Multiplex sanger sequencing kit and method

The multiplex Sanger sequencing kit and method address the high cost and time issues of Sanger sequencing by using primers with predetermined sequences for multiplexing, enabling efficient simultaneous amplification and sequencing of multiple gene sites in a single reaction, thereby reducing costs and time.

WO2026071758A1PCT designated stage Publication Date: 2026-04-02SEEGENE MEDICAL FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/015134
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-25
Filing Date
2025-09-25
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Sanger sequencing for diagnosing genetic diseases is costly and time-consuming due to the need to amplify large human gene exons in multiple units and perform separate sequencing for each unit.

Method used

A multiplex Sanger sequencing kit and method that uses primers with predetermined nucleotide sequences at their 5' ends to facilitate multiplexing reactions, allowing simultaneous amplification and sequencing of multiple target gene sites in a single reaction vessel, reducing the need for separate tubes and steps.

Benefits of technology

Significantly reduces material costs and time required for PCR and sequencing processes by enabling multiple amplifications and analyses in a single tube, maintaining result quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025015134_02042026_PF_FP_ABST
    Figure KR2025015134_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a multiplex Sanger sequencing kit and method. Using the kit and method according to the present invention can facilitate multiple amplification and sequencing in Sanger sequencing for diagnosing genetic diseases and the like, and thus can significantly save costs and time.
Need to check novelty before this filing date? Find Prior Art

Description

Multiplex Sanger Sequencing Kit and Method

[0001] This patent application claims priority to Korean Patent Application No. 10-2024-0129900, filed with the Korean Intellectual Property Office on September 25, 2024, the disclosures of said patent application are incorporated herein by reference.

[0002] The present invention relates to a multiplex Sanger sequencing kit and method. More specifically, it relates to a kit and method for gene detection and base sequence analysis that can reduce cost and time in Sanger sequencing for diagnosing genetic diseases, etc.

[0003]

[0004] Sanger sequencing is a technique widely used in genetic laboratories to test for mutations in specific genes. The general workflow of Sanger sequencing follows the sequence of DNA extraction from a sample, DNA amplification, electrophoresis and purification of PCR products, dye-terminator cycle sequencing, purification, and sequencing analysis. It is described in detail as follows. First, DNA is extracted from a sample using an appropriate extraction method known in the art, and the target region of the gene to be tested is amplified via PCR. Depending on the diagnostic item, the target region varies, including a single SNP, a sub-exon of a single gene, a whole exon of a single gene, or a complex gene. In the case of large target regions, the sample is divided into appropriate PCR amplification sizes to amplify multiple PCR products. Next, electrophoresis is used to verify whether the PCR products of the target size have been amplified, and the PCR products are purified using a purification kit, the Exo-SAP method, etc. Subsequently, a new DNA strand is synthesized by adding the corresponding unidirectional primer and ddNTP to each amplified PCR product. Finally, the newly synthesized product is purified once more using a sequencing clean-up kit, and then the reaction product is run on a sequencer (3730xL, 3500xL, etc., Thermo Fisher Scientific) to perform capillary electrophoresis. At this time, the bases are separated by size and each ddNTP is labeled with a different fluorescence so that the bases are read in order (Fig. 1).

[0005] Although Sanger sequencing is known as the gold standard among various genetic testing techniques, as mentioned above, for items involving the testing of large human gene exons, there is a problem in that amplifying the entire exon into multiple units of appropriate size (PCR) and sequencing them requires high cost and a significant amount of hands-on time.

[0006]

[0007] The inventors have made diligent research efforts to develop an analysis method that can reduce costs and time in Sanger sequencing for diagnosing genetic diseases. As a result, they confirmed that by tailing different primers with predetermined nucleotide sequences at the 5' ends of two or more primer pairs used in a multiplexing reaction, multiplexing is possible while sequencing analysis can be facilitated, thereby saving costs and time, and thus completed the present invention.

[0008] Accordingly, another objective of the present invention is to provide a kit for gene detection and base sequence analysis.

[0009] Another objective of the present invention is to provide a method for gene detection and base sequence analysis.

[0010] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims, and drawings.

[0011]

[0012] According to one aspect of the present invention, the present invention provides a kit for gene detection and base sequence analysis.

[0013] In one embodiment of the present invention, the kit for gene detection and base sequence analysis comprises two or more pairs of forward primers and reverse primers designed to amplify a target gene region.

[0014] In one embodiment of the present invention, the forward primer and reverse primer pairs are involved in a multiplexing reaction that simultaneously amplifies two or more target gene sites within a single reaction vessel.

[0015] In this specification, the term “nucleic acid molecule” has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogues in which sugar or base sites are modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

[0016] The nucleotides constituting the above nucleic acid molecules can be isolated from nature or manufactured by chemical synthesis.

[0017] The term “primer” as used herein means an oligonucleotide that can act as an initiator of synthesis under conditions in which the synthesis of a primer extension product complementary to a nucleic acid strand (template) is induced, that is, in the presence of a polymerizing agent such as a nucleotide and DNA polymerase, and at a suitable temperature and pH.

[0018] The above "target gene," "target nucleic acid," "target nucleic acid sequence," or "target sequence" refers to the nucleic acid sequence of the gene to be detected, and is annealed or hybridized with the above primer under hybridization, annealing, or amplification conditions.

[0019] More specifically, the primer is a single-stranded deoxyribonucleotide molecule. The probe or primer used in the present invention may include naturally occurring dNMP (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. Additionally, the primer may include ribonucleotides.

[0020] The primer must be long enough to prime the synthesis of the extension product in the presence of the polymer. The exact length of the primer will be determined by a number of factors, including, for example, temperature, application, and the source of the primer.

[0021] The terms “annealing” or “priming” as used in this specification mean the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, said apposition causes a polymerase to polymerize the nucleotide to form a nucleic acid molecule complementary to the template nucleic acid or a part thereof.

[0022] The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions for nucleic acid hybridization suitable for forming such a double-stranded structure are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

[0023] As used herein, the term "hybridization" means the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization may occur between two nucleic acid strands that are completely matched or substantially matched with some mismatch. The complementarity for hybridization may depend on hybridization conditions, particularly temperature. As used herein, the terms "annealing" and "hybridization" are not different and are used interchangeably.

[0024] In one embodiment of the present invention, the amplification of the gene is carried out by PCR (polymerase chain reaction).

[0025] The above Polymerase Chain Reaction (PCR) is the most well-known nucleic acid amplification method, and many variations and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR were developed by modifying the traditional PCR procedure to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (IPCR), vectorette PCR, and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more details on PCR, see McPherson, MJ, and Moller, SG PCR. It is described in BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY (2000), and its teachings are incorporated herein by reference.

[0026] The above terms "multiple amplification," "multiple detection," "multiplex detection," or "multiplexing detection" refer to the simultaneous amplification and detection of multiple target nucleic acid sequences in a reaction vessel (e.g., a reaction tube).

[0027] As used herein, the term "multiplex PCR" refers to the simultaneous amplification of multiple targets by a polymerase chain reaction in a reaction vessel.

[0028] Various DNA polymerases may be used in the above polymerase chain reaction, including the 'Klenow' fragment of E. coli DNA polymerase I, heat-stable DNA polymerases, and bacteriophage T7 DNA polymerases. Specifically, the polymerase is a heat-stable DNA polymerase that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu).

[0029] According to one embodiment of the present invention, the kit of the present invention comprises Taq DNA polymerase or Pfu DNA polymerase.

[0030] According to another embodiment of the present invention, the kit of the present invention includes Taq DNA polymerase.

[0031] The kit of the present invention may additionally include dUTP (deoxyuridine triphosphate) and UDG (Uracil DNA Glycosilase) to block carryover or crossover contamination caused by polymerase chain reaction products. UDG recognizes and cuts uracil contained in the DNA template strand of the previous amplification product, and as the cut DNA template strand loses its function as a template strand, the amplification reaction does not occur. By using dUTP and UDG, the present invention fundamentally blocks the generation of amplification products caused by contamination of the previous amplification product, thereby excluding false positive results caused by laboratory contamination of the previous amplification product and improving the accuracy of the test.

[0032] When carrying out a polymerization reaction, it is desirable to provide the components necessary for the reaction in excess in the reaction vessel. The excess of the components necessary for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. Mg 2+ It is desirable to provide cofactors such as dATP, dCTP, dGTP, and dTTP to the reaction mixture in such a way that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changes in conditions, such as the addition of reactants.

[0033] In the present invention, annealing is performed under strict conditions that enable specific binding between the target nucleotide sequence and the primer. The strict conditions for annealing are sequence-dependent and vary depending on surrounding environmental variables.

[0034] In one embodiment of the present invention, the 5' ends of the forward primer and the reverse primer are characterized by being tailed with primers consisting of a predetermined nucleotide sequence.

[0035] The above 'tailing' refers to adding a specific sequence to the 5' end of a primer. This is performed for purposes such as enabling the amplified DNA to have a specific function in subsequent experimental steps or to allow for the simultaneous analysis of various target sequences.

[0036] In one embodiment of the present invention, the primer composed of the predetermined nucleotide sequence may be a universal primer.

[0037] In one embodiment of the present invention, if a universal primer is tailed to the 5' end of the forward primer and the reverse primer, after a specific target sequence is amplified in the first PCR cycle, the amount of amplified DNA can be increased in the next step by using the universal primer.

[0038] In a specific embodiment of the present invention, the universal primer is ACYCDuetUP1, BGH-R, CMV24, CMV30, CMV-Forward, DuetDown1, DuetUP2, EGFP-C, EGFP-N, GAL4(-BD)-3, GAL4(-BD)-5, GL1, GL2, hU6, M13F(-20), M13F(-40), M13pUC-R, M13R, MATCHMAKER3, MATCHMAKER5, mCherry-F, mCherry-R, pBad-F, pBad-R, pET-upstream, pFastBac-F, pFastBac-R, pGEX3, pGEX5, pJET1.2-F, pJET1.2-R, pMAL-F, pMAL-R, pQE-forward, pQE-reverse, RV3, It may be selected from the group consisting of RV4, SP6, SV40 pAR, T3, T7, T7terminator, U6, and U6pro, but is not limited thereto.

[0039] In one embodiment of the present invention, the primer, such as a universal primer, which is composed of a predetermined nucleotide sequence tailed to the forward primer and reverse primer pair, is different for each forward primer and reverse primer pair.

[0040] In a specific embodiment of the present invention, if the primers consisting of a predetermined nucleotide sequence tailed to the forward primer and reverse primer pairs are different for each primer pair, multiple amplification is possible using different primer pairs, and after amplification, when analyzing the nucleotide sequence through Sanger sequencing, if different tailing primers are used for each amplified target gene region, the nucleotide sequences for various amplified target gene regions can be analyzed using a single multiple amplification sample.

[0041] As a result, conventionally, single PCR was performed in a separate tube for each target gene region, and sequencing was performed for each amplification product. However, using the kit of the present invention, multiple amplification reactions of multiple target genes can be performed in a single tube, and sequencing can be performed according to the tailing primer used for analysis on a single amplification product containing all the amplified target genes of the multiple regions. Therefore, the number of tubes used for the amplification reaction is significantly reduced, thereby saving material costs and time in the PCR process and purification step.

[0042] In one embodiment of the present invention, two or more pairs of primers for the multiple amplification reaction do not have overlapping target gene regions.

[0043] In another embodiment of the present invention, two or more pairs of primers for the multiple amplification reaction are spaced at least 1.0 kb apart from the target gene region to be amplified in terms of gene location.

[0044] In other words, the gene fragments amplified within a single tube are spaced apart so that they do not overlap and are not adjacent beyond a certain distance, so the nucleic acid sequences of the amplification products are not connected to each other, and each amplification site does not affect the amplification reaction of others, forming separate amplification products. Therefore, when analyzing the amplification products, the effects such as interference between amplification products from each amplification site can be minimized.

[0045] In a specific embodiment of the present invention, each target gene region that is multiplely amplified within a single reaction vessel targets a different gene.

[0046] In another specific embodiment of the present invention, when each target gene region multiplely amplified within a single reaction vessel is within a single gene, the spacing between target gene regions is at least 1.0 kb and 27 kb and 0.5 kb, 1.0 kb and 25 kb and 1.0 kb and 20 kb and 1.0 kb and 18 kb and 1.0 kb and 15 kb and 1.0 kb and 13 kb and 1.0 kb and 12 kb and 1.0 kb and 11 kb and 1.0 kb and 10 kb and 1.0 kb and 9.0 kb and 1.0 kb and 8.0 kb and 1.0 kb and 7.0 kb and 1.0 kb and 6.0 kb and 1.0 kb and 5.0 kb and 1.0 kb and 1.0 kb and 0.5 kb and 1.0 kb and 0.5 kb and 1.0 kb and 0.5 kb and 0.5 kb and 0.5 kb and 0.5 kb and 0.5 kb and 0.5 kb, respectively, based on the gene location. It is characterized by being 4.0 kb or less, 1.0 kb or more and 3.0 kb or less, 1.0 kb or more and 2.0 kb or less, or 1.0 kb or more and 1.5 kb or less, but is not limited thereto.

[0047] In another specific embodiment of the present invention, if each target gene region to be multiplely amplified within a single reaction vessel is within a single gene and is very large in size, it is configured to be divided into sizes suitable for amplification and analysis and amplified within different reaction vessels. The above amplification and analysis-capable size is, for example, 50 to 1000 bp, more specifically 50 to 1000 bp, 50 to 950 bp, 50 to 900 bp, 50 to 850 bp, 50 to 800 bp, 100 to 1000 bp, 100 to 950 bp, 100 to 900 bp, 100 to 850 bp, 100 to 800 bp, 150 to 1000 bp, 150 to 950 bp, 150 to 900 bp, 150 to 850 bp, 150 to 800 bp, 200 to 1000 bp, 200 to 950 bp, 200 to 900 bp, 200 to 850 bp, or 200 to 800 bp, but not limited thereto.

[0048]

[0049] According to another aspect of the present invention, the present invention provides a method for gene detection and base sequence analysis.

[0050] In one embodiment of the present invention, the gene detection and base sequence analysis method comprises the following steps:

[0051] (a) a step of multiplexing two or more target gene regions in a single reaction vessel using two or more pairs of forward and reverse primers designed to amplify target gene regions;

[0052] (b) a step of performing an amplification reaction using the amplification product of the target gene region as a template, by adding ddNTPs labeled to be distinguishable according to the type of base; and

[0053] (c) A step of purifying the amplified product and performing base sequence analysis to confirm the base sequence of the target gene region.

[0054]

[0055] Since the gene detection and base sequence analysis method according to the above-described embodiment of the present invention is an invention that commonly utilizes the gene detection and base sequence analysis kit according to one embodiment of the present invention described above and the primers, which are components thereof, the common contents between the two inventions are applied identically without limitation.

[0056]

[0057] The present invention is described below in each step.

[0058]

[0059] Step (a): Multiple amplification step of the target gene region

[0060] This step is a step for multiple amplification of the target gene region to be amplified.

[0061] The above multiple amplification utilizes two or more pairs of forward primers and reverse primers designed to amplify target gene regions. As a result, each pair of forward primers and reverse primers is hybridized to a target gene region, thereby enabling multiple amplification of two or more target gene regions.

[0062] The above multiple amplification process takes place within a single reaction vessel (e.g., a reaction tube) and can be expressed as 'multiple amplification' or 'multiplex PCR'.

[0063] In one embodiment of the present invention, the 5' ends of the forward primer and the reverse primer are tailed with primers consisting of a predetermined nucleotide sequence.

[0064] In a specific embodiment of the present invention, the primer composed of the predetermined nucleotide sequence may be a universal primer.

[0065] In a more specific embodiment of the present invention, the universal primer is ACYCDuetUP1, BGH-R, CMV24, CMV30, CMV-Forward, DuetDown1, DuetUP2, EGFP-C, EGFP-N, GAL4(-BD)-3, GAL4(-BD)-5, GL1, GL2, hU6, M13F(-20), M13F(-40), M13pUC-R, M13R, MATCHMAKER3, MATCHMAKER5, mCherry-F, mCherry-R, pBad-F, pBad-R, pET-upstream, pFastBac-F, pFastBac-R, pGEX3, pGEX5, pJET1.2-F, pJET1.2-R, pMAL-F, pMAL-R, pQE-forward, pQE-reverse, RV3, It may be selected from the group consisting of RV4, SP6, SV40 pAR, T3, T7, T7terminator, U6, and U6pro, but is not limited thereto.

[0066] In one embodiment of the present invention, the primers consisting of a predetermined nucleotide sequence tailed to the forward primer and reverse primer pair are different for each pair.

[0067] In one embodiment of the present invention, the two or more pairs of primers do not overlap target gene regions.

[0068] In one embodiment of the present invention, the two or more pairs of primers are a gene detection and base sequence analysis method in which the target gene region to be amplified is separated from the target gene region by at least 1.0 kb in terms of gene location.

[0069]

[0070] Step (b): A step of performing an amplification reaction using the amplification product of the target gene region as a template, by adding ddNTPs labeled to be distinguishable according to the type of base.

[0071] This step is a core process required for Sanger sequencing, in which DNA amplification is performed using the amplification product of a target gene region as template DNA, and the amplification product to be analyzed is amplified to various lengths prior to base sequence analysis.

[0072] In one embodiment of the present invention, in the step, a ddNTP (dideoxynucleotide triphosphate) is added and an amplification reaction is performed. The ddNTP acts as a terminator for the base sequence, and each ddNTP is characterized by being labeled so as to be distinguishable by a fluorescent or radioactive label corresponding to a specific base (A, T, C, G).

[0073] Amplification in this step uses a primer in which a primer consisting of a predetermined nucleotide sequence is tailed at the 5' end of a forward primer and a reverse primer pair designed to amplify the target gene region of step (a) above.

[0074] In a specific embodiment of the present invention, the primer tailed with the predetermined base sequence binds to the template DNA (amplification product) and initiates an amplification reaction by the action of DNA polymerase.

[0075] The reaction mixture for the above amplification reaction includes DNA polymerase, dNTPs (deoxynucleotide triphosphates), and ddNTPs labeled so as to be distinguishable by fluorescent or radioactive labels corresponding to specific bases (A, T, C, G). The dNTPs promote normal DNA synthesis, and the ddNTPs stop the elongation of the DNA chain.

[0076] When the above amplification reaction mixture is reacted, DNA polymerase extends a new DNA chain from the primer. The dNTPs are extended according to the bases corresponding to the template, and the chain is terminated by a ddNTP that happens to be included. Since each ddNTP corresponds to a specific base (A, T, C, G), DNA fragments of various lengths are produced, and each fragment contains a labeled ddNTP at its end.

[0077] As a final result of this step, DNA fragments of various lengths of the target gene region are generated, and the ends of each fragment are labeled with labeled ddNTPs corresponding to specific bases.

[0078]

[0079] Step (c): A step of purifying the amplification product and performing sequencing analysis to confirm the nucleotide sequence of the target gene region.

[0080] This step involves purifying the DNA fragments generated in the previous step and analyzing their nucleotide sequences to ultimately confirm the accurate nucleotide sequence of the target gene region.

[0081] This step begins with the purification of the amplification product.

[0082] The amplification reaction product of step (b) above contains amplified DNA fragments, template DNA, remaining dNTPs and ddNTPs, and other reaction byproducts. To remove these impurities, the amplification product is purified. Purification is mainly performed using equipment such as a manual kit, chromatography, or polymer gel electrophoresis. In this process, unnecessary molecules of different sizes or properties are removed, and only pure DNA fragments are obtained.

[0083] Next, the purified DNA fragments are subjected to electrophoresis.

[0084] The purified DNA fragments are subjected to electrophoresis to separate them by size. The electrophoresis technique used for this purpose may primarily be polyacrylamide gel electrophoresis (PAGE) or automated capillary electrophoresis, but is not limited thereto. The DNA fragments are separated by size, and shorter fragments move faster.

[0085] Finally, the base sequences of the DNA fragments separated by size by electrophoresis are analyzed.

[0086] DNA fragments separated by electrophoresis are detected by their respective ddNTP labels. In the case of fluorescent labels, a laser passes through each DNA fragment to detect the fluorescent signal and record the color corresponding to each base. In the case of radioactive labels, an X-ray film is used to record the location of each fragment. This data is transmitted to a computer for analysis to read the base sequence. The reading of the base sequence is performed using computer software in the order of the fluorescent signals or radioactive labels. During this process, the base sequence of the entire target gene region is reconstructed based on the terminal base sequence of each DNA fragment. Consequently, the accurate base sequence of the target gene region is identified.

[0087] Through this step, the nucleotide sequence of the target gene region is clearly analyzed, and this can be used to identify specific variations, mutations, or genetic characteristics within the gene.

[0088]

[0089] The present invention provides a kit and method for gene detection and base sequence analysis. By using the kit and method of the present invention, multiple amplification and base sequence analysis can be facilitated in Sanger sequencing for diagnosing genetic diseases, etc., thereby significantly saving costs and time.

[0090]

[0091] Figure 1 is a schematic diagram of a conventional Sanger sequencing process.

[0092] Figure 2 is a figure showing the reason for multiple universal primer tailing in the application of Multiplex PCR, comparing single PCR and multiplex PCR.

[0093] Figure 3 is a schematic diagram of the entire exon of the BRCA1 gene and a diagram showing the primer design positions of some exons (exons 6–11).

[0094] Figure 4 is a figure showing the Sanger sequencing results according to multiplex PCR applying the technology of the present invention compared with the Sanger sequencing results using conventional single PCR.

[0095]

[0096] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.

[0097]

[0098] Examples

[0099]

[0100] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0101]

[0102] Example 1: Effects of Universal Primer Tailing

[0103] In Sanger sequencing, the M13 forward or reverse primer, one of the universal primers, was tailed to each target-specific primer (forward or reverse) during the PCR step. By tailing universal primers to specific primers, the operator can perform the task efficiently by creating and using an M13 forward or reverse primer cocktail during the subsequent Big-dye terminator cycle sequencing step.

[0104] However, in the present invention, multiple universal primers were used instead of a single universal primer in a single tube reaction to apply multiplex PCR. For example, if five PCR products are amplified in a single tube reaction, five pairs of universal primers (forward, reverse) were used.

[0105] In the present invention, as shown in Table 1 below, five pairs of universal primers were used. These universal primers are sequences that are generally used when sequencing DNA sequences inserted into plasmids, phages, or other vectors, and are publicly available sequences that researchers can use.

[0106] Serial Number Universal Primer Name Sequence Usage Direction mer(bp) Sequence Number 1M13(-21)FTGTAAAACGACGGCCAGTF181M13(-40)RCAGGAAACAGCTATGACR1722T7TAATACGACTCACTATAGGGF203SP6ATTTAGGTGACACTATAGR1843T3CAATTAACCCTCACTAAAF185T7terminatorGCTAGTTATTGCTCAGCGGR1964pMAL-FAACATCCCGCAGATGTCCF187pMAL-RCAAGCTGCCATTCGCCATR1885pQE-forwardCCCGAAAAGTGCCACCTGF189pQE-reverseGTTCTGAGGTCATTACTGGR1910

[0107] In addition, various known vector primers can be used as universal primers by tailing them to specific primers; the number used is proportional to the number of targets to be amplified in a single tube of multiplex PCR, and it is efficient to select the number by also considering the number of universal primer cocktails prepared during the Big-dye terminator cycle sequencing step.

[0108] The reason why universal primers must be used in proportion to the number of targets in the application of Multiplex PCR is explained using BRCA1 as an example as follows.

[0109] BRCA1 multiplex PCR tube configuration targetM1Product size*(bp)M2Product size*(bp)M3Product size*(bp)M4Product size*(bp)M5Product size*(bp)M6Product size*(bp)Universal primerex1265ex2364ex3364ex5242ex6343ex7342T7(F) / SP6(R)ex8624ex9240ex10285ex11A619ex11B723ex11C774M13-(F) / (R)ex11D640ex11E744ex11F6 40ex12374ex13450ex14264pMAL-(F) / (R)ex15332ex16438ex17285ex18407ex 19287ex20438pQE-(F) / (R)ex21290ex22243ex23251ex24309----T3(F) / T7(R)

[0110] PCR product size containing universal primer

[0111] Columns M1 to M6 of Table 2 above represent groups of gene regions amplified within a single PCR reaction tube, and the 'universal primer' column on the right represents the types of universal primers tailored to primers designed for each amplified gene region.

[0112] Specifically, for example, in the BRCA1 multiplex PCR tube configuration of Table 2 above, M6 consists of four targets: exon 7, exon 11C, exon 14, and exon 20. When sequencing using the conventional single PCR method, PCR is performed in separate tubes for each target, and the target nucleotide sequences can be analyzed by sequencing each of the four PCR products.

[0113] However, in multiplex PCR where the four targets of the M6 ​​group are amplified in a single tube reaction, since the four targets are mixed in a single PCR product, sequencing with a single type of M13 forward or reverse primer as in the conventional method results in the nucleotide sequences of the four targets being mixed and not properly analyzed. Therefore, if specific primers are tailed with different universal primers for each of the four targets and amplified, and then the single PCR product is sequenced with different universal primers for each, the nucleotide sequences for each target can be obtained cleanly (Fig. 2).

[0114]

[0115] Example 2: Method for constructing gene target sites in each tube of multiplex PCR

[0116] In the case of multiplex PCR, which amplifies two or more targets in a single PCR tube reaction, the distance between targets within the genome is important. For example, if targets A and B are close to each other (e.g., 800 bp), in addition to the amplification of targets A and B, the forward primer of target A and the reverse primer of target B may also be amplified, potentially amplifying the AB amplification product and affecting the analysis. Therefore, when performing multiplex PCR, it is generally necessary to configure different gene targets within a single tube, or, if within a single gene, to group targets that are far apart from each other.

[0117] In the present invention, the tubes were configured to avoid adjacent targets within a single multiplex PCR tube, and the distance between each target within the tube was configured to be at least 3.4 kb (maximum 27 kb). A schematic diagram regarding the configuration of the gene target region of the BRCA1 gene according to the present invention is shown in Fig. 3.

[0118] As shown in Figure 3, for example, the distance between exon 6 and exon 7 of the BRCA1 gene is very close at 381 bp (approx. 400 bp), so for these targets, they were configured as different tubes (e.g., exon 6 as M5, exon 7 as M6).

[0119] In addition, since exon 11 of the BRCA1 gene is a very large exon (approximately 3,450 bp), it was designed to overlap six PCR products to consider PCR amplification and sequencing efficiency, and the overlap targets were safely divided into six tubes (M1–M6). By placing the remaining targets in each tube, the structure was configured so that there are 4 to 5 targets per tube and the distance between targets is at least 3.4 kb (maximum 27 kb). In practice, configuring the distance between targets to be far apart is stable.

[0120]

[0121] Example 3: Composition of universal primer-tailed BRCA1 / BRCA2 primers and multiplex PCR tubes

[0122] The BRCA1 gene consists of a total of 23 exons, and primers were designed so that large exons, such as exon 11, could be divided into appropriate sizes to amplify the PCR products. Accordingly, as shown in Table 2 of Example 2 above, a total of 28 PCR products were divided into 6 tubes so that 4 to 5 PCR targets were formed in each tube.

[0123] Primer information targeting the BRCA1 gene of the present invention is shown in Table 3 below.

[0124]

[0125] Universal primer sequence is indicated by an underline

[0126] Similarly, the BRCA2 gene consists of a total of 27 exons, and since some exons are large, primers were designed to divide them into appropriate sizes so that the PCR products could be amplified. Therefore, a total of 35 PCR products were divided into 7 tubes, so that 5 PCR targets were formed in each tube. The BRCA2 multiplex PCR tube targets are shown in Tables 4 and 5.

[0127]

[0128] BRCA2 multiplex PCR tube configuration target 1M1Product size* (bp)M2Product size* (bp)M3Product size* (bp)M4Product size* (bp)Universalprimerex1365ex2359ex3586ex4369T7(F) / SP6(R)ex9409ex10A774ex10B470ex11A747pMAL-(F) / (R)ex11E826ex11F 667ex11G809ex11H577pQE-(F)(R)ex16485ex15600ex17514ex18492M13-(F) / (R)ex22489ex23-24645ex25467ex26477T3(F) / T7t(R)

[0129] PCR product size containing universal primer

[0130] BRCA2 multiplex PCR tube configuration target 2M5Product size* (bp)M6Product size* (bp)M7Product size* (bp)Universalprimerex5-6568ex7480ex8294T7(F) / SP6(R)ex11B877ex11C845ex11D832pMA L-(F) / (R)ex12438ex13349ex14689pQE-(F)(R)ex19376ex20438ex21336M13-(F) / (R)ex27-1 542ex27-2 551ex10C450T3(F) / T7t(R)

[0131] PCR product size containing universal primer

[0132]

[0133] Experimental Example: BRCA1, 2 multiplex PCR results

[0134] 1. Sample extraction, PCR execution, and amplification verification

[0135] First, DNA was extracted from the sample (EDTA W / B) using a commercial manual kit and equipment.

[0136] After preparing the multiplex PCR master mix with the composition shown in Table 6 below, it was lightly mixed about 5 times or vortexed and then lightly centrifuged.

[0137] BRCA12X Multiplex pre-mix10㎕Primer mix (M1~M6)8㎕DNA2㎕Total20㎕BRCA22X Multiplex pre-mix10㎕Primer mix (M1~M7)8㎕DNA2㎕Total20㎕

[0138] 18 µl of PCR master mix was dispensed into PCR tubes, 2 µl of sample nucleic acid was added, and PCR was performed according to the program in Table 7 below (identical PCR conditions for both BRCA1 and 2).

[0139] SegmentNo. of cyclesTemperature(℃)Duration119415 min2309430 sec621 min721.5 min31727 min

[0140] After the PCR reaction was completed, electrophoresis was performed using a 2% agarose gel and 0.5X TBE buffer.

[0141] Electrophoresis bands were checked to see if the PCR products were properly amplified in tubes M1–M6 of BRCA1 and tubes M1–M7 of BRCA2.

[0142]

[0143] 2. PCR product purification

[0144] The PCR product was purified using commercially available purification kits, the Exo-SAP method, etc. The inventors purified the PCR product using the MEGAquick-spin total DNA purification kit (iNtRON) according to the manufacturer's protocol.

[0145]

[0146] 3. Big-dye terminator cycle sequencing

[0147] Big-dye terminator cycle sequencing was performed using the Big-dye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) according to the manufacturer's protocol.

[0148] Since five pairs of universal primers (forward or reverse) were added to the sequencing primers, a total of 10 mixture cocktails were prepared, and the reagent composition, universal primers, and cycle PCR conditions were as follows.

[0149] 5X sequencing buffer 2 µl, Primer (5 pmole / µl) - Universal primer F or R 1 µl, RR-100 (BigDye) 0.5 µl, DW 5.5 µl, Purified PCR product 10 µl

[0150] Temperature / TimeCycle96℃ / 1 min1 Cycle96℃ / 10 sec50℃ / 5 sec60℃ / 4 min25 Cycles

[0151]

[0152] 4. Purification and sequencer running

[0153] The newly synthesized product was purified once more using a clean-up kit, and subsequently, the reaction product was run on a sequencer (3730xL, 3500xL, etc., Thermo Fisher Scientific) to perform capillary electrophoresis. The inventors performed purification according to the manufacturer's protocol using the ZR-96 DNA sequencing clean-up kit (Zymo Research) and ran it on the Sequencing Analysis application of a 3730xL sequencer.

[0154]

[0155] 5. BRCA1, 2 multiplex PCR results

[0156] The Sanger sequencing results according to multiplex PCR applying the technology of the present invention are shown in Figure 4.

[0157] As shown in Figure 4, the number of PCR tube reactions performed was significantly reduced by switching from the existing single PCR to multiplex PCR. Specifically, for BRCA1, the number of tube reactions decreased from 34 to 6, and for BRCA2, from 44 to 7. After proceeding with the testing process, the sequencing analysis results showed no difference before and after the change, confirming that the result quality was maintained.

[0158]

[0159] 6. Review - Effects of reducing inspection material costs and shortening inspection hands-on time

[0160] By applying the technology of the present invention, the number of tests is reduced not only in the PCR step but also in the subsequent electrophoresis and PCR product purification steps (highlighted in yellow in Fig. 1), thereby reducing material costs for these steps and shortening the hands-on testing time. Changes in material costs and testing time resulting from the application of the technology of the present invention are shown in Table 10 below.

[0161]

[0162]

[0163]

[0164] Comparison of Material Costs and Testing Time Based on Multiplex PCR Application Before Change (BRCA1+BRCA2) After Change Remarks 1) Reagent Production (Tube) 2) PCR (Enzyme, PCR Tube) 3) Electrophoresis (Well) 4) PCR Product Purification (Kit) 34T + 44T = 78T 6T + 7T = 13T Reagent Reduction (65T volume) Testing Time (Excluding Analysis Time) (=> Increased Convenience) 130 min + 150 min = 280 min 50 min + 60 min = 110 min Test Hands-on Time Reduced by 170 Minutes

[0165]

[0166] Generally, since a single patient requests BRCA1 and BRCA2 tests simultaneously, when calculating the two test items together, applying the technology of the present invention reduced the material cost corresponding to 78 tubes at each stage from PCR reagent production to PCR product purification to the level of 13 tubes, resulting in a material cost reduction of approximately 83%. In addition, the examiner hands-on time, excluding equipment running time, was shortened from a total of 280 minutes to about 110 minutes, showing a time reduction effect of approximately 60% (Table 10). The effects of material cost and test time reduction will vary depending on the number of targets applied to multiplex PCR.

[0167]

[0168] 7. Other applicable items

[0169] Table 11 below is an example of items to which multiplex PCR is applied among Sanger sequencing items by genetic disease or target gene name being conducted by the applicant. As exemplarily shown in Table 11, the method of the present invention can be applied to genes tested by the Sanger sequencing method in cases where there are two or more targets, regardless of gene size.

[0170] No. Item (Genome Name or Disease Name) Number of Single PCR Tubes Number of Multiplex PCR Tubes 1 CKIT 4 1 2 NRAS 4 1 3 KRAS 2 1 4 EGFR 4 1 5 NOTCH 3 9 3 6 NUDT 1 5 2 1 7 IDH 1 / IDH 2 2 1 8 CYP 2 C 19 3 1 9 LHON type 4 4 ​​1

[0171] As described above, the present invention relates to applying multiplex PCR, rather than single PCR, to the PCR step of Sanger sequencing. To achieve this, the core technical components include a method using various universal primer tailings and a method for configuring the gene target regions of each multiplex PCR tube. The greatest advantage of this technology is that, compared to conventional methods, the number of tests in this step is drastically reduced, resulting in significant material cost savings and shortened hands-on time for the technician. Furthermore, its application in actual laboratories has led to high technician satisfaction.

[0172]

[0173] Examples of universal primers that can be tailed to specific primers that specifically bind to the gene target site of the present invention are shown in Table 12 below.

[0174] 연번유니버설 프라이머 명칭염기 서열서열번호1ACYCDuetUP1GGA TCT CGA CGC TCT CCC T672BGH-RCTA GAA GGC ACA GTC GAG GC683CMV24TAT TAG GAC AAG GCT GGT GGG CAC694CMV30AAT GTC GTA ATA ACC CCG CCC CGT TGA CGC705CMV-ForwardCGC AAA TGG GCG GTA GGC GTG716DuetDown1GAT TAT GCG GCC GTG TAC AA727DuetUP2TTG TAC ACG GCC GCA TAA TC738EGFP-CCAT GGT CCT GCT GGA GTT CGT G749EGFP-NCGT CGC CGT CCA GCT CGA CCA G7510GAL4(-BD)-3TTT TCG TTT TAA AAC CTA AGA GT7611GAL4(-BD)-5TCA TCG GAA GAG AGT AGT7712GL1TGT ATC TTA TGG TAC TGT AAC TG7813GL2CTT TAT GTT TTT GGC GTC TTC CA7914hU6GAG GGC CTA TTT CCC ATG ATT8015M13F(-20)GTA AAA CGA CGG CCA GT8116M13F(-40)GTT TTC CCA GTC ACG AC8217M13pUC-RGCG ​​GAT AAC AAT TTC ACA CAG8318M13RCAG GAA ACA GCT ATG AC8419MATCHMAKER3GTG AAC TTG CGG GGT TTT TCA GTA TCT ACG AT8520MATCHMAKER5GAA GAT ACC CCA CCA AAC8621mCherry-FCCC CGT AAT GCA GAA GAA GA8722mCherry-RTTG GTC ACC TTC AGC TTG G8823pBad-FATG CCA TAG CAT TTT TAT CC8924pBad-RGAT TTA ATC TGT ATC AGG9025pET-upstreamATG CGT CCG GCG TAG AGG9126pFastBac-FGGATTA TTC ATA CCG TCC CA9227pFastBac-RCAA ATG TGG TAT GGC TGA TT9328pGEX3CCG GGA GCT GCA TGT GTC AGA GG9429pGEX5GGG CTG GCA AGC CAC GTT TGG TG9530pJET1.2-FCGA CTC ACT ATA GGG AGA GCG GC9631pJET1.2-RAAG AAC ATC GAT TTT CCA TGG CAG9732pMAL-FAAC ATC CCG CAG ATG TCC9833pMAL-RCAA GCT GCC ATT CGC CAT9934pQE-forwardCCC GAA AAG TGC CAC CTG10035pQE-reverseGTT CTG AGG TCA TTA CTG G10136RV3CTA GCA AAA TAG GCT GTC CC10237RV4GAC GAT AGT CAT GCC CCG CG10338SP6ATT TAG GTG ACA CTA TAG10439SV40 pARGAA ATT TGT GAT GCT ATT GC10540T3CAA TTA ACC CTC ACT AAA10641T7TAA TAC GAC TCA CTA TAG GG10742T7terminatorGCT AGT TAT TGC TCA GCG G10843U6CAG TGC AGG GGA AAG AAT AGT AGA C10944U6proGGG CAG GAA GAG GGC CTA T110

Claims

1. A kit for gene detection and sequencing analysis comprising two or more pairs of forward primers and reverse primers designed to amplify a target gene region, A kit for gene detection and sequencing analysis, wherein the above-described forward primer and reverse primer pairs are associated with a multiplexing reaction that simultaneously amplifies two or more target gene regions within a single reaction vessel.

2. A kit for gene detection and base sequence analysis according to claim 1, wherein the 5' ends of the forward primer and the reverse primer are tailed with primers having a predetermined base sequence.

3. A kit for gene detection and base sequence analysis, wherein the primer composed of the above-mentioned predetermined base sequence is a universal primer.

4. In paragraph 3, the universal primers are ACYCDuetUP1, BGH-R, CMV24, CMV30, CMV-Forward, DuetDown1, DuetUP2, EGFP-C, EGFP-N, GAL4(-BD)-3, GAL4(-BD)-5, GL1, GL2, hU6, M13F(-20), M13F(-40), M13pUC-R, M13R, MATCHMAKER3, MATCHMAKER5, mCherry-F, mCherry-R, pBad-F, pBad-R, pET-upstream, pFastBac-F, pFastBac-R, pGEX3, pGEX5, pJET1.2-F, pJET1.2-R, pMAL-F, pMAL-R, pQE-forward, pQE-reverse, RV3, A kit for gene detection and sequencing analysis selected from the group consisting of RV4, SP6, SV40 pAR, T3, T7, T7terminator, U6, and U6pro.

5. A kit for gene detection and base sequence analysis according to paragraph 2, wherein the primers consisting of a predetermined base sequence tailed to the forward primer and reverse primer pair are different for each pair.

6. A kit for gene detection and base sequence analysis according to claim 1, wherein the two or more pairs of primers do not have overlapping target gene regions.

7. A kit for gene detection and base sequence analysis according to claim 1, wherein the two or more pairs of primers are such that the target gene region to be amplified is separated by at least 1.0 kb in the gene location.

8. A gene detection and base sequence analysis method comprising the following steps: (a) a step of multiplexing two or more target gene regions in a single reaction vessel using two or more pairs of forward and reverse primers designed to amplify target gene regions; (b) a step of performing an amplification reaction using the amplification product of the target gene region as a template, by adding ddNTPs labeled to be distinguishable according to the type of base; and (c) A step of purifying the amplified product and performing base sequence analysis to confirm the base sequence of the target gene region.

9. A gene detection and base sequence analysis method according to claim 8, wherein the 5' ends of the forward primer and the reverse primer are tailed with primers consisting of a predetermined base sequence.

10. A gene detection and base sequence analysis method according to claim 9, wherein the primer composed of the above-mentioned predetermined base sequence is a universal primer.

11. In paragraph 10, the universal primers are ACYCDuetUP1, BGH-R, CMV24, CMV30, CMV-Forward, DuetDown1, DuetUP2, EGFP-C, EGFP-N, GAL4(-BD)-3, GAL4(-BD)-5, GL1, GL2, hU6, M13F(-20), M13F(-40), M13pUC-R, M13R, MATCHMAKER3, MATCHMAKER5, mCherry-F, mCherry-R, pBad-F, pBad-R, pET-upstream, pFastBac-F, pFastBac-R, pGEX3, pGEX5, pJET1.2-F, pJET1.2-R, pMAL-F, pMAL-R, pQE-forward, pQE-reverse, RV3, A gene detection and base sequence analysis method selected from the group consisting of RV4, SP6, SV40 pAR, T3, T7, T7terminator, U6, and U6pro.

12. A method for gene detection and base sequence analysis according to claim 8, wherein the primers consisting of a predetermined base sequence tailed to the forward primer and reverse primer pair are different for each pair.

13. A gene detection and base sequence analysis method according to claim 8, wherein the two or more pairs of primers do not overlap target gene regions.

14. A method for gene detection and base sequence analysis according to claim 8, wherein the two or more pairs of primers are such that the target gene region to be amplified is located at least 1.0 kb apart from the target gene region in terms of gene location.