can be effectively used to verify the function of the agRNA targeting the pseudo-exon of the mouse SCN1A gene.
[0169] Example 3 Detection of gene expression of SCN1A gene reporter plasmid
[0170] Hela cells were seeded in a 24-well cell culture plate, and 12 hours later, the reporter plasmid was transfected into Hela cells using Lipofectamine 3000 reagent, 500 ng of human SCN1A gene reporter plasmid (as shown in Example 1) or mouse SCN1A gene reporter plasmid (as shown in Example 1) was transfected per well, and 12 hours later, the cells were treated with Lipofectamine TMRNAiMAX was used to transfect 20 pmol of the positive drug into the cells. After 48 hours of treatment with the positive drug (SEQ ID NO: 9, the specific sequence is shown in Table 3), the total RNA of the cells was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novoprotein, product number: RC101-01) according to the instructions.
[0171] The RNA was then reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Novoprotein, product number: R312-02) according to the instructions. Then, using the 2x Taq PCR StarMix (manufacturer: GenStar, product number: A012) kit according to the instructions, the human SCN1A gene was amplified using the Human-F: GAGACCTCTAAGAGCCTTATCTCG (SEQ ID NO: 206) and Human-R: TCATGATGGATGGAATTGCT (SEQ ID NO: 207) primer pairs, and the mouse SCN1A gene was amplified using the Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 204) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 205) primer pairs. The PCR products were subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.
[0172] The experimental results are shown in Figures 5 and 6. The human and mouse SCN1A gene reporter plasmids can correctly express the SCN1A gene fragment in cells, and there are two types of transcription products, namely the non-productive transcription product containing the pseudo-exon and the productive transcription product not containing the pseudo-exon. After treatment with the positive drug, the non-productive transcription product decreased and the productive transcription product significantly increased, indicating that the human and mouse SCN1A gene reporter plasmids constructed in the present disclosure can be effectively used to verify the function of the agRNA targeting the pseudo-exon of the human or mouse SCN1A gene.
[0173] Example 4 Verification of Transcriptional Expression of SCN1A Gene in C57BL / 6 Mouse Brain Tissue
[0174] The brain tissues of adult and day-two-old wild-type C57BL / 6 mice were separated, and then the expression of the SCN1A gene was detected according to the method in Example 2.
[0175] The experimental results are shown in FIG. 7 and FIG. 8. The SCN1A gene in the brain tissue of adult and second-day-old wild-type C57BL / 6 mice expresses both non-productive transcription products containing pseudo-exons and productive transcription products not containing pseudo-exons. The expression of non-productive transcription products of the SCN1A gene in the brain tissue of adult wild-type C57BL / 6 mice is lower than that of second-day-old wild-type C57BL / 6 mice. The experimental results show that wild-type C57BL / 6 mice can be effectively used to verify the function of agRNA targeting the pseudo-exon of the mouse-derived SCN1A gene.
[0176] Example 5 Verification of the function of agRNA targeting the 3' splice site of the pseudo-exon of the human-derived SCN1A gene in HEK293T-ADAR-OE cells
[0177] 1. HEK293T-ADAR-OE cells overexpressing ADAR protein were seeded in a 48-well cell culture plate, and after 12 hours, human-derived SCN1A gene reporter plasmid (as shown in Example 1) was transfected into the cells using Lipofectamine 3000 reagent, with 250 ng of plasmid transfected per well. After 8 hours of plasmid transfection, 10 pmol of agRNA was transfected into the cells using Lipofectamine RNAiMAX, and the control group was not transfected with agRNA. After 48 hours of agRNA transfection, the total RNA of the cells was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Subsequently, the RNA was reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions. TM RNAiMAX transfection into cells, and the control group was not transfected with agRNA. After 48 hours of agRNA transfection, the total RNA of the cells was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Subsequently, the RNA was reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.
[0178] 2. Real-time fluorescent quantitative PCR detection: Using the ChamQ SYBR qPCR Master Mix kit, the expression changes of the SCN1A gene productive transcription products were detected by real-time fluorescent quantitative PCR using the HPrimer1-F and HPrimer1-R primer pairs as templates, and the expression changes of the SCN1A gene non-productive transcription products were detected by real-time fluorescent quantitative PCR using the HPrimer2-F and HPrimer2-R primer pairs according to the instructions.
[0179] 3. First-generation sequencing Sanger sample preparation: The 2xTaq PCR StarMix (manufacturer: GenStar, product number: A012) kit was used according to the instructions to amplify the pre-mRNA of the SCN1A gene using HPrimer3-F and HPrimer3-R primers as templates, and the PCR products were subjected to Sanger sequencing.
[0180] 4. Sanger data RNA editing level measurement: The raw sequencing files obtained by Sanger sequencing need to measure the editing level of the editing site. The present disclosure uses the EditR software (https: / / moriaritylab.shinyapps.io / editr_v10 / ) for calculation and analysis. The software analyzes the peak value of each base of A, T, G, and C in the upstream and downstream regions of the editing site. The calculation method of editing efficiency is 100*(1-A peak / A+T+C+G peak sum).
[0181] The primer sequences used in this example are shown in Table 3.
[0182] Table 3 Primer sequences for detecting human SCN1A gene
[0183] This example designs a series of agRNAs targeting the pre-mRNA of the human SCN1A gene, and the sequences of the regions they target are located on the Human GRCh37 / hg19: chr2. The experimental results are shown in Table 4. The results show that the agRNAs designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can induce RNA editing of the 3' splice site of the pseudo-exon of the SCN1A gene pre-mRNA in cells, can induce splicing skipping of the pseudo-exon of the SCN1A gene, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene. The agRNAs designed by the present disclosure have better effects than the ASO (SEQ ID NO: 9) of the prior art under the same experimental conditions.
[0184] Table 4 Function verification of agRNAs targeting the 3' splice site of the pseudo-exon of the human SCN1A gene
[0185] Note: The conventional fluorescent quantitative PCR method is used for detection. The "% control" in the table means that the expression of the detected gene in the treatment group is 100% of the control group. For example, 167% means that the expression of the detected gene in the treatment group is 167% of the control group.
[0186] Example 6 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene of mice in Hela cells
[0187] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene (obtained by the method of Example 2) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 48 hours after transfection of the agRNA, the expression of the SCN1A gene and the editing of the target site of the pre-mRNA of the SCN1A gene in the cells were detected according to the method in Example 6.
[0188] The cDNA was used as a template to detect the expression changes of the productive transcription product of the SCN1A gene in the cells transfected with the SCN1A gene reporter plasmid of mice by real-time fluorescent quantitative PCR using the ChamQ SYBR qPCR Master Mix kit according to the instructions, using the MPrimer1-F and MPrimer1-R primer pairs, and the expression changes of the non-productive transcription product of the SCN1A gene were detected by real-time fluorescent quantitative PCR using the MPrimer2-F and MPrimer2-R primer pairs. The cDNA was used as a template to amplify the pre-mRNA of the SCN1A gene in the cells transfected with the SCN1A gene reporter plasmid of mice and detect the editing efficiency of the target site using the 2x Taq PCR StarMix kit according to the instructions, using the MPrimer3-F and MPrimer3-R primer pairs.
[0189] The primer sequence information used in this example is shown in Table 5.
[0190] Table 5 Primer sequence for detection of SCN1A gene of mice
[0191] The experimental results are shown in Table 6, and the results show that the agRNAs designed by the disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in cells, and can induce splicing skipping of the pseudo-exon of the SCN1A gene in cells, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0192] Table 6 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene of mice
[0193] The values in this table are calculated in the same way as in Table 4.
[0194] Example 7 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene in C57BL / 6 mice
[0195] A single intracerebroventricular (ICV) injection was administered to C57BL / 6 mice on the second day after birth by the stereotaxic apparatus injection system of the RWD, 20 μg of agRNA was injected into each mouse in the administration group, and 3 mice were injected in each group; the same volume of vehicle (PBS) was injected into each mouse in the control group, and 3 mice were injected in each group. The mice were anesthetized and sacrificed on the 13th day after administration, the mouse brain tissue was isolated, and the expression of the SCN1A gene in the brain tissue was detected according to the method in Example 7.
[0196] The experimental results are shown in Table 7, and the results show that the agRNAs designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can all induce the splicing jump of the pseudo-exon of the SCN1A gene in the brain tissue of mice, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0197] Table 7 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene in C57BL / 6 mice
[0198] The values in this table are calculated in the same way as in Table 4.
[0199] Example 8 Verification of the editing efficiency of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene in Hela cells
[0200] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene (constructed according to the method of Example 1) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 12 hours later, wherein the control group was not transfected with agRNA. 48 hours after transfection of the agRNA, the editing of the target site of the pre-mRNA of the SCN1A gene in the cells was detected according to the method in Example 6. The 2x Taq PCR StarMix kit was used according to the instruction steps to amplify the pre-mRNA of the SCN1A gene in the cells transfected with the mouse SCN1A gene reporter plasmid using the MPrimer3-F and MPrimer3-R primers, and to detect the editing efficiency of the target site.
[0201] The experimental results are shown in Figure 9. The results show that the agRNA targeting the pseudo-exon 3' splicing site of the SCN1A gene designed in this disclosure can induce RNA editing of the pseudo-exon 3' splicing site in the pre-mRNA of the SCN1A gene expressed endogenously in cells.
[0202] Example 9: Functional Verification of agRNA Expressed by Plasmid
[0203] The aforementioned embodiments all synthesized agRNA through chemical synthesis. Whether agRNA targeting the 3' splicing site of the SCN1A gene pseudoexon, synthesized in vivo, has the same function as the SCN1A gene pseudoexon needs further verification. In this embodiment, three sequences, SEQ ID NO: 201, SEQ ID NO: 202, and SEQ ID NO: 203, were synthesized through gene synthesis, as shown in Table 8 below.
[0204] Table 8
[0205] The pC0043-U6-circle vector was linearized by double digestion with KpnI and XhoI, and the synthesized DNA fragments were ligated into the pC0043-U6-circle vector using homologous recombination. Three plasmids were obtained: pC0043-U6-SCN1A-51nt-circle, pC0043-U6-SCN1A-101nt-circle, and pC0043-U6-SCN1A-151nt-circle. The plasmid map is shown in Figure 10.
[0206] The mRNA expressed in cells from the plasmid pC0043-U6-SCN1A-51 nt-circle is circularized to form a circular mRNA under the action of a ribozyme, wherein a gRNA with a length of 51 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124216-66124266; the mRNA expressed in cells from the plasmid pC0043-U6-SCN1A-101 nt-circle is circularized to form a circular mRNA under the action of a ribozyme, wherein a gRNA with a length of 101 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124191-66124291; the mRNA expressed in cells from the plasmid pC0043-U6-SCN1A-51 nt-circle is circularized to form a circular mRNA under the action of a ribozyme, wherein a gRNA with a length of 151 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124166-66124316.
[0207] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene was inoculated in a 24-well cell culture plate, and after 12 hours, the above three plasmids were transfected into the cells using Lipofectamine 3000 reagent, 500 ng per well, three biological replicates per group, and the control group was transfected with the pC0043-U6 empty plasmid. After 48 hours of transfection, the expression of the SCN1A gene in the cells and the editing of the pre-mRNA target site of the SCN1A gene were detected according to the method in Example 6.
[0208] The experimental results are shown in Figure 11, and the results show that by using plasmid vectors to biosynthesize agRNAs of different lengths targeting the 3' splice site of the pseudo-exon of the SCN1A gene in cells, RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the SCN1A gene can be induced in cells (Figure 11D and Figure 11E), pseudo-exon splicing skipping of the SCN1A gene can be induced in cells (Figure 11A), expression of the productive SCN1A gene can be increased (Figure 11B), and expression of the non-productive SCN1A gene can be reduced (Figure 11C). Moreover, the results show that the longer the expressed agRNA, the higher the RNA editing efficiency of the 3' splice site of the pseudo-exon in the pre-mRNA of the SCN1A gene induced by the agRNA, and the better the pseudo-exon splicing skipping effect mediated by the agRNA.
[0209] Example 10 Disruption of the 3' splice site promotes splicing skipping of an exon in pre-mRNA
[0210] The 3' splice site AG / GATA sequence of the pseudo-exon (Exon20N) in the wild-type SCN1A gene reporter plasmid was mutated to GG / GATA by PCR site-directed mutation, and a mutant SCN1A gene reporter plasmid was obtained. Through gene expression detection of the mutant reporter plasmid, the influence of RNA editing mediated by ADAR proteinase to edit A base to I base to destroy the 3' splice site on the splicing of the pseudo-exon or exon in vivo was simulated.
[0211] HEK293T cells were seeded in a 24-well cell culture plate, and 12 hours later, wild-type and mutant human SCN1A gene reporter plasmids were transfected into HEK293T cells using Lipofectamine 3000 reagent, 500 ng of plasmid per well. After 24 hours of plasmid transfection, total RNA was extracted from the cells using the FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novozyme, catalog number: RC101-01) according to the instructions. Then the RNA was reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Novozyme, catalog number: R312-02) according to the instructions.
[0212] Using the 2x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit, the cDNA was used as a template, and the SCN1A gene was amplified using Primer4-F and Primer4-R primers according to the instructions. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection. The experimental results are shown in Figure 12A.
[0213] Using the ChamQ SYBR qPCR Master Mix kit, the cDNA was used as a template, and the SCN1A gene production transcription product expression change was detected by real-time fluorescent quantitative PCR using Primer5-F and Primer5-R primer pairs according to the instructions. The experimental results are shown in Figure 12B; the SCN1A gene non-productive transcription product expression change was detected by real-time fluorescent quantitative PCR using Primer6-F and Primer6-R primer pairs, and the experimental results are shown in Figure 12C.
[0214] The primer sequences used in this example are shown in Table 9.
[0215] Table 9 SCN1A gene detection primer sequences
[0216] The experimental results are shown in FIG. 12. When the 3' splice site AG / GATA sequence of the SCN1A pseudo-exon is mutated to GG / GATA, the pseudo-exon is skipped in the splicing process of the pre-mRNA, the expression of the productive transcription product in the mutant reporter plasmid is greatly up-regulated compared with the wild type, and the expression of the non-productive transcription product is greatly down-regulated compared with the wild type. The experimental results show that the destruction of the 3' splice site of the exon or pseudo-exon can effectively promote the splicing skipping of the exon or pseudo-exon.
[0217] Example 11 Verification of the function of the agRNA targeting the 3' splice site of the SCN1A gene pseudo-exon in hSCN1A-Hela stable transfection cells
[0218] The human SCN1A gene reporter plasmid constructed in Example 1 was transfected into Hela cells according to the conventional cell passage and transfection procedures. After 48 hours of transfection, the selection drug G418 was added, and the liquid was changed every two days. After the untransfected group had no living cells, the selection of the Hela cell strain stably transfected with the mouse SCN1A gene was completed, and the hSCN1A-Hela stable transfection cell strain was obtained.
[0219] The hSCN1A-Hela stable transfection cell strain stably expressing the SCN1A gene was inoculated in a 48-well cell culture plate. After 12 hours, 10 pmol of agRNA was transfected into the cells using Lipofectamine TM RNAiMAX, and the control group was not transfected with agRNA. After 48 hours of transfection of agRNA, the expression changes of the SCN1A gene productive transcription product and non-productive transcription product in the cells and the editing of the SCN1A gene pre-mRNA target site were detected according to the method in Example 5.
[0220] The experimental results are shown in Table 10. The results show that the agRNA designed by the disclosure targeting the 3' splice site of the SCN1A gene pseudo-exon can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in the cells, can induce splicing skipping of the SCN1A gene pseudo-exon in the cells, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0221] Table 10 Verification of the function of the agRNA targeting the 3' splice site of the SCN1A gene pseudo-exon
[0222] The calculation method of the numerical values in this table is the same as that in Table 4.
[0223] Example 12 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of SCN1A gene in hSCN1A-Hela stable transfected cells
[0224] SEQ ID NOs: 258-270 are a chemically modified oligonucleotide comprising a first domain and a second domain, which are connected by a linker, such as the common chemical structure PEG2. Both the first domain and the second domain can target and bind to the pre-mRNA of the target gene, mediating ADAR enzyme-based RNA editing.
[0225] The structure of PEG2 is shown below:
[0226] hSCN1A-Hela stable transfected cell lines stably expressing SCN1A gene (constructed by the method of Example 11) were seeded in 48-well cell culture plates, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 48 hours after transfection of agRNA, the expression changes of the productive and non-productive transcription products of SCN1A gene and the editing of the target site of SCN1A gene pre-mRNA in the cells were detected according to the method in Example 5.
[0227] The experimental results are shown in Table 11, and the results show that the agRNAs designed by the present disclosure to target the 3' splice site of the pseudo-exon of SCN1A gene can all induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in the cells, and can all induce splicing skipping of the pseudo-exon of SCN1A gene in the cells, increasing the expression of the productive SCN1A gene and reducing the expression of the non-productive SCN1A gene.
[0228] Table 11 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of human SCN1A gene
[0229] The calculation method of the numerical values in this table is the same as that in Table 4.
[0230] Example 13 Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of SCN1A gene in hSCN1A-Hela stable transfected cells
[0231] The function of the agRNA modified by Mesyl Phosphoramidate was tested in hSCN1A-Hela stable cell. The structure of the agRNA modified by Mesyl Phosphoramidate is as follows:
[0232] Mesyl Phosphoramidate, wherein represents a 5' or 3' oligonucleotide connected to the upstream or downstream of the nucleic acid sequence.
[0233] The hSCN1A-Hela stable cell line stably expressing SCN1A gene (constructed by the method of Example 11) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells by Lipofectamine TM RNAiMAX 12 hours later, wherein the control group was not transfected with agRNA. 48 hours after transfection of agRNA, the changes in the expression of the productive and non-productive transcription products of the SCN1A gene and the editing of the pre-mRNA target site of the SCN1A gene in the cells were detected according to the method in Example 5.
[0234] The experimental results are shown in Table 12, and the results show that the agRNA designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in the cells, and can induce splicing skipping of the pseudo-exon of the SCN1A gene in the cells, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0235] Table 12 Function verification of agRNA targeting the 3' splice site of the pseudo-exon of the human SCN1A gene
[0236] The calculation method of the numerical values in this table is the same as that in Table 4.
[0237] Example 14 Verification of the function of agRNA targeting the 3' splice site of the pseudo-exon of the SCN1A gene in hSCN1A-Hela stable cells
[0238] The function of the agRNA modified by PN (phosphoryl guanidine) was tested in hSCN1A-Hela stable cells. The structure of the agRNA modified by PN is as follows:
[0239] PN, wherein represents a 5' or 3' oligonucleotide connected to the upstream or downstream of the nucleic acid sequence.
[0240] The hSCN1A-Hela stable cell strain stably expressing SCN1A gene (constructed by the method of Example 11) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 48 hours after transfection of agRNA, the expression changes of the productive transcription product and the non-productive transcription product of the SCN1A gene and the editing of the target site of the pre-mRNA of the SCN1A gene in the cells were detected according to the method in Example 5.
[0241] The experimental results are shown in Table 13, and the results show that the agRNAs designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can all induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in the cells, and can all induce splicing skipping of the pseudo-exon of the SCN1A gene in the cells, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0242] Table 13 Functional verification of agRNAs targeting the 3' splice site of the pseudo-exon of the SCN1A gene
[0243] The calculation method of the numerical values in this table is the same as that in Table 4.
[0244] The embodiments described in the present disclosure are only illustrative examples, and the embodiments of the present disclosure are not limited by the above, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present disclosure should be equivalent replacement methods, which are all included in the protection scope of the present disclosure.
Claims
1. Use of a guide agRNA in the manufacture of a medicament for altering the expression of a target protein by a cell of a subject, wherein, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; The guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; The target protein is Nav1.1 protein.
2. A method of altering the expression of a target protein by a cell of a subject, wherein, The method comprises contacting the cell with a guide agRNA; The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; The target protein is Nav1.1 protein.
3. The use as claimed in claim 1, or the method as claimed in claim 2, wherein, The guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo 3' splice site to edit the A base of the 3' splice site or pseudo 3' splice site, thereby splicing the entire exon flanking the 3' splice site or pseudo 3' splice site of the intron from the precursor mRNA to skip the exon, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; In particular, the guide agRNA is unmodified or has a modification; In particular, the guide agRNA comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of SEQ ID NO: 303-SEQ ID NO: 428; In particular, the guide agRNA comprises at least 2 domains connected by a linker; in particular, the linker is polyethylene glycol; in particular, the polyethylene glycol is selected from diethylene glycol; In particular, the modification comprises one or more of backbone modification, sugar modification, and base modification; In particular, the backbone modification comprises one or more of phosphorothioate bond modification, alkylphosphonate modification, phosphoramidate modification, peptide nucleic acid modification, and 2'-5' linked phosphate bond modification; In particular, the phosphoramidate modification comprises guanyl phosphate amidite modification or methanesulfonyl phosphate amidite modification; In particular, the sugar modification comprises one or more of a deoxyribose modification, a ribose modification, an arabinose modification, a threose modification, a hexitol modification, L-DNA, a cyclopentane modification, a cyclohexane modification, or a modified sugar analog thereof; In particular, the modified sugar analog comprises a derivative or isomer of a sugar; In particular, the sugar modification comprises one or more of a 2'-substitution modification, a 3'-substitution modification, a 4'-substitution modification, and a 5'-substitution modification; in particular, the sugar modification comprises one or more of a 2'-O-methyl, 2'F, 2'-O-methoxyethyl, 2'-O-C16 modification, 2'-deoxy-2'-fluoroarabinose modification, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-formamide, 4'-O-methyl, 2',4'-difluoro, and 2',2'-difluoro; In particular, the sugar modification of the 2',2'-difluoro is selected from 2′,2′-difluoro-2′-deoxycytidine; In particular, the sugar modification comprises a ring-opening modification, a bicyclic modification, a tricyclic modification, an INV modification, or a derivative or isomer thereof; in particular, the INV modification comprises an INV at the C1' position alpha or beta, or a derivative or isomer thereof; in particular, the ring-opening modification comprises a GNA modification or a UNA modification; in particular, the GNA modification is selected from an S-GNA modification; in particular, the bicyclic modification comprises a LNA modification, a cEt modification, a BNA modification, or a bcDNA modification; in particular, the tricyclic modification comprises a tcDNA modification; In particular, the base comprises a modified adenine, guanine, cytosine, uracil, thymine, hypoxanthine, 5-methylcytosine, or a base analog; In particular, the base modification comprises an alkyl modification; In particular, the base modification comprises: (a) an isomerization modification of the glycosidic bond linkage site, including N7 position of purine, N3 position of pyrimidine linkage, or pyrimidine 5 / 6 carbon glycosidic bond linkage; the N3 position of pyrimidine linkage can be isoU; or the pyrimidine 5 / 6 carbon glycosidic bond linkage can be pseudouridine; (b) an oxidation modification, which can be 8-oxo-purine or 6-oxo-pyrimidine; or (c) an alkyl or halogen modification, which can be one or more of 5-halo / alkyl pyrimidine, 8-halo or alkyl purine; In particular, the base analog comprises: (a) aza, deaza, or deaminated base, which can be 6-azapyrimidine, 8-azapurine, 3-deazapurine, 6-deaminoadenine, etc.; or (b) a base analog with an aromatic ring system, which can be benzene or 2,4-difluorobenzene, nitroindole, benzimidazole, isoquinoline, or a derivative thereof; In particular, the guide agRNA, wherein at least 20%, 30%, 40%, 50%, or 60% of the nucleotides are fluorine-modified at the 2' position of the sugar residue, or wherein the oligonucleotide comprises 3 to 20 2'-F modifications; In particular, the guide agRNA, wherein at least 10%, in particular 10%-80%, more particularly 30%-70%, of the chemical modifications are 2'-O-methyl substituents; In particular, the guide agRNA, wherein at least 10%, in particular 10-80%, more particularly 30-70% of the chemical modifications are 2'-O-methoxyethyl substituents; In particular, the guide agRNA, wherein at least 0%, 10%, 20%, 30%, or 40% of the nucleotides have a bicyclic modification at the 2' position of the sugar residue; In particular, the bicyclic modification comprises a LNA modification or a cEt modification; In particular, the guide agRNA comprises one or more internucleoside linkages that are one or more of a phosphoromorpholidate, a guanidinyl phosphoramidate, a phosphodiester, and a phosphorothioate; In particular, the guide agRNA, wherein one or more of the internucleoside linkages are phosphorothioate linkages, optionally wherein at least 30% of the linkages are phosphorothioate linkages, in particular wherein 40-95% of the linkages are phosphorothioate linkages; In particular, the guide agRNA, wherein (i) less than 60%, 50%, 45%, 40%, or 30% of the internucleoside linkages are phosphodiester linkages; and / or (ii) no more than 95%, 80%, 70%, 60%, 50%, 40%, 30%, or 20% of the internucleoside linkages are phosphodiester linkages; In particular, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif; In particular, the 3' splice site or pseudo 3' splice site has a consensus NAG / N motif; In particular, the "N" is one of an A, U, G, C, or I base, and " / " is an exon-intron boundary; In particular, the adenine in the 3' splice site or pseudo 3' splice site NAG / N sequence is edited by ADAR; In particular, the ADAR editing is ADAR-mediated A-to-I editing; In particular, the ADAR is selected from ADAR1 or ADAR2; In particular, the guide agRNA, when bound to the pre-mRNA, forms a complex that is capable of recruiting ADAR, which is capable of mutating an A in the 3' splice site or pseudo 3' splice site NAG / N sequence of the pre-mRNA to an I; In particular, the guide agRNA is fully complementary to the pre-mRNA or is not fully complementary to the pre-mRNA; In particular, the non-full base complementation is a complementation with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region; In particular, the guide agRNA has at least one mismatch to the pre-mRNA; In particular, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, U, or I, or a base derivative thereof; In particular, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C, or a base derivative thereof; In particular, the guide agRNA forms a double stranded RNA with the pre-mRNA that is not fully base complemented.
4. The use or the method of claim 3, wherein, The complementary strand is base complemented at non-mismatched or non-deleted or non-bulged or non-intronic or non-wobbled base pairing sites; In particular, the complementary base pairing ratio in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 60%; In particular, the complementary base pairing ratio in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 75%; In particular, the guide agRNA can bind to the precursor mRNA to form a complex connected with the ADAR protein, and then edit the precursor mRNA, with an editing efficiency of greater than 1%.
5. The use as claimed in claim 1, or the method as claimed in claim 2, wherein, The position of the guide agRNA targeting the precursor mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site or pseudo 3' splice site; In particular, the position of the guide agRNA targeting the precursor mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site or pseudo 3' splice site; In particular, the position of the guide agRNA targeting the precursor mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site or pseudo 3' splice site; In particular, the sequence length of the guide agRNA is 10-300 bp; in particular, the sequence length of the guide agRNA is 20-150 bp; in particular, the sequence length of the guide agRNA is 20-100 bp; in particular, the sequence length of the guide agRNA is 20-70 bp; In particular, the sequence of the guide agRNA is selected from the sequences shown as SEQ ID NO: 10-200, SEQ ID NO: 217-302, or, a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with the sequence contained in the guide agRNA sequence expressed by the vector containing any one of SEQ ID NO: 201-203; In particular, the drug is a drug for treating Dravet syndrome.
6. A guide agRNA, wherein, The guide agRNA comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with any one of the sequences of SEQ ID NO: 303-SEQ ID NO: 428; In particular, the guide agRNA comprises at least 2 domains connected by a linker between the domains; in particular, the linker is a polyethylene glycol; in particular, the polyethylene glycol is selected from a dimeric ethylene glycol; In particular, the guide agRNA has a modification comprising one or more of a backbone modification, a sugar modification, and a base modification; In particular, the backbone modification comprises one or more of a phosphorothioate linkage modification, an alkylphosphonate modification, a phosphoramidate modification, a peptide nucleic acid modification, and a 2’-5’ linked phosphate linkage modification; In particular, the phosphoramidate modification comprises a guanyl phosphoramidate modification or a methanesulfonyl phosphoramidate modification; In particular, the sugar modification comprises one or more of a deoxyribose modification, a ribose modification, an arabinose modification, a threose modification, a hexitol modification, an L-DNA, a cyclopentane modification, a cyclohexane modification, or a modified sugar analog thereof; In particular, the modified sugar analog comprises a derivative or isomer of a sugar; In particular, the sugar modification comprises one or more of a 2’-substitution modification, a 3’-substitution modification, a 4’-substitution modification, and a 5’-substitution modification; in particular, the sugar modification comprises one or more of a 2’-O-methyl, 2’F, 2’-O-methoxyethyl, 2’-O-C16 modification, 2'-deoxy-2'-fluoroarabinose modification, 2’-O-[2-(methylamino)-2-oxoethyl], 2’-formamide, 4’-O-methyl, 2’,4’-difluoro, and 2’,2’-difluoro; In particular, the sugar modification of the 2’,2’-difluoro is selected from 2′,2′-difluoro-2′-deoxycytidine; In particular, the sugar modification comprises a ring-opening modification, a bicyclic modification, a tricyclic modification, an INV modification, or a derivative or isomer thereof; in particular, the INV modification comprises an INV at the C1’ position alpha or beta, or a derivative or isomer thereof; in particular, the ring-opening modification comprises a GNA modification or a UNA modification; in particular, the GNA modification is selected from an S-GNA modification; in particular, the bicyclic modification comprises a LNA modification, a cEt modification, a BNA modification, or a bcDNA modification; in particular, the tricyclic modification comprises a tcDNA modification; In particular, the base comprises a modified adenine, guanine, cytosine, uracil, thymine, hypoxanthine 5-methylcytosine, or a base analog; In particular, the base modification comprises an alkyl modification; In particular, the base modification comprises: (a) an isomerization modification of a glycosidic bond linkage site, including an N7 position of a purine, an N3 position of a pyrimidine linkage, or a pyrimidine 5 / 6 carbon glycosidic bond linkage; the N3 position of a pyrimidine linkage can be isoU; or the pyrimidine 5 / 6 carbon glycosidic bond linkage can be pseudouridine; (b) an oxidation modification, which can be an 8-oxo-purine or a 6-oxo-pyrimidine; or (c) an alkyl or halo modification, which can be one or more of a 5-halo / alkyl pyrimidine, an 8 halo or alkyl purine; In particular, the base analogues include: (a) anza, deaza or deaminated bases, which can be 6-aza pyrimidine, 8-aza purine, 3-deaza purine, 6-deaminated adenine, etc.; or (b) base analogues with aromatic ring systems, which can be benzene or 2,4- difluorobenzene, nitroindole, benzimidazole, isoquinoline or derivatives thereof; In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, 7. A vector, wherein, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, In particular, the guide agRNA includes a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-302, or, 8. A composition comprising a plasmid or viral vector comprising a polynucleotide encoding or comprising a guide agRNA, wherein, 9. The host cell of claim 8, wherein, 10. A pharmaceutical composition, wherein, 11. A method of treating a disease in a subject in need thereof by altering the expression of a target protein or functional RNA by a cell of the subject, wherein, comprising contacting a cell of a subject with the guide agRNA of claim 6, the vector of claim 7, or the composition of claim 8, or the host cell of claim 9 or the pharmaceutical composition of claim 10; In particular, the disease of the subject in need thereof comprises a disease or disorder associated with abnormal expression of SCN1A gene; In particular, the disease comprises Dravet syndrome; In particular, the cell has a precursor mRNA encoding a target protein Nav1.1, wherein the precursor mRNA comprises an intron, an exon flanking the 5’ splice site of the intron, and an exon flanking the 3’ splice site or pseudo 3’ splice site of the intron; In particular, the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; In particular, the guide agRNA is capable of recruiting ADAR to the 3’ splice site or pseudo 3’ splice site to edit the A base of the 3’ splice site or pseudo 3’ splice site, thereby splicing the entire exon flanking the 3’ splice site or pseudo 3’ splice site of the intron from the precursor mRNA to skip the exon, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; In particular, the 5’ splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif; In particular, the 3’ splice site or pseudo 3’ splice site has a consensus N / AGN motif; In particular, the “N” is any base, and the “ / ” is the exon-intron boundary; In particular, the adenine in the N / AGN sequence of the 3’ splice site or pseudo 3’ splice site is edited by ADAR; In particular, the ADAR editing is ADAR-mediated A-to-I editing; In particular, the ADAR is selected from ADAR1 or ADAR2; In particular, after the guide agRNA binds to the precursor mRNA to form a complex capable of recruiting ADAR, the A in the NAG / N of the 3’ splice site or pseudo 3’ splice site of the precursor mRNA is mutated to I.
Citation Information
Patent Citations
Antisense oligomers for treatment of conditions and diseases
CN111278991A
Antisense oligomers for treatment of conditions and diseases
CN113748209A
Antisense oligomers for treatment of autosomal dominant hysteretic type 5 and draft syndrome
CN116059236A
U1-snRNA for repairing or inhibiting abnormal splicing of SCN1A gene and application of U1-snRNA
CN116334086A
Method for editing RNA, composition and application thereof
CN118853661A