Treatment of neurological diseases using modulators of UNC13a gene transcripts

Modified oligonucleotides with specific structures and spacers enhance UNC13A expression and reduce mis-splicing, effectively treating neurological diseases by increasing full-length protein and stabilizing UNC13A function.

WO2026080323A1PCT designated stage Publication Date: 2026-04-16QURALIS CORP
View PDF 45 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/049415
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-09
Filing Date
2025-10-03
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

Conventional antisense oligonucleotides exhibit poor efficacy in modulating gene expression, necessitating the development of improved splice-switching oligonucleotides for treating neurological diseases.

Method used

Modified oligonucleotides with specific structures and spacers, such as Formula (Bl), exhibit enhanced efficacy by increasing UNC13A protein expression and reducing mis-spliced transcripts, administered through various routes to treat neurological diseases.

Benefits of technology

The modified oligonucleotides demonstrate a significant increase in full-length UNC13A protein and reduction in mis-spliced transcripts, effectively treating conditions like ALS, FTD, Alzheimer's, Parkinson's, and other neurological disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000002_0001
    Figure IMGF000002_0001
  • Figure IMGF000002_0002
    Figure IMGF000002_0002
  • Figure IMGF000004_0001
    Figure IMGF000004_0001
Patent Text Reader

Abstract

Disclosed herein are UNC13A antisense oligonucleotides with modified backbone structures. The disclosed UNC13A oligonucleotides reduce mis-spliced UNC13A transcripts and increase full length UNC13A transcripts, thereby imparting therapeutic efficacy against neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or Alzheimer's disease (AD).
Need to check novelty before this filing date? Find Prior Art

Description

TREATMENT OF NEUROLOGICAL DISEASES USING MODULATORS OF UNC13AGENE TRANSCRIPTSBACKGROUND

[0001] Antisense oligonucleotides are nucleic acid-based compounds that can be used to modulate (e.g., inhibit) expression of certain genes that are linked to diseases. Although antisense oligonucleotides can be generally designed to hybridize with target genes, conventional antisense oligonucleotides often exhibit poor efficacy. There is a need to develop compounds (z.e., building blocks) useful for synthesizing splice- switching oligonucleotides (e.g., splice-switching oligonucleotides comprising one or more spacers) and methods of preparing such compounds, in order to develop modified antisense oligonucleotides that exhibit improved performance and efficacy for preventing, ameliorating, and treating diseases.SUMMARY

[0002] Disclosed here is a modified oligonucleotide comprising a sequence that is at least 90% complementary to an equal length portion of any one of SEQ ID NO: 5057-5068, wherein the modified oligonucleotide comprises at least one structure of Formula (Bl):wherein each ofsymbol represents the point of connection to an intemucleoside linkage.

[0003] In some embodiments, the modified oligonucleotide comprises 12 to 50 oligonucleotide units

[0004] In various embodiments, the modified oligonucleotide comprises a segment with at most 11 linked nucleosides. In various embodiments, the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 linked nucleosides. In various embodiments, the modified oligonucleotide comprises a segment with at most 10, 9, or 8 linked nucleosides. In variousembodiments, the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides. In various embodiments, the modified oligonucleotide comprises a segment with at most 7 linked nucleosides. In various embodiments, the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, or 7 linked nucleosides. In various embodiments, every segment of the modified oligonucleotide comprises at most 7 linked nucleosides. In various embodiments, every segment of the modified oligonucleotide comprises 2, 3, 4, 5, 6, or 7 linked nucleosides.

[0005] In various embodiments, the modified oligonucleotide comprises a sequence that shares at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, and SEQ ID NOs: 5073-5092. In various embodiments, the modified oligonucleotide comprises a sequence that shares 90% identity, 91% identity, 92% identity, 93% identity, 94% identity, 95% identity, 96% identity, 97% identity, 98% identity, or 99% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, and SEQ ID NOs: 5073-5092. In various embodiments, the modified oligonucleotide comprises a sequence of any one of SEQ ID NOs: 5073-5092. In various embodiments, the modified oligonucleotide consists essentially of a sequence of any one of SEQ ID NOs: 5073-5092. In various embodiments, the modified oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the modified oligonucleotide is 23 oligonucleotide units in length. In various embodiments, the modified oligonucleotide is 25 oligonucleotide units in length. In various embodiments, the modified oligonucleotide is between 18 and 30, between 19 and 30, between 20 and 30, between 21 and 30, between 22 and 30, between 23 and 30, between 24 and 30, or between 25 and 30 oligonucleotide units in length.

[0006] In various embodiments, the structure of Formula (Bl) or the spacer is incapable of linking to a nucleotide base. In various embodiments, the structure of Formula (Bl) or the spacer is located between positions 6 and 10 of the modified oligonucleotide. In various embodiments, the structure of Formula (Bl) or the spacer is located between positions 7 and 9 of the modified oligonucleotide. In various embodiments, the structure of Formula (Bl) or the spacer is located at position 7, position 8, or position 9 of the modified oligonucleotide.

[0007] In various embodiments, the modified oligonucleotide further comprises a second structure of Formula (Bl) or a second spacer, wherein the structure of Formula (Bl) is:

[0008] In various embodiments, the second structure of Formula (Bl) or the second spacer is located between positions 15 and 20 of the modified oligonucleotide. In various embodiments, the second structure of Formula (Bl) or the second spacer is located between positions 16 and 19 of the modified oligonucleotide. In various embodiments, the second structure of Formula (Bl) or the second spacer is located at position 16, position 17, position 18, or position 19 of the modified oligonucleotide. In various embodiments, the second structure of Formula (Bl) or the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the modified oligonucleotide. In various embodiments, the second structure of Formula (Bl) or the spacer is located at position 7 of the oligonucleotide, and wherein the second spacer is located at position 19 of the modified oligonucleotide. In various embodiments, the second structure of Formula (Bl) or the spacer is located at position 9 of the oligonucleotide, and wherein the second structure of Formula (Bl) or the second spacer is located at position 19 of the modified oligonucleotide.

[0009] In various embodiments, at least one (i.e., one or more) intemucleoside linkage of the modified oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In various embodiments, at least one nucleoside linkage of the modifiedoligonucleotide is a phosphorothioate linkage. In various embodiments, the phosphorothioate linkage is in one of a Rp configuration or a .S'p configuration. In various embodiments, all intemucleoside linkages of the modified oligonucleotide are phosphorothioate linkages.

[0010] In various embodiments, the modified oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is one of a 2'-0Me modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-M0E), 2'-deoxy-2'-fluoro nucleoside, 2’-fluoro-P-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’- bridged nucleic acid (cEt), .S'-cEt. tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA). In various embodiments, the modified sugar moiety is a 2’-O-(2-methoxyethyl) (2’- MOE).

[0011] In various embodiments, the modified oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase of full length UNC13A protein. In various embodiments, increase of the full length UNC13A protein is measured in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide. In various embodiments, the modified oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein. In various embodiments, the modified oligonucleotide exhibits 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein. In various embodiments, the modified oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced UNC13A transcript. In various embodiments, the modified oligonucleotide exhibits at a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced UNC13A transcript.

[0012] Additionally disclosed herein is a method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to the patient a modified oligonucleotide. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-RelatedTDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson- dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism. In various embodiments, the modified oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracistemally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, intraduodenally, or intracerebroventricularly. In various embodiments, the modified oligonucleotide is administered orally. In various embodiments, a therapeutically effective amount of the modified oligonucleotide is administered intrathecally, intrathalamically or intracistemally. In various embodiments, the patient is a human patient.

[0013] Additionally disclosed herein is a method of restoring axonal outgrowth and / or regeneration of a neuron, the method comprising exposing the neuron to a modified oligonucleotide.Additionally disclosed herein is a method of increasing, promoting, stabilizing, or maintaining UNC13A expression and / or function in a neuron, the method comprising exposing the cell to a modified oligonucleotide. In various embodiments, the neuron is a motor neuron. In various embodiments, the neuron is a spinal cord neuron.

[0014] Additionally disclosed herein is a pharmaceutical composition comprising a disclosed modified oligonucleotide, or a pharmaceu tic ally acceptable salt thereof, and a pharmaceutically acceptable excipient.DETAILED DESCRIPTION

[0015] The features and other details of the disclosure will now be more particularly described. Certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.Definitions

[0016] The terms “treat,” “treatment,” “treating,” and the like arc used herein to generally mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and / or adverse effect attributed to the disease. The term “treatment” as used herein covers any treatment of a disease in a mammal, particularly ahuman, and includes: (a) inhibiting the disease, i.e.. preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, i.e., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease.

[0017] “Preventing” includes delaying the onset of clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition developing in a subject that may be afflicted with or predisposed to the state, disorder, disease, or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder, disease, or condition. “Preventing” includes prophylactically treating a state, disorder, disease, or condition in or developing in a subject, including prophylactically treating clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition in or developing in a subject.

[0018] The term “pharmaceutically acceptable earner” or “pharmaceutically acceptable excipient” as used herein interchangeably refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds providing supplemental, additional, or enhanced therapeutic functions.

[0019] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one biologically active compound, for example, a UNC13A antisense oligonucleotide (AON), as disclosed herein formulated together with one or more pharmaceutically acceptable excipients.

[0020] ‘ ‘Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the invention can be administered to a mammal, such as a human, but can also be other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, and the like). In some embodiments, the mammal treated in the methods ofthe invention is desirably a mammal in whom modulation of UNC13A expression and / or activity is desired.

[0021] As used herein, “UNC13A” (also known as Unc-13 Homolog A, Muncl3-1, KIAA1032, unc-13 homolog A (C. elegans), or Protein Unc-13 Homolog A) refers to the gene or gene products (e.g., protein or mRNA transcript (including pre-mRNA) encoded by the gene) identified by Entrez Gene ID No. 23025 and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice).

[0022] The term “UNC13A transcript” refers to a UNC13A transcript which can be a UNC13A pre-mRNA sequence or a UNC13A mature RNA sequence. UNC13A transcript sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.

[0023] The term “UNC13A oligonucleotide,” “UNC13A antisense oligonucleotide,” or “UNC13A AON” refers to an oligonucleotide that is capable of increasing, restoring, or stabilizing full-length UNC13A activity e.g., full length UNC13A expression, for example, full length UNC13A mRNA and / or full length UNC13A protein expression. Generally, a UNC13A oligonucleotide reduces the level of mis-spliced UNC13A transcripts by targeting a UNC13A transcript (e.g., UNC13A pre- mRNA or mis-spliced UNC13A with a target sequence). In various embodiments, a UNC13A oligonucleotide comprises a sequence that is at least 90% complementary to an equal length portion of a transcript comprising a sequence at least 90% identical to SEQ ID NO: 5057-5068, or a contiguous 15 to 50 nucleobase portion of SEQ ID NO: 5057-5068. UNC13A target sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.

[0024] In various embodiments, UNC13A oligonucleotides are characterized by having one or more structures of Formula (Bl) or spacers, where each structure of Formula (Bl) or spacer divides up the UNC13A oligonucleotide into segments of linked nucleosides. In various embodiments, UNC13A oligonucleotides have two structures of Formula (Bl) or two spacers. In one embodiment, UNC13A oligonucleotides have two segments of linked nucleosides separated by one structure of Formula (Bl) or one spacer. In one embodiment, UNC13A oligonucleotides have three segments of linked nucleosides separated by two structures of Formula (Bl) or two spacers. In such embodiments, UNC13A oligonucleotides have one segment with at most 7 linkednucleosides. For example, a UNC13A oligonucleotide may have, from the 5’ to the 3’ end, 7 linked nucleosides, followed by a structure of Formula (Bl) or spacer, 7 linked nucleosides, followed by a second structure of Formula (Bl) or a second spacer, and 7 linked nucleosides. In various embodiments, each of the four segments of the UNC13A oligonucleotide have at most 7 linked nucleosides.

[0025] As used herein, the term “UNC13A oligonucleotide” encompasses a “UNC13A parent oligonucleotide,” a “UNC13A oligonucleotide with one or more structures of Formula (Bl) or spacers” (e.g., UNC13A oligonucleotide with two spacers or a UNC13A oligonucleotide with three spacers), a “UNC13A oligonucleotide variant with one or more structures of Formula (Bl) or spacers.” Examples of UNC13A oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1-1264, SEQ ID NO: 2529-3792, or SEQ ID NOs: 5073-5092.

[0026] The term “UNC13A parent oligonucleotide” refers to an oligonucleotide that targets a UNC13A transcript and is capable of increasing, restoring, or stabilizing full-length UNC13A activity e.g., full length UNC13A expression, for example, full length UNC13A mRNA and / or full length UNC13A protein expression. UNC13A parent oligonucleotides do not include a structure of Formula (Bl) or a spacer. Examples of UNC13A parent oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NO: 1-1264. As described hereafter, UNC13A oligonucleotide with structures of Formula (Bl) or spacers and UNC13A oligonucleotide variants are described in relation to a corresponding UNC13A parent oligonucleotide.

[0027] The term “UNC13A oligonucleotide variant” refers to a UNC13A oligonucleotide that represents a modified version of a corresponding UNC13A parent oligonucleotide. For example, a UNC13A oligonucleotide variant represents a shortened version of a UNC13A parent oligonucleotide. In various embodiments, a UNC13A oligonucleotide variant is any one of a 15mer, 16mer, 17mer, 18mer 19mer, 20mer, 21mer, 22mer 23mer, 24mer, 25mer, 26mer, or 27mer. In particular’ embodiments, a UNC13A oligonucleotide variant is a 23mer. Examples of UNC13A oligonucleotide variants include oligonucleotides comprising a sequence of any one of SEQ ID NO: 2529-3792. In various embodiments, UNC13A oligonucleotide variants comprise one or more structures of Formula (Bl) or spacers.

[0028] The term “oligonucleotide with one or more structures of Formula (Bl) or spacers” or “oligonucleotide comprising a structure of Formula (Bl) or spacer” refers to an oligonucleotidewith at least one structure of Formula (Bl) or a spacer. An oligonucleotide with one or more structures of Formula (Bl) or spacers can, in various embodiments, include one, two, three, four, five, six, seven, eight, nine, or ten structuree of Formula (Bl) or spacers. In various embodiments, an oligonucleotide comprising one or more structures of Formula (Bl) or spacers includes at least one segment with at most 7 linked nucleosides. In various embodiments, every segment of an oligonucleotide with one or more structures of Formula (Bl) or spacers has at most 7 linked nucleosides. For example, the oligonucleotide may include 23 oligonucleotide units that includes two structures of Formula (Bl) or spacers that divide the oligonucleotide into three separate segments of 7 linked nucleosides each. Therefore, each segment of the oligonucleotide has at most 7 linked nucleosides.

[0029] Generally, UNC13A oligonucleotides comprising one or more structures of Formula (Bl) or one or more spacers are described in reference to a corresponding UNC13A parent oligonucleotide or a corresponding UNC13A oligonucleotide variant. Example UNC13A oligonucleotides comprising one or more structures of Formula (Bl) or one or more spacers include any of SEQ ID NOs: 5073-5092.

[0030] In various embodiments, one or more structures of Formula (Bl) or one or more spacers may be located at one or more positions of an oligonucleotide. A structure of Formula (Bl) or a spacer may be located between a first position and a second position of the oligonucleotide. As used herein, a structure of Formula (Bl) or a spacer located between a first position and second position encompasses being located at the first position, located at the second position, or located at any position of the oligonucleotide sandwiched by the first position and the second position.

[0031] In the present specification, the term “therapeutically effective amount” means the amount of an oligonucleotide, such as a modified oligonucleotide disclosed herein, that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor, or other clinician. The oligonucleotide is administered in therapeutically effective amounts to treat and / or prevent a disease, condition, disorder, or state, for example, a neurological disease and / or a neuropathy. Alternatively, a therapeutically effective amount of an oligonucleotide is the quantity required to achieve a desired therapeutic and / or prophylactic effect, such as an amount which results in the prevention of or a decrease in the symptoms associated with a disease associated with reduced UNC13A activity in the motor neurons.

[0032] The phrase “a UNC13A oligonucleotide that targets a UNC13A transcript” refers to a UNC13A oligonucleotide that binds to a UNC13A transcript

[0033] The term “pharmaceutically acceptable salt(s)” as used herein refers to salts of acidic or basic groups that may be present in a UNC13A oligonucleotide used in the present compositions. A UNC13A oligonucleotide included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., l,l’-methylene-bis-(2- hydroxy-3-naphthoate)) salts. A UNC13A oligonucleotide included in the present compositions that include an amino moiety may form pharmaceutically acceptable salts with various amino acids, in addition to the acids mentioned above. Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the disclosure include, for example, pharmaceutically acceptable salts of UNC13A oligonucleotides that include a sequence of any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, or SEQ ID NOs: 5073-5092.

[0034] A UNC13A oligonucleotide of the disclosure may contain one or more chiral centers, groups, linkages, and / or double bonds and, therefore, exist as stereoisomers, such as geometric isomers, enantiomers or diastereomers. The term “stereoisomers” when used herein consist of all geometric isomers, enantiomers or diastereomers. These compounds may be designated by the symbols “R” or “S” (or “Rp” or “Sp”) depending on the configuration of substituents around the stereogenic atom, for example, a stereogenic carbon, phosphorous, or sulfur atom. In some embodiments, one or more linkages of the compound may have a Rp or Sp configuration (e.g., one or more phosphorothioate linkages have either a Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., onephosphorothioate linkage has a Rp configuration and a second phosphorothioate linkage has a Sp configuration). In various embodiments, the UNC13A oligonucleotide can have a mixed configuration of phosphorothioate linkages. For example, the UNC13A oligonucleotide may have five phosphorothioate linkages in a Rp configuration, followed by fifteen phosphorothioate linkages in a Sp configuration, followed by five phosphorothioate linkages in a Rp configuration. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly.

[0035] Individual stereoisomers of a UNC13A oligonucleotide of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the ait. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography and liberation of the optically pure product from the auxiliary, (2) salt formation employing an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on chiral chromatographic columns. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods, such as chiral-phase gas chromatography, chiral-phase super critical fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereomerically-pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0036] The UNC13A oligonucleotide disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms.

[0037] As used herein, “2’-O-(2-methoxyethyl)” (also 2’-M0E and 2’-O(CH2)2OCH3 and MOE) refers to an (9-methoxyethyl modification of the 2’ position of a furanose ring. A 2’-O-(2- methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in the present disclosure. A sugar moiety in a nucleoside modified with 2’ -MOE is a modified sugar.

[0038] As used herein, “2’-MOE nucleoside” (also 2’ -O-(2- methoxy ethyl) nucleoside) means a nucleoside comprising a 2’ -MOE modified sugar moiety.

[0039] As used herein, ”2’ -substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanose ring other than H or OH. In certain embodiments, 2’ substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0040] As used herein, “5-methyl cytosine” (5-MeC) means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine (5-MeC) is a modified nucleobase.

[0041] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As an example to the contrary, two nucleosides separated by a structure of Formula (Bl) or a spacer are not contiguous.

[0042] As used herein, a “spacer” refers to a nucleo side-replacement group (e.g., a non-nucleoside group that replaces a nucleoside present in a UNC13A parent oligonucleotide). The spacer is characterized by the lack of a nucleotide base and by the replacement of the nucleoside sugar’ moiety with a non-sugar substitute. The non-sugar substitute group of a spacer lacks an aldehyde, ketone, acetal, ketal, hemiacetal or hemiketal group. The non-sugar substitute group of a spacer is thus capable of connecting to the 3’ and 5’ positions of the nucleosides adjacent to the spacer through an internucleoside linker as described herein, but not capable of forming a covalent bond with a nucleotide base (i.e., not capable of linking a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide). Generally, a UNC13A oligonucleotide with a spacer is described in relation to a UNC13A parent oligonucleotide, wherein the spacer replaces a nucleoside of the UNC13A parent oligonucleotide. In all embodiments of the present disclosure, a spacer cannot hybridize to a nucleoside comprising a nucleobase at the corresponding position of a UNC13A transcript, within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is positioned after nucleoside 4 of an AON (i.e., at position 5 from the 5 ’-end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position of the target UNC13A transcript)).

[0043] As used herein, “mismatch” or a “non-complementary group” refers to the case when a group (e.g., nucleobase) of a first nucleic acid is not capable of pairing with the corresponding group (e.g., nucleobase) of a second or target nucleic acid.

[0044] As used herein, “modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside bond).

[0045] As used herein, “modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of a modified nucleobase include 5-methyl cytosine, pseudouridine, or 5 -methoxy uridine. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0046] As used herein, a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that are incapable of linking a nucleobase. Examples of modified nucleosides include, but are not limited to, 5-Me-C.

[0047] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). In various embodiments, an oligonucleotide may have different segments of linked nucleosides connected through a structure of Formula (B 1 ) or a spacer. Here, the structure of Formula (B 1 ) or the spacer (i.e., nucleoside replacement) is not considered a nucleoside and therefore, divides up the oligonucleotide into two segments of linked nucleosides. The oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides that are connected in a contiguous sequence), followed by a structure of Formula (B 1) or a spacer, and then a second segment of Z linked nucleosides. Here, the Y and Z linked nucleosides is described in either the 5’ to 3’ direction or the 3’ to 5’ direction. In various embodiments, the first segment consists of 7 or fewer linked nucleosides (e.g., Y = 7 or fewer) whereas the second segment comprises 8 or more linked nucleosides (e.g., Z = 8 or more).

[0048] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one (i.e., one or more) modified intemucleoside linkage, modified sugar, and / or modified nucleobase.

[0049] As used herein, “modified sugar” or “modified sugar moiety” means a modified furanosyl sugar moiety or a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.

[0050] As used herein, “natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’ -OH).

[0051] As used herein, “naturally occurring intemucleoside linkage” means a 3’ to 5’ phosphodiester linkage.

[0052] As used herein, “non-complementary nucleobases” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0053] As used herein, “nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, double-stranded nucleic acids, non-coding RNA, small interfering ribonucleic acids (siRNA), short-hairpin RNA (shRNA), and microRNAs (miRNA).

[0054] As used herein, “nucleobase” means a heterocyclic moiety capable of base pairing with a base of another nucleic acid.

[0055] As used herein, “nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a corresponding nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

[0056] As used herein, “nucleobase sequence” means the order of nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0057] As used herein, “nucleoside” refers to a nucleobase linked to a sugar. The term “nucleoside” also includes a “modified nucleoside” which has independently, a modified sugar moiety and / or modified nucleobase.

[0058] As used herein, “nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0059] As used herein, “oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0060] As used herein, “oligonucleotide” means a polymer of one or more segments of linked nucleosides each of which can be modified or unmodified, independent one from another.Antisense Therapeutics

[0061] Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate a transcript, such as mRNA. In various embodiments, antisense therapeutics comprise one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or spacers and can be used to modulate a transcript that is transcribed from a gene, such as a UNC13A pre- mRNA.

[0062] Antisense therapeutics may be single- or double- stranded deoxyribonucleic acid (DNA)- based, ribonucleic acid (RNA)-based, or DNA / RNA chemical analogue compounds. In general, antisense therapeutics are designed to include a sequence that is complementary or nearly complementary to an mRNA or pre-mRNA sequence transcribed from a given gene in order to promote binding between the antisense therapeutic and the pre-mRNA or mRNA. In certain embodiments, antisense therapeutics act by binding to an mRNA or pre-mRNA, thereby inhibiting protein translation, altering pre-mRNA splicing into mature mRNA (e.g., by preventing appropriate proteins such as splicing activator proteins from binding), and / or causing destruction of mRNA. In certain embodiments, the antisense therapeutic sequence is complementary to a portion of a targeted gene’s or mRNA’s sense sequence. In certain embodiments, antisense therapeutics described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to a pre-mRNA sense, or a portion thereof, and one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or spacers. In certain embodiments, antisense therapeutics described herein can also be nucleotide chemical analog-based compounds.

[0063] In certain embodiments, an oligonucleotide, such as disclosed herein, may be an oligonucleotide sequence of 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 oligonucleotide units in length. As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and / or a nucleobase) or a nucleo side-replacement group (e.g., Formula (B) (e.g., Formula (Bl)) or a spacer) of the oligonucleotide.

[0064] In particular embodiments, the oligonucleotides are 25 oligonucleotide units in length. In particular embodiments, the oligonucleotides are 23 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 26 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 27 oligonucleotide units in length.

[0065] In certain embodiments, AONs may include chemically modified nucleosides (for example, 2’-O-methylated nucleosides or 2’-O-(2-methoxyethyl) nucleosides) as well as modified intemucleoside linkages (for example, phosphorothioate linkages). In certain embodiments, AONs described herein include oligonucleotide sequences that are complementary to RNA sequences, such as UNC13A mRNA sequences. In certain embodiments, AONs described herein can include chemically modified nucleosides and modified intemucleoside linkages (for example, phosphorothioate linkages). In particular embodiments, AONs described herein include one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or spacers.

[0066] In various embodiments, the oligonucleotides comprise one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or spacers. In particular embodiments, the oligonucleotides comprise one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer. In various embodiments, the oligonucleotides comprise two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. For example, the oligonucleotide includes 25 oligonucleotide units with 23 nucleobases and two nucleoside replacement groups (e.g., two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers). For example, the oligonucleotide includes 23 oligonucleotide units with 21 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of oligonucleotides with one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer and oligonucleotides with two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers are described herein.

[0067] In some embodiments, an antisense oligonucleotide can be, but is not limited to, inhibitors of a gene transcript (for example, shRNAs, siRNAs, PNAs, LNAs, 2’-O-methyl (2’OMe) antisense oligonucleotide (AON), 2’-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))), or compositions that include such compounds. In some embodiments an oligonucleotide is an antisense oligonucleotide (AON) comprising 2’0Me (e.g., a AON comprising one or more 2’0Me modified sugar), MOE (e.g., a AON comprising one or more MOE modified sugar), peptide nucleic acids (e.g., a AON comprising one or more N-(2- aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleic acids (e.g., a AON comprising one or more locked ribose, and can be a mixture of 2’ -deoxy nucleotides or 2’0Me nucleotides), c-ET (e.g., a AON comprising one or more cET sugar), constrained methoxyethyl (cMOE) (e.g., a AON comprising one or more cMOE sugar), morpholino oligomer (e.g., a AON comprising a backbone comprising one or more PMO), deoxy-2’ -fluoro nucleoside (e.g., a AON comprising one or more 2’-fluoro-P-D-arabinonucleoside), tricyclo-DNAs (tcDNA) (e.g., a AON comprising one or more tcDNA modified sugar), 2’-O,4’-C-Ethylene-bridged nucleic acid (ENA) (e.g., a AON comprising one or more ENA modified sugar), or hexitol nucleic acids (HNA) (e.g., a AON comprising one or more HNA modified sugar). In some embodiments, a AON comprises one or more internucleoside linkage independently selected from a phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, aphosphoramidothioate linkage, a thiopho sphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, and PNA linkage. In some embodiments, a UNC13A AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages.

[0068] Peptide nucleic acids (PNAs) are short, artificially synthesized polymers with a structure that mimics DNA or RNA. PNAs include a backbone composed of repeating N-(2-aminoethyl)- glycine units linked by peptide bonds. In certain embodiments, PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and / or stabilize levels (e.g., full length UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity).

[0069] Locked nucleic acids (LNAs) are oligonucleotide sequences that include one or more modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2’ oxygen and 4’ carbon. LNAs are believed to have higher Tm’s than analogous oligonucleotide sequences. In certain embodiments, LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity. For example, LNAs can bind to UNCI 3 A pre-mRNA and prevent mis- splicing of UNC13A pre-mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity).

[0070] Morpholino oligomers arc oligonucleotide compounds that include DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. In certain embodiments, morpholino oligomers of the present invention can be designed to bind to specific pre-mRNA sequence of interest. For example, morpholino oligomers bind to UNC13A pre-mRNA thereby preventing mis-splicing of the pre-mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity). In certain embodiments, UNC13A morpholino oligomers described herein can be used as antisense therapeutics that bind to UNC13A pre-mRNA sequences with high specificity and prevent mis-splicing of UNC13A pre-mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity,for example, UNC13A activity). In certain embodiments, UNC13A morpholino oligomers described herein can also be used to bind UNC13A pre-mRNA sequences, altering UNC13A pre- mRNA splicing and UNC13A gene expression, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity).UNC13A Oligonucleotides Complementary to UNC13A Transcript

[0071] In some embodiments, a UNC13A AON includes a sequence that is at least 90% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NOs: 5057-5068). In some embodiments, a UNC13A AON includes a sequence that is between 90-95% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NOs: 5057-5068). In particular embodiments, a UNC13A AON includes a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NOs: 5057-5068). In particular embodiments, a UNC13A AON includes a sequence that is between 84% to 88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NOs: 5057-5068). In particular embodiments, a UNC13A AON includes a sequence that is between 89% to 92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a mis-spliced UNC13A transcript (e.g., SEQ ID NO: 5057-5068). In particular embodiments, a UNC13A AON includes a sequence that is between 94% to 96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NOs: 5057-5068).

[0072] In various embodiments, a UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529- 3792, or SEQ ID NOs: 5073-5092. In various embodiments, a UNC13A AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5133-5166, or SEQ ID NOs: 5073-5092.

[0073] In some embodiments, the UNC13A AON comprises a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer and has a segment having at most 7 linked nucleosides. In some embodiments, the UNC13A AON comprises a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer and has a segment having at most 6, 5, 4, 3, or 2 linked nucleosides.

[0074] UNC13A AON binding specificity can be assessed via measurement of parameters such as dissociation constant, melting temperature, or other criteria such as changes in protein or RNA expression levels or other assays that measure UNC13A activity or expression.

[0075] In some embodiments, a UNC13A AON can include a non-duplexed oligonucleotide. In some embodiments, a UNC13A AON can include a duplex of two oligonucleotides where the first oligonucleotide includes a nucleobase sequence that is completely or almost completely complementary to a UNC13A pre-mRNA sequence and the second oligonucleotide includes a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0076] In some embodiments, a UNC13A AON can target UNC13A pre-mRNAs produced from UNC13A genes of one or more species. For example, a UNC13A AON can target a UNC13A pre- mRNA of a mammalian UNC13A gene, for example, a human (i.e., Homo sapiens) UNC13A gene. In particular embodiments, the UNC13A AON targets a human UNC13A pre-mRNA. In some embodiments, the UNC13A AON includes a nucleobase sequence that is complementary to a nucleobase sequence of a UNC13A gene or a UNC13A pre-mRNA or a portion thereof.

[0077] UNC13A AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below:Table 1. Example UNC13A AON Sequences.* At least one (z.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phospho triester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.UNC13A Transcript

[0078] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 5057.GCAACCC(SEQ ID NO: 5064 (SOURCE NCBI Reference Sequence NG_052872.1)).

[0086] In various embodiments, a UNC13A transcript is a pre-mRNA UNC13A transcript. In various embodiments, a UNC13A pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 5065. NCBI Reference Sequence NC_000019.10 Reference GRCh38.pl3 Primary Assembly is SEQ ID NO: 5065.UNC13A Transcript with a Cryptic Exon

[0087] In some embodiments, an UNC13A AON targets a region of an UNC13A transcript comprising a cryptic exon sequence, the UNC13A mRNA transcript comprising the sequence provided as SEQ ID NO: 5066.ACTCATCCATCATCTAACAATTACCCCCAAATTCACCCATCCATACATCTUNC13A Oligonucleotides Targeting Regions of the UNC13A Transcript

[0090] In various embodiments, UNC13A AON disclosed herein are complementary to specific regions of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5068. In some embodiments, a UNC13A AON comprises a sequence that is complementary to a specific region of the UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5068. In some embodiments, aUNC13A AON comprises a sequence that is at least 85% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 90 to 99% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 90 to 95% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 95 to 99% complementary to a specific region of the UNC13A transcript.

[0091] In some embodiments, the UNC13A AON (e.g., UNC13A AON) has a segment that has, at most, 7 linked nucleosides. In some embodiments, the UNC13A AON has a segment that has, at most, 6, 5, 4, 3, or 2 linked nucleosides. The segments of the UNC13A AON may be separated from other segments of the UNC13A AON through a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer. The segment of the UNC13A AON is complementary to a specific region of the UNC13A transcript (for example, a UNC13A transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5063, a UNC13A pre-mRNA transcript transcribed from any one of SEQ ID NO: 5064 or 5065, or any one of SEQ ID NOs: 5066-5068.UNC13A Oligonucleotide Variants

[0092] In various embodiments, UNC13A AONs include different variants, hereafter referred to as UNC13A AON variants. A UNC13A AON variant may be an oligonucleotide sequence of 5 to 100 nucleobases in length, for example, 10 to 40 nucleobases in length, for example, 14 to 40 nucleobases in length, 10 to 30 nucleobases in length, for example, 14 to 30 nucleobases in length, for example, 16 to 28 nucleobases in length, for example, 19 to 23 nucleobases in length, for example, 21 to 23 nucleobases in length, for example, or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. A UNC13A AON variant may be an oligonucleotide sequence complementary to a portion of a UNC13A pre-mRNA sequence or a UNC13A gene sequence.

[0093] In various embodiments, a UNC13A AON variant represents a modified version of a corresponding UNC13A parent oligonucleotide that includes a nuclcobasc sequence selected fromany one of SEQ ID NOs: 1-1264. In some embodiments, a UNC13A AON variant includes a nucleobase sequence that represents a shortened version of a nucleobase sequence of a UNC13A AON selected from any one of SEQ ID NOs: 1-1264. As one example, if a UNC13A parent oligonucleotide includes a 25mer (e.g., 25 oligonucleotide units in length) a variant (e.g., a UNC13A variant) may include a shorter version (e.g., 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, or 23mer) of the 25mer UNC13A parent oligonucleotide. In one embodiment, a nucleobase sequence of a UNC13A AON variant differs from a corresponding nucleobase sequence of a UNC13A parent oligonucleotide in that 1, 2, 3, 4, 5, or 6 oligonucleotide units are removed from one or both of the 3’ and 5’ ends of the nucleobase sequence of the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 23mer where two oligonucleotide units were removed from one of the 3’ or 5’ end of a 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 23mer where one nucleotide base is removed from each of the 3’ and 5’ ends of the 25mcr included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 21mer where two oligonucleotide units are removed from each of the 3’ and 5’ ends of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 21mer where four oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 20mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and three oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 20mer where three oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 20mer where five oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 19mer where three oligonucleotide units are removed from each of the 3’ and 5’ ends of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a19mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and four oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 19mer where four oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 19mer where six oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide.

[0094] In one embodiment, the corresponding UNC13A AON variant may include a 18mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and five oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 18mer where five oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 18mer where one oligonucleotide unit is removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and six oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 18mer where six oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and one oligonucleotide unit is removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 18mer where seven oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide.

[0095] In one embodiment, the corresponding UNC13A AON variant may include a 17mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and six oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 17mer where six oligonucleotide units are removed from the 3’ end ofthe 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 17mer where eight oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide.

[0096] In one embodiment, the corresponding UNC13A AON variant may include a 16mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNCI 3 A parent oligonucleotide and seven oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 16mer where seven oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 16mer where nine oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide.

[0097] In one embodiment, the corresponding UNC13A AON variant may include a 15mer where two oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and eight oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 15mer where eight oligonucleotide units are removed from the 3’ end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5’ end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may include a 15mer where ten oligonucleotide units are removed from either the 3’ or 5’ end of the 25mer included in the UNC13A parent oligonucleotide. Example sequences of UNC13A AON variants (e.g., UNC13A AONs with 23 oligonucleotide units) are shown below in Table 2.Table 2. Example UNC13A Oligonucleotide Variant Sequences* At least one nucleoside linkage of the nucleobase sequence is selected from a pho sphoro thioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalky Iphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.Antisense Oligonucleotides with One or More Structures of Formula (B) (e.g., a structure of Formula (Bl)) or Spacers

[0098] In various embodiments, antisense oligonucleotides comprise one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or spacers. In particular embodiments,an antisense oligonucleotide includes one a structure of Formula (B) (e.g., a structure of Formula (Bl)) or one spacer. In particular embodiments, an antisense oligonucleotide includes two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. Generally, a spacer refers to a nucleoside-replacement group lacking a nucleotide base and wherein the nucleoside sugar moiety is replaced by a non-sugar substitute group. The non-sugar substitute group is not capable of linking to a nucleobase, but is capable of linking with the 3’ and 5’ positions of nucleosides adjacent to the spacer through an intemucleoside linking group.

[0099] In certain embodiments, an oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers, such as disclosed herein, may be an oligonucleotide with 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length. As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and / or a nucleobase) or a nucleoside-replacement group (e.g., a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer) of the oligonucleotide.

[0100] In particular embodiments, oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 25 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 23 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 21 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are at 18 oligonucleotide units in length. In various embodiments, the oligonucleotides with one ormore structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 20 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 21 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 22 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 23 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 24 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers arc 25 oligonucleotide units in length.

[0101] In various embodiments, a UNC13A AON comprises a sequence that shares at least 80% identity with an equal length portion of any one of SEQ ID NOs: 5073-5092. In various embodiments, a UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 5073-5092. In various embodiments, a UNC13A AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 5073-5092. In various embodiments, a UNC13A AON comprises a sequence that shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 5073- 5092. In various embodiments, a UNC13A AON comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 5073-5092.

[0102] In various embodiments, a UNC13A AON comprises the structure of Formula (B):

[0103] In various embodiments, a UNC13A AON comprises two structures, each structure of Formula (B):

[0104] In various embodiments, a UNC13A AON comprises the structure of Formula (Bl):

[0105] In various embodiments, a UNC13A AON comprises two structures, each structure of Formula (Bl):

[0106] As described further below, a UNC13A oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers is described in reference to a corresponding UNC13A parent oligonucleotide or a corresponding UNC13A variant oligonucleotide. In various embodiments, a UNC13A oligonucleotide with a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer differs from a UNC13A parent oligonucleotide or an UNC13A variant oligonucleotide in that the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside in the UNC13A parent oligonucleotide or an UNC13A valiant oligonucleotide. As used hereafter, the “position” of the UNC13A oligonucleotide refers to a particular location as counted from the 5’ end of the UNC13Aoligonucleotide. In various embodiments, a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer replaces a nucleoside at any one of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 of the UNC13A parent oligonucleotide or an UNC13A valiant oligonucleotide. In various embodiments, structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer replaces a nucleoside at one of positions 7, 8, 9, 11, 14, 16, 19, or 22 of the UNC13A parent oligonucleotide or an UNC13A variant oligonucleotide. In various embodiments, structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer replaces a nucleoside at one of positions 7, 8, 9, 16, or 19 of the UNC13A parent oligonucleotide or an UNC13A valiant oligonucleotide.

[0107] In various embodiments, a UNC13A oligonucleotide includes one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer that replaces a nucleoside in the UNC13A oligonucleotide (e.g., one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer replaces one nucleoside of the UNC13A oligonucleotide). In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside between positions 6 and 10 of the UNC13A oligonucleotide. In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside between positions 7 and 9 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside at position 7 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside at position 8 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside at position 9 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside between positions 15 and 20 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside between positions 16 and 19 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside at position 16 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside at position 17 of the UNC13A oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer replaces a nucleoside atposition 18 of the UNC13A oligonucleotide. In various embodiments, the spacer replaces a nucleoside at position 19 of the UNC13A oligonucleotide.

[0108] In various embodiments, a UNC13A oligonucleotide including one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer has 2 segments, where at least one of the 2 segments has at most 11 linked nucleosides. For example, the UNC13A oligonucleotide may be 23 oligonucleotide units in length, and the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer can be located at position 12. Therefore, the UNC13A oligonucleotide has 2 segments divided by the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer, where both of the 2 segments are 11 nucleobases in length. In various embodiments, a UNC13A oligonucleotide including one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer has 2 segments, where at least one of the 2 segments has at most 10 linked nucleosides. For example, the UNC13A oligonucleotide may be 21 oligonucleotide units in length, and the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer can be located at position 11. Therefore, the UNC13A oligonucleotide has 2 segments divided by the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer, where both of the 2 segments are 10 nucleobases in length. As another example, the UNC13A oligonucleotide may be 25 oligonucleotide units in length, and the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer can be located at position 15. Therefore, the UNC13A oligonucleotide has 2 segments divided by the spacer, where one of the 2 segments is 14 nucleobases in length and the second of the 2 segments is 10 nucleobases in length.

[0109] In various embodiments, a UNC13A oligonucleotide includes two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers that each replace a nucleoside in the UNC13A oligonucleotide (e.g., two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers replace two separate nucleosides of the UNC13A oligonucleotide). In various embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, at least 7 nucleobases, at least 8 nucleobases, at least 9 nucleobases, or at least 10 nucleobases in the oligonucleotide. In particular embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7nucleobases. In particular embodiments, the first structure of Formula (B) (e.g., a first structure of Formula (Bl)) and the second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or the first spacer and the second spacer are not adjacent to one another in the oligonucleotide.

[0110] In particular embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside between positions 7 and 11 of the UNC13A oligonucleotide. In various embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside between positions 8 and 11, positions 9 and 11, positions 10 and 11, positions 7 and 10, positions 7 and 9, positions 7 and 8, positions 8 and 10, positions 8 and 9, or positions 9 and 10 of the UNC13A oligonucleotide. In particular embodiments, a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside between positions 14 and 22 of the UNC13A oligonucleotide. In various embodiments, a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside between positions 15 and 22, positions 16 and 22, positions 17 and 22, position 18 and 22, position 19 and 22, positions 20 and 22, positions 21 and 22, positions 15 and 21, position 16 and 21, positions 17 and 21, positions 18 and 21, positions 19 and 21, positions 20 and 21, positions 15 and 20, positions 16 and 20, positions 17 and 20, positions 18 and 20, positions 19 and 20, positions 15 and 19, positions 16 and 19, positions 17 and 19, positions 18 and 19, positions 15 and 18, position 16 and 18, position 17 and 18, positions 15 and 17, positions 16 and 17, or positions 15 and 16 of the UNC13A oligonucleotide.

[0111] In preferred embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside at position 7 of the UNC13A oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 14 of the UNC13A oligonucleotide. In preferred embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside at position 7 of the UNC13A oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 19 of the UNC13A oligonucleotide. In preferred embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl) or a first spacer replaces a nucleoside at position 8 of the UNC13A parent oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 16 of the UNC13A parent oligonucleotide. In preferred embodiments, a first structure of Formula (B) (e.g., a first structure ofFormula (Bl)) or a first spacer replaces a nucleoside at position 8 of the UNC13A oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 15 of the UNC13A oligonucleotide. In preferred embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside at position 11 of the UNC13A oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 22 of the UNC13A oligonucleotide. In preferred embodiments, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer replaces a nucleoside at position 9 of the UNC13A oligonucleotide and a second structure of Formula (B) (e.g., a second structure of Formula (Bl)) or a second spacer replaces a nucleoside at position 19 of the UNC13A oligonucleotide.

[0112] In various embodiments, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides ( guanine or cytosine nucleosides). For example, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine adenosine or thymine nucleosides in the oligonucleotide. In various embodiments, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides). For example, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine guanine or cytosine nucleosides in the oligonucleotide. In various embodiments, the structures of Formula (B) (e.g., the structures of Formula (Bl)) or the spacers are positioned in the oligonucleotide to replace an equal number of adenosine / thymine nucleosides and guanine / cytosine nucleosides. For example, a first structure of Formula (B) (e.g., a first structure of Formula (Bl)) or a first spacer in the oligonucleotide may replace an adenosine / thymine nucleoside and a second spacer in the oligonucleotide may replace a guanine / cytosine nucleoside.

[0113] In various embodiments, the one or more stiuctures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned in the oligonucleotide to control the sequence content in the oligonucleotide. For example, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned such that at least one of the structures of Formula (B) (e.g., at least one of the structures of Formula (Bl)) orat least one of the spacers is located adjacent to a guanine group. In various embodiments, an oligonucleotide with structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers can include one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer adjacent to a guanine group, two spacers adjacent to guanine groups, three spacers adjacent to guanine groups, four spacers adjacent to guanine groups, or five spacers adjacent to guanine groups. In one embodiment, if counting from the 5’ end of the oligonucleotide, a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer immediately precedes a guanine group in the sequence. Thus, in various embodiments, an oligonucleotide with structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers can include one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer that immediately precedes a guanine group, two spacers that each immediately precede a guanine group, three spacers that each immediately precede a guanine group, four spacers that each immediately precede a guanine group, or five spacers that each immediately precede a guanine group. In one embodiment, if counting from the 5’ end of the oligonucleotide, a guanine group is immediately succeeded by a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer. Thus, in various embodiments, an oligonucleotide with structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers can include one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer that immediately succeeds a guanine group, two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers that each immediately succeed a guanine group, three structures of Formula (B) (e.g., three structures of Formula (Bl)) or three spacers that each immediately succeed a guanine group, four structures of Formula (B) (e.g., four structures of Formula (Bl)) or four spacers that each immediately succeed a guanine group, or five structures of Formula (B) (e.g., five structures of Formula (Bl)) or five spacers that each immediately succeed a guanine group. In various embodiments, the structures of Formula (B) (e.g., the structures of Formula (Bl)) or spacers in the oligonucleotide can be positioned to maximize the number of structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers adjacent to guanine groups.

[0114] In various embodiments, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides such that the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are located adjacent to guanine groups. For example, two structures of Formula (B) (e.g., two structures of Formula (Bl))or two spacers can replace adenosine or thymine nucleosides in the oligonucleotide, each of the two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers being located adjacent to a guanine group.

[0115] In various embodiments, the UNC13A oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers has a particular GC content. As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogenous bases in the oligonucleotide that are either guanine (G) or cytosine (C). In various embodiments, the UNC13A oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers has at least 10% GC content, at least 20% GC content, at least 25% GC content, at least 30% GC content, at least 35% GC content, at least 40% GC content, at least 45% GC content, at least 50% GC content, at least 55% GC content, at least 60% GC content, at least 65% GC content, at least 75% GC content, at least 80% GC content, at least 85% GC content, at least 90% GC content, or at least 95% GC content. In particular embodiments, the UNC13A oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers has at least 30% GC content. In particular embodiments, the UNC13A oligonucleotide with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers has at least 40% GC content. In various embodiments, the one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are positioned in the UNC13A oligonucleotide to maximize GC content. For example, instead of selecting a guanine or cytosine for replacement by a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer in the UNC13A oligonucleotide, a thymine or adenine can be selected for replacement by a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer.

[0116] In various embodiments, a UNC13A oligonucleotide with structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers is designed such that I) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides and 2) at least two, three, or four structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers are positioned adjacent to a guanine group. In some embodiments, a UNC13A oligonucleotide with structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers is designed such that 1) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides and 2) each of two structures of Formula (B) (e.g., two structures of Formula (Bl)) or spacers precede a guanine group.

[0117] In various embodiments, the inclusion of one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide in restoring full length UNC13A protein or full length UNC13A mRNA in comparison to the effect of a corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide in restoring full length UNC13A protein or full length UNC13A mRNA in comparison to the effect of a corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide in reducing quantity of UNC13A transcripts in comparison to the effect of a corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide in reducing quantity of UNC13A transcripts in comparison to the effect of a corresponding UNC13A parent oligonucleotide.

[0118] Tables 3 A, 3B, and 3C document example UNC13A oligonucleotides with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers and their relation to corresponding UNC13A parent oligonucleotides. Each UNC13A oligonucleotide is assigned a sequence name. As used hereafter, the nomenclature of the sequence name is expressed as “X_spA” (for a UNC13A AON with one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer), “X_spA_spB” (for a UNC13A AON with two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers), or “X_spA_spB_spC” (for a UNC13A AON with three structures of Formula (B) (e.g., three structures of Formula (Bl)) or three spacers). Here, “X” refers to the length of the UNC13A AON, “A” refers to the position in the UNC13A AON where the first structure of Formula (B) (e.g., the first structure of Formula (Bl)) or the first spacer is located, “B” refers to the position in the UNC13A AON where the second structure of Formula (B) (e.g., the second structure of Formula (Bl)) or the second spacer is located, and if present, “C” refers to the position in the UNC13A AON where the third spacer is located.

[0119] In various embodiments, UNC13A oligonucleotides include one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer. In various embodiments, the UNC13A oligonucleotides are oligonucleotide valiants, such as any one of a 23mer, 21mer, or 19mer. In various embodiments, the inclusion of a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer divides up the UNC13A oligonucleotide into two separate segments, where at least one of the segments is at most 11 linked nucleosides in length. In various embodiments, the inclusion of a structure of Formula (B) (e.g., a structure of Formula (Bl)) or a spacer divides up the UNC13A oligonucleotide into two separate segments, where at least one of the segments is at most 10 linked nucleosides in length.

[0120] In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located between positions 10 and 12 of the oligonucleotide. In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located at position 10 of the oligonucleotide. In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located at position 11 of the oligonucleotide. In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located at position 12 of the oligonucleotide. In particular embodiments, the structure of Formula (B) (e.g., the structure of Formula (Bl)) or the spacer is located at position 15 of the oligonucleotide. Example UNC13A AONs with one spacer are documented below in Table 3A.Table 3A: Identification of UNC13A AONs with one structure of Formula (B) (e.g., one structure of Formula (Bl)) or one spacer. Here, each UNC13A AON has 2 segments, where at least one of the segments has at most 11 linked nucleosides.At least one nucleoside linkage of the nucleobase sequence is selected from a phosphoro thioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage,an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0121] In various embodiments, UNC13A oligonucleotides include two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. In various embodiments, the inclusion of a spacer divides up the UNC13A oligonucleotide into three separate segments, where at least one of the segments is at most 7 linked nucleosides in length. Example UNC13A AONs with two spacers are documented below in Table 3B.Table 3B: Identification of UNC13A AONs with two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. Here, each UNC13A AON has 3 segments, where at least one of the segments has at most 7 linked nucleosides.* At least one nucleoside linkage of the nucleobase sequence is selected from a phosphoro thioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0122] In various embodiments, UNC13A AONs with one or more structures of Formula (Bl) or one or more spacers are reduced in length in comparison to the UNC13A AONs described above in Tables 3A and 3B. For example, such UNC13A AONs may be UNC13A oligonucleotide variants with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers. In various embodiments, the UNC13A oligonucleotide variants with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are 23mers, 21mers, or 19mers. In various embodiments, UNC13A oligonucleotide variants include two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers such that the UNC13A oligonucleotide variant includes three segments that are divided up by the two structuresof Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. In various embodiments, at least one of the three segments has at most 7 linked nucleosides. In various embodiments, each of the three segments has at most 7 linked nueclosides. Example UNC13A oligonucleotide variants with one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers are shown below in Table 3C.Table 3C: Example UNC13A AON variants with two structures of Formula (B) (e.g., two structures of Formula (Bl)) or two spacers. Here, each UNC13A AON variant has 3 segments, where at least one segment has at most 7 linked nucleosides.* At least one nucleoside linkage of the nucleobase sequence is selected from a phosphoro thioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.Performance of UNC13A OligonucleotidesF0123] Generally, UNC13A oligonucleotides and / or UNC13A parent oligonucleotides (e.g., UNC13A oligonucleotides with sequences of any of SEQ ID NOs: 1-1264, SEQ ID NO: 2529- 3792, or SEQ ID NOs: 5073-5092) target UNC13A transcripts (for example, a UNC13A pre- mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NOs: 5057-5068 in order to increase, restore, rescue, or stabilize levels of expression of UNC13A mRNA that is capable of translation to produce a functional UNC13A protein (e.g.. full length UNC13A). In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of mis-spliced UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A protein. In various embodiments, UNC13A AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length UNC13A protein. In some embodiments, the percent increase of the full length UNC13A protein is an increase in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide. For example, a TDP43 antisense oligonucleotide can be used to deplete full length UNC13A protein followed by increase of the full length UNC13A protein using a UNC13A AON.

[0124] In some embodiments, UNC13A AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein. In some embodiments, the percent rescue of full length UNC13A refers to the % of full length UNC13A following depletion using a TDP43 antisense oligonucleotide and a treatment using UNC13A AONs in comparison to a negative control (e.g., cells that did not undergo depletion or treatment or cells that were treated with a vehicle solution).

[0125] In various embodiments, UNC13A AONs can exhibit at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of an UNC13A transcript with a cryptic exon. In various embodiments, UNC13A AONs can exhibit at least a 100% reduction of an UNC13A transcript with a cryptic exon. In various embodiments, reduction of an UNC13A transcript with a cryptic exon is measured in comparison to a level of UNC13A transcript with a cryptic exon detected using a TDP43 antisense oligonucleotide. In various embodiments, UNC13A AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction of an UNC13A transcript with a cryptic exon.Modifications

[0126] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar- portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear- polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.

[0127] Modifications to antisense compounds encompass substitutions or changes to intemucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased activity.

[0128] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

[0129] Additional details of Chemically Modified UNC13A Oligonucleotides are described in WO2023102225, which is hereby incorporated by reference in its entirety.Modified Intemucleoside Linkages

[0130] The naturally occurring internucleoside linkage of RNA and DNA is a 3’ to 5’ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0131] Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorusatom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known.

[0132] In certain embodiments, antisense compounds targeted to a UNC13A nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage. In certain embodiments, the antisense compounds targeted to a UNC13A nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.Modified Sugar Moieties

[0133] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(RI)(R2) (R, RI and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2’ -F-5’ -methyl substituted nucleoside (see PCT International Application WO 2008 / 101157 Published on Aug. 21, 2008 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see published U.S. Patent Application US2005- 0130923, published on Jun. 16, 2005) or alternatively 5 ’-substitution of a BNA (see PCT International Application WO 2007 / 134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5 ’-methyl or a 5 ’-vinyl group).

[0134] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or 5), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’-0 CH2CH2F and 2’-O(CH2)2OCH3 substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O — C1-C10 alkyl, OCF3, OCH2F, O(CH2)2S CH3, O(CH2)2— O— N(Rm)(Rn), O— CH2— C(=O)— N(Rm)(Rn), and O— CH2— C(=O)— N(Ri)— ( CH2)2— N(Rm)(Rn)- , where each Ri, Rmand Rnis, independently, H or substituted or unsubstituted C1-C10 alkyl.

[0135] Additional examples of modified sugar moieties include a 2’-0Me modified sugar moiety, bicyclic sugar’ moiety, 2’-O-(2-methoxyethyl) (2’-M0E), 2’ -deoxy -2’ -fluoro nucleoside, 2’-fluoro- P-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

[0136] As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4’-(CH2)— 0-2’ (LNA); 4’-(CH2)— S-2’; 4’-(CH2)2— 0-2’ (ENA); 4’-CH(CH3)— 0-2’ and 4’-CH(CH2OCH3) — 0-2’ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4’-C(CH3)(CH3) — 0-2’ (and analogs thereof see published International Application WO / 2009 / 006478, published Jan. 8, 2009); 4’-CH2— N(OCH3)-2’ (and analogs thereof see published International Application WO / 2008 / 150729, published Dec. 11, 2008); 4’-CH2— O — N(CH3)-2’ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4’- CH2— N(R)— 0-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4’-CH2— C(H)(CH3)-2’ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4’-CH2— C — (=CH2)-2’ (and analogs thereof see published International Application WO 2008 / 154401, published on Dec. 8, 2008).

[0137] Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035- 10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr.Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461;6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Ser. No. 60 / 989,574;61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; Published PCT International applications WO 1994 / 014226; WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; and WO 2009 / 006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar' configurations including for example ot-L-ribofuranose and P-D-ribofuranose (see PCT international application PCT / DK98 / 00393, published on Mar. 25, 1999 as WO 99 / 14226).

[0138] In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from — [C(Ra)(Rb)]n — , — C(Ra)=C(Rb) — , — C(Ra)=N — , — C(=O)— , — C(=NRa)— , — C(=S) — , — O— , — Si(Ra)2— , — S(=O)X— , and — N(Ra)— ; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi, acyl (C(=O) — H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=O)-Ji); and each Ji and Jo is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C20 aryl, acyl (C(=O) — H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

[0139] In certain embodiments, the bridge of a bicyclic sugar- moiety is — [C(Ra)(Rb)]n — , — [ — [C(Ra)(Rb)]n — O — , — C(RaRb) — N(R) — O — or — C(RaRb) — O — N(R) — . In certain embodiments, the bridge is 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2O-2’, 4’-(CH2)2O-2’, 4’-CH2O — N(R)-2’ and 4’-CH2 — N(R) — O-2’- wherein each R is, independently, H, a protecting group or C1-C12 alkyl, each Raand Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl,substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2- C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi, acyl (C(=O) — H), substituted acyl, CN, sulfonyl (S(=O)2-Ji), or sulfoxyl (S(=O)-Ji); each Ji and J2 is, independently, H, C1-C12 alkyl, substituted Ci- C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O) — H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group; and R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008).

[0140] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’ -2’ methylene-oxy bridge, may be in the a-L configuration or in the 0-D configuration. Previously, a-L-methyleneoxy (4’-CH2 — 0-2’) BNA’s have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0141] In certain embodiments, bicyclic nucleosides include, but are not limited to, a-L- methyleneoxy (4’-CH2 — O-2’) BNA, P-D-methyleneoxy (4’-CH2 — 0-2’) BNA, ethyleneoxy (4’- (CH2)2— 0-2) BNA, aminooxy (4’-CH2— O— N(R)-2’) BNA, oxyamino (4’-CH2— N(R)— 0-2’) BNA, methyl(methyleneoxy) (4’-CH(CH3) — 0-2’) BNA, methylene-thio (4’-CH2 — S-2’) BNA, methylene-amino (4’-CH2 — N(R)-2’) BNA, methyl carbocyclic (4’-CH2 — CH(CH3)-2’) BNA, and propylene carbocyclic (4’-(CH2)3-2’) BNA; wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008).

[0142] The present disclosure provide, in some embodiments, methods for treating, ameliorating, or preventing a neurological disease and / or a neuropathy further include methods of administering, to a patient, a pharmaceutically acceptable composition, for example, a pharmaceutically acceptable formulation that includes one or more UNC13A oligonucleotides. UNC13A oligonucleotides can increase, restore, or stabilize UNC13A activity, for example, UNC13A activity, and / or levels of UNC13A expression, for example, UNC13A mRNA and / or protein expression.

[0143] The present disclosure also provides pharmaceutical compositions comprising a UNC13A oligonucleotide formulated together with one or more pharmaceutically or cosmetically acceptable excipients. These formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, e.g., as part of a composition suitable for applying topically to skin and / or mucous membrane, for example, a composition in the form of a gel, a paste, a wax, a cream, a spray, a liquid, a foam, a lotion, an ointment, a topical solution, a transdermal patch, a powder, a vapor, or a tincture. Although the most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and on the nature of the particular UNC13A oligonucleotide being used.

[0144] The present disclosure also provides a pharmaceutical composition comprising a UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof (for example, a UNC13A AON that includes a sequence of any of SEQ ID NOs: 1-1264, SEQ ID NO: 2529-3792, or SEQ ID NOs: 5073-5092).

[0145] The present disclosure also provides methods that include the use of pharmaceutical compositions comprising a UNC13A AON is formulated together with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising a UNC13A AON, and one or more pharmaceutically acceptable excipients. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use. The most suitable form of administration in any given case will depend on the clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition that one is trying to prevent in a subject; the state, disorder, disease, or condition one is trying to prevent in a subject; and / or on the nature of the particular compound and / or the composition being used.Synthetic Methods

[0146] Methods disclosed herein are useful for synthesizing oligonucleotides described herein(e.g., oligonucleotides comprising one or more structures of Formula (B) (e.g., structures ofFormula (Bl)) or spacers, e.g., splice- switching oligonucleotides comprising one or more structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers).

[0147] Disclosed herein are methods or processes for synthesizing or preparing an oligonucleotide comprising one or more structures of Formula (B) (e.g., structures of Formula (Bl)) or spacers.

[0148] Disclosed herein are methods or processes for synthesizing or preparing an oligonucleotide comprising one or more structures of Formula (B):each of symbol represents the point of connection to an intemucleoside linkage.

[0149] In some embodiments, the intemucleoside linkage comprises a phosphodiester, a phosphorothioate, or a phosphoramidate.

[0150] In some embodiments, the intemucleoside linkage comprises the structure of:W is O, S, Se, or NILR1); each of X, Y, and Z is independently — O — , — S — , or — N^R1) — ;L is a covalent bond or an optionally substituted, linear or branched C1-C50 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted Ci-Ce alkylene, Ci-Ce alkenylene, — C=C — , — C(R')2 — , -Cy-, — O — , — S— , — S— S— , — N(R')— , — C(O)— , — C(S)— , — C(NR')— , — C(O)N(R')— , —N(R')C(O)N(R')— , — N(R')C(O)— , — N(R')C(O)O— , — OC(O)N(R')— , — S(O)— , — S(O)2— , — S(O)2N(R')— , — N(R')S(O)2— , — SC(O)— , — C(O)S— , — OC(O)— , or — C(O)O— ;R1is halogen, R, or an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted Ci- C6alkylene, Ci-C6alkenylene, — C=C— , — C(R')2— , -Cy-, — O— , — S— , — S— S— , — N(R')— , — C(O)— , — C(S)— , — C(NR')— , — C(O)N(R')— , — N(R')C(O)N(R')— , — N(R')C(O)— , — N(R')C(O)O— , — OC(O)N(R')— , — S(O)— , — S(O)2— , — S(O)2N(R')— , — N(R')S(O)2— , — SC(O)— , — C(O)S— , — OC(O)— , or — C(O)O— each R' is independently — R, — C(O)R, — CO2R, or — SO2R, or two R' on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;-Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen, or an optionally substituted group selected from Ci- C<> aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and eachindependently represents a connection to a nucleoside.

[0151] In some embodiments, the intemucleoside linkage comprises a structure described in PCT Publication No. WO 2016 / 028187, which is hereby incorporated by reference in its entirety.

[0152] In some embodiments, the intemucleoside linkage comprises a structure described in PCT Publication No. WO 2020 / 118246, which is hereby incorporated by reference in its entirety.

[0153] In some embodiments, the structure of Formula (B) is Formula (Bl):wherein each of I- symbol represents the point of connection to an intemucleoside linkage.

[0154] In some embodiments, the methods or processes for synthesizing or preparing an oligonucleotide comprising one or more structures of Formula (B) comprises one or more of the following synthetic steps: benzyl protection; reductive cleavage; alkylation; benzyl deprotection; DMT protection; and phosphoramidite installation.

[0155] In some embodiments, the methods or processes for synthesizing or preparing an oligonucleotide comprising one or more structures of Formula (B) comprises one or more of the following synthetic steps: protecting a compound of Formula (I); reductively cleaving a compound of Formula (II); alkylating a compound of Formula (III); deprotecting a compound of Formula (IV); protecting a compound of Formula (V); installing a phosphoramidite group on a compound of Formula (VI), thereby producing a compound of Formula (A), wherein each variable (i.e., R1, R2, and R3) is as defined and described herein; and using the compound of Formula (A) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0156] In various embodiments, the methods or processes for synthesizing or preparing an oligonucleotide comprising one or more structures of Formula (B) comprises the use of one or more of the following compounds: a compound of Formula (I); a compound of Formula (II); a compound of Formula (III); a compound of Formula (IV); a compound of Formula (V); a compound of Formula (VI); and a compound of Formula (A), wherein each variable (i.e.. R1, R2, and R3) is as defined and described herein.

[0157] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: reductively cleaving a compound of Formula (II):thereby producing a compound of Formula (III):

[0158] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: alkylating a compound of Formula (III):

[0159] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: deprotecting a compound of Formula (IV):thereby producing a compound of Formula (V):

[0160] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: protecting a compound of Formula (V):thereby producing a compound of Formula (VI):using the compound of Formula (VI) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0161] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: installing a phosphoramidite group on a compound of Formula (VI):thereby producing the compound of Formula (A):using the compound of Formula (A) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0162] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B), comprising: protecting a compound of Formula (I):thereby producing a compound of Formula (II):reductively cleaving the compound of Formula (II), thereby producing a compound of Formula (HI):alkylating the compound of Formula (III), thereby producing a compound of Formula (IV):deprotecting the compound of Formula (IV), thereby producing a compound of Formula(V):protecting a compound of Formula (V), thereby producing a compound of Formula (VI):installing a phosphoramidite group on the compound of Formula (VI), thereby producing the compound of Formula (A):each of R2and R3is independently H or Ci-Ce alkyl; and using the compound of Formula (A) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0163] Disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers comprising any of the processes described herein, or a combination thereof.

[0164] Disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (A). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (I). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (II). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (III). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (IV). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (V). Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more spacers or one or more structures of Formula (B) using a compound of Formula (VI).

[0165] In some embodiments, the splice- switching oligonucleotide comprising one or more spacers is any splice- switching oligonucleotide comprising one or more spacers described in PCT Publication No. WO 2021 / 247800, which is hereby incorporated by reference in its entirety.

[0166] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: protecting a compound of Formula (I):thereby producing a compound of Formula (II):each of R2and R3is independently H or Ci-Ce alkyl; and each ofsymbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (II) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0167] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: reductively cleaving a compound of Formula (II):thereby producing a compound of Formula (III):each of R2and R3is independently H or Ci-Ce alkyl; and each ofsymbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (III) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0168] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: alkylating a compound of Formula (III):whereinepresents the point of connection to an intemucleoside linkage; and using the compound of Formula (IV) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0169] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: deprotecting a compound of Formula (IV):thereby producing a compound of Formula (V):each ofsymbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (V) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0170] Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: protecting a compound of Formula (V):thereby producing a compound of Formula (VI):each ofsymbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (VI) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0171] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: installing a phosphoramidite group on a compound of Formula (VI):thereby producing the compound of Formula (A):each ofsymbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (A) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0172] Additionally disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising: protecting a compound of Formula (I):thereby producing a compound of Formula (II):reductively cleaving the compound of Formula (II), thereby producing a compound of Formula (HI):alkylating the compound of Formula (III), thereby producing a compound of Formula (IV):deprotecting the compound of Formula (IV), thereby producing a compound of Formula(V):protecting a compound of Formula (V), thereby producing a compound of Formula (VI):and installing a phosphoramidite group on the compound of Formula (VI), thereby producing the compound of Formula (A):each of R2and R3is independently H or Ci-Ce alkyl; and each of « symbol represents the point of connection to an intemucleoside linkage; and using the compound of Formula (A) to synthesize or prepare the oligonucleotide comprising one or more structures of Formula (B).

[0173] Disclosed herein is a process for preparing an oligonucleotide comprising one or more structures of Formula (B):comprising any of the processes described herein, or a combination thereof, wherein each ofsymbol represents the point of connection to an internucleoside linkage.

[0174] In any of the embodiments described herein, the method or process further comprises: protecting a compound of Formula (I):thereby producing a compound of Formula (II):each of R2and R3is independently H or Ci-Ce alkyl.

[0175] In any of the embodiments described herein, the method or process further comprises: reductively cleaving a compound of Formula (II):thereby producing a compound of Formula (III):each of R2and R3is independently H or Ci-Ce alkyl.

[0176] In any of the embodiments described herein, the method or process further comprises: alkylating a compound of Formula (III):

[0177] In any of the embodiments described herein, the method or process further comprises: deprotecting a compound of Formula (IV):thereby producing a compound of Formula (V):

[0178] In any of the embodiments described herein, the method or process further comprises: protecting a compound of Formula (V):thereby producing a compound of Formula (VI):

[0179] In any of the embodiments described herein, the method or process further comprises: installing a phosphoramidite group on a compound of Formula (VI):thereby producing the compound of Formula (A):whereinFormula (I)

[0180] In any of the embodiments described herein, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first base.

[0181] In some embodiments, the first base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, a hydride base, or a hydroxide base. Exemplary carbonate bases include, but are not limited to, Li2CO3, Na2COs, K2CO3, and CS2CO3. Exemplary hydride bases include, but are not limited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the first base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the first base is NaH.

[0182] In any of the embodiments described herein, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with Bn-X1, wherein X1is a leaving group. Exemplary leaving groups include, but are not limited to, halo and sulfonic acid esters. Exemplary leaving groups include, but are not limited to, -Cl, -Br, -I, -OTs, -OMs, or -OTf. In some embodiments, X1is halo. In some embodiments, X1is -Cl, -Br, or -I. In some embodiments, X1is -Cl. In some embodiments, X1is -Br. In some embodiments, X1is -I. In some embodiments, X1is sulfonic acid ester. In some embodiments, X1is OTs, -OMs, or -OTf.

[0183] In any of the embodiments described herein, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first solvent. In some embodiments, the first solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the first solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the first solvent is acetonitrile, dimethylformamide(DMF), dimethylsulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the first solvent is tetrahydrofuran (THF).

[0184] In any of the embodiments described herein, contacting the compound of Formula (I) with the first solvent comprises dissolving the compound of Formula (I) in the first solvent.

[0185] In any of the embodiments described herein, protecting a compound of Formula (I) comprises elevating reaction temperature to reflux. In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to above about 23 °C (e.g., about 23 °C, about 25 °C, about 27 °C, about 29 °C, about 30 °C, about 32 °C, about 34 °C, about 36 °C, about 38 °C, about 40 °C, about 42 °C, about 44 °C, about 46 °C, about 48 °C, about 50 °C, about 55 °C, about 60 °C, about 65 °C, about 70 °C, about 75 °C, about 80 °C, about 85 °C, about 90 °C, about 95 °C, about 100 °C, about 110 °C, about 120 °C, or about 130 °C). In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to about 50 °C, about 55 °C, about 60 °C, about 65 °C, about 70 °C, or about 75 °C. In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to about 65 °C.Formula (II)

[0186] In any of the embodiments described herein, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with an activating agent. In some embodiments, the activating agent comprises a trialkylsilyl cation. Exemplary alkyl groups for trialkylsilyl cations include methyl, ethyl, and propyl groups. In some embodiments, the activating agent comprises a trimethylsilyl cation. In some embodiments, the activating agent comprises a leaving group (e.g., halo or sulfonic acid ester). In some embodiments, the activating agent comprises a trimethylsilyl cation and a leaving group (e.g., halo or sulfonic acid ester). Exemplary activating agents comprising a trimethylsilyl cation include, but are not limited to, trimethylsilyl chloride (TMSC1) and trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activating agent is trimethylsilyl chloride (TMSC1) or trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activating agent is trimethylsilyl trifluoromethanesulfonate (TMSOTf).

[0187] In any of the embodiments described herein, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a reducing agent. In some embodiments, the reducing agent is an organosilyl reducing agent. In some embodiments, thereducing agent is a silane. In some embodiments, the reducing agent is a trialkylsilane. Exemplary alkyl groups for trialkylsilanes include methyl, ethyl, and propyl groups. In some embodiments, the reducing agent is triethylsilane.

[0188] In any of the embodiments described herein, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a second solvent. In some embodiments, the second solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1 -dichloroethane, 1,2- dichloroethane, cis-l,2-dichloroethene, trans- 1,2-dichloroethene, 1,2-dichloropropane, 1,1,1- trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the second solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the second solvent is dichloromethane (DCM) or 1 ,2-dichloroethane. In some embodiments, the second solvent is dichloromethane (DCM).

[0189] In any of the embodiments described herein, contacting the compound of Formula (II) with the second solvent comprises dissolving the compound of Formula (II) in the second solvent.

[0190] In any of the embodiments described herein, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature below about 0 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, or about -2 °C). In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, or about -8 °C. In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -18 °C.Formula (III)

[0191] In any of the embodiments described herein, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a second base. In some embodiments, the second base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, a hydride base, or a hydroxide base. Exemplary carbonate bases include, but are not limited to, Li2CC>3, NaiCO,, K2CO3, and CS2CO3. Exemplary hydride bases include, but arc notlimited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the second base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the second base is NaH.

[0192] In any of the embodiments described herein, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with an alkylating agent. In some embodiments, the alkylating agent is Rl-X2, wherein X2is a leaving group. Exemplary leaving groups include, but are not limited to, halo and sulfonic acid esters. Exemplary leaving groups include, but are not limited to, -Cl, -Br, -1, -OTs, -OMs, or-OTf. In some embodiments, X2is halo. In some embodiments, X2is -Cl, -Br, or -I. In some embodiments, X2is -Cl. In some embodiments, X2is -Br. In some embodiments, X2is -I. In some embodiments, X2is sulfonic acid ester. In some embodiments, X2is OTs, -OMs, or -OTf.

[0193] In any of the embodiments described herein, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a third solvent. In some embodiments, the third solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the third solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the third solvent is acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the third solvent is tetrahydrofuran (THF).

[0194] In any of the embodiments described herein, contacting the compound of Formula (III) with the third solvent comprises dissolving the compound of Formula (III) in the third solvent.

[0195] In any of the embodiments described herein, alkylating a compound of Formula (III) comprises lowering reaction temperature below about 10 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about - 8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8°C, or about 10 °C). In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about 0 °C.Formula (IV)

[0196] In any of the embodiments described herein, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a first catalyst. In some embodiments, the first catalyst is a palladium catalyst. In some embodiments, the first catalyst is a palladium (0) catalyst. In some embodiments, the first catalyst is a palladium on carbon. In some embodiments, the first catalyst is about 5% by weight palladium on carbon. In some embodiments, the first catalyst is about 10% by weight palladium on carbon.

[0197] In any of the embodiments described herein, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 1 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 18 mol%, about 20 mol%, about 25 mol%, 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, or about 50 mol% of the first catalyst. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 30 mol% of the first catalyst.

[0198] In any of the embodiments described herein, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at atmospheric pressure. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at about 0.9 atm, about 0.91 atm, about 0.92 atm, about 0.93 atm, about 0.94 atm, about 0.95 atm, about 0.96 atm, about 0.97 atm, about 0.98 atm, about 0.99 atm, about 1 atm, about 1.01 atm, about 1.02 atm, about 1.03 atm, about 1.04 atm, about 1.05 atm, about 1.06 atm, about 1.07 atm, about 1.08 atm, about 1.09 atm, or about 1.1 atm. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at about 1 atm. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at a pressure of about 0.5 megapascal (MPa) to about 1.5 megapascal (MPa) (e.g., about 0.5 MPa, about 0.6 MPa, about 0.7 MPa, about 0.8 MPa, about 0.9MPa, about 1.0 MPa, about 1.1 MPa, about 1.2 MPa, about 1.3 MPa, about 1.4 MPa, or about 1.5 MPa).

[0199] In any of the embodiments described herein, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a fourth solvent. In some embodiments, the fourth solvent is a protic solvent. Exemplary protic solvents include, but are not limited to, alcoholic solvents, such as methanol and ethanol. In some embodiments, the fourth solvent is methanol or ethanol. In some embodiments, the fourth solvent is methanol.

[0200] In any of the embodiments described herein, contacting the compound of Formula (IV) with the fourth solvent comprises dissolving the compound of Formula (IV) in the fourth solvent.

[0201] In any of the embodiments described herein, deprotecting a compound of Formula (IV) comprises reaction temperature of room temperature. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of ambient temperature. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of about 20 °C, about 21 °C, about 22 °C, about 23 °C, about 24 °C, about 25 °C, or about 26 °C. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of about 23 °C.Formula (V)

[0202] In any of the embodiments described herein, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6- dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert- butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (lutidine).

[0203] In any of the embodiments described herein, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP).

[0204] In any of the embodiments described herein, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, about 20 mol%, about 22 mol%, about 24 mol%, about 25 mol%, about 27 mol%, about 29 mol%, about 30 mol%, about 32 mol%, about 34 mol%, about 35 mol%, about 37 mol%, about 39 mol%, about 40 mol%, about 42 mol%, about 44 mol%, about 45 mol%, about 48 mol%, about 50 mol%, about 55 mol%, or about 60 mol% of the second catalyst. In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst.

[0205] In any of the embodiments described herein, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with DMT-X3, wherein X3is a leaving group. Exemplary leaving groups include, but are not limited to, -Cl, -Br, -I, -OTs, -OMs, or-OTf. In some embodiments, X3is halo. In some embodiments, X3is -Cl, -Br, or -I. In some embodiments, X3is -Cl. In some embodiments, X3is -Br. In some embodiments, X3-I. In some embodiments, X3is sulfonic acid ester. In some embodiments, X3is OTs, -OMs, or -OTf.

[0206] In any of the embodiments described herein, protecting a compound of Formula (V) comprises lowering reaction temperature below about 10 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about - 8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about 0 °C.Formula (VI)

[0207] In any of the embodiments described herein, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fourth base. In some embodiments, the fourth base is an organic base. In some embodiments, the fourth base is an amine base. In some embodiments, the fourth base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, 2,6-dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the fourth base is triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA). In some embodiments, the fourth base is N,N-diisopropylethylamine (DIPEA).

[0208] In any of the embodiments described herein, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a phosphoramidite reagent.

[0209] In any of the embodiments described herein, the phosphoramidite reagent is, wherein X5is a leaving group. Exemplary leaving groups include, but are not limited to, halo and sulfonic acid esters. Exemplary leaving groups include, but are not limited to, -Cl, -Br, -I, -OTs, -OMs, or-OTf. In some embodiments, X5is halo. In some embodiments, X5is -Cl, -Br, or -I. In some embodiments, X5is -Cl. In some embodiments, X5is -Br. In some embodiments, X5is -I. . In some embodiments, X5is sulfonic acid ester. In some embodiments, X5is OTs, -OMs, or -OTf. In some embodiments, the phosphoramidite reagent is 2-cyanoethyl N,N- diisopropylchlorophosphoramidite.

[0210] In any of the embodiments described herein, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fifth solvent. In some embodiments, the fifth solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1- dichloroethane, 1 ,2-dichloroethane, cis-l,2-dichloroethene, trans- 1 ,2-dichloroethene, 1,2- dichloropropane, 1,1,1 -trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the fifth solvent is dichloromethane (DCM) or dichlorocthanc (DCE). In some embodiments, the fifth solvent is dichloromcthanc (DCM) or 1,2- dichloroethane. In some embodiments, the fifth solvent is dichloromethane (DCM).

[0211] In any of the embodiments described herein, contacting the compound of Formula (VI) with the fifth solvent comprises dissolving the compound of Formula (VI) in the fifth solvent.

[0212] In any of the embodiments described herein, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature lowering reaction temperature below about 10 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about 0 °C.Subformulas

[0213] In any of the embodiments described herein, R2is H or C1-C3 alkyl. In some embodiments, R2is H, -Me, -Et, or -nPr. In some embodiments, R2is -Me, -Et, or -nPr. In some embodiments, R2is -Me. In some embodiments, R2is -Et. In some embodiments, R2is -nPr.

[0214] In any of the embodiments described herein, R3is H or C1-C3 alkyl. In some embodiments, R3is H, -Me, -Et, or -nPr. In some embodiments, R3is -Me, -Et, or -nPr. In some embodiments, R3is -Me. In some embodiments, R3is -Et. In some embodiments, R3is -nPr.

[0215] In any of the embodiments described herein, R2is -Me and R3is -Me.

[0216] In any of the embodiments described herein, the compound of Formula (A) or Formula (Al) is:

[0217] In any of the embodiments described herein, the compound of Formula (IV) or Formula(IV-a) is:

[0218] In any of the embodiments described herein, the compound of Formula (V) or Formula (V- a) is:

[0219] In any of the embodiments described herein, the compound of Formula (VI) or Formula(Vl-a) is:Example Diseases

[0220] UNC13A AONs disclosed herein are useful for treating a neurological disease and / or a neuropathy in a patient in need thereof. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic -predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motorneuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

[0221] Further details of exemplary neurological diseases and / / or neuropathies including motor neuron diseases, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson- dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism are described in WO2023102225, which is hereby incorporated by reference in its entirety.Methods of Treatment

[0222] The disclosure contemplates, in part, treating neurological diseases including any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), Limbic-predominant age-related TDP-43 encephalopathy (LATE), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism) in a patient in need thereof comprising administering a UNC13A AON. In some embodiments, provided herein are methods for treatment of a neurological disease in a patient in need thereof, comprising administering a disclosed UNC13A AON. In some embodiments of the disclosure, an effective amount of a disclosed UNC13A oligonucleotide may be administered to a patient in need thereof to treat a neurological disease, and / or to increase, restore, or stabilize expression of UNC13A mRNA that is capable of translation to produce a functional UNC13A protein, thereby increase, restore, or stabilize UNC13A activity and / or function.

[0223] In some embodiments, treating a neurological disease comprises at least ameliorating or reducing one symptom associated with the neurological disease (for example, reducing muscleweakness in a patient with ALS). Methods of treating a neurological disease (for example, ALS, FTD, or ALS with FTD) in a patient suffering therefrom are provided, that include administering a disclosed UNC13A AON. In some embodiments, methods of slowing the progression of a neurological disease, for example, a motor neuron disease, are provided.

[0224] Provided herein are methods of treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof comprising administering a disclosed UNC13A AON. The methods include for example, treating a subject at risk of developing a neurological disease; e.g., administering to the subject an effective amount of a disclosed UNC13A AON. Neurological diseases that can be treated in this manner include motor neuron diseases, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

[0225] Methods of preventing or treating neurological diseases (for example, PD, ALS, FTD, and ALS with FTD) form part of this disclosure. Such methods may comprise administering to a patient in need thereof or a patient at risk, a pharmaceutical preparation comprising a UNC13A AON disclosed herein. For example, a method of preventing or treating a neurological disease is provided comprising administering to a patient in need thereof a UNC13A AON disclosed herein.

[0226] Patients treated using an above method may experience an increase, restoration of, or stabilization of UNC13A mRNA expression, which is capable of translation to produce a functional UNC13A protein, of at least about 5%, 10%, 20%, 30%, 40% or even 50%, thereby increase, restore, or stabilize UNC13A activity and / or function in a target cell (for example, a motor neuron) after administering a UNC13A oligonucleotide e.g. after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3, months, 4 months, 5, months, or 6 months or more. In some embodiments, administering such a UNC13A oligonucleotide may be on, e.g., at least a daily basis. The UNC13A oligonucleotide may be administered orally. In some embodiments, the UNC13A oligonucleotide is administered intrathecally, intrathalamically, or intracisternally. For example, in an embodiment described herein, a UNC13A oligonucleotide is administered intrathecally, intrathalamically or intracisternally about every 3 months. The delay or amelioration of clinical manifestation of a neurological disease in a patient as a consequence of administering a UNC13A oligonucleotide disclosed here may be at least e.g., 6 months, 1 year, 18 months or even 2 year’s or more ascompared to a patient who is not administered a UNC13A oligonucleotide, such as one disclosed herein.

[0227] UNC13A oligonucleotides can be used alone or in combination with each other whereby at least two UNC13A oligonucleotides are used together in a single composition or as part of a treatment regimen. UNC13A oligonucleotides may also be used in combination with other drugs or AON for treating neurological diseases or conditions.

[0228] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, or SEQ ID NOs: 5073-5092, or a pharmaceutically acceptable salt thereof; wherein at least one (z.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramido thioate linkage, a thiopho sphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’ -deoxy-2’ -fluoro nucleoside, a 2’-fluoro-P-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers.

[0229] In various embodiments, disclosed herein is a method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, SEQ ID NOs:2529-3792, or SEQ ID NOs: 5073-5092, or a pharmaceutically acceptable salt thereof; wherein at least one (z.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramido thioate linkage, a thiopho sphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’ -deoxy-2’ -fluoro nucleoside, a 2’-fluoro-P-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained mcthoxycthyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers.

[0230] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, or SEQ ID NOs: 5073-5092, or a pharmaceutically acceptable salt thereof; wherein at least one (z’.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiopho sphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and aboranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’- O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-P-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers.Pharmaceutical Compositions and Routes of Administration

[0231] The present disclosure also provides methods for treating a neurological disease via administration of a pharmaceutical composition comprising a disclosed UNC13A oligonucleotide. In another aspect, the disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition may be comprised of a disclosed UNC13A oligonucleotide, and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutical composition” means, for example, a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount, of a therapeutic compound in a pharmaceutically acceptable carrier to be administered to a mammal, e.g., a human, in order to treat a neurological disease. In some embodiments, described herein are pharmaceutical compositions comprising a disclosed UNC13A oligonucleotide, and a pharmaceutically acceptable carrier. In another aspect, the disclosure provides use of a disclosed UNCI 3A oligonucleotide in the manufacture of a medicament for treating a neurological disease. “Medicament,” as used herein, has essentially the same meaning as the term “pharmaceutical composition.”

[0232] As used herein, “pharmaceutically acceptable carrier” means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the ait. In one embodiment the pharmaceutical composition is administered orally and includesan enteric coating suitable for regulating the site of absorption of the encapsulated substances within the digestive system or gut. For example, an enteric coating can include an ethylacrylatemethacrylic acid copolymer.

[0233] In one embodiment, a disclosed UNC13A oligonucleotide and any pharmaceutical composition thereof may be administered by one or several routes, including topically, intrathecally, intrathalamically, intraci sternally, intracerebroventricularly, parenterally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally. The term parenteral as used herein includes subcutaneous injections, intrapancreatic administration, intravenous, intracistemal, intracerebroventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. For example, a disclosed UNC13A oligonucleotide may be administered subcutaneously to a subject. In another example, a disclosed UNC13A oligonucleotide may be administered orally to a subject. In another example, a disclosed UNC13A oligonucleotide may be administered directly to the nervous system, or specific regions or cells of the nervous system (e.g., the brain, brain stem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, for example, a disclosed UNC13A oligonucleotide may be administered intrathecally, intrathalamically intracistemally, or intracerebroventricularly.

[0234] In various embodiments, a UNC13A oligonucleotide, for example a UNC13A AON, can be exposed to calcium-containing buffers prior to administration. Such calcium-containing buffers can mitigate toxicity adverse effects of the UNC13A oligonucleotide. Further details of exposing an example antisense oligonucleotide to calcium-containing buffers is described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is hereby incorporated by reference in its entirety.

[0235] In some embodiments, a UNC13A oligonucleotide, for example a UNC13A AON, can be encapsulated in a nanoparticle coating. It is believed that nanoparticle encapsulation prevents AON degradation and enhances cellular uptake. For example, in some embodiments a UNC13A oligonucleotide is encapsulated in a coating of a cationic polymer, for example, a synthetic polymer (e.g., poly-L- lysine, polyamidoamine, a polyfP-amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chitosan and a protamine). In some embodiments, a UNC13A oligonucleotide is encapsulated in a lipid or lipid-like material, for example, a cationic lipid, acationic lipid-like material, or an ionizable lipid that is positively charged only at an acidic pH. An example of a lipid nanoparticle nucleotide therapy includes Exicure’s XCUR-FXN, a lipid- nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, a UNC13A oligonucleotide is encapsulated in a lipid nanoparticle that includes hydrophobic moieties, e.g., cholesterol and / or a polyethylene glycol (PEG) lipid.

[0236] In various embodiments, a pharmaceutical composition comprising a disclosed UNC13A oligonucleotide may further comprise a bolaamphiphilic compound. Example bolaamphiphilic compounds are described in WO2014039493A1, W02014039500A1, W02014039502A1, W02014039503A1, and W02014039504A1, each of which is hereby incorporated by reference in its entirety. In particular embodiments, a bolaamphiphilic compound is a compound according to formula I: HG2L1HG1, or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; wherein: each HG1and HG2is independently a hydrophilic head group; andL1is alkylene, alkenyl, heteroalkylene, or heteroalkenyl linker; unsubstituted or substituted with C1-C20 alkyl, hydroxyl, or oxo.

[0237] In one embodiment, with respect to the bolaamphiphilic compound of formula I, the bolaamphiphilic compound is a compound according to formula 11, 111, IV, V, or VI:

[0238] or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; wherein: each HG1and HG2is independently a hydrophilic head group; each Z1and Z2is independently -C(R3)2-, -N(R3)- or -0-; each Rla, Rlb, R3, and R4is independently H or Ci-Cs alkyl; each R2aand R2bis independently H , Ci-Cs alkyl, OH, alkoxy, or O-HG1or O-HG2; each n8, n9, nil, and nl2 is independently an integer from 1-20; nlO is an integer from 2-20; and each dotted bond is independently a single or a double bond.

[0239] In one embodiment, with respect to the bolaamphiphilic compound of formula I, II, III, IV, V, or VI, each HG1and HG2is independently selected from:

[0240] wherein: X is -NR5aR5b, or -N+R5aR5bR5c; each R5a, and R5bis independently H or substituted or unsubstituted C1-C20 alkyl or R5aand R5bmay join together to form an N containing substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclyl; each R5cis independently substituted or unsubstituted C1-C20 alkyl; each R8is independently H, substituted or unsubstituted C1-C20 alkyl, alkoxy, or carboxy; ml is 0 or 1; and each nl3, nl4, and nl5 is independently an integer from 1-20.

[0241] In various embodiments, pharmaceutical compositions disclosed herein comprise complexes between bolaamphiphiles and pharmacologically or biologically active compounds (e.g., an UNC13A oligonucleotide disclosed herein). In various embodiments, the pharmaceutical compositions disclosed herein comprise a bolaamphiphile vesicle complexes comprising one or more bolaamphiphilic compounds and the biologically active compound is an oligonucleotide (e.g., an UNC13A oligonucleotide disclosed herein).

[0242] Pharmaceutical compositions containing a disclosed UNC13A oligonucleotide, such as those disclosed herein, can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington ’s Pharmaceutical Sciences, 18thed. (Mack Publishing Company, 1990).

[0243] Pharmaceutical formulations, in some embodiments, are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where thecomposition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.Parenteral Administration

[0244] The pharmaceutical compositions of the disclosure can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intracisternal, intracerebroventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes. The preparation of an aqueous composition, such as an aqueous pharmaceutical composition containing a disclosed UNC13A oligonucleotide, will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.

[0245] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including normal saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

[0246] Solutions of active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. The sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution. In one embodiment, a disclosed UNC13A antisense oligonucleotide may be suspended in a carrier fluid comprising 1% (w / v) sodiumcarboxymethylcellulose and 0.1% (v / v) TWEEN™ 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0247] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. Sterile injectable solutions of the disclosure may be prepared by incorporating a disclosed UNC13A antisense oligonucleotide in the required amount of the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze- drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter.

[0248] The preparation of more, or highly concentrated solutions for intramuscular injection is also contemplated. In this regal’d, the use of DMSO as solvent is preferred as this will result in extremely rapid penetration, delivering high concentrations of the disclosed oligonucleotide to a small area.

[0249] Suitable preservatives for use in such a solution include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal and the like. Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium carbonate, sodium acetate, sodium biphosphatc and the like, in amounts sufficient to maintain the pH at between about pH 6 and pH 8, and for example, between about pH 7 and pH 7.5. Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is in the range 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea and the like. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282 and tyloxapol. Suitable viscosityincreasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymcthylpropylccllulosc, lanolin, mcthylccllulosc , petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose and the like.Oral Administration

[0250] In some embodiments, contemplated herein are compositions suitable for oral delivery of a disclosed UNC13A oligonucleotide, e.g., tablets that include an enteric coating, e.g., a gastro- resistant coating, such that the compositions may deliver a UNC13A oligonucleotide to, e.g., the gastrointestinal tract of a patient.

[0251] For example, a tablet for oral administration is provided that comprises granules (e.g., is at least partially formed from granules) that include a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any SEQ ID NOs; 1-1264, SEQ ID NO: 2529-3792, or SEQ ID NOs: 5073-5092 that targets a UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5068, and pharmaceutically acceptable excipients. Such a tablet may be coated with an enteric coating. Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and / or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as Wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and / or antioxidants.

[0252] In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase that includes a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any of SEQ ID NOs: 1-1264, SEQ ID NO: 2529-3792, or SEQ ID NOs: 5073-5092 that targets a UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057- 5068, and a pharmaceutically acceptable salt. In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase that includes a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any of SEQ ID NOs: 1-1264, SEQ ID NO: 2529- 3792, or SEQ ID NOs: 5073-5092 that targets a UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5068, and a pharmaceutically acceptable filler. For example, a disclosed UNC13A oligonucleotide and a filler may be blended together, optionally, with other excipients, and formed into granules. In some embodiments, the intragranular phase may be formed using wet granulation, e.g., a liquid (e.g., water) is added to the blended UNC13A oligonucleotide and filler, and then the combination is dried, milled and / or sieved to producegranules. One of skill in the art would understand that other processes may be used to achieve an intragranular phase.

[0253] In some embodiments, contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and which may be blended with the intragranular phase to form a disclosed formulation.

[0254] A disclosed formulation may include an intragranular phase that includes a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pre-gelatinized starch, calcium carbonate, and others including combinations thereof.

[0255] In some embodiments, a disclosed formulation may include an intragranular phase and / or an extragranular phase that includes a binder, which may generally function to hold the ingredients of the pharmaceutical formulation together. Exemplary binders of the disclosure may include, but are not limited to, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pre-gelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others including combinations thereof.

[0256] Contemplated formulations, e.g., that include an intragranular phase and / or an extragranular phase, may include a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof. For example, an intragranular’ phase and / or an extragranular phase may include a disintegrant.

[0257] In some embodiments, a contemplated formulation includes an intra-granular phase comprising a disclosed UNC13A oligonucleotide and excipients chosen from: mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate or combinations thereof, and an extra-granular phase comprising one or more of: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or mixtures thereof.

[0258] In some embodiments, a contemplated formulation may include a lubricant, e.g. an extra- granular phase may contain a lubricant. Lubricants include but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, com starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0259] In some embodiments, the pharmaceutical formulation comprises an enteric coating. Generally, enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track. Enteric coatings may include a polymer that disintegrates at different rates according to pH. Enteric coatings may include for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymers, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymers, ethylacrylate-methacrylic acid copolymers, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.

[0260] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, Eudragit® grades. In some embodiments, an enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of a contemplated tablet by weight. For example, enteric coatings may include an ethylacrylate-methacrylic acid copolymer.

[0261] For example, in a contemplated embodiment, a tablet is provided that comprises or consists essentially of about 0.5% to about 70%, e.g., about 0.5% to about 10%, or about 1% to about 20%, by weight of a disclosed UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof. Such a tablet may include for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and / or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, a disclosed tablet may comprise an intragranular phase that includes about 30% to about 60%, e.g. about 45% to about 65% by weight, or alternatively, about 5 to about 10% by weight of a disclosed UNC13A oligonucleotide, about 30% to about 50%, or alternatively, about 5% to about 15% by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7%hydroxypropylmethylcellulose, and about 0% to about 4%, e.g., about 2% to about 4% sodium starch glycolate by weight.

[0262] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed UNC13A oligonucleotide comprises an intra-granular phase, wherein the intra-granular phase includes a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof (such as a sodium salt), and a pharmaceutically acceptable filler, and which may also include an extra-granular phase, that may include a pharmaceutically acceptable excipient such as a disintegrant. The extra-granular phase may include components chosen from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also include an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed UNC13A AON, e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight mannitol, about 10% to 30% by weight microcrystalline cellulose, and an enteric coating comprising an ethylacrylate-methacrylic acid copolymer.

[0263] In another example, a pharmaceutically acceptable tablet for oral use may comprise an intra-granular phase, comprising about 5 to about 10% by weight of a disclosed UNC13A AON, e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate; an extra-granular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating over the tablet comprising an ethylacrylate-methacrylic acid copolymer.

[0264] In some embodiments the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010 / 054826, which is hereby incorporated by reference in its entirety).

[0265] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In an embodiment, a contemplated tablet may have a dissolution profile, e.g., when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 7.2, of about 50% to about 100% of the UNC13A oligonucleotide releasing after about 120 minutes to about 240 minutes, for example after 180 minutes. In another embodiment, a contemplated tabletmay have a dissolution profile, e.g., when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in diluted HC1 with a pH of 1.0, where substantially none of the UNC13A oligonucleotide is released after 120 minutes. A contemplated tablet, in another embodiment, may have a dissolution profile, e.g., when tested in USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 6.6, of about 10% to about 30%, or not more than about 50% of the UNC13A oligonucleotide releasing after 30 minutes.

[0266] In some embodiments, methods provided herein may further include administering at least one other agent that is directed to treatment of diseases and disorders disclosed herein. In one embodiment, contemplated other agents may be co-administered (e.g., sequentially or simultaneously).Conjugates

[0267] In certain embodiments, provided herein are oligomeric compounds, which comprise an oligonucleotide (e.g., UNC13A oligonucleotide) and optionally one or more conjugate groups and / or terminal groups. Conjugate groups include one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2’ -position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and / or 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached to the 3’-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached to the 5 ’-position of a nucleoside of a modified oligonucleotide.

[0268] In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’- end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.

[0269] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.Conjugate Groups

[0270] In certain embodiments, a UNC13A AON is covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In particular embodiments, conjugate groups modify the circulation time (e.g., increase) of the oligonucleotides in the bloodstream such that increased concentrations of the oligonucleotides are delivered to the brain. In particular embodiments, conjugate groups modify the residence time (e.g., increase residence time) of the oligonucleotides in a target organ (e.g., brain) such that increased residence time of the oligonucleotides improves their performance (e.g., efficacy). In particular embodiments, conjugate groups increase the delivery of the oligonucleotide to the brain through the blood brain barrier and / or brain parenchyma (e.g., through receptor mediated transcytosis). In particular embodiments, conjugate groups enable the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553- 6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hcxyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison- Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethyl -ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crookeel al., J. Pharmacol. Exp. Then, 1996, 277, 923-937), a tocopherol group (Nishina et al.. Molecular Therapy Nucleic .Acids, 2015, 4, e220; and Nishina et al.. Molecular Therapy, 2008. 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620).Conjugate Moieties

[0271] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, dyes, bile acids, and phenylbutyric acid. In particular embodiments, conjugate moieties are selected from a peptide, a lipid, N- acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, panthothenic acid, polyethylene glycol, an antibody (e.g., an antibody for crossing the blood brain barrier such as antitransferrin receptor antibody), or a cell-penetrating peptide (e.g., transactivator of transcription (TAT) and penetratine).

[0272] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (£)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.Conjugate Linkers

[0273] Conjugate moieties are attached to a UNC13A AON through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0274] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selectedfrom alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0275] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the ait to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0276] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0277] In certain embodiments, conjugate linkers comprise 1-10 linker- nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise 3 linker-nucleosides.

[0278] In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N -benzoyl-5 -methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0279] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker- nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.

[0280] In certain embodiments, it is desirable for a conjugate group to be cleaved from the UNC13A AON. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0281] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0282] In certain embodiments, a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2’ -deoxy nucleoside that is attached to either the 3’ or 5 ’-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2’ -deoxy adenosine.Terminal Groups

[0283] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’- vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’ -linked nucleosides. In certain such embodiments, the 2’ -linked nucleoside is an abasic nucleoside. In various embodiments, terminal groups comprise one or more structures of Formula (B) (e.g., one or more structures of Formula (Bl)) or one or more spacers.EXAMPLES

[0284] The disclosure is further illustrated by the following examples, which are provided for illustrative purposes only. The following examples are not to be construed as limiting the scope of the disclosure in any way.Example 1. UNC13A Antisense Oligonucleotides

[0285] Several UNC13A antisense oligonucleotides with one or more structures of:were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 40,000 cells / well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to decrease expression of the full length UNC13A transcript and increase expression of UNC13A cryptic exon. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).

[0286] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ (SEQ ID NO: 5069) where * = phosphorothioate, underlined = DNA, other=2’-MOE RNA;each “C”is 5-MeC.

[0287] To evaluate UNC13A AON ability to reduce UNC13A cryptic exon levels, antisense oligonucleotides to UNC13A and TDP-43 AON were co-incubated with endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media alone. After 18 additional days, RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated and multiplexed RT- qPCR assay performed with Taqman probes for UNC13A cryptic exon, and reference GAPDH quantification.

[0288] Transcript levels (e.g., UNC13A cryptic exon, and TDP43 transcript) were detected by RT- qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_gl. UNC13a cryptic exon was detected using custom sequences.UNC13a Cryptic Exon:Forward Primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 5070) Reverse Primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 5071) Probe Sequence: AGTTCTTTCCAGGAAACCCAGGCA (SEQ ID NO: 5072)

[0289] To evaluate UNC13A AON ability to reduce UNC13A correctly spliced (CS) exon junction 20 / 21 levels, antisense oligonucleotides to UNC13A were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media alone. After 18 additional days, RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated and multiplexed RT-qPCR assay performed with Taqman probes for UNC13A CS exon 20 / 21 junction, and reference GAPDH quantification.

[0290] Transcript levels (e.g., UNC13A exon junction 20 / 21, and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_gl. UNC13A exon 20 / 21 junction was detected using TaqMan Gene Expression Assay Hs01000584_ml.

[0291] RT-qPCR was performed on Applied Biosystems® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50°C for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95°C for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95 °C for 1 second followed by 60°C for 20 seconds.

[0292] UNC13A-cryptic exon cycle threshold (Ct) values were subtracted from the GAPDH cycle threshold values to generate ACt. To visualize the quantitative changes (e.g., % decrease of UNC13A-cryptic transcript), the ACt UNC13A-cryptic values were normalized to the vehicle (treated with Endoporter only) to obtain AACt values. Finally, relative quantities (RQ) of transcript level were calculated using the equation 'RQ=2A-AACt' and is used to describe the treatment condition comparison to normal, healthy levels (1.0)

[0293] As shown in Table 1 and Table 2, UNC13A AONs (e.g., UNC13A oligonucleotides without spacers or with one or two structures of Formula (B) (e.g., one or two structures of Formula (Bl)) or one or two spacers) were tested for their ability to reduce UNC13A transcripts with a cryptic exon. Specific AON sequences are labeled according to their corresponding SEQ ID NO.

[0294] Correctly spliced UNC13A cycle threshold (Ct) values were also subtracted from the GAPDH cycle threshold values to generate ACt. To visualize the quantitative changes (e.g., % decrease of UNC13A-cryptic transcript), the ACt UNC13A-cryptic values were normalized to the vehicle (treated with Endoporter only) to obtain AACt values. Finally, relative quantities (RQ) of transcript level were calculated using the equation 'RQ=2A-AACt' and is used to describe the treatment condition comparison to normal, healthy levels (1.0).

[0295] Relative quantity (RQ) of transcript level was calculated using the equation RQ=2A(- deltadeltaCt) and is used to describe the treatment condition comparison to normal, healthy levels (1.0). RQ values for UNC13A corrected splicing were normalized using the following formula:(((RQAON - RQTDP43) / (RQendo-RQTDP43))*100

[0296] Table 4 shows exemplary UNC13A AONs evaluated in human derived iPSC motor neuronsTable 4. Exemplary UNC13A AONs (including UNC13A oligonucleotides with S#)* Unless otherwise noted, each of the nucleosides of antisense oligonucleotides shown in Table 4 are modified nucleosides with with 2’-O-(2-methoxyethyl) (2’ -MOE) sugar moieties, each “C” is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. S#, is not a nucleoside. S# represents the following structure:r neurons* Unless otherwise noted, each of the nucleosides of antisense oligonucleotides shown in Table 5 are modified nucleosides with 2’-O- (2-methoxyethyl) (2’-M0E) sugar moieties, each “C” is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. S#, is not a nucleoside. S# represents the structure of Formula (Bl) as disclosed herein.INCORPORATION BY REFERENCE

[0297] All publications and patents mentioned herein are hereby incorporated by reference in their entirety for all purposes as if each individual publication or patent was specifically and individually incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.EQUIVALENTS

[0298] While specific embodiments of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the present disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

[0299] Those skilled in the ail will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described herein. Such equivalents are intended to be within the scope of the following claims.

Claims

CLAIMSWhat is claimed is:

1. A modified oligonucleotide comprising 12 to 50 oligonucleotide units, the modified oligonucleotide comprising a sequence that is at least 90% complementary to an equal length portion of any one of SEQ ID NO: 5057-5068, wherein the modified oligonucleotide comprises at least one structure of Formula (Bl):wherein each ofsymbol represents the point of connection to an intemucleoside linkage.

2. The modified oligonucleotide of claim 1, wherein the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 linked nucleosides.

3. The modified oligonucleotide of claim 1 or 2, wherein the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides.

4. The modified oligonucleotide of any one of claims 1-3, wherein the modified oligonucleotide comprises a segment with 2, 3, 4, 5, 6, or 7 linked nucleosides.

5. The modified oligonucleotide of any one of claims 1-4, wherein every segment of the modified oligonucleotide comprises 2, 3, 4, 5, 6, or 7 linked nucleosides.

6. The modified oligonucleotide of any one of claims 1-5, wherein the modified oligonucleotide is between 18 and 30, between 19 and 30, between 20 and 30, between 21 and 30, between 22 and 30, between 23 and 30, between 24 and 30, or between 25 and 30 oligonucleotide units in length.

7. The modified oligonucleotide of any one of claims 1-6, wherein the modified oligonucleotide is 23 oligonucleotide units in length.

8. The modified oligonucleotide of any one of claims 1-6, wherein the modified oligonucleotide is 25 oligonucleotide units in length.

9. The modified oligonucleotide of any one of claims 1-8, wherein the structure of Formula (Bl) does not form a bond with a nucleotide base.

10. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) between positions 6 and 10 of the modified oligonucleotide.

11. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) between positions 7 and 9 of the modified oligonucleotide.

12. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) at position 7, position 8, or position 9 of the modified oligonucleotide.

13. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) between positions 15 and 20 of the modified oligonucleotide.

14. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) between positions 16 and 19 of the modified oligonucleotide.

15. The modified oligonucleotide of any one of claims 1-9, wherein the modified oligonucleotide comprises one structure of Formula (Bl) at position 16, position 17, position 18, or position 19 of the modified oligonucleotide.

16. The modified oligonucleotide of any one of claims 1-15, wherein the modified oligonucleotide comprises the structure of Formula (Bl) at position 8 and at position 16 of the modified oligonucleotide.

17. The modified oligonucleotide of any one of claims 1-15, wherein the modified oligonucleotide comprises the structure of Formula (Bl) at position 7 and at position 19 of the modified oligonucleotide.

18. The modified oligonucleotide of any one of claims 1-15, wherein the modified oligonucleotide comprises the structure of Formula (Bl) at position 9 and at position 19 of the modified oligonucleotide.

19. The modified oligonucleotide of any one of claims 1-18, wherein at least one (z.e., one or more) internucleoside linkage of the modified oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphoro thioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiopho sphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

20. The modified oligonucleotide of any one of claims 1-19, wherein at least one nucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage.

21. The modified oligonucleotide of claim 20, wherein the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration.

22. The modified oligonucleotide of any one of claims 1-21, wherein all internucleoside linkages of the modified oligonucleotide are phosphorothioate linkages.

23. The modified oligonucleotide of any one of claims 1-22, wherein the modified oligonucleotide comprises at least one modified sugar moiety.

24. The modified oligonucleotide claim 23, wherein the modified sugar moiety is one of a 2'- OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-M0E), 2'-deoxy-2'- fluoro nucleoside, 2’-fluoro-P-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), 5-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

25. The modified oligonucleotide claim 24, wherein the modified sugar moiety is a 2’-O-(2- methoxyethyl) (2 ’-MOE).

26. The modified oligonucleotide of any one of claims 1-25, wherein the modified oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase of full length UNC13A protein.

27. The modified oligonucleotide of claim 26, wherein increase of the full length UNC13A protein is measured in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide.

28. The modified oligonucleotide of any one of claims 1-25, wherein the modified oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein.

29. The modified oligonucleotide of any one of claims 1-25, wherein the modified oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced UNC 13 A transcript.

30. The modified oligonucleotide of any one of claims 1-29, wherein the modified oligonucleotide comprises a sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529- 3792, and SEQ ID NOs: 5073-5092.

31. The modified oligonucleotide of any one of claims 1-29, wherein the modified oligonucleotide comprises a sequence of any one of SEQ ID NOs: 5073-5092.

32. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-31, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

33. A method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to the patient a therapeutic amount of a modified oligonucleotide of any one of claims 1-31 or the pharmaceutical composition of claim 32.

34. The method of claim 32, wherein the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson- dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

35. The method of claim 33 or 34, wherein the modified oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracistemally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, intraduodenally, or intracerebroventricularly.

36. The method of claim 33 or 34, wherein the therapeutically effective amount of the modified oligonucleotide is administered intravenously.

37. The method of claim 33 or 34, wherein the therapeutically effective amount of the modified oligonucleotide is administered intrathecally, intrathalamically or intracistemally.

38. The method of any one of claims 33-37, wherein the patient is a human patient.

39. A method of restoring axonal outgrowth and / or regeneration of a neuron, the method comprising exposing the neuron to a modified oligonucleotide of any one of claims 1-31 or the pharmaceutical composition of claim 32.

40. A method of increasing, promoting, stabilizing, or maintaining UNC13A expression and / or function in a neuron, the method comprising exposing the cell to a modified oligonucleotide of any one of claims 1-31 or the pharmaceutical composition of claim 32.

41. The method of claim 39 or 40, wherein the neuron is a motor neuron.

42. The method of claim 39 or 40, wherein the neuron is a spinal cord neuron.

43. Use of the modified oligonucleotide of any one of claims 1-31 in the manufacture of a medicament for the treatment of a neurological disease or disorder, wherein optinally the neurological disease or disorder is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age- related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

44. The modified oligonucleotide of any one of claims 1-31 or the pharmaceutical composition of claim 32 for use in the treatment of a neurological disease or disorder in a subject, for use in restoring axonal outgrowth and / or regeneration of a neuron, or for increasing, promoting, stabilizing, or maintaining UNC13A expression and / or function in a neuron.

Citation Information

Patent Citations

  • 4'-thionucleosides and oligomeric compounds

    US20050130923A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • 6-modified bicyclic nucleic acid analogs

    US20090012281A1

  • Magnetic flux bias for pulse shaping of microwave signals

    US20210288611A1

  • Bicyclic cyclohexitol nucleic acid analogs

    US61026998P0