Compositions and methods for treating fibrotic and inflammatory diseases
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY DEPARTMENT OF HEALTH & HUMAN SERVICES
- Filing Date
- 2025-10-07
- Publication Date
- 2026-05-28
AI Technical Summary
Current therapeutic strategies for fibrotic and inflammatory disorders focus on immune cells and fibroblasts, neglecting epithelial cell repair and regeneration mechanisms, leading to a lack of effective treatments for conditions such as idiopathic pulmonary fibrosis, chronic kidney disease, and other fibrosing diseases.
Inhibitory compounds, including small molecules, proteins, antibodies, and iRNAs, specifically targeting the ABHD14B gene or protein to inhibit epithelial-mesenchymal transition (EMT) and collagen biosynthesis, thereby promoting epithelial cell repair and reducing fibrosis.
The inhibition of ABHD14B gene expression attenuates collagen production, reduces fibrosis, and enhances epithelial cell regeneration, providing therapeutic benefits for fibrotic and inflammatory diseases across various organs.
Smart Images

Figure US2025049791_28052026_PF_FP_ABST
Abstract
Description
Aty. Docket No. 40574-137COMPOSITIONS AND METHODS FOR TREATINGFIBROTIC AND INFLAMMATORY DISEASESCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority and the benefit of U.S. Provisional Patent Application No. 63 / 704,345, filed October 7, 2024, the entire contents of which are hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH & DEVELOPMENT
[0002] This invention was made with government support under grant number NIH Z01 AAOOO355 awarded by the National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health. The government has certain rights in the invention.INCORPORATION BY REFERENCE STATEMENT
[0003] This application includes a Sequence Listing submitted electronically as an XML file named 40574137SEQ, created on October 5, 2025, with a size of 187,494.4 bytes. The Sequence Listing is incorporated herein by reference.FIELD OF THE DISCLOSURE
[0004] The field of the disclosure generally relates to compositions and methods for inhibiting genetic pathways involved in inflammatory, proliferative, and fibrotic disorders.BACKGROUND
[0005] Fibrosing diseases are complex diseases having poor prognosis due to the absence of effective therapies. Fibrosis develops when a wound is severe, when a tissue damaging irritant persists, or when repair processes become dysregulated. During wound healing, the deposition of extracellular matrix (ECM) produced by myofibroblasts rebuilds parenchymal tissue architecture. However, once ECM production exceeds its degradation, tissue architecture is destructed and subsequently the process of fibrosis is initiated. Fibrosis may occur in many different vital organs or tissues, such as the kidneys (chronic kidney disease), lungs (idiopathic pulmonary fibrosis (IPF), cystic fibrosis), heart (myocardial fibrosis, atherosclerosis), digestive system (liver cirrhosis,Aty. Docket No. 40574-137Crohn’s disease), the lens of the eye (cataract), and skin (keloid, scleroderma), leading to organ dysfunction or failure. Currently, 6000 new cases of IPF are diagnosed annually, 1.2 million people die worldwide from chronic kidney disease, and 6.8 million new cases of irritable bowel disease are reported worldwide. In addition, it is estimated that 300 million people suffer from asthma. Further, it is predicted that by 2025, there will be over 100 million people that have a high risk of lung fibrosis. Thus, effective strategies that prevent or even reverse fibrotic pathological processes are urgently needed.
[0006] Fibrosis is characterized by loss of cellular homeostasis and excessive ECM deposition. Myofibroblasts, activated in response to tissue injury, synthesize ECM during wound healing and can be differentiated from multiple cell types, such as resident fibroblasts, pericytes, bone marrow, adipocytes, endothelial cells and epithelial cells. Epithelial-mesenchymal transition (EMT) is a process in which epithelial cells lose their apical-basal polarity and adhesion with downregulated epithelial markers such as E-cadherin, occludin, claudin-1, and acquire mesenchymal features with upregulated mesenchymal markers such as a-smooth muscle actin (a-SMA), vimentin, fibronectin and fibroblast-specific protein 1 (FSP-1). EMT is closely related to fibrogenesis in distinct organs and therefore, targeting EMT may be a valuable and novel anti-fibrotic therapeutic strategy.
[0007] Currently, all therapeutic approaches in the inflammatory and fibrotic disorders focus on pathologic processes in the immune cells and fibroblasts. However, there is no effective therapeutic strategy described yet focusing on the epithelial cell repair and regeneration mechanisms. The present disclosure provides compositions and methods that focus on such repair and regeneration mechanisms.SUMMARY OF THE DISCLOSUREOne aspect of the disclosure is an inhibitory compound that inhibits the expression of an abhydrolase domain containing 14B (ABHD14B) gene, or the activity or a protein encoded thereby. In certain aspects, the inhibitory compound may comprise a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA). The iRNA may comprise an antisense oligonucleotide (ASO), an siRNA, a ribozyme or a miRNA. The iRNA may inhibit expression of the ABHD14B gene. In certain aspects, the iRNA may comprise a region of complementarity to a target sequence in a ABHD14B mRNA transcript. The target sequence my comprise at least 12 contiguous nucleotides differing from no more than 5 nucleotides from the region of complementarity. TheAty. Docket No.40574-137 target sequence may be between 12 and 30 nucleotides in length. In certain aspects, the ABDHD14B mRNA transcript may comprise SEQ ID NO:1. The target sequence may be in an untranslated region of the ABHD14B mRNA transcript, and may comprises between 15 and 30 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise between 12 and 19 contiguous nucleotides from a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQIDNO:15, SEQ IDNO:16, SEQIDNO:19, SEQIDNO:20, SEQIDNO:23, SEQIDNO:24, SEQIDNO:31, SEQ IDNO:33, SEQIDNO:35, SEQIDNO:37, SEQIDNO:39, SEQIDNO:40, SEQIDNO:43, SEQ IDNO:44, SEQIDNO:47, SEQIDNO:48, SEQ IDNO:51, SEQIDNO:52, SEQIDNO:55, SEQ IDNO:57, SEQIDNO:59, SEQIDNO:61, SEQIDNO:63, SEQIDNO:64, SEQIDNO:67, SEQ IDNO:68, SEQIDNO:71, SEQIDNO:72, SEQIDNO:75, SEQIDNO:76, SEQIDNO 79, SEQ IDNO 81, SEQIDNO:83, SEQIDNO:85, SEQ IDNO:87, SEQIDNO:89, SEQ ID NO 91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQIDNO:113, SEQIDNO:115, SEQIDNO:117, SEQIDNO:119, SEQIDNO:121, SEQ ID NO: 123, SEQ ID NO: 125, and SEQ ID NO: 127. In certain aspects, the region of complementarity may comprise between 12 and 30 contiguous nucleotides differing no more than 5 nucleotides from a sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ IDNO:14, SEQIDNO:17, SEQ ID NO: 18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO 32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:46, SEQIDNO:49, SEQ IDNO:50, SEQIDNO:53, SEQIDNO:54, SEQ IDNO:56, SEQIDNO:58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQIDNO:73, SEQ IDNO:74, SEQIDNO:77, SEQIDNO:78, SEQIDNO:80, SEQIDNO:82, SEQIDNO:84, SEQ IDNO:86, SEQIDNO:88, SEQIDNO:90, SEQ IDNO:92, SEQIDNO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, and SEQ ID NO: 128. In certain aspects, the region of complementarity may be fully complementary to the target sequence. In certain aspects, the iRNA may comprise an ASO.Aty. Docket No. 40574-137
[0008] In certain aspects, the iRNA may comprise an siRNA having a sense strand and an antisense strand, and the antisense strand may comprise the region of complementarity. The sense strand and the antisense strands may hybridize to form double stranded RNA. In certain aspects, the sense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, and SEQ ID NO: 24. In certain aspects, the sense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, and SEQ ID NO: 24. In certain aspects, the antisense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 26. In certain aspects, the antisense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 26. The sense strand may comprise a nucleotide sequence at least 85%at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:3, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:63, or SEQ ID NO: 109 and the antisense strand may comprise a nucleotide sequence at least 85%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:4, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:65, or SEQ ID NO: 110. The sense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 11, and SEQ ID NO: 12, and the antisense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO: 13, and SEQ ID NO: 14. In certain aspects, the sense strand may comprise a nucleotide sequence at least 85%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:5, SEQ ID NO:15, or SEQ ID NO: 16, and the antisense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18. The sense strand mayAty. Docket No. 40574-137 comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO: 15, and SEQ ID NO: 16, and the antisense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO: 17, and SEQ ID NO: 18. The sense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22. The sense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22. The sense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand may comprise a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NOTO, SEQ ID NO:25, or SEQ ID NO:26. The sense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:9, SEQ ID NO:23, and SEQ ID NO:24, and the antisense strand may comprise a nucleotide sequence selected from the group consisting of SEQ ID NOTO, SEQ ID NO:25, and SEQ ID NO:26. The sense strand and the anti-sense strand are connected by a hairpin loop. In certain aspects, at least one ribonucleotide in the iRNA may a modified nucleotide, and the modified ribonucleotide may comprise a phosphonate modification, a ribose modification, or a base modification. The at least one modified nucleotide may be selected from the group consisting of a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2’-hydroxly- modified nucleotide, a 2'-methoxyethyl modified nucleotide, a morpholino nucleotide, a phosphorami date, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'- phosphate, and a nucleotide comprising a 5'-phosphate mimic.
[0009] In certain aspects, the inhibitory compound may comprise a molecule comprising a ligand, and the ligand may conjugated to the 5’ end of the iRNA or the 3’ end of the iRNA.Aty. Docket No. 40574-137
[0010] One aspect of the disclosure is a vector encoding an iRNA of the disclosure. In certain aspects, the vector may comprise a virus vector or a plasmid.
[0011] One aspect of the disclosure is a composition comprising an inhibitory compound of the disclosure, or a vector of the disclosure, wherein the inhibitory compound inhibits expression of a ABHD14B gene, or the activity or a protein encoded thereby, or wherein the vector encodes at least one strand of an iRNA that inhibits expression of a ABHD14B gene. The composition may comprise a lipid formulation, a polymer formulation or a sugar formulation. The composition may be a pharmaceutical composition. In certain aspects, the composition may comprise an inhibitory compound that inhibits expression of an CB1R gene, or a protein encoded thereby, and / or an inhibitory compound that inhibits expression of an MGLUR5 gene, or a protein encoded thereby. The composition may comprise a cell-penetrating peptide, which may be linked to the inhibitory compound. In certain aspects, the composition may comprise lipids that form a nanoparticle that encapsulates the inhibitory compound.
[0012] One aspect of the disclosure is a method of decreasing expression and / or function of Abhdl4b in a cell, comprising contacting the cell with an inhibitory compound, a vector, or a composition of disclosure.
[0013] One aspect of the disclosure is a method of attenuating collagen biosynthesis, comprising contacting a collagen producing cell with an inhibitory compound, a vector, or a composition of disclosure.
[0014] One aspect of the disclosure is a method of attenuating collagen biosynthesis in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure.
[0015] One aspect of the disclosure is a method of increasing carnitine biosynthesis in a cell, comprising contacting the cell with an inhibitory compound, a vector, or a composition of disclosure.
[0016] One aspect of the disclosure is a method of increasing carnitine biosynthesis in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure.
[0017] One aspect of the disclosure is a method of attenuating an epithelial-mesenchymal transition in an epithelial cell, comprising contacting the epithelial cell with an inhibitory compound, a vector, or a composition of disclosure.Aty. Docket No. 40574-137
[0018] One aspect of the disclosure is a method of attenuating senescence of an epithelial cell, comprising contacting the epithelial cell with an inhibitory compound, a vector, or a composition of disclosure. In certain aspects, the epithelial cell may be within an individual.
[0019] One aspect of the disclosure is a method of reducing activation of a fibroblast, comprising contacting the fibroblast with an inhibitory compound, a vector, or a composition of disclosure.
[0020] One aspect of the disclosure is a method of decreasing the activation of fibroblasts in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. The fibroblast may be a lung fibroblast, a dermal fibroblast, a cardiac fibroblast, a renal fibroblast, a corneal fibroblast, a hepatic stellate cell, a portal fibroblast, a synovial fibroblast, an intestinal fibroblast, a gastric fibroblast, a mammary gland fibroblast, or a cancer-associated fibroblast.
[0021] One aspect of the disclosure is a method of reducing inflammation and / or fibrosis in the lung of an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure.
[0022] One aspect of the disclosure is a method of treating a fibrosing interstitial lung disease [ILD] in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. In certain aspects, the fibrosing interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis [IPF], Hermansky-Pudlak syndrome pulmonary fibrosis [HPSPF], chronic graft versus host disease (cGVHD) related interstitial lung disease, scleroderma related Interstitial lung disease [SSc-ILD], rheumatoid arthritis associated-ILD, usual interstitial pneumonia [UIP], idiopathic nonspecific interstitial pneumonia [NSIP], chronic cryptogenic organizing pneumonia, Polymyositis / dermatomyositis- ILD, systemic lupus erythematosus [SLE], Sjogren’s Syndrome, bronchopulmonary dysplasia, respiratory bronchiolitis, hypersensitivity pneumonitis, radiation related pulmonary fibrosis, sarcoidosis, pneumoconiosis, Lymphangioleiomyomatosis (LAM), post-ARDS fibrosis, and pulmonary disease related to SARS-CoV2 and variants thereof.
[0023] One aspect of the disclosure is a method of treating a chronic obstructive lung disease (COPD) in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. The chronic obstructive lung disease may be selected from the group consisting of asthma, bronchiectasis, and chronic obstructive pulmonary disease (COPD)Aty. Docket No. 40574-137
[0024] One aspect of the disclosure is a method of treating pulmonary vascular disease in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. The pulmonary vascular disease may be selected from the group consisting of primary pulmonary hypertension, pulmonary arterial hypertension [PAH], pulmonary venous hypertension, idiopathic pulmonary hypertension, precapillary pulmonary hypertension, alveolar -capillary dysplasia, sickle cell chronic lung disease, systemic lupus erythematosus related pulmonary fibrosis, pathogenic pulmonary fibrosis. Administration may comprise contacting the inhibitory compound, the vector, or the composition with the lung of the individual. Administration may comprise inhalation of the inhibitory compound, the vector, or the composition of disclosure.
[0025] One aspect of the disclosure is a method for reducing fibrosis in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. The fibrosis may comprise liver fibrosis, which may be a result of Schistosoma mansoni infection, cirrhosis, alcohol associated liver disease, primary sclerosing cholangitis [PSC], or MASH- associated liver fibrosis. The inhibitory compound may be iRNA, which may comprise a ligand that targets the iRNA to the liver. The fibrosis may comprise kidney fibrosis, renal fibrosis, or nephrogenic systemic fibrosis. In certain aspects, kidney fibrosis may be a result of diabetic nephropathy, chronic glomerulonephritis, polycystic kidney disease, chronic kidney disease, lupus nephritis, Alport syndrome, Berger’s disease, focal segmental glomerulosclerosis, or sarcoidosis. The inhibitory compound may comprise a ligand that targets the inhibitory compound to the kidney. The fibrosis may comprise cardiac fibrosis, myocardial fibrosis or subendocardial fibrosis. In certain aspects, the cardiac fibrosis may be a result of cardiomyopathy, myocarditis, sarcoidosis, systemic lupus erythematosus, Marfan syndrome, or ischemia related conditions including preischemia and post-ischemia conditions such as congestive heart failure. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to the heart. In certain aspects, the fibrosis may comprise corneal fibrosis, and the inhibitory compound may comprise a ligand that targets the inhibitory compound to the cornea. In certain aspects, the fibrosis may comprise uterine fibroids, and the inhibitory compound may comprise a ligand that targets the inhibitory compound to uterine smooth muscle cells. In certain aspects, the fibrosis may comprise ovarian fibroids, and the inhibitory compound may comprise a ligand that targets the inhibitory compound to the ovarian smooth muscle cells. The fibrosis may comprise stromalAty. Docket No. 40574-137 remodeling of the pancreas including pancreatic cancer, and the inhibitory compound may comprise a ligand that targets the inhibitory compound to pancreatic tissue. The fibrosis may comprise intestinal fibrosis. In certain aspects, the intestinal fibrosis may be a result of Crohn’s disease, ulcerative colitis, intestinal tuberculosis, chronic mesenteric ischemia, radiation enteritis, gastrointestinal carcinoids, desmoplastic reaction to adenocarcinoma, eosinophilic gastroenteritis, or systemic sclerosis. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to intestinal tissue. The fibrosis may comprise skin fibrosis. In certain aspects, the skin fibrosis may be a result of scleroderma, chronic graft-versus-host disease, morphea, hypertrophic scars, keloids, dermatomyositis, lipodermatosclerosis, eosinophilic fasciitis, Werner syndrome, Dupuytren contracture, Werner syndrome or Epidermolysis Bullosa dystrophica. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to the skin.
[0026] One aspect of the disclosure is a method for treating cancer in an individual, comprising administering to the individual an inhibitory compound, a vector, or a composition of disclosure. In certain aspect, the cancer may comprise lung cancer, lung adenocarcinoma, non-small cell lung cancer, small cell lung carcinoma, mesothelioma, squamous cell carcinoma, large cell carcinoma, liver cancer, hepatocellular carcinoma, cholangiocarcinoma, breast cancer, prostate cancer, endometrial cancer, bladder cancer, ovarian cancer, glioblastoma, skin squamous cell carcinoma, melanoma, desmoplastic melanoma, pancreatic ductal adenocarcinoma, esophageal squamous cell carcinoma, myelofibrosis, Hodgkin lymphoma, sclerosing epithelioid fibrosarcoma, sclerosing liposarcoma, or T-cell lymphoma.
[0027] On aspect of the disclosure is a kit comprising the inhibitory compound an inhibitory compound, a vector, or a composition of disclosure.BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A & IB show the distribution of Abhdl4b gene expression in the lungs of untreated mice and mice treated with bleomycin to induce pulmonary fibrosis. Single cell RNA sequencing was performed in lungs from untreated mice (Control) or mice treated with bleomycin at 14- and 28-days post bleomycin. FIG. 1A illustrates distribution ofAbhdl4b gene expression across cells from normal and fibrotic lungs. FIG. IB illustrates Abhdl4b gene expression in macrophages, fibroblasts and epithelial cells from the lungs of untreated mice (Control), or miceAty. Docket No. 40574-137 administered bleomycin (Bleomycin). FIG. IB shows the expression levels at D14 and D28 postadministration of bleomycin. Single cell RNA sequencing experiment reveals increased gene expression of Abhdl4B in the three lung cell types (epithelial cells, fibroblasts, and macrophages) during fibrosis.
[0029] FIG.2 shows body weight change in wild-type (WT) (circles) and Abhdl4b knock-out (Abhdl4b KO) (squares) mice following single dose oropharyngeal bleomycin (1.5 U / kg) instillation to induce pulmonary fibrosis. N:9 Wt-Bleomycin, N:8 Abhdl4B KO-Bleomycin, Data represents Mean ± S.E.M.
[0030] FIGS. 3A-3D show pulmonary function parameters acquired by FlexiVent in WT or Abhdl4b Knock out (KO) mice that were either untreated (circles) or treated with bleomycin (squares). FIG. 3A shows forced vital capacity. FIG. 3B shows compliance. FIG. 3C shows peripheral airway resistance, while FIG. 3D shows tissue stiffness. Figure 3 demonstrates that deletion of Abhdl4b prevented bleomycin-induced decline in pulmonary function parameters. N:3 Wt-Control, N:7 Wt-Bleomycin, N: 4 Abhdl4B KO-Control, N:7 Abhdl4B KO-Bleomycin. Data represents Mean ± S.E.M. Statistical significance **p < 0.01, *p < 0.05.
[0031] FIG. 4 shows left lung hydroxyproline levels, which is a biochemical marker of fibrosis, in WT or Abhdl4b KO mice that were either untreated (circles) or treated with bleomycin (squares). Figure 4 demonstrates attenuation of pulmonary fibrosis with deletion of Abhdl4b gene in mice. N: 4 Wt-Control, N:9 Wt-Bleomycin, N: 5 Abhdl4B KO-Control, N:6 Abhdl4B KO- Bleomycin. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0032] FIGS. 5A-5B show the level of expression of several genes known to be markers for fibrosis marker genes. FIG. 5A shows the expression level of Col 1 A, FIG. 5B shows the expression level of Fnl, FIG. 5C shows the expression level of Timpl and FIG. 5D shows the expression level of Col4al quantified by quantitative PCR. N: 4 Wt-Control, N:8-9 Wt-Bleomycin, N: 3-4 Abhdl4B KO-Control, N:6 Abhdl4B KO-Bleomycin. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05
[0033] FIG. 6 is a heat map showing pulmonary fibrosis related differential expression of 4566 genes (DEG) in lung transcriptome from untreated (CT) and bleomycin-treated mice. Bleomycin up-regulated 2414 genes (DEG-0) in WT mice but the deletion of Abhdl4b prevented thisAty. Docket No. 40574-137 overexpression. Bleomycin down -regulated 21 2 genes (DEG-1) in WT mice but the deletion of Abhdl4b prevented this downregulation. N:4 in each group.
[0034] FIG. 7 is a heat map showing that deletion of Abhdl4b attenuated bleomycin-induced increase of gene expression for multiple subspecies of collagen genes in lung transcriptome from bleomycin-induced pulmonary fibrosis. N; 4 in each group. CT- untreated mice; Bleo- bleomycin- treated mice.
[0035] FIG. 8 shows the relative level of expression of various genes in lungs from wild-type (WT) or Abhdl4b knock-out (ABHD14B KO) mice that were either untreated (CT) or treated with bleomycin (Bleo). FIG. 8 depicts the relative level of expression of P3hl, P3h2, P3h3, Plodl Plod2, Plod3, Colgaltl, Colgalt2, Lox, P4ha3 and Pycrl., all of which are involved in the collagen biosynthesis pathway. Administration of bleomycin resulted in increased expression of these genes in WT mice. Knock-out of the Abhdl4b gene reduced the bleomycin-induced increase in gene expression observed in WT mice. Increased expression of Pycrl is also highly associated with cancer development by enhancing collagen production in cancer associated fibroblasts. In N; 4 in each group. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0036] FIGS. 9A-9C show the relative levels of N6,N6,N6-trimethylsine (FIG. 9A), y- butyrobaine, (FIG. 9B) and carnitine (FIG. 9C) in lungs from wild-type (WT) or ABHD14B knock-out (ABHD14B KO) mice that were either untreated (CT) or treated with bleomycin (Bleo). Administration of bleomycin resulted in decreased levels of these metabolites in WT mice. Knockout of Abhdl4b restored bleomycin-induced decline in carnitine biosynthesis in lungs from bleomycin-induced PF. The levels of metabolites were measured from the whole lung by metabolomics. N: 4 in each group. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, *** > < 0.001, **p < 0.01, *p < 0.05.
[0037] FIGS. 10A & 10B show the relative level of expression of Bboxl in lungs from wild-type (WT) or ABHD14B knock-out (ABHD14B KO) mice that were either untreated (CT) or treated with bleomycin (Bleo). FIG. 10A shows that knock-out of the Abhdl4b gene restored fibrosis- induced decline in Bboxl gene expression in lungs from bleomycin-induced PF model. FIG.10B shows that silencing the ABHD14B gene by SiRNA targeting ABHD14B (sense :CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13) significantly increased gene expression of BBOX1 in normal human bronchial epithelial cells. BBOX1 gene encodes theAty. Docket No. 40574-137 enzyme responsible for carnitine production. Loosing BBOX1 function also known to promote carcinogenesis (PMID:35775648). Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, *** / ? < 0.001.
[0038] FIGS. 11 A & B show the gene knock-down efficiency of several Abhdl4b siRNAs. FIG. 11A shows the expression of Abhdl4B protein (relative to HSC70) produced by human carcinoma lung epithelial cells (A549) that were untreated (NT), treated with non-specific scrambled siRNAs (scr), or treated with siRNAs specific for Abhdl4B. siRNA ABHD14B Seq #1: (sense: CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13); siRNA ABHD14B Seq #2: (Sense:GGGCAACUGCAUAGGUACAUU, (SEQ ID NO: 15) Antisense:UGUACCUAUGCAGUUGCCCUU) (SEQ ID NO: 17) ; siRNA ABHD14B Seq #3: (Sense:GCUUACAUGUUUAGAGCCAUU, (SEQ ID NO: 19) Antisense:UGGCUCUAAACAUGUAAGCUU) (SEQ ID NO:21); siRNA ABHD14B Seq #4: (Sense:AUAAUCCUGUGGAGGGUAAUU, (SEQ ID NO:23) Antisense:UUACCCUCCACAGGAUUAUUU) (SEQ ID NO:25). N:3. FIG. 11B shows that a siRNA ABHD14B seq#l (SEQ ID NO: 11 / SEQ ID NO: 13) significantly attenuated ABHD14B protein expression in human bronchial epithelial cells (NHBE) measured by RT-qPCR. N:3. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0039] FIGS. 12A & 12B show that siRNA knock-down of ABHD14B (sense: CCAGAGUGGAGGUCGGUGAUU, (SEQ ID NO: 11) antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13); silenced ABHD14B protein expression and epithelial-mesenchymal transition (EMT) in normal human bronchial epithelial (NHBE) cells by western-blot. FIG. 12A shows the protein level of VIMENTINE, ABHD14B and NKX2-1 relative to HSC70 in NHBE cells exposed to either non-specific scrambled siRNA (SCR) or siRNA to Abhdl4b (siAbhdl4b #1) and either untreated or treated with EMT inducers. FIG.12 B shows the western-blot densitometry of VIMENTINE, which is a marker for epithelial- mesenchymal transition (EMT) and also associated with cancer progression, ABHD14B and NKX2-1, which is a transcriptional regulator of lung development and homeostasis. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.Aty. Docket No. 40574-137
[0040] FIGS.13A-13D show the relative level of gene expression of ACTA2 (FIG. 13 A), COL1A1 (FIG. 13B), NKX2-1 (FIG.13C), and PYCR1 (FIG. 13D) in idiopathic pulmonary fibrosis patient’s derived lung fibroblast (DHLF). The data show that siRNA silencing of ABHD14B gene expression (siAbhdl4b#l) attenuated EMT inducer-induced myofibroblast activation and differentiation. Data represents Mean ± S.E.M.
[0041] FIGS.14A & 14B show the relative level of gene expression of Vimentine and Nkx2-1 in lung transcriptome from wild-type (WT) or ABHD14B knock-out (ABHD14B KO) mice that were either untreated (CT) or treated with bleomycin (Bleo). FIG.14A shows that deletion of Abhdl4b attenuated EMT as observed by the reducing bleomycin induced increased expression level of Vimentine. FIG.14B shows that deletion of Abhdl4B restored epithelial cell homeostasis as observed by preventing bleomycin-induced reduction in the expression level of Nkx2-1. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0042] FIGS. 15A & 15B show relative level of gene expression of ACTA2 (FIG.15A) and CTHRC1 (FIG15B) in idiopathic pulmonary fibrosis patient-derived lung fibroblasts (DHLF) exposed to either non-specific scrambled siRNA (SCR) or siRNA to Abhdl4b [siAbhdl4b #1 (sense :CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13)] and either untreated (CT) or treated with TGF(31 (2 ng / ml) (TGF). Both scrambled SiRNA and SiRNA to ABHD14B incubated with cells 24 hours prior to adding TGF(H for an additional 48 hours of exposure. The data show that siRNA silencing of ABHD14B gene expression by 12.5 nM of siAbhdl4b#l attenuated TGFpi induced myofibroblast activation and profibrotic differentiation as observed reduction of ACTA2 and CTHRC1 expression, respectively. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0043] FIGS. 16A & 16B show the effect of silencing ABHD14B gene by siRNA [siAbhdl4b #1 (sense:CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13)] in atenuating TGF[3 (10 ng / ml) induced activation of protein markers of myofibroblasts in idiopathic pulmonary fibrosis patient’s derived lung fibroblast (DHLF). FIG. 16A shows the protein expression of aSMA, CTHRC1, ABHD14B and HSC70 that were untreated (CT), treated with non-specific scrambled siRNAs (scr), or treated with siRNA specific for ABHD14B (ABHD14B Seq #1 [12.5 nM]). FIG. 16BAty. Docket No. 40574-137 shows quantification of protein expression of a-SMA and CTHRC1 relative to housekeeping protein HSC70. This data demonstrates SiRNA silencing of ABHD14B gene expression attenuated protein expression of ABHD14B as well as myofibroblast activation protein marker aSMA and fibrotic fibroblast marker CTHRC1 in IPF patient-derived and fibrosis-prone lung fibroblasts.
[0044] FIG. 17 shows the gene silencing efficiency of antisense LNA Gapmer targeting human ABHD14B [abhdl4b iRNA seq#13 (sense:AAAGUGAUGCAAUUAG (SEQ ID NO: 109), antisense:CTAATTGCATCACTTT) (SEQ ID NO: 110)] at 5 pM, and SiRNA targeting ABHD14B [siAbhdl4b #5 (sense:GCUGCAUGGUAUUCGCUUCUU (SEQ ID NO:63), antisense:GAAGCGAAUACCAUGCAGCUU) (SEQ ID NO:65)] at 12.5 nM for human ABHD14B idiopathic pulmonary fibrosis patient’s derived lung fibroblast (DHLF) as measured by qPCR. Data represents Mean ± S.E.M. Statistical significance **p < 0.01, *p < 0.05.
[0045] FIGS. 18A & 18B show relative levels of gene expression of ACTA2 (FIG.18A) and COL1A1 (FIG18B) in idiopathic pulmonary fibrosis patient-derived lung fibroblasts (DHLF) either untreated (Control) or exposed to TGF[31 (2 ng / ml). TGF[3 exposed cells treated with antisense LNA Gapmer specific to human ABHD14B gene at 5pM [abhdl4b iRNA seq#13 (sense:AAAGUGAUGCAAUUAG (SEQ ID NO: 109), antisense:CTAATTGCATCACTTT) (SEQ ID NO: 110)], its negative control (Neg GAPMER), scrambled siRNA (NT SiRNA), or siRNA to Abhdl4b [siAbhdl4b #5 (sense: GCUGCAUGGUAUUCGCUUCUU (SEQ ID NO:63), antisense:GAAGCGAAUACCAUGCAGCUU) (SEQ ID NO:65)] at 12.5 nM. These data show that silencing human ABHD14B gene by either antisense oligonucleotides (ASO) such as antisense LNA GAPMER (SEQ ID NO: 110) or SiRNA (SEQ ID NO:65) similarly and fully attenuated TGF[3 induced activation of idiopathic pulmonary fibrosis patient’s derived lung fibroblast (DHLF) as quantified by the expression of ACTA2 and COL1A1. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05.
[0046] FIGS. 19 shows level of gene expression of MGLUR5 and gene silencing efficiency of MGLUR5 by using antisense LNA GAPMERs at 1 pM in idiopathic pulmonary fibrosis patient- derived lung fibroblasts (DHLF). TGF[31 (10 ng / ml) exposure increased gene expression of MGLUR5. Co-treatment of the TGF01 treat cells with Antisense LNA GAPMERs targeting MGLUR5 [(MGLUR5 gapmer# 5 (sense: AUGGCAAGCAUAGUCG (SEQ ID NO:79), antisense: CGACTATGCTTGCCAT) (SEQ ID NO:80); MGLUR5 gapmer# 6 (sense: CCAGCUAACUUCAACG (SEQ ID NO:81), antisense: CGTTGAAGTTAGCTGG) (SEQ IDAty. Docket No. 40574-137NO:82); MGLUR5 gapmer# 7 (sense: AUACGUUUCACUCUAG (SEQ ID NO:83), antisense: CTAGAGTGAAACGTAT) (SEQ ID NO:84); MGLUR5 gapmer# 8 (sense: UGCACUUCAUACUGUC (SEQ ID NO:85), antisense: GACAGTATGAAGTGCA) (SEQ ID NO:86); MGLUR5 gapmer# 9 (sense: AGAUUUACUGCUACCU (SEQ ID NO:87), antisense: AGGTAGCAGTAAATCT) (SEQ ID NO:88); MGLUR5 gapmer# 10 (sense: UACACCGAGGCUUUUA (SEQ ID NO:89), antisense: TAAAAGCCTCGGTGTA) (SEQ ID NO:90); MGLUR5 gapmer# 11 (sense: CGUUUCACUCUAGACC (SEQ ID NO:91), antisense: GGTCTAGAGTGAAACG) (SEQ ID NO: 92); MGLUR5 gapmer# 12 (sense: GAUUUGACUGAAGCAA (SEQ ID NO:93), antisense: TTGCTTCAGTCAAATC) (SEQ ID NO:94); MGLUR5 gapmer# 15 (sense: UUUGCCACUCCAUUGA (SEQ ID NO:99), antisense: TCAATGGAGTGGCAAA) (SEQ ID NO: 100)] significantly silenced gene expression of MGLUR5 compared to the negative control GAPMER treated cells. The antisense LNA GAPMERs targeting MGLUR5 were obtained from Qiagen. Statistical significance ****p < 0.0001, ** < 0.01, *p < 0.05.
[0047] FIGS. 20A & 20B show relative level of gene expression of ACTA2 (FIG.20A) and COL1A1 (FIG20B) in idiopathic pulmonary fibrosis patient-derived lung fibroblasts (DHLF) either untreated (Control) or exposed to TGFpi (2 ng / ml). TGF|3 exposed cells treated with 1 pM antisense oligonucleotides such as antisense LNA Gapmer specific to human MGLUR5 gene [(MGLUR5 gapmer# 5 (sense: AUGGCAAGCAUAGUCG (SEQ ID NO:79), antisense: CGACTATGCTTGCCAT) (SEQ ID NO:80); MGLUR5 gapmer# 6 (sense: CCAGCUAACUUCAACG (SEQ ID NO:81), antisense: CGTTGAAGTTAGCTGG) (SEQ ID NO:82); MGLUR5 gapmer# 7 (sense: AUACGUUUCACUCUAG (SEQ ID NO:83), antisense: CTAGAGTGAAACGTAT) (SEQ ID NO:84); MGLUR5 gapmer# 8 (sense: UGCACUUCAUACUGUC (SEQ ID NO:85), antisense: GACAGTATGAAGTGCA) (SEQ ID NO:86); MGLUR5 gapmer# 9 (sense: AGAUUUACUGCUACCU (SEQ ID NO:87), antisense: AGGTAGCAGTAAATCT) (SEQ ID NO:88); MGLUR5 gapmer# 10 (sense: UACACCGAGGCUUUUA (SEQ ID NO:89), antisense: TAAAAGCCTCGGTGTA) (SEQ ID NO:90); MGLUR5 gapmer# 11 (sense: CGUUUCACUCUAGACC (SEQ ID NO:91), antisense: GGTCTAGAGTGAAACG) (SEQ ID NO:92); MGLUR5 gapmer# 12 (sense: GAUUUGACUGAAGCAA (SEQ ID NO:93), antisense: TTGCTTCAGTCAAATC) (SEQ ID NO:94); MGLUR5 gapmer# 15 (sense: UUUGCCACUCCAUUGA (SEQ ID NO:99), antisense:Aty. Docket No. 40574-137TCAATGGAGTGGCAAA) (SEQ ID NO: 100)], and its negative control (Neg GAPMER). This figure shows that Antisense LNA gapmer mediated gene silencing of human MGLUR5 achieved attenuation of the gene expression of fibroblast activation and fibrosis markers such as alpha smooth muscle actin (ACTA2) and Collagen 1A1 (COL1A1) in IPF patients derived lung fibroblasts. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, ***p < 0.001, *p < 0.05.
[0048] FIGS. 21A & 21B show relative level of gene expression of ABHD14B (FIG.21A), and fibroblast activation markers ACTA2 and COL1A1 (FIG.21B) in Normal Human Ventricular Cardiac Fibroblasts (NHCF-V) exposed to either non-specific scrambled siRNA (ScRNA) or siRNA to Abhdl4b [siAbhdl4b #1 (sense :CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13)]. These cells were either untreated (CT) or treated with TGFpi (10 ng / ml) (TGF). Portion of TGFpi treated cells treated by metabotropic glutamate receptor 5 (mGluR5) negative allosteric modulator basimglurant (1 pM) for parallel comparison of its efficacy with ABHD14B gene silencing. Both scrambled SiRNA and SiRNA to ABHD14B incubated at 12.5 nM with cells 24 hours prior to adding TGFpi for an additional 48 hours of exposure. FIG 21A shows that siRNA (siAbhdl4b#l) treatment effectively silenced ABHD14B gene expression in both untreated and TGFpi treated human cardiac fibroblasts (NHCF-V). FIG 21B shows that the siRNA silencing of ABHD14B gene expression by siAbhdl4b#l attenuated TGFpi-induced myofibroblast activation markers of ACTA2 and COL 1 Al in human cardiac fibroblasts. Basimglurant treatment also significantly attenuated TGFpi-induced myofibroblast activation in human cardiac fibroblasts. NHCF-V human ventricular cardiac fibroblasts (CC-2904) obtained from Lonza Bioscience. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, *p < 0.05.
[0049] FIGS. 22A & 22B show relative level of gene expression of ABHD14B (FIG.22A), and fibroblast activation markers ACTA2 and COL 1 Al (FIG.22B) in Normal Adult Human Dermal Fibroblasts (NHDF-Ad) exposed to either non-specific scrambled siRNA (ScRNA) or siRNA to Abhdl4b [siAbhdl4b #1 (sense :CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13)]. These cells were either untreated (CT) or treated with TGFpi (10 ng / ml) (TGF). A portion of TGFpi -treated cells were further treated with mGluR5 negative allosteric modulator basimglurant (1 pM) for parallel comparison of its efficacy with ABHD14B gene silencing. Both scrambled SiRNA and SiRNA toAty. Docket No. 40574-137ABHD14B were incubated at 12.5 nM with cells 24 hours prior to adding TGF01 for an additional 48 hours of exposure. FIG 22A shows that siRNA (siAbhdl4b#l) treatment effectively silenced ABHD14B gene expression in both untreated and TGFpi-treated human dermal fibroblasts (NHDF-Ad). FIG 22B shows that the siRNA silencing of ABHD14B gene expression by siAbhdl4b#l attenuated TGFpi induced myofibroblast activation markers of ACTA2 and COL1A1 in human dermal fibroblasts. Basimglurant treatment also significantly attenuated TGFpi-induced myofibroblast activation in human dermal fibroblasts.NHDF-Ad human dermal fibroblasts (CC-2511) obtained from Lonza Bioscience. Data represents Mean ± S.E.M. Statistical significance ****p < 0.0001, **p < 0.01.
[0050] FIGS. 23A & 23B show distinct regulatory roles of ABHD14B and Cannabinoid receptor 1 (CB1R) in regulating fibrosis related alterations in lung transcriptomes in fibrotic lungs in bleomycin-induced pulmonary fibrosis. Genes that are also altered similarly in fibrotic lungs in human patients are also shown. FIG. 23A shows the Venn diagram depicting numbers of fibrosis related DEGs (1596) reversed by either deletion of CB1R or ABHD14B in bleomycin-induced pulmonary fibrosis model in mice. Deletion of ABHD14B (ABHD14B KO) in mice attenuated 1548 fibrosis-related DEGs. FIG. 23B demonstrates fibrosis-related 1548 DEGs were also similarly altered in lung transcriptomes of idiopathic pulmonary fibrosis patients compared to the healthy subjects. FIG. 23B also shows that these 1548 DEGs were progressively altered in the lungs on day 7 and 14 post-bleomycin in the bleomycin-induced pulmonary fibrosis model suggesting their role in fibrosis progression. The majority of DEGs as also shown in FIG. 23A were not reversed by the deletion of CB1R (CB1R KO), whereas they are fully reversed by the deletion of ABHD14B (ABHD14B KO) in mice at 14 days post bleomycin, which is the peak fibrotic stage in the bleomycin-induced pulmonary fibrosis. The systems pharmacology data provides a rationale on a combination of CB1R antagonism and ABHD14B inhibition to achieve a superior therapeutic efficacy in fibrotic disorders including fibrotic lung diseases.
[0051] FIGS. 24A & 24B show distinct regulatory roles of ABHD14b and mGluR5 in regulating fibrosis-related alterations in lung transcriptomes in fibrotic lungs in bleomycin-induced pulmonary fibrosis. Genes that are also altered similarly in fibrotic lungs in human patients are shown. FIG. 24A shows the Venn diagram depicting numbers of fibrosis related DEGs (1514) reversed by either deletion of mGluR5 or ABHD14B in bleomycin-induced pulmonary fibrosis model in mice. Deletion of ABHD14B (ABHD14B KO) in mice attenuated 1548 fibrosis-relatedAty. Docket No. 40574-137DEGs. FIG. 24B shows that fibrosis-related 1548 DEGs are also similarly altered in lung transcriptomes idiopathic pulmonary fibrosis patients compared to healthy subjects. FIG. 24B also shows these 1548 DEGs were progressively altered in the lungs on day 7 and 14 post-bleomycin in the bleomycin-induced pulmonary fibrosis model suggesting their role in the fibrosis progression. The majority of DEGs as also shown in FIG. 24B were not reversed by the deletion of mGluR5 (mGluR5 KO), whereas they are fully reversed by the deletion of ABHD14B (ABHD14B KO) in mice at 14 days post bleomycin. The systems pharmacology data provides a rationale on a combination of mGluR5 antagonism and ABHD14B inhibition to achieve a superior therapeutic efficacy in fibrotic disorders including fibrotic lung diseases.
[0052] FIGS. 25A & 25B show distinct regulatory roles of ABHD14b and metabotropic glutamate receptor 5 (mGluR5) in regulating TGFpi -induced alterations and activation in IPF patient derived lung fibroblast (DHLF) transcriptome. FIG 25 A shows the Venn diagram depicting numbers of TGFpi mediated DEGs (682) reversed by either antagonism of mGluR5 by basimglurant (1 pM) or gene silencing of ABHD14B by SiRNA [siAbhdl4b #1 (sense :CCAGAGUGGAGGUCGGUGAUU (SEQ ID NO: 11), antisense:UCACCGACCUCCACUCUGGUU) (SEQ ID NO: 13)]. Gene silencing of ABHD14B attenuated 555 TGFpi mediated DEGs. mGluR5 antagonism attenuated 290 TGFpi mediated DEGs. Only 24% of the TGFpi mediated DEGs were reversed by both basimglurant and the SiRNA ABHD14B treatments. FIG. 25B shows a heatmap of TGFpi mediated DEGs in IPF patient-derived lung fibroblasts (DHLF) and their attenuation by the treatments of basimglurant or siRNA ABHD14B #1. As observed similarly in the mouse model of pulmonary fibrosis in FIG. 24A and 24B, the systems pharmacology data from Human lung fibroblasts provides a rationale on a combination of mGluR5 antagonism and ABHD14B inhibition to achieve superior therapeutic efficacy in fibrotic disorders including fibrotic lung diseases.DETAILED DESCRIPTION
[0053] The present disclosure relates to compositions and methods for treating acute and chronic inflammatory and fibrotic disorders as well as diseases with stromal remodeling such as cancer. More specifically, the present disclosure relates to compositions and methods for suppressing the production and / or function of proteins involve in the development of inflammatory and fibrotic disorders, and cancer. The disclosed compositions are particularly useful for suppressing theAty. Docket No. 40574-137 production and / or function of proteins involved in the remodeling of connective tissue. Such compositions may comprise an inhibitory compound that inhibits the expression of a gene encoding a protein involved in remodeling connective tissue, or the activity of the encoded protein. Thus, aspects of the disclosure may generally be practiced by producing a composition comprising one or more compounds that inhibit expression of one or more genes encoding one or more proteins involved in remodeling connective tissue, or the activity of the encoded protein. In certain aspects, the gene may be an abhydrolase domain containing 14B (“ABHD14B”) gene, cannabinoid type I receptor (“CB1R”) gene, or a metabotropic glutamate receptor 5 (“MGLUR5”) gene. In certain aspects, the protein may comprise an ABHD14B protein, a CB1R protein, or a MGLUR5 protein.
[0054] Before the present disclosure is further described, it is to be understood that the disclosure is not limited to particular aspects described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the claims.
[0055] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, a compound refers to one or more compound molecules. As such, the terms “a”, “an”, “one or more” and “at least one” may be used interchangeably. Similarly, the terms “comprising”, “including” and “having” may be used interchangeably. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements or use of a “negative” limitation.
[0056] Publications disclosed herein are provided solely for their disclosure prior to the fding date of the present application. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosureAty. Docket No. 40574-137 belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. Terms and phrases, which are common to the various aspects disclosed herein, are defined below.
[0058] As used herein, the terms “individual”, “subject” and “patient “may be used interchangeably and includes any animal, including mammals. Mammals include, but are not limited to, farm animals (such as, for example, horses, cows, and pigs), companion animals (such as, for example, dogs and cats), laboratory animals (such as, for example, mice, rats, and rabbits), and primates, including both human and non-human primates. In certain aspects, the subject is a human. In certain aspects, the human is a patient under the care of a physician. The terms individual, subject, and patient by themselves, do not denote a particular age, sex, race, and the like. Thus, individuals of any age, whether male or female, are intended to be covered by the present disclosure and include, but are not limited to the elderly, adults, children, babies, infants, and toddlers.
[0059] One aspect of the disclosure is an inhibitory compound that inhibits the expression of a gene selected from the group consisting of &ABHD14B gene, a CB1R gene, or &MGLUR5 gene, or the activity of the protein encoded thereby.
[0060] As used herein, the term “inhibitory compound” refers to any molecule that inhibits the expression of a gene of the disclosure (e.g., ABHD14B, CB1R, or MGLUR5) or the activity of a protein encoded by such gene. Such molecules may comprise, for example, organic molecules, proteins, nucleic acids, mono- or polysaccharides, lipids, and combinations thereof. Examples of types of inhibitory compounds include, but are not limited to, small molecule inhibitors, inhibitory peptides, inhibitory proteins, antibodies, antisense oligonucleotides (ASOs) and inhibitory ribonucleic acid (iRNA).
[0061] As used herein, the phrases “express a gene”, “expression of a gene”, “gene expression”, and the like, refer to a process by which information encoded in a gene is converted into an end product (e.g., a protein) having a particular function e.g., enzyme activity). As such, the process of expressing a gene encompasses, for example, transcription (i.e., the production of mRNA), splicing (if splice sites are present), and translation.
[0062] As used herein, the phrases “inhibits”, “inhibits the expression”, “down-regulates the expression of’, “suppresses the expression of’, and the like, in so far as they relate to a gene of theAty. Docket No. 40574-137 disclosure, herein refer to the at least partial suppression of expression of the gene, as manifested by a reduction of the amount, or level, of mRNA transcribed from the gene, and / or the protein encoded by the gene, in a system (e.g., a cell or individual). It will be understood by those skilled in the art that inhibition may be determined by comparing the measured amount, or level, of mRNA, or protein encoded thereby, to the amount, or level, of the same mRNA, or protein encoded thereby, produced by a substantially identical system, but in the absence of the inhibitory compound. Thus, in certain aspects, the degree of inhibition may be determined by measuring a reduction in the amount, or level, of mRNA, or a protein encoded thereby, produced in the presence of the inhibitory compound. Other methods of determining the degree of inhibition may also be used. For example, the degree of inhibition may be given in terms of a reduction of a parameter functionally linked to expression of a gene of the disclosure, such as the number or percentage of cells expressing a certain phenotype when exposed to the inhibitory compound. For example, with respect to the ABHD14B gene, the degree of inhibition may be measured in terms of collagen synthesis or carnitine synthesis by a cell, or EMT transition or epithelial cell senescence by cells in culture. Exemplary methods of measuring inhibition are disclosed herein.
[0063] In certain aspects, an inhibitory compound of the disclosure may inhibit expression of a gene of the disclosure by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, by about 90%, by about 95%, by about 98%, or by about 100%. In certain aspects, an inhibitory compound of the disclosure may inhibit expression of a gene such that no amount of mRNA encoded by the gene, or protein encoded by the gene, is detectable. In these aspects, the inhibitory compound of the disclosure may be said to “silence” expression of the gene, or the protein encoded thereby.
[0064] As used herein, the phrases “inhibits the activity of’, “down-regulates the function of’, “suppresses the function of’, “suppresses the activity”, and the like, in so far as they relate to the activity of a protein of the disclosure (e.g., ABHD14B) in a system, refer to an at least partial reduction of an activity possessed by the referenced protein. For example, inhibiting the activity of an ABHD14B protein refers to an at least partial decrease in the level of an activity (e.g., hydrolase) expressed by ABHD14B. It will be understood by those skilled in the art that inhibition of protein activity by an inhibitory compound in a system may be determined by comparing the measured amount, or level, of activity, to the amount, or level, of the same protein activity in a substantially identical system, but in the absence of the inhibitory compound. Other methods ofAty. Docket No. 40574-137 determining the degree of inhibition may also be used. For example, the degree of inhibition may be given in terms of a reduction of a parameter functionally linked to the activity of a protein of the disclosure, such as the number or percentage of cells expressing a certain phenotype when exposed to the inhibitory compound. For example, with respect to a ABHD14B protein, the degree of inhibition may be measured in terms of collagen synthesis or carnitine synthesis by a cell, or EMT transition or epithelial cell senescence by cells in culture.
[0065] In certain aspects, an inhibitory compound of the disclosure may inhibit the activity of a protein encoded by a gene of the disclosure by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, by about 90%, by about 95%, by about 98%, or by about 100%. In certain aspects, an inhibitory compound of the disclosure may inhibit the activity of a protein such that no activity possessed by the protein is detectable. In these aspects, the inhibitory compound of the disclosure may be said to “silence” activity of the protein.
[0066] Administration of the therapeutic agents that treat or inhibit an inflammatory, proliferative, or fibrotic disorder can be repeated, for example, after one day, two days, three days, five days, one week, two weeks, three weeks, one month, five weeks, six weeks, seven weeks, eight weeks, two months, or three months. The repeated administration can be at the same dose or at a different dose. The administration can be repeated once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, or more. For example, according to certain dosage regimens a patient can receive therapy for a prolonged period of time such as, for example, 6 months, 1 year, or more.
[0067] Administration of the therapeutic agents that treat or an inflammatory, proliferative, or fibrotic disorder can occur by any suitable route including, but not limited to, parenteral, intravenous, oral, subcutaneous, intra-arterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Pharmaceutical compositions for administration are desirably sterile and substantially isotonic and manufactured under GMP conditions. Pharmaceutical compositions can be provided in unit dosage form (i.e., the dosage for a single administration). Pharmaceutical compositions can be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients or auxiliaries. The formulation depends on the route of administration chosen. The term “pharmaceutically acceptable” means that the carrier, diluent, excipient, or auxiliary is compatible with the other ingredients of the formulation and not substantially deleterious to the recipient thereof.Aty. Docket No. 40574-137
[0068] As used herein, abhydrolase domain containing 14B (“ABHD14B”) refers to a particular gene or its encoded polypeptide. ABHD14B protein is also known as, for example, Alpha / Beta Hydrolase Domain-Containing Protein 14B, Putative Protein-Lysine Deacylase ABHD14B, CCG1 / TAFII25O-Interacting Factor B, CCG1 -Interacting Factor B, and Cell Cycle Gene 1- Interacting Factor B. ABHD14B possesses, at least, hydrolase activity and is an atypical protein- lysine deacetylase. An exemplary sequence of a human ABHD14B mRNA transcript, and protein, may be found, for example, at the National Library of Medicine database, at the National Institutes of Health, under NM_032750.3. Exemplary sequences of a human ABHD14B mRNA transcript, or a portion thereof, are represented by SEQ ID NOS: 1 and 2.
[0069] As used herein, cannabinoid type I receptor (“CB 1R”), refers to refers to a particular gene or its encoded polypeptide. CB1R is also known as, for example, CANN6, CB-R, CB 1K5, and CNR1. CB1R is in the G-coupled receptor family and inhibits adenylate cyclase activity in a dose dependent manner. An exemplary sequence of a human CB1R mRNA transcript, and protein, may be found, for example, at the National Library of Medicine database, at the National Institutes of Health, NM_001424094. 1. Exemplary sequences of a human CB1R mRNA transcript, or a portion thereof, are represented by SEQ ID NOS: 27 and 28.
[0070] As used herein, metabotropic glutamate receptor 5 (“MGLUR5”), refers to a particular gene or its encoded polypeptide. MGLUR5 is also known as, for example, GRM5, GPRC1E, protein phosphatase 1, regulatory subunit 86, and glutamate receptor, metabotropic 5. An exemplary sequence of a human MGLUR5 mRNA transcript, and protein, may be found, for example, at the National Library of Medicine database, at the National Institutes of Health, NM 001384268.1. Exemplary sequences of a human MGLUR5 mRNA transcript, or a portion thereof, are represented by SEQ ID NOS: 29 and 30.
[0071] In certain aspects, an inhibitory compound may comprise an iRNA that inhibits expression of a gene of the disclosure (e.g., ABHD14B, CB1R, or MGLUR5). As used herein, the term "iRNA" refers to an agent comprising, or consisting of, RNA, antisense oligonucleotides, and which mediates targeted inhibition of mRNA. As used herein” “inhibition of mRNA” with respect to an iRNA means that the iRNA interacts with the mRNA such that production of the protein encoded by the mRNA is reduced or prevented. Such interaction may occur with a pre-mRNA (i.e., pre-splicing) or with the spliced mRNA. “Targeted inhibition” refers to the fact that the iRNA comprises a region of complementarity comprising a nucleotide sequence that hybridizes with aAty. Docket No. 40574-137 target sequence in mRNA transcribed from a gene of interest. Such regions of complementarity, which are generally less than 50 nucleotides in length, are discussed in more detail below. In certain aspects, the region of complementarity may be 36 nucleotides or less, and generally 18-27 nucleotides, in length. In certain aspects, the iRNA inhibits production of a protein encoded by an mRNA comprising the target sequence. Such inhibition may comprise binding of the iRNA to the mRNA, thereby inhibiting production of the encoded protein by one or more mechanisms such as, inhibition of 5’cap formation, steric blocking of protein translation, inhibition or alteration of splicing or activation of an RNase, such as RNase H, which degrade the target mRNA. In certain aspects, the iRNA may mediate targeted cleavage of the mRNA transcript via an RNA-induced silencing complex (RISC) pathway. Thus, an iRNA of the disclosure may comprise, for example, antisense RNA, antisense oligonucleotides (ASO), miRNA, and / or small inhibitory RNA (siRNA).
[0072] In certain aspects, the iRNA may comprise an antisense oligonucleotide (ASO). As used herein, an ASO is a short oligonucleotide (or oligonucleotide analogs) generally 12-36 nucleotides in length, comprising a region of complementarity designed to hybridize with the target sequence in the mRNA. ASOs of the disclosure may be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, including and any subrange therein. In certain aspects, the sub-range may include, but is not limited to, 15-30 base pairs, 15-27 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 15-27 base pairs, 18- 26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20- 30 base pairs, 15-27 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21- 24 base pairs, 21-23 base pairs, or 21-22 base pairs. ASOs may be designed to bind a target sequence in a coding region, a non-coding region, or composites thereof, in an mRNA molecule. In certain aspects, ASOs of the disclosure may comprise nucleotide analogs comprising modifications that enhance the activity of the ASO by, for example, enhancing binding of the ASO to the target mRNA, increase metabolic stability, reduce degradation, and decrease adverse effects. Examples of such modifications include, but are not limited to, a 2'-0-methyl modification, a 2’- O-methoxyethyl (MOE) modification, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, aAty. Docket No. 40574-137 locked nucleoside, an abasic nucleoside, a 2'-deoxy- 2'-fluoro modified nucleoside, a 2'-amino- modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof.
[0073] In certain aspects, an iRNA of the disclosure may encompass a double-stranded RNA (dsRNA) molecule having a sense strand, and a complementary antisense strand, the antisense strand having a region of complementarity. As used herein, the term "double- stranded RNA (dsRNA) refers to an iRNA that includes an RNA molecule having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which may be referred to as having "sense" and "antisense" orientations with respect to a target mRNA. mRNA is considered to be in the sense orientation. Such an iRNA may be referred to as a siRNA. In certain aspects, the antisense strand may comprise the region of complementarity that hybridizes with the target sequence in the mRNA. The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway but will typically range from 9 to 36 base pairs in length. In certain aspects, the duplex region may be in the range of 15-30 base pairs in length. In certain aspects, the duplex may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, including and any sub-range therein. In certain aspects, the sub-range may include, but is not limited to, 15-30 base pairs, 15-27 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 15-27 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19- 30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 15-27 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20- 23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. In certain aspects, the strands forming the duplex structure may be from two or more separate RNA molecules. In certain aspects, the dsRNA may have open ends (i.e., the adjacent, paired 3’-5’ ends are not covalently linked to one another). In certain aspects, at least one of the adjacent, paired 3’-5’ ends are “closed” (i.e., the adjacent, paired 3’-5’ ends are covalently linked to one another). In certain aspects, dsRNAs generated in the cell by processing by the endonuclease Dicer protein, or similar enzymes, may generally be in the range of 19-22 base pairs in length. In certain aspects, the strands forming theAty. Docket No. 40574-137 duplex structure may be from two separate RNA molecules, and one or more of the strands may comprise nucleotide overhangs, which may comprise 1 or 2 nucleotide overhangs on their 3’ ends.
[0074] In certain aspects, the two strands forming the duplex structure may be from a single RNA molecule having at least one self-complementary region, or they may be from two or more separate RNA molecules. In aspects where the duplex region is formed from two strands of a single molecule, the molecule may have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop") between the 3'-end of one strand and the 5'-end of the paired strand forming the duplex structure. The hairpin loop may comprise at least one unpaired nucleotide. In certain aspects, hairpin loop may comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 20, unpaired nucleotides. In certain aspects, the hairpin loop comprises no more than 30, no more than 35, no more than 40, no more than 45, no more than 50, no more than 55, or no more than 60, unpaired nucleotides. In aspects, where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but may be covalently connected. Moreover, where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a "linker." The term "siRNA" may also be used herein to refer to a dsRNA as described herein.
[0075] In certain aspects, the inhibitory compound may comprise a gapmer. A gapmer generally has the formula 5'-X-Y-Z-3', with X and Z as flanking regions around a gap region Y. In certain aspects, the Y region comprises a contiguous stretch of nucleotides. By way of a non-limiting example, the Y region may comprise at least 6 DNA nucleotides that are capable of recruiting an RNAse. In certain aspects, the RNAase comprises RNAse H. In certain aspects, the gapmer binds to the target nucleic acid so that an RNAse is recruited that can cleave the target nucleic acid. In certain aspects, the Y region is flanked both 5' and 3' by regions X and Z comprising high-affinity modified nucleotides, e.g., one to six modified nucleotides. Examples of modified nucleotides include, but are not limited to, 2' MOE or 2'OMe or Locked Nucleic Acid bases (LNA). In certain aspects, the flanking sequences X and Z may be of one to twenty nucleotides, one to eight nucleotides, or one to five nucleotides in length. The flanking sequences X and Z may be of similar length or of dissimilar lengths. In certain aspects, the gap-segment Y may be a nucleotide sequence of five to twenty nucleotides, six to twelve nucleotides, or six to ten nucleotides in length.Aty. Docket No. 40574-137
[0076] In certain aspects, the gap region of the gapmer oligonucleotides comprises modified nucleotides acceptable for efficient RNase action in addition to DNA nucleotides. In certain aspects, the modified nucleotides comprise C4'-substituted nucleotides, acyclic nucleotides, or arabino-configured nucleotides. In certain aspects, the gap region comprises one or more unmodified internucleosides. In certain aspects, one or both flanking regions each independently comprise at least one phosphorothioate intemucleoside linkage. By way of anon-limiting example, the phosphorothioate internucleoside linkage or other linkages comprises at least two, at least three, at least four, at least five or more nucleotides. In certain aspects, the gap region and two flanking regions each independently comprise modified intemucleoside linkages including, by way of a non-limiting example, phosphorothioate intemucleoside linkages or other linkages between at least two, at least three, at least four, at least five or more nucleotides.
[0077] A gapmer may be produced using appropriate methods. Representative reports of the preparation of gapmers include, but are not limited to, U.S. Patent Nos. 5,013,830, 5,149,797, 5,220,007, 5,256,775, 5,366,878, 5,403,711, 5,491,133, 5,565,350, 5,623,065, 5,652,355, 5,652,356, 5,700,922, 5,898,031, 7,432,250, and 7,683,036; U.S. Patent Application Publication Nos. 2009 / 0286969, 2010 / 0197762, 2011 / 0112170, and 2025 / 0304710; and PCT International Publication Nos. 2008 / 049085 and 2009 / 090182, each of which is herein incorporated by reference in its entirety.
[0078] It is to be understood that any nucleic acid molecule disclosed herein may be a DNA molecule, an RNA molecule, a nucleic acid molecule comprising at least one modified nucleoside, a nucleic acid molecule comprising an LNA, a nucleic acid molecule comprising at least one intemucleoside, a nucleic acid molecule comprising at least one modified intemucleoside linkage, or any combination thereof.
[0079] As used herein, the phrase a ‘region of complementarity” refers to a region of contiguous ribonucleotides in an antisense strand of an iRNA, the contiguous ribonucleotides being substantially complementary to a contiguous sequence of ribonucleotides (a.k.a., target sequence) in an mRNA transcript of a gene of the disclosure. As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions, such as physiological conditions, with an oligonucleotide or polynucleotide comprising the secondAty. Docket No. 40574-137 nucleotide sequence. The term "fully complementary" means that when the two strands hybridize, the nucleotide base at each position in one strand is paired (i.e., forms hydrogen bonds) with its specifically, complementary base (A:T or U, C:G) in the corresponding position on the opposite strand. Where a first sequence is referred to as "substantially complementary" with respect to a second sequence, the two sequences may be fully complementary, or they may contain one or more (but generally not more than 5, 4, 3 or 2 for a duplex up to 30 base pairs) mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway in a cell or an individual. In certain aspects, the region of complementarity may comprise a region of contiguous nucleotides that is at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical over their entire length with a target sequence in an mRNA from a gene of the disclosure. In certain aspects, an iRNA molecule of the disclosure may comprise 2 nucleotide overhangs on the 3’ end of each strand in the iRNA. Thus, in iRNAs of the disclosure, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 contiguous nucleotides that is fully complementary to the shorter oligonucleotide, may be referred to as "fully complementary" for the purposes described herein. "Complementary" sequences, as used herein, can also include, or be formed entirely from, non- Watson- Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms "complementary," "fully complementary" and "substantially complementary" herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use by a person of skill in the art. It is to be understood that an iRNA sense strand having a particular nucleotide sequence has a “corresponding” antisense strand that has a nucleotide sequence that is 100% complementary to the particular nucleotide sequence. By way of a non-limiting example, if the sense strand of an iRNA has the nucleotide sequence set forth in SEQ ID NO: 3 (“Abhdl4B iRNA Seq #1 sense strand”), the “corresponding” antisense strand has the nucleotide sequence set forth in SEQ ID NO:4 (“Abhdl4B iRNA Seq #1 antisense strand”). It is also to be understood thatAty. Docket No. 40574-137 disclosure of an oligonucleotide having a particular nucleotide sequence is a disclosure of the complement of such sequence.
[0080] As used herein, the term "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a gene of the disclosure. Such mRNA molecules include mRNA that is a product of RNA processing of a primary transcription product. The target sequence should be at least long enough to serve as a substrate for iRNA- directed cleavage at or near the portion of the mRNA containing the target sequence. In certain aspects, the target sequence may generally be about 9-36 nucleotides in length. In certain aspects, the target sequence may be about 15-30 nucleotides in length, including all sub-ranges there between. For example, as non- limiting examples, the target sequence may be 15-30 nucleotides in length, 15-27 nucleotides in length, 15-26 nucleotides in length, 15-23 nucleotides in length, 15-22 nucleotides in length, 15-21 nucleotides in length, 15-20 nucleotides in length, 15-19 nucleotides in length, 15-18 nucleotides in length, 15-17 nucleotides in length, 18-30 nucleotides in length, 18-27 nucleotides in length, 18-26 nucleotides in length, 18-23 nucleotides in length, 18-22 nucleotides in length, 18-21 nucleotides in length, 18-20 nucleotides in length, 19-30 nucleotides in length, 18-27 nucleotides in length, 19-26 nucleotides in length, 19-23 nucleotides in length, 19-22 nucleotides in length, 19-21 nucleotides in length, 19-20 nucleotides in length,20-30 nucleotides in length, 20-27 nucleotides in length, 20-26 nucleotides in length, 20- 25 nucleotides in length, 20-24 nucleotides in length, 20-23 nucleotides in length, 20-22 nucleotides in length, 20-21 nucleotides in length, 21-30 nucleotides in length, 21-27 nucleotides in length,21-26 nucleotides in length, 21-25 nucleotides in length, 21-24 nucleotides in length, 21-23 nucleotides in length, or 21-22 nucleotides in length. In certain aspects, the target may comprise a region of at least 15 contiguous nucleotides.
[0081] It should be understood that the term "RNA molecule" or "ribonucleic acid molecule" encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or as known in the art. Strictly speaking, a "ribonucleoside" includes a nucleoside base and a ribose sugar, and a "ribonucleotide" is a ribonucleoside with one, two or three phosphate moieties. However, the terms "ribonucleoside" and "ribonucleotide" may be considered to be equivalent as used herein. The RNA may be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below. However, theAty. Docket No. 40574-137 molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non- limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-0-methyl modified nucleoside, a 2’-O- methoxyethyl (MOE) modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy- 2'-fluoro modified nucleoside, a 2'-amino- modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule. In certain aspects, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that can form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway.
[0082] Thus, in one aspect of the disclosure, the inhibitory compound comprises an iRNA for inhibiting the expression of a gene selected from the group consisting of ABHD14B gene, a CB1R gene, and aMGLUR5 gene, the iRNA comprising a region of complementarity to a target sequence in an mRNA transcribed from the gene of interest. In certain aspects, the iRNA comprises, at least, an antisense strand comprising the region of complementarity. In certain aspects, the iRNA may be a dsRNA comprising a sense strand and an antisense strand that hybridize to form a duplex region, the antisense strand comprising the region of complementarity to the target sequence in mRNA transcribed from the gene of interest. In certain aspects, the duplex region may be between 9 and 36 base pairs in length. In certain aspects, the duplex region may be between 15 and 25 base pairs in length. In certain aspects, the duplex region may be at least 17 base pairs in length. In certain aspects, the duplex region may be between 17 and 21 base pairs in length. In certain aspects, the duplex region may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length. In certain aspects, the region of complementarity may be between 9 and 36 base pairs in length. In certain aspects, the region of complementarity may be between 15 and 25 base pairs in length. In certain aspects, the region of complementarity may be at least 17 base pairs in length. In certain aspects, the region ofAty. Docket No. 40574-137 complementarity may be between 17 and 21 base pairs in length. In certain aspects, the region of complementarity may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, T1 , 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length.
[0083] In certain aspects, the iRNA promotes inhibition of mRNA encoding an ABHD14B protein, which may comprise degradation of the mRNA. In such aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the 3’ untranslated region of the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the 3’ untranslated region of the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO: 1. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO: 1. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO: 1. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides comprising SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25,Aty. Docket No.40574-137SEQIDNO26, SEQ IDNO56, SEQIDNO58, SEQIDNO:60, SEQ IDNO:62, SEQIDNO:65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:114, SEQ ID NO:116, SEQ ID NO:118, or SEQ ID NO:120. In certain aspects, the region of complementarity may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising a nucleotide sequence comprising SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ IDNO:14, SEQIDNO:17, SEQ ID NO: 18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO 73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO:104, SEQIDNO:106, SEQIDNO:108, SEQIDNO:110, SEQIDNO:112, SEQIDNO:114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQIDNO:63, SEQ IDNO:64, SEQIDNO:67, SEQIDNO:68, SEQIDNO:71, SEQIDNO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO:107, SEQIDNO:109, SEQIDNO:111, SEQIDNO:113, SEQIDNO:115, SEQIDNO:117, or SEQ ID NO: 119. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence comprising SEQ ID NO:4, SEQ IDNO:6, SEQIDNO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQIDNO:58, SEQ IDNO:60, SEQIDNO:62, SEQIDNO:65, SEQIDNO:66, SEQIDNO:69, SEQ ID NO:70, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotidesAty. Docket No. 40574-137 from a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO:16, SEQ ID NO 19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ IDNO:63, SEQ IDNO:64, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from a sequence comprising SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ IDNO:21, SEQ IDNO:22, SEQ ID NO:25, SEQ IDNO:26, SEQ IDNO:56, SEQ IDNO:58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO 73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the sense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO 71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119. In certain aspects, the region of complementarity may comprise a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO 71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119. In certain aspects, the region of complementarity may comprise a sequence comprisingSEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO: 18, SEQ IDAty. Docket No. 40574-137NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:3 and the antisense strand may comprise, or consist of, SEQ ID NO:4. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:5 and the antisense strand may comprise, or consist of, SEQ ID NO:6. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:7 and the antisense strand may comprise, or consist of, SEQ ID NO:8. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:9 and the antisense strand may comprise, or consist of, SEQ ID NO: 10. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 11 and the antisense strand may comprise, or consist of, SEQ ID NO: 13. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 12 and the antisense strand may comprise, or consist of, SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 15 and the antisense strand may comprise, or consist of, SEQ ID NO: 17. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 16 and the antisense strand may comprise, or consist of, SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 19 and the antisense strand may comprise, or consist of, SEQ ID NO:21. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:20 and the antisense strand may comprise, or consist of, SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:23 and the antisense strand may comprise, or consist of, SEQ ID NO:25. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:24 and the antisense strand may comprise, or consist of, SEQ ID NO:26. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:55 and the antisense strand may comprise, or consist of, SEQ ID NO:56. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 57 and the antisense strand may comprise, or consist of, SEQ ID NO:58. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:59 and the antisense strand may comprise, or consist of, SEQ ID NO:60. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 61 and the antisense strand may comprise, or consist of, SEQ ID NO:62. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:63 and the antisense strand may comprise, or consist of, SEQ ID NO:65.Aty. Docket No. 40574-137In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:64 and the antisense strand may comprise, or consist of, SEQ ID NO:66. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:67 and the antisense strand may comprise, or consist of, SEQ ID NO:69. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:68 and the antisense strand may comprise, or consist of, SEQ ID NO:70. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:71 and the antisense strand may comprise, or consist of, SEQ ID NO:73. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:72 and the antisense strand may comprise, or consist of, SEQ ID NO:74. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:75 and the antisense strand may comprise, or consist of, SEQ ID NO:77. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:76 and the antisense strand may comprise, or consist of, SEQ ID NO:78. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 101 and the antisense strand may comprise, or consist of, SEQ ID NO: 102. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 103 and the antisense strand may comprise, or consist of, SEQ ID NO: 104. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 105 and the antisense strand may comprise, or consist of, SEQ ID NO: 106. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 107 and the antisense strand may comprise, or consist of, SEQ ID NO: 108. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 109 and the antisense strand may comprise, or consist of, SEQ ID NO: 110. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 111 and the antisense strand may comprise, or consist of, SEQ ID NO: 112. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 113 and the antisense strand may comprise, or consist of, SEQ ID NO: 114. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 115 and the antisense strand may comprise, or consist of, SEQ ID NO: 116. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 117 and the antisense strand may comprise, or consist of, SEQ ID NO:118. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 119 and the antisense strand may comprise, or consist of, SEQ ID NO: 120.
[0084] In certain aspects, the iRNA promotes inhibition of mRNA encoding a CB1R protein, which may comprise degradation of the mRNA. In such aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the CB 1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotidesAty. Docket No. 40574-137 from the CB1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the 3’ untranslated region of the CB1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the 3’ untranslated region of the CB1R encoding mRNA. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:27. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:27. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO:27. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:28. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO:28. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from SEQ ID NOs:121, 123, 125, or 127. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from SEQ ID NOs: 122, 124, 126, or 128. In certain aspects, the region of complementarity may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising a nucleotide sequence set forth in SEQ ID NOs: 121, 123, 125, or 128. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, or SEQ ID NO: 127. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, or SEQ ID NO: 128. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from a sequence selected from the group consisting of SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, or SEQ ID NO: 127. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from a sequence selected from the group consisting of SEQ IDAty. Docket No. 40574-137NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, or SEQ ID NO: 128. In certain aspects, the sense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising a nucleotide sequence set forth in SEQ ID NOs: 121, 123, 125, or 127. In certain aspects, the region of complementarity may comprise a sequence selected from the group consisting of SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, or SEQ ID NO: 127. In certain aspects, the region of complementarity may comprise a sequence selected from the group consisting of SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, or SEQ ID NO: 128. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 121 and the antisense strand may comprise, or consist of, SEQ ID NO: 122. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 123 and the antisense strand may comprise, or consist of, SEQ ID NO: 124. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 125 and the antisense strand may comprise, or consist of, SEQ ID NO: 126. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 127 and the antisense strand may comprise, or consist of, SEQ ID NO: 128.
[0085] In certain aspects, the iRNA promotes inhibition of mRNA encoding an MGLUR5 protein, which may comprise degradation of the mRNA. In such aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the 3’ untranslated region of the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the 3’ untranslated region of the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:29. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:29. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO:29. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:30. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:30. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36,Aty. Docket No.40574-137 contiguous nucleotides from SEQ ID NO:30. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from SEQ IDNOs:31, 33, 35, 37, 39, 40, 43, 44, 47, 48, 51, 52, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, or 99. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from SEQ ID NOs:32, 34, 36, 38, 41, 42, 45, 46, 49, 50, 53, 54, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, or 100. In certain aspects, the region of complementarity may comprise at least 12, 13, 14, 15,16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising a nucleotide sequence set forth in SEQ ID NOs:32, 34, 36, 38, 41, 42, 45, 46, 49, 50, 53, 54, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, or 100. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence comprising SEQIDNO:31, SEQIDNO33, SEQIDNO35, SEQIDNO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO 47, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQIDNO:87, SEQ IDNO:89, SEQIDNO:91, SEQIDNO:93, SEQ IDNO:95, SEQIDNO:97, or SEQ ID NO:99. In certain aspects, the region of complementarity may comprise an at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence comprising SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:45, SEQIDNO46, SEQ IDNO:49, SEQIDNO:50, SEQIDNO53, SEQ IDNO:54, SEQIDNO:80, SEQIDNO:82, SEQIDNO:84, SEQIDNO:86, SEQIDNO:88, SEQIDNO:90, SEQIDNO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, or SEQ ID NO: 100. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from a sequence comprising SEQ ID NO 31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:48, SEQIDNO:51, SEQ IDNO:52, SEQIDNO:79, SEQIDNO:81, SEQ IDNO:83, SEQIDNO:85, SEQIDNO:87, SEQ IDNO:89, SEQIDNO:91, SEQIDNO:93, SEQIDNO:95, SEQIDNO:97, or SEQ ID NO:99. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16,17, 18, or 19 contiguous nucleotides from a sequence comprising SEQ ID NO:32, SEQ ID NO:34, SEQIDNO:36, SEQ IDNO:38, SEQIDNO:41, SEQIDNO:42, SEQIDNO:45, SEQIDNO:46, SEQIDNO 49, SEQ IDNO 50, SEQIDNO:53, SEQIDNO:54, SEQ IDNO:80, SEQIDNO:82,Aty. Docket No. 40574-137SEQ ID NO 84, SEQ ID NO 86, SEQ ID NO 88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, or SEQ ID NO: 100. In certain aspects, the region of complementarity may comprise a sequence selected from the group consisting of SEQ ID NO:31, SEQ IDNO:33, SEQ IDNO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ IDNO:44, SEQ IDNO:47, SEQ ID NO:48, SEQ IDNO:51, SEQ IDNO:52, SEQ IDNO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, or SEQ ID NO:99. In certain aspects, the region of complementarity may comprise a sequence comprising SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:46, SEQ IDNO:49, SEQ IDNO:50, SEQ ID NO:53, SEQ IDNO:54, SEQ IDNO:80, SEQ IDNO:82, SEQ IDNO:84, SEQ IDNO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, or SEQ ID NO: 100. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:31 and the antisense strand may comprise, or consist of, SEQ ID NO:32. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:33 and the antisense strand may comprise, or consist of, SEQ ID NO:34. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:35 and the antisense strand may comprise, or consist of, SEQ ID NO:36. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:37 and the antisense strand may comprise, or consist of, SEQ ID NO:38. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:39 and the antisense strand may comprise, or consist of, SEQ ID NO:41. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:40 and the antisense strand may comprise, or consist of, SEQ ID NO:42. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 43 and the antisense strand may comprise, or consist of, SEQ ID NO:45. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:44 and the antisense strand may comprise, or consist of, SEQ ID NO:46. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:47 and the antisense strand may comprise, or consist of, SEQ ID NO:49. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:48 and the antisense strand may comprise, or consist of, SEQ ID NO:50. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:51 and the antisense strand may comprise, or consist of, SEQ ID NO:53. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:52 and the antisense strand may comprise, or consist of, SEQ ID NO:54. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:79Aty. Docket No. 40574-137 and the antisense strand may comprise, or consist of, SEQ ID NO:80. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:81 and the antisense strand may comprise, or consist of, SEQ ID NO:82. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:83 and the antisense strand may comprise, or consist of, SEQ ID NO:84. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 85 and the antisense strand may comprise, or consist of, SEQ ID NO:86. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:87 and the antisense strand may comprise, or consist of, SEQ ID NO:88. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:89 and the antisense strand may comprise, or consist of, SEQ ID NO:90. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:91 and the antisense strand may comprise, or consist of, SEQ ID NO:92. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:93 and the antisense strand may comprise, or consist of, SEQ ID NO:94. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:95 and the antisense strand may comprise, or consist of, SEQ ID NO:96. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:97 and the antisense strand may comprise, or consist of, SEQ ID NO:98. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 99 and the antisense strand may comprise, or consist of, SEQ ID NO: 100.
[0086] As discussed elsewhere herein, the strands forming the duplex structure may be from two separate RNA molecules, and one or more of the strands may comprise nucleotide overhangs, which may comprise 1 or 2 nucleotide overhangs on their 3’ ends. Thus, in certain aspects, the antisense strand may comprise nucleotide XI, and optionally, nucleotide X2 on its 3’end. Likewise, the sense strand may comprise nucleotide XI, and optionally, nucleotide X2 on its 3’end. Thus, for example, the antisense strand may comprise (UCACCGACCUCCACUCUGG(X)n), (UGUACCUAUGCAGUUGCCC(X)n),(UGGCUCUAAACAUGUAAGC(X)n), or (UUACCCUCCACAGGAUUAU(X)n), and the sense strand may comprise (CCAGAGUGGAGGUCGGUGA(X)n), (GGGCAACUGCAUAGGUACA(X)n), (GCUUACAUGUUUAGAGCCA(X)n), or (AUAAUCCUGUGGAGGGUAA(X)n), wherein n is 1 or 2, and wherein XI and X2, if present, are selected independently from the group consisting of adenine (A), cytosine (C), guanine (G), uracil (U), and deoxythymidine (dT).Aty. Docket No. 40574-137
[0087] Thus, in certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, or SEQ ID NO: 24. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, or SEQ ID NO: 24. In certain aspects, the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 26. In certain aspects, the antisense strand may comprise SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 26.
[0088] In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand may comprise, or consist of, SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:5, SEQ ID NO: 15, or SEQ ID NO: 16, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:5, SEQ ID NO: 15, or SEQ ID NO: 16, and the antisense strand may comprise, or consist of, SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%,Aty. Docket No. 40574-137 at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise, or consist of, SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 10, SEQ ID NO:25, or SEQ ID NO:26. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand may comprise, or consist of, SEQ ID NO: 10, SEQ ID NO:25, or SEQ ID NO:26.
[0089] In certain aspects, an inhibitory compound of the disclosure may inhibit one or more activities possess by the ABHD14B protein. In such aspects, the inhibitory compound may be a small molecule that binds the ABHD14B protein, thereby inhibiting the one or more activity. In certain aspects, the inhibitory compound may comprise an anti-ABHD14B protein antibody.
[0090] In certain aspects, an iRNA of the disclosure may promote degradation of mRNA encoding a CB1R protein. In such aspects, the target sequence may comprise, or consist of, between 15 and 30 contiguous nucleotides from the CB1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 18 and 25 contiguous nucleotides from the CB1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 30 contiguous nucleotides in the 3’ untranslated region of the CB1R encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 18 and 25 contiguous nucleotides in the 3’ untranslated region of the CB1R encoding mRNA. In certain aspects, the target sequence may comprise between 18 and 25 contiguous nucleotides from SEQ ID NO:27 or SEQ ID NO:28.
[0091] In certain aspects, an inhibitory compound of the disclosure may inhibit one or more activities possess by the CB1R protein. In such aspects, the inhibitory compound may be a small molecule that binds the CB1R protein, thereby inhibiting the one or more activity. In certain aspects, the inhibitory compound may comprise an anti-CBlR protein antibody. Examples of such inhibitors include, but are not limited to, MRI-1891 (monlunabant), MRI-1867 (zevaquenabant),Aty. Docket No. 40574-137JD5037, CRB-556, CRB-913, nimacimab, GFB-024, ANEB-001 (selonabant), AEF0117, TNV- 347, rimonabant, taranabant, otenabant, surinabant, ibipinabant, TM38837.
[0092] In certain aspects, an iRNA of the disclosure may promote degradation of mRNA encoding a MGLUR5 protein. In such aspects, the target sequence may comprise, or consist of, between 15 and 30 contiguous nucleotides from the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 18 and 25 contiguous nucleotides from the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 30 contiguous nucleotides in the 3’ untranslated region of the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 18 and 25 contiguous nucleotides in the 3’ untranslated region of the MGLUR5 encoding mRNA. In certain aspects, the target sequence may comprise between 18 and 25 contiguous nucleotides from SEQ ID NO:29 or SEQ ID NO:30.
[0093] In certain aspects, an inhibitory compound of the disclosure may inhibit one or more activities possessed by the MGLUR5 protein. In such aspects, the inhibitory compound may be a small molecule that binds the MGLUR5 protein, thereby inhibiting the one or more activity. In certain aspects, the inhibitory compound may comprise an anti-MGLUR5 protein antibody. Examples of such inhibitors include, but are not limited to, basimglurant, mavoglurant, AZD 2066, AZD9272, BMS-984923 (ALX-001), remeglurant, dipraglurant, F169521, F1699611, STX107, fenobam, CTEP, GET73, ADX10059. The inhibitors are disclosed in PCT International Publication No: WO2023 / 244530, which is incorporated herein by reference in its entirety.
[0094] In certain aspects, an inhibitory compound of the disclosure may be joined to an unrelated molecule, such as a cell-penetrating peptide (CPP), or a ligand, or a cell targeting antibody. In certain aspects, the unrelated molecule may be covalently joined to the inhibitory compound. In certain aspects, the unrelated molecule may be non-covalently joined to the inhibitory compound. In certain aspects, the ligand may target the inhibitory compound to a specific type of tissue or cell. For example, the ligand may target the inhibitory compound to lung cells, kidney cells, cardiac cells, pancreatic cells, eye cells, uterine cells, ovarian cells, or intestinal cells. In certain aspects, the targeted cell may be a cell of the immune system, such as a T-cell. Ligands may include naturally occurring substances, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin,Aty. Docket No. 40574-137 cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, or synthetic peptide.
[0095] One aspect of the disclosure is a vector comprising a nucleic acid sequence encoding at least one strand of an iRNA of the disclosure. In certain aspects, the vector may comprise a plasmid or a viral vector. Depending on the structure of the iRNA, the vector may encode one strand or both strands of an iRNA. For example, in cases where the two strands forming the duplex structure of an iRNA are from a single RNA molecule having at least one self-complementary region, the vector may encode the single RNA molecule. In cases where the two strands forming the duplex structure of the iRNA are from separate RNA molecules, the vector may encode any one of the individual RNA molecules. In certain aspects, the nucleic acid sequence encoding an iRNA may be operably linked to a regulatory sequence, such as a promoter or enhancer, that drives expression of the iRNA in target cells.
[0096] One aspect of the disclosure is a composition comprising one or more inhibitory compounds, or vectors, of the disclosure. In certain aspects, the composition may comprise a compound that inhibits expression of a ABHD14B gene, or a protein encoded thereby, and at least one compound selected from the group consisting of a compound that inhibits expression of a CB 1R gene, or a protein encoded thereby, and a compound that inhibits expression of a MGLUR5 gene, or a protein encoded thereby. In such aspects, the compound that inhibits expression of a ABHD14B gene, or a protein encoded thereby, may be an iRNA of the disclosure. In certain aspects, the iRNA may be an ASO or a siRNA of the disclosure. In certain aspects, the iRNA may be a siRNA comprising a sense and an antisense strand, the antisense strand comprising a region of complementarity to a target sequence in an mRNA transcribed from a ABHD14B gene. In such aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 9 and 36 contiguous nucleotides from the 3’ untranslated region of the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise, or consist of, between 15 and 25 contiguous nucleotides from the 3’ untranslated region of the ABHD14B encoding mRNA. In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO: 1. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQAty. Docket No. 40574-137ID NO: 1. In certain aspects, the target sequence may comprise 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ ID NO:2 . In certain aspects, the target sequence may comprise between 9 and 36 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise between 15 and 25 contiguous nucleotides from SEQ ID NO:2. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, contiguous nucleotides from SEQ IDNO:2. In certain aspects, the target sequence may comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from SEQ ID NOs:3, 5, 7, 9, 11, 12, 15, 16, 19, 20, 23, 24, 55, 57, 59, 61, 63, 64, 67, 68, 71, 72, 75, 76, 101, 103, 105, 107, 109, 111, 113, 115, 117, or 119 [
[0097] In certain aspects, the region of complementarity may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 1, 2, 3, 4, or 5 nucleotides from a sequence comprising SEQ ID NOs:4, 6, 8, 10, 13, 14, 17, 18, 21, 22, 25, 26, 56, 58, 60, 62, 65, 66, 69, 70, 73, 74, 77, 78, 102, 104, 106, 108, 110, 112, 114, 116, 118, or 120. In certain aspects, the region of complementarity may comprise at least 12 contiguous nucleotides at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the antisense strand may comprise at least 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleotides from a sequence comprising SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ IDNO:21, SEQ IDNO:22, SEQ ID NO:25, SEQ IDNO:26, SEQ IDNO:56, SEQ IDNO:58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the sense strand may comprise a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9,Aty. Docket No. 40574-137SEQ ID NO : 11 , SEQ ID NO : 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:20, SEQ IDNO:23, SEQ IDNO:24, SEQ ID NO:55, SEQ IDNO:57, SEQ IDNO:59, SEQ IDNO:61, SEQ IDNO:63, SEQ ID NO:64, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO:107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO:115, SEQ ID NO: 117, or SEQ ID NO: 119. In certain aspects, the region of complementarity may comprise a sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ IDNO: 13, SEQ IDNO: 14, SEQ ID NO: 17, SEQ IDNO: 18, SEQ IDNO:21, SEQ IDNO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO:108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO:116, SEQ ID NO: 118, or SEQ ID NO: 120. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:3 and the antisense strand may comprise, or consist of, SEQ ID NO:4. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:5 and the antisense strand may comprise, or consist of, SEQ ID NO:6. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:7 and the antisense strand may comprise, or consist of, SEQ ID NO: 8. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:9 and the antisense strand may comprise, or consist of, SEQ ID NO: 10. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 11 and the antisense strand may comprise, or consist of, SEQ ID NO: 13. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 12 and the antisense strand may comprise, or consist of, SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 15 and the antisense strand may comprise, or consist of, SEQ ID NO: 17. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 16 and the antisense strand may comprise, or consist of, SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 19 and the antisense strand may comprise, or consist of, SEQ ID NO:21. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:20 and the antisense strand may comprise, or consist of, SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:23 and the antisense strand may comprise, or consist of, SEQ ID NO:25. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:24 and the antisense strand may comprise, or consist of, SEQ ID NO:26. In certain aspects, the sense strandAty. Docket No. 40574-137 may comprise, or consist of, SEQ ID NO 55 and the antisense strand may comprise, or consist of, SEQ ID NO:56. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:57 and the antisense strand may comprise, or consist of, SEQ ID NO:58. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:59 and the antisense strand may comprise, or consist of, SEQ ID NO:60. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:61 and the antisense strand may comprise, or consist of, SEQ ID NO:62. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:63 and the antisense strand may comprise, or consist of, SEQ ID NO:65. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:64 and the antisense strand may comprise, or consist of, SEQ ID NO:66. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 67 and the antisense strand may comprise, or consist of, SEQ ID NO:69. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:68 and the antisense strand may comprise, or consist of, SEQ ID NO:70. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:71 and the antisense strand may comprise, or consist of, SEQ ID NO:73. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:72 and the antisense strand may comprise, or consist of, SEQ ID NO:74. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:75 and the antisense strand may comprise, or consist of, SEQ ID NO:77. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:76 and the antisense strand may comprise, or consist of, SEQ ID NO:78. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 101 and the antisense strand may comprise, or consist of, SEQ ID NO: 102. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 103 and the antisense strand may comprise, or consist of, SEQ ID NO: 104. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 105 and the antisense strand may comprise, or consist of, SEQ ID NO: 106. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 107 and the antisense strand may comprise, or consist of, SEQ ID NO: 108. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 109 and the antisense strand may comprise, or consist of, SEQ ID NO: 110. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 111 and the antisense strand may comprise, or consist of, SEQ ID NO: 112. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 113 and the antisense strand may comprise, or consist of, SEQ ID NO: 114. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 115 and the antisense strand may comprise, or consist of, SEQ ID NO: 116.Aty. Docket No. 40574-137In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 117 and the antisense strand may comprise, or consist of, SEQ ID NO: 118. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 119 and the antisense strand may comprise, or consist of, SEQ ID NO: 120.
[0098] In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, or SEQ ID NO: 24. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, or SEQ ID NO: 24.
[0099] In certain aspects, the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 26. In certain aspects, the antisense strand may comprise SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, or SEQ ID NO: 26.
[0100] In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand may comprise, or consist of, SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:5, SEQ ID NO: 15, or SEQ ID NO: 16, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:5, SEQ ID NO: 15, or SEQ ID NO: 16, and the antisense strand mayAty. Docket No. 40574-137 comprise, or consist of, SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 8, SEQ ID NO:21, or SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand may comprise, or consist of, SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22. In certain aspects, the sense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand may comprise, or consist of, a nucleotide sequence at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to SEQ ID NO: 10, SEQ ID NO:25, or SEQ ID NO:26. In certain aspects, the sense strand may comprise, or consist of, SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand may comprise, or consist of, SEQ ID NO: 10, SEQ ID NO:25, or SEQ ID NO:26.
[0101] In certain aspects, the composition may comprise an additional molecule that helps protect the inhibitory compound from degradation. For example, the composition may comprise a lipid that encapsulates the inhibitory compound, thereby forming a nanoparticle comprising the inhibitory compound. Examples of other molecules that may be present in the composition include, but are not limited to, cholesterol, cholic acid, a thioether, a thiocholesterol, a polyamine
[0102] In certain aspects, the composition may be a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient, or stabilizer. Inhibitory compounds and vectors used in methods of the disclosure may be formulated in a therapeutic composition comprising a carrier. "Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. A "pharmaceutically acceptable carrier" is an excipient that does not interfere with the effectiveness of the biological activity of an inhibitory compound of the disclosure. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids, Hanks' solution, Ringer's solution, or physiological saline buffer; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins,Aty. Docket No. 40574-137 such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®. Additional agents, such as flavoring, coloring, sweetening, and / or thickening agents, may be added to compositions of the disclosure.
[0103] Compositions, including pharmaceutical compositions, of the disclosure may comprise an amount of an inhibitory compound, or vector, of the disclosure, sufficient to inhibit expression of a gene of the disclosure, or the activity of a protein encoded thereby. With respect to iRNAs of the disclosure, a suitable amount of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of an individual to which the iRNA may be administered. In certain aspects, the iRNA may be in the range of 1 to 50 mg per kilogram body weight per day. For example, in certain aspects the iRNA may be administered at 0.05 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg per single dose, 100 mg / kg per single dose, 150 mg / kg per single dose, or 200 mg / kg per single dose.METHODS
[0104] One aspect of the disclosure is a method of decreasing expression of ABHD14B protein in a cell, comprising contacting the cell with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0105] One aspect of the disclosure is a method of attenuating collagen biosynthesis by a cell, comprising contacting the cell with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0106] One aspect of the disclosure is a method of increasing carnitine biosynthesis in a cell, comprising contacting the cell with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0107] One aspect of the disclosure is a method of attenuating an epithelial-mesenchymal transition in a cell, comprising contacting the cell with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.Aty. Docket No. 40574-137
[0108] One aspect of the disclosure is a method of attenuating senescence of an epithelial cell, comprising contacting the epithelial cell with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0109] One aspect of the disclosure is a method of reducing or preventing fibroblast activation, comprising contacting the fibroblast with an inhibitory compound of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0110] One aspect of the disclosure is a method of attenuating senescence of an epithelial cell, comprising contacting the epithelial cell with an inhibitory compound of the disclosure.
[0111] In these methods, the inhibitory compound may be an iRNA of the disclosure. In such aspects, the iRNA may inhibit the expression of a ABHD14B gene. In certain aspects, the iRNA may promote degradation of an ABHD14B protein encoding mRNA.
[0112] In these methods, the inhibitory compound may be a molecule that binds to the ABHD14B protein and inhibits one or more activities possessed thereby. In such aspects, the inhibitory compound may be, for example, a small molecule, a peptide, a protein, or an antibody.
[0113] In these methods, unless otherwise specified, the cell may be any cell. In certain aspects, the cell may be an epithelial cell, which may be a lung epithelial cell or a bronchial epithelial cell or alveolar epithelial cell. In these methods, the step of contacting may comprise introducing the inhibitory compound into the cell. As used herein, “introducing into a cell,", and the like, when referring to an inhibitory compound (e.g., iRNA), means facilitating or effecting uptake or absorption of the inhibitory compound into the cell, as is understood by those skilled in the art. Absorption or uptake may occur through unaided diffusive or active cellular processes. Alternatively, absorption of uptake may occur thought he use of auxiliary agents or devices known to those skilled in the art. Such absorption or uptake is not limited to cells in vitro, since the inhibitory compound may be introduced into a cell that is part of an individual. In such an instance, introduction into the cell may include delivery to the individual.
[0114] One aspect of the disclosure is a method of reducing inflammation in the lung of an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure.
[0115] One aspect of the disclosure is a method treating a fibrosing interstitial lung disease in an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure. In certain aspects, theAty. Docket No. 40574-137 fibrosing interstitial lung disease is selected from the group consisting of idiopathic pulmonary fibrosis [IPF], Hermansky-Pudlak syndrome pulmonary fibrosis [HPSPF], chronic graft versus host disease (cGVHD) related interstitial lung disease, scleroderma related Interstitial lung disease [SSc-ILD], rheumatoid arthritis associated pulmonary fibrosis, usual interstitial pneumonia [UIP], idiopathic nonspecific interstitial pneumonia [NSIP], chronic cryptogenic organizing pneumonia, Polymyositis / dermatomyositis-ILD, systemic lupus erythematosus [SLE], Sjogren’s Syndrome, respiratory bronchiolitis, hypersensitivity pneumonitis, radiation related pulmonary fibrosis, bronchopulmonary dysplasia, sarcoidosis, pneumoconiosis, Lymphangioleiomyomatosis (LAM), post-ARDS fibrosis, and virus- related pulmonary disease.
[0116] One aspect of the disclosure is a method treating a chronic obstructive lung disease in an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure. In certain aspects, the chronic obstructive lung disease is selected from the group consisting of asthma, bronchiectasis, and chronic obstructive pulmonary disease (COPD).
[0117] One aspect of the disclosure is a method treating pulmonary vascular disease in an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure. In certain aspects, the pulmonary vascular disease is selected from the group consisting of primary pulmonary hypertension, pulmonary arterial hypertension [PAH], pulmonary venous hypertension, idiopathic pulmonary hypertension, precapillary pulmonary hypertension, alveolar -capillary dysplasia, sickle cell chronic lung disease, systemic lupus erythematosus related pulmonary fibrosis, and pathogenic pulmonary fibrosis.
[0118] One aspect of the disclosure is a method reducing fibrosis in an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure. In such aspects, the fibrosis being reduced may be in any tissue of the body. In certain aspects, the fibrosis may comprise liver fibrosis, which may be the result of Schistosoma mansoni infection, cirrhosis, alcohol associated liver disease, primary sclerosing cholangitis [PSC], or MASH-associated liver fibrosis. In certain aspects, the fibrosis may comprise kidney fibrosis, which may be the result of diabetic nephropathy, chronic glomerulonephritis, polycystic kidney disease, chronic kidney disease, lupus nephritis, Alport syndrome, Berger’s disease, focal segmental glomerulosclerosis, sarcoidosis, or renal disease. InAty. Docket No. 40574-137 certain aspects, the fibrosis may comprise cardiac fibrosis, which may be the result of cardiomyopathy, myocarditis, sarcoidosis, systemic lupus erythematosus, Marfan syndrome, or ischemia related conditions including pre-ischemia and post-ischemia conditions such as congestive heart failure. In certain aspects, the fibrosis may comprise intestinal fibrosis, corneal fibrosis, uterine fibrosis, or fibrosis of the ovaries. In certain aspects, the fibrosis may comprise remodeling of pancreatic tissue, including pancreatic cancer. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to pancreatic tissue. The fibrosis may comprise intestinal fibrosis. In certain aspects, the intestinal fibrosis may be a result of Crohn’s disease, ulcerative colitis, intestinal tuberculosis, chronic mesenteric ischemia, radiation enteritis, gastrointestinal carcinoids, desmoplastic reaction to adenocarcinoma, eosinophilic gastroenteritis, or systemic sclerosis. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to intestinal tissue. The fibrosis may comprise skin fibrosis. In certain aspects, the skin fibrosis may be a result of scleroderma, chronic graft-versus-host disease, morphea, hypertrophic scars, keloids, dermatomyositis, lipodermatosclerosis, eosinophilic fasciitis, Werner syndrome, Dupuytren contracture, Werner syndrome or Epidermolysis Bullosa dystrophica. In certain aspects, the inhibitory compound may comprise a ligand that targets the inhibitory compound to the skin.
[0119] One aspect of the disclosure is a method treating cancer in an individual, comprising administering to the individual one or more inhibitory compounds of the disclosure, a composition of the disclosure, or a vector of the disclosure. In certain aspects, the cancer may comprise lung cancer, lung adenocarcinoma, non-small cell lung cancer, small cell lung carcinoma, mesothelioma, squamous cell carcinoma, large cell carcinoma, liver cancer, kidney cancer, hepatocellular carcinoma, cholangiocarcinoma, pancreatic cancer, breast cancer, prostate cancer, endometrial cancer, bladder cancer, ovarian cancer, glioblastoma, skin squamous cell carcinoma, melanoma, desmoplastic melanoma, pancreatic ductal adenocarcinoma, esophageal squamous cell carcinoma, myelofibrosis, Hodgkin lymphoma, sclerosing epithelioid fibrosarcoma, sclerosing liposarcoma, or T-cell lymphoma.
[0120] In these methods, the one or more inhibitory compound may be selected from the group consisting of an inhibitory compound that inhibits expression of &ABHD14B gene, an inhibitory compound that inhibits expression of a CB1R gene an inhibitory compound that inhibits expression of & MGLUR5 gene an inhibitory compound that inhibits one or more activities of a ABHD14BAty. Docket No. 40574-137 protein, an inhibitory compound that inhibits the activity of a CB1R protein such as MRI-1891 (monlunabant), MRI-1867 (zevaquenabant), JD5037, CRB-556, CRB-913, nimacimab, GFB-024, ANEB-001, AEF0117, INV-347, rimonabant, taranabant, otenabant, surinabant, ibipinabant, or TM38837, and an inhibitory compound that inhibits the activity of a MGLUR5 protein such as basimglurant, mavoglurant, AZD 2066, AZD9272, BMS-984923 (ALX-001), remeglurant, dipraglurant, F169521,F1699611, STX107, GET73, fenobam, or ADX10059. In certain aspects, at least one of the one or more inhibitory compounds administered to the individual inhibits the expression of &ABHD14B gene or inhibits one or more activities of a ABHD14B protein. In certain aspects, the one or more inhibitory compounds may comprise one or more iRNAs of the disclosure, which may be selected from the group consisting of an iRNA that inhibits the expression of a ABHD14B gene, an iRNA that inhibits the expression of a CB1R gene, and an iRNA that inhibits the expression of a MGLUR5 gene. In certain aspects, the one or more iRNAs may promote degradation of mRNA transcribed from a ABHD14B gene, a CB1R gene, or &MGLUR5 gene. In certain aspects, the one or more iRNAs may be administered in the form of one or more vectors of the disclosure, or in one or more compositions of the disclosure.
[0121] In certain aspects, the one or more inhibitory compounds may be selected from the group consisting of inhibitory compounds that inhibit one or more activities of a ABHD14B protein, inhibitory compounds that inhibit one or more activities of a CB1R protein, and inhibitory compounds that inhibit one or more activities of a MGLUR5 protein. In such aspects, the one or more inhibitory compounds may comprise, for example, small molecules, organic compounds, peptides, proteins, or antibodies.
[0122] In these methods, the one or more inhibitory compounds may be administered to the individual by any method suitable for treating the specified condition. Examples of routes of administration include, but are not limited to, injection into a tissue site, systemic administration via injection into a vein or a port, inhalation, topical administration, including skin electroporation, oral administration, and intranasal administration. In certain aspects, the iRNA may be administered as a “naked” iRNA (i.e., not in complex with any other molecules), in the form of a vector of the disclosure, or in the form of a composition of the disclosure. Methods of administering inhibitory compounds in a manner appropriate for the intended use are known in the art.Aty. Docket No. 40574-137
[0123] One aspect of the disclosure is a kit comprising an inhibitory compound of the disclosure, a vector of the disclosure, a composition or the disclosure, or a pharmaceutical composition of the disclosure. In certain aspects, the inhibitory compound may inhibit expression of an ABHD14B gene, or at least activity of a protein encoded thereby. In certain aspects, the inhibitory compound may comprise an iRNA of the disclosure. In certain aspects, the iRNA may comprise an ASO or an siRNA of the disclosure. Kits of the disclosure may also contain associated components, such as, but not limited to, diluents, buffers, labels, containers, vials, inserts, tubing, syringes, instructions for use, and the like.
[0124] One aspect of the disclosure is a method for treating acute or chronic inflammatory or fibrotic disorders in a subject comprising administering to the subject an ABHD14B inhibitory compound, a CB1R inhibitory compound, and / or an MGLUR5 inhibitory compound. In certain aspects, the subject is administered an ABHD14B inhibitory compound. In certain aspects, the subject is administered a CB1R inhibitory compound. In certain aspects, the subject is administered an MGLUR5 inhibitory compound. In certain aspects, the subject is administered an ABHD14B inhibitory compound and a CB1R inhibitory compound. In certain aspects, the subject is administered an ABHD14B inhibitory compound and an MGLUR5 inhibitory compound. In certain aspects, the subject is administered a CB1R inhibitory compound and an MGLUR5 inhibitory compound. In certain aspects, the subject is administered an ABHD14B inhibitory compound, a CB1R inhibitory compound, and an MGLUR5 inhibitory compound.
[0125] In certain aspects, the ABHD14B inhibitory compound inhibits the expression of an ABHD14B gene or inhibits an activity of an ABHD14B protein. In certain aspects, the ABHD14B inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA). In certain aspects, the ABHD14B inhibitory compound comprises a small molecule. In certain aspects, the ABHD14B inhibitory compound comprises a protein. In certain aspects, the ABHD14B inhibitory compound comprises an ABHD14B antibody. In certain aspects, the ABHD14B inhibitory compound comprises an ABHD14B iRNA. In certain aspects, the ABHD14B iRNA comprises an ABHD14B sense strand and an ABHD14B antisense strand. In certain aspects, the nucleotide sequence of the ABHD14B sense strand comprises a nucleotide sequence set forth in SEQ ID NOs:3, 5, 7, 9, 11, 12, 15, 16, 19, 20, 23, 24, 55, 57, 59, 61, 63, 64, 67, 68, 71, 72, 75, 76, 101, 103, 105, 107, 109, 111, 113, 115, 117, or 119. In certain aspects, the nucleotide sequence of the ABHD14B antisense strand comprises a nucleotide sequence set forthAty. Docket No. 40574-137 in SEQ ID NOs: 4, 6, 8, 10, 13, 14, 17, 18, 21, 22, 25, 26, 56, 58, 60, 62, 65, 66, 69, 70, 73, 74, 77, 78, 102, 104, 106, 108, 110, 112, 114, 116, 118, or 120.
[0126] In certain aspects, the CB 1R inhibitory compound inhibits the expression of a CB1R gene or inhibits an activity of a CB1R protein. In certain aspects, the CB1R inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA). In certain aspects, the CB1R inhibitory compound comprises a small molecule. In certain aspects, the small molecule comprises MRI-1891 (monlunabant), MRI-1867 (zevaquenabant), JD5037, CRB-556, CRB-913, ANEB-001 (selonabant), AEF0117, INV-347, rimonabant, taranabant, otenabant, surinabant, ibipinabant, or TM38837. In certain aspects, the CB 1R inhibitory compound comprises a protein. In certain aspects, the CB1R inhibitory compound comprises a CB1R antibody. In certain aspects, the CB1R antibody comprises nimacimab, or GFB-024. In certain aspects, the CB1R inhibitory compound comprises a CB1R iRNA. In certain aspects, the CB1R iRNA comprises a CB1R sense strand and a CB1R antisense strand. In certain aspects, the nucleotide sequence of the CB1R sense strand comprises a nucleotide sequence set forth in SEQ ID NOs: 121, 123, 135, or 127. In certain aspects, the nucleotide sequence of the CB1R antisense strand comprises a nucleotide sequence set forth in SEQ ID NOs: 122, 124, 126, or 128.
[0127] In certain aspects, the MGLUR5 inhibitory compound inhibits the expression of an MGLUR5 gene or inhibits an activity of an MGLUR5 protein. In certain aspects, the MGLUR5 inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA). In certain aspects, the MGLUR5 inhibitory compound comprises a small molecule. In certain aspects, the small molecule comprises basimglurant, mavoglurant, AZD 2066, AZD9272, BMS-984923 (ALX-001), remeglurant, dipraglurant, F169521, F1699611, STX107, GET73, fenobam, or ADX10059. In certain aspects, the MGLUR5 inhibitory compound comprises a protein. In certain aspects, the MGLUR5 inhibitory compound comprises an MGLUR5 antibody. In certain aspects, the MGLUR5 inhibitory compound comprises an MGLUR5 iRNA. In certain aspects, the MGLUR5 iRNA comprises an MGLUR5 sense strand and an MGLUR5 antisense strand. In certain aspects, the nucleotide sequence of the MGLUR5 sense strand comprises a nucleotide sequence set forth in SEQ ID NOs:31, 33, 35, 37, 39, 40, 43, 44, 47, 48, 51, 52, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, or 99. In certain aspects, the nucleotide sequence of the MGLUR5 antisense strand comprises a nucleotide sequence set forth in SEQ ID NOs: 32, 34, 36, 38, 41, 42, 45, 46, 49, 50, 53, 54, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, or 100.Aty. Docket No. 40574-137
[0128] This writen description uses examples to disclose the invention, including the best mode, and also to enable any person skilled in the art to practice the invention, including making and using any devices or systems and performing any incorporated methods. The patentable scope of the invention is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.EXAMPLES
[0129] The following materials and methods were used to produce the data illustrated in the Figures.
[0130] Materials and Methods:
[0131] Materials
[0132] Scrambled or ABHD14B siRNA, were obtained from Dharmacon (Horizon Discovery). Antisense Locked nucleic acid (LNA) GapmeR for ABHD14B and its negative control were obtained from Qiagen. Pharmaceutical grade bleomycin was from Hospira (Lake Forest, IL, USA). Normal Human Bronchial Epithelial cells (NHBE) and Human lung fibroblasts idiopathic pulmonary fibrosis (DHLF) were purchased from Lonza. Lung carcinoma epithelial cells were purchased fron ATCC. All the other chemicals were from Sigma-Aldrich (St. Louis, MO, USA).
[0133] Animals
[0134] All animal procedures were conducted in accordance with the rules and regulations of the Institutional Animal Care and Use Committee of the National Institutes of Alcohol Abuse and Alcoholism (NIAAA), under the protocols of LPS-GK1. Thirteen-week-old male C57BL / 6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). Abhdl4b- / - (Abhdl4B KO) mice (046229-JAX) were purchased from The Jackson Laboratory. Abhdl4b- / - (Abhdl4B KO) mice were on a C57BL / 6NJ genetic background. Abhdl4b- / - mice colonies were maintained with heterozygous breeding. Mice were housed individually under a 12-hour light / dark cycle and fed a standard diet, ad libitum (Teklad NIH-31; Envigo, Huntingdon, UK).
[0135] Oropharyngeal Aspiration of BleomycinAty. Docket No. 40574-137
[0136] We generated a bleomycin-induced pulmonary fibrosis model by delivering bleomycin via oropharyngeal aspiration as previously described (1). Briefly, bleomycin (Hospira) is delivered to mice anesthetized with ketamine / xylazine through the oropharynx at 1 U / kg dose using a sterile 100 pL pipette during inspiration at a volume of 100 pL / 50 g body weight. Sterile saline was used as vehicle and applied to the control groups. The animals are then allowed to recover from the anesthesia.
[0137] Lung function measurements in mice
[0138] Respiratory system mechanics measurements were performed using the FlexiVent FX system (SCIREQ Inc., Montreal, Canada), which is equipped with an FX1 module and negative pressure forced expiration (NPFE) extension for mice. FlexiWare v7.2 software was used to operate the system. Forced oscillation techniques and forced expiration measurements were conducted as described previously (2, 3). Lung function measurements were performed at the end of the study as a terminal procedure. Mice were anesthetized by intraperitoneal (i.p.) injection of Ketamine / Xylazine, then an 18-gauge metal cannula was inserted into the trachea by small incision. Pancuronium was then administered by IP injection (0.8 mg / kg) to induce paralysis before connecting mice to FlexiVent and starting ventilation. Pressure-volume (PV) curve, airway resistance, tissue damping (G), tissue elastance (H), forced expiratory volume per 0.1 seconds (FEV 0.1), forced vital capacity (FVC), inspiratory capacity (IC), inhaled air amount (A), and caompliance parameters were measured. Mouse tissue was collected after performing lung function tests.
[0139] Hydroxyproline (Hyp) Measurement
[0140] The degree of lung fibrosis was quantified biochemically by measuring the hydroxyproline content of lung extracts using liquid chromatography / tandem mass spectrometry (LC-MS / MS) as described (1).
[0141] Real-time PCR Analyses
[0142] RNA extraction was performed using RNeasy Mini Kits from Qiagen (Valencia, CA). One microgram of total RNA was reverse transcribed to cDNA using Bio-Rad i Script cDNA synthesis kit (Hercules, CA). Expression of the target gene was quantified with gene-specific primers and PowerSYBRGreen master mix using a QuantStudio 3 Real-Time PCR instrument from Applied Biosystems. Predesigned primers mouse Tbp (QT00198443), Collal (QT01055418), Fnl (QT00135758), Timpl (QT00996282), Col4al (QT00100128) humanAty. Docket No. 40574-137ACTA2 (QT00088102), COL1 A1 (QT00037793), COL1A2 (QT00072058), PYCR1 (QT00065485). The house-keeping gene TATA-Box Binding Protein (Tbp) was used as loading control. Gene expression values were calculated based on the AACt method.
[0143] Transcriptomics analysis
[0144] RNA sequencing and Transcriptomics analysis were performed as previously described(4) Briefly, RNA isolated from the control and fibrotic lung tissues of wt, Abhdl4B KO mice. Then, RNA sequencing was conducted by Azenta Genewiz (NJ, USA) using Poly-A library selection on Illumina NovaSeq6000. Raw RNA-sequencing results were quantified using Kallisto(5) with the Ensemble mouse reference genome (GRCm39) (6). The quantification data was used for differential expression analysis using DeSeq2 (7) and generation of co-expression network using a previously described method (8) using top 10% correlation results.
[0145] Untargeted metabolomics profiling
[0146] Metabolites of carnitine synthesis pathways was measured by untargeted metabolomics approach as previously described (4)
[0147] Cell culture experiments and SiRNA knock-down
[0148] A549 were cultivated in DMEM supplemented with 10% Fetal Bovine Serum (FBS). NHBE were cultivated in PneumaCult-Ex Plus medium (Stem cell). DHLF were cultivated in DMEM supplemented with 2mM glutamine, ImM pyruvate and 0.1% BSA. The cells were transfected according to the manufacturer's instructions. Briefly, 12.5nM of either scramble (scr) or siRNA are mixed with DharmaFECT 1 (Horizon). Cells are incubated with this mix for 24hr to allow the transfection. 48hr hours post-transfetion, the cells are collected to assess the efficiency of siRNA. Cells were treated with StemXVivo, according to the manufacturer’s instructions, for 48hr post-transfection. Then, cells have been harvested for further analysis.
[0149] DHLF-IPF-diseased human lung fibroblasts, idiopathic pulmonary fibrosis (DHLF- Lonza Bioscience Cat# CC-7231), NHCF-V- Human ventricular cardiac fibroblasts (Lonza Bioscience Cat# CC-2904), and NHDF-Ad- Normal adult human dermal fibroblasts (Lonza Bioscience Cat# CC-2511) were cultured in FGM®-2 fibroblast growth medium-2 bulletkit at at 37°C in a 5% CO2 incubator. During the experiments, the cells were seeded with DMEM media containing 10% FBS and 2 mM glutamine. After 24 hr, the cells were treated with experimental media containing serum-free DMEM, 2 mM glutamine, 1 mM pyruvate, and 1% BSA. After 24 hr., TGF[31 and other compounds were treated in the experimental media for 24 or up to 72hrs asAty. Docket No. 40574-137 indicated. SiRNA or Antisense LNA Gapmer treatments conducted 24 hours prior addition of TGFpi.
[0150] Western blotting
[0151] Cells were extracted with RIPA buffer supplied with protease and phosphatase inhibitor (ThermoFisher). Samples were prepared with NuPAGE™ LDS Sample Buffer and NuPAGE™ Sample Reducing Agent (10X) (ThermoFisher). Proteins were loaded in NuPAGE Bis-Tris gels (ThermoFisher) in MES buffer (ThermoFisher). Voltage was applied according to the pre-set program from PowerEase™ Touch Power Supply 35OW (ThermoFisher). Proteins were transferred into a PVDF membrane by iBlot2 transfer system (ThermoFisher) using P0 pre-set program. Membranes were Blocker™ BSA (ThermoFisher) for 30 min and then incubated with primary antibody HSC70 (sc-7298, Santa Cruz), Abhdl4b (20952-1-AP, Proteintech), NKX2-1 (TTF1) (ab76013, Abeam) and Vimentin (#5741, Cell signaling). Membranes were watched and then incubated with secondary antibodies Goat anti-mouse (Catalog#31430, ThermoFisher) or Goat anti-rabbit (Catalog#32460) for 30min. Protein were revealed with SuperSignal™ West Pico PLUS Chemiluminescent Substrate (ThermoFisher) by using iBrightl500 (Thermofisher).
[0152] Statistical Analysis
[0153] Statistical analyses were performed by one-way ANOVA using SciPy (9) module in Python 3.7.
[0154] References
[0155] 1. J. K. Park et al., Bleomycin Induces Drug Efflux in Lungs. A Pitfail for Pharmacological Studies of Pulmonary Fibrosis. Am J Respir Cell Mol Biol 62, 178-190 (2020).
[0156] 2. T. K. McGovern, A. Robichaud, L. Fereydoonzad, T. F. Schuessler, J. G. Martin, Evaluation of respiratory system mechanics in mice using the forced oscillation technique. J Vis Exp, e50172 (2013).
[0157] 3. F. C. Devos et al., Forced expiration measurements in mouse models of obstructive and restrictive lung diseases. Respir Res 18, 123 (2017).
[0158] 4. M. Arif et al., An Integrative Multiomics Framework for Identification of Therapeutic Targets in Pulmonary Fibrosis. Adv Sci (Weinh), e2207454 (2023).
[0159] 5. N. L. Bray, H. Pimentel, P. Melsted, L. Pachter, Near-optimal probabilistic RNA- seq quantification. Nat Biotechnol 34, 525-527 (2016).
[0160] 6. D. R. Zerbino et al., Ensembl 2018. Nucleic Acids Res 46, D754-D761 (2018).Atty. Docket No. 40574-137
[0161] 7. M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).
[0162] 8. M. Arif et al., Integrative transcriptomic analysis of tissue-specific metabolic crosstalk after myocardial infarction. Elife 10, (2021).
[0163] 9. P. Virtanen et al., SciPy 1.0: fundamental algorithms for scientific computing inPython. Nature Methods 17, 261-272 (2020).
Claims
Aty. Docket No. 40574-137WHAT IS CLAIMED IS:
1. An inhibitory compound that inhibits the expression of an abhydrolase domain containing 14B (ABHD14B) gene, or the activity or a protein encoded thereby.
2. The inhibitory compound of claim 1, wherein the inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA).
3. The inhibitory compound of claim 1 or 2, wherein the iRNA comprises an antisense oligonucleotide (ASO), siRNA, a ribozyme or a miRNA.
4. The inhibitory compound of any one of claims 1-3, wherein the iRNA inhibits expression of the ABHD14B gene.
5. The inhibitory compound of any one of claims 1-4, wherein the inhibitory compound comprises an iRNA.
6. The inhibitory compound of claim 5, wherein the iRNA comprises a region of complementarity to a target sequence in a ABHD14B mRNA transcript.
7. The inhibitory compound of claim 6, wherein the target sequence comprises at least 12 contiguous nucleotides differing from no more than 4 nucleotides from the region of complementarity.
8. The inhibitory compound of claim 6 or 7, wherein the target sequence is between 12 and 30 nucleotides in length.
9. The inhibitory compound of any one of claims 6-8, wherein the ABDHD14B mRNA transcript comprises SEQ ID NO: 1.
10. The inhibitory compound of any one of claims 6-8, wherein the target sequence is in an untranslated region of the ABHD14B mRNA transcript.
11. The inhibitory compound of claim 10, wherein the target sequence comprises between 15 and 30 contiguous nucleotides from SEQ ID NO:2.
12. The inhibitory compound of claim 10, wherein the target sequence comprises between 12 and 19 contiguous nucleotides from a sequence comprising SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:55, SEQ ID NO:57, SEQ IDNO:59, SEQ IDNO:61, SEQ ID NO:63, SEQ IDNO:64, SEQ IDNO:67, SEQ IDNO:68, SEQ ID NO 71, SEQ ID NO:72, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO: 101, SEQ IDAty. Docket No. 40574-137NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 1 11 , SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119.
13. The inhibitory compound of any one of claims 6-12, wherein the region of complementarity comprises between 12 and 30 contiguous nucleotides differing no more than 5 nucleotides from a sequence comprising SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO:74, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120.
14. The inhibitory compound of any one of claims 6-13, wherein the region of complementarity is fully complementary to the target sequence.
15. The inhibitory compound of any one of claims 5-14, wherein the iRNA comprises an ASO.
16. The inhibitory compound of any one of claims 5-14, wherein the iRNA comprises an siRNA having a sense strand and an antisense strand.
17. The inhibitory compound of claim 16, wherein the antisense strand comprises the region of complementarity.
18. The inhibitory compound of claim 16 or 17, wherein the sense strand and the antisense strands hybridize to form double stranded RNA.
19. The inhibitory compound of claim any one of claims 16-18, wherein the sense strand comprises a nucleotide sequence at least 85%, identical to a sequence comprising SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, or SEQ ID NO: 119.
20. The inhibitory compound of any one of claims 16-19, wherein the sense strand comprises a nucleotide sequence comprising SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ IDAty. Docket No. 40574-137NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO:115, SEQ ID NO: 117, or SEQ ID NO 119.
21. The inhibitory compound of any one of claims 16-20, wherein the antisense strand comprises a nucleotide sequence at least 85% identical to a sequence comprising SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, or SEQ ID NO: 120.
22. The inhibitory compound of any one of claims 16-21, wherein the antisense strand comprises a nucleotide sequence comprising SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 77, and SEQ ID NO: 78, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO:114, SEQ ID NO:116, SEQ ID NO: 118, or SEQ ID NO:120.
23. The inhibitory compound of any one of claims 16-22, wherein the sense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14.
24. The inhibitory compound of claim 23, wherein the sense strand comprises a nucleotide sequence comprising SEQ ID NO:3, SEQ ID NO: 11, or SEQ ID NO: 12, and the antisense strand comprises a nucleotide sequence comprising SEQ ID NO:4, SEQ ID NO: 13, or SEQ ID NO: 14.
25. The inhibitory compound of any one of claims 16-22, wherein the sense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:5, SEQ ID NO: 15, or SEQ ID NO: 16,Aty. Docket No. 40574-137 and the antisense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:6, SEQ ID NO: 17, or SEQ ID NO: 18.
26. The inhibitory compound of claim 25, wherein the sense strand comprises a nucleotide sequence comprising SEQ ID NO:5, SEQ ID NO: 15, and SEQ ID NO: 16, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO: 17, and SEQ ID NO: 18.
27. The inhibitory compound of any one of claims 16-22, wherein the sense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:8, SEQ ID NO:21, or SEQ ID NO:22.
28. The inhibitory compound of claim 27, wherein the sense strand comprises a nucleotide sequence comprising SEQ ID NO:7, SEQ ID NO: 19, or SEQ ID NO:20, and the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO:21, or SEQ ID NO:22.
29. The inhibitory compound of claim 27, wherein the sense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO:9, SEQ ID NO:23, or SEQ ID NO:24, and the antisense strand comprises a nucleotide sequence at least 85% identical to SEQ ID NO: 10, SEQ ID NO:25, or SEQ ID NO:26.
30. The inhibitory compound of claim 27, wherein the sense strand comprises a nucleotide sequence comprising SEQ ID NO:9, SEQ ID NO:23, and SEQ ID NO:24, and the antisense strand comprises a nucleotide sequence comprising SEQ ID NO: 10, SEQ ID NO:25, and SEQ ID NO:26.
31. The inhibitory compound of any one of claims 16-30, wherein the sense strand and the anti-sense strand are connected by a hairpin loop.
32. The inhibitory compound of any one of claims 6-31, wherein at least one ribonucleotide in the iRNA is a modified nucleotide.
33. The inhibitory compound of claim 32, wherein the modified ribonucleotide comprises a phosphonate modification, a ribose modification, or a base modification.
34. The inhibitory compound of claim 32 or 33, wherein the at least one modified nucleotides is selected from the group consisting of a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-Aty. Docket No. 40574-137 modified nucleotide, a 2’-hydroxly-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a morpholino nucleotide, a phosphoramidate, a tetrahydropyran modified nucleotide, a 1,5- anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, and a nucleotide comprising a 5'-phosphate mimic.
35. The inhibitory compound of any one of claims 5-34, comprising a molecule comprising a ligand.
36. The inhibitory compound of claim 35, wherein the ligand is conjugated to the 5’ end of the iRNA.
37. The inhibitory compound of claim 35, wherein the ligand is conjugated to the 3’ end of the iRNA.
38. A vector encoding the iRNA of any one of claims 5-34.
39. The vector of claim 38 wherein the vector is a virus vector or a plasmid.
40. A composition comprising the inhibitory compound of any one of claims 1-37 or the vector of claim 38 or 39.
41. The composition of claim 40, comprising a lipid formulation, polymer formulation or a sugar formulation.
42. The composition of claim 41, wherein the composition is a pharmaceutical composition.
43. The composition of any one of claims 40-42, comprising at least a second inhibitory compound selected from the group consisting of: a) an inhibitory compound that inhibits expression of CB1R gene, or a protein encoded thereby; and, b) an inhibitory compound that inhibits expression of MGLUR5 gene, or a protein encoded thereby.
44. The composition of any one of claims 40-43, comprising a cell-penetrating peptide (CPP) or a lipid.
45. The composition of claim 44, wherein the CPP is linked to the inhibitory compound.
46. The composition of claim 44, wherein the lipid forms a nanoparticle that encapsulates the inhibitory compound.Aty. Docket No. 40574-13747. A method of decreasing expression and / or function of Abhdl4b in a cell, comprising contacting the cell with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
48. A method of attenuating collagen biosynthesis, comprising contacting a collagen producing cell with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
49. A method of attenuating collagen biosynthesis in an individual, comprising administering the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46, to the individual.
50. A method of increasing carnitine biosynthesis in a cell, comprising contacting the cell with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
51. A method of increasing carnitine biosynthesis in an individual, comprising administering the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46, to the individual.
52. A method of attenuating an epithelial-mesenchymal transition in an epithelial cell, comprising contacting the epithelial cell with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
53. A method of attenuating senescence of an epithelial cell, comprising contacting the epithelial cell with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
54. The method of claim 52 or 53, wherein the epithelial cell is in an individual.
55. A method of reducing activation of a fibroblast, comprising contacting the fibroblast with the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
56. A method of decreasing the activation of fibroblasts in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
57. The method of claim 55 or 56, wherein the fibroblast is a lung fibroblast.Aty. Docket No. 40574-13758. A method of reducing inflammation and / or fibrosis in the lung of an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
59. A method of treating a fibrosing interstitial lung disease in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
60. The method of claim 59, wherein the fibrosing interstitial lung disease comprises idiopathic pulmonary fibrosis [IPF], Hermansky-Pudlak syndrome pulmonary fibrosis [HPSPF], chronic graft versus host disease (cGVHD) related interstitial lung disease, scleroderma related Interstitial lung disease [SSc-ILD], rheumatoid arthritis associated pulmonary fibrosis, usual interstitial pneumonia [UIP], bronchopulmonary dysplasia, respiratory bronchiolitis, hypersensitivity pneumonitis, radiation related pulmonary fibrosis, sarcoidosis, or SARS-CoV2 or variants related pulmonary diseases61. A method of treating a chronic obstructive lung disease (COPD) in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
62. The method of claim 61, wherein the chronic obstructive lung disease is selected from the group consisting of asthma, bronchiectasis, and chronic obstructive pulmonary disease (COPD).
63. A method of treating pulmonary vascular disease in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
64. The method of claim 63, wherein the pulmonary vascular disease is selected from the group consisting of primary pulmonary hypertension, pulmonary arterial hypertension [PAH], pulmonary venous hypertension, idiopathic pulmonary hypertension, precapillary pulmonary hypertension, alveolar-capillary dysplasia, sickle cell chronic lung disease, systemic lupus erythematosus related pulmonary fibrosis, pathogenic pulmonary fibrosis.
65. The method of any one of claim 58-64, wherein administration comprises contacting the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46, with the lung of the individual.Aty. Docket No. 40574-13766. The method of claim 65, wherein administration comprises inhalation of the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
67. A method for reducing fibrosis in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
68. The method of claim 67, wherein fibrosis comprises liver fibrosis.
69. The method of claim 68, wherein the liver fibrosis is a result of Schistosoma mansoni infection, cirrhosis, alcohol associated liver disease, primary sclerosing cholangitis [PSC], or MASH-associated liver fibrosis.
70. The method of claim 67 or 68, wherein the inhibitory compound comprises a ligand that targets the iRNA to the liver.
71. The method of claim 67, wherein fibrosis comprises kidney fibrosis.
72. The method of claim 71, wherein the kidney fibrosis comprises renal fibrosis, or nephrogenic systemic fibrosis.
73. The method of claim 72, wherein the kidney fibrosis is a result of chronic renal disease, chronic glomerulonephritis, polycystic kidney disease, chronic kidney disease, lupus nephritis, Alport syndrome, Berger’s disease, focal segmental glomerulosclerosis, sarcoidosis, or diabetic nephropathy.
74. The method of any one of claims 71-74, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to the kidney.
75. The method of claim 67, wherein fibrosis comprises cardiac fibrosis.
76. The method of claim 75, wherein the cardiac fibrosis comprises myocardial fibrosis or subendocardial fibrosis.
77. The method of claim 76, wherein the cardiac fibrosis is a result of cardiomyopathy, myocarditis, sarcoidosis, systemic lupus erythematosus, Marfan syndrome or ischemia related conditions including pre-ischemia and post-ischemia conditions such as congestive heart failure.
78. The method of any one of claims 75-77, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to the heart.
79. The method of claim 67, wherein fibrosis comprises corneal fibrosis.Aty. Docket No. 40574-13780. The method of 79, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to the cornea.
81. The method of claim 67, wherein fibrosis comprises uterine fibroids.
82. The method of 81, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to uterine smooth muscle cells.
83. The method of claim 67, wherein fibrosis comprises ovarian fibroids.
84. The method of 83, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to ovarian smooth muscle cells.
85. The method of claim 67, wherein fibrosis comprises stromal remodeling of the pancreas.
86. The method of 85, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to pancreatic tissue.
87. The method of claim 67, wherein fibrosis comprises intestinal fibrosis.
88. The method of 87, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to intestinal tissue.
89. The method of claim 67, where in fibrosis comprises dermal fibrosis.
90. The method of claim 89, where in the dermal fibrosis is a result of scleroderma, chronic graft-versus-host disease, morphea, hypertrophic scars, keloids, dermatomyositis, lipodermatosclerosis, eosinophilic fasciitis, Werner syndrome, Dupuytren contracture, Werner syndrome or Epidermolysis Bullosa dystrophica.
91. The method of 90, wherein the inhibitory compound comprises a ligand that targets the inhibitory compound to dermal tissue.
92. A method for treating cancer in an individual, comprising administering to the individual the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
93. The method of claim 92, wherein the cancer comprises lung cancer, lung adenocarcinoma, non-small cell lung cancer, small cell lung carcinoma, mesothelioma, squamous cell carcinoma, large cell carcinoma, liver cancer, kidney cancer, hepatocellular carcinoma, cholangiocarcinoma, pancreatic cancer, breast cancer, prostate cancer, endometrial cancer, bladder cancer, ovarian cancer, glioblastoma, skin squamous cell carcinoma, melanoma, desmoplastic melanoma, pancreatic ductal adenocarcinoma, esophageal squamous cell carcinoma, myelofibrosis, Hodgkin lymphoma, sclerosing epitheliod fibrosarcoma, sclerosing liposarcoma, or T-cell lymphoma.Aty. Docket No. 40574-13794. A kit comprising the inhibitory compound of any one of claims 1-37, the vector of claim 38 or 39, or the composition of any one of claims 40-46.
95. An inhibitory compound that inhibits the expression of a Cannabinoid receptor 1 (CB1R) gene, or the activity or a protein encoded thereby.
96. The inhibitory compound of claim 95, wherein the inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA).
97. The inhibitory compound of claim 95 or claim 96, wherein the iRNA comprises an antisense oligonucleotide (ASO), siRNA, a ribozyme or a miRNA.
98. The inhibitory compound of any one of claims 95-97, wherein the iRNA inhibits expression of the CB1R gene.
99. The inhibitory compound of any one of claims 95-98, wherein the inhibitory compound comprises an iRNA.
100. The inhibitory compound of claim 99, wherein the iRNA comprises a region of complementarity to a target sequence in a CB1R mRNA transcript.
101. The inhibitory compound of claim 100, wherein the target sequence comprises at least 12 contiguous nucleotides differing from no more than 4 nucleotides from the region of complementarity.
102. The inhibitory compound of claim 100 or 101, wherein the target sequence is between 12 and 30 nucleotides in length.
103. The inhibitory compound of any one of claims 100-102, wherein the CB1R mRNA transcript comprises SEQ ID NO:27.
104. The inhibitory compound of any one of claims 100-103, wherein the target sequence is in an untranslated region of the CB1R mRNA transcript.
105. The inhibitory compound of claim 104, wherein the target sequence comprises between 15 and 30 contiguous nucleotides from SEQ ID NO:28.
106. The inhibitory compound of claim 104, wherein the target sequence comprises between 12 and 19 contiguous nucleotides from a sequence comprising SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, or SEQ ID NO: 127.
107. The inhibitory compound of any one of claims 100-106, wherein the region of complementarity comprises between 12 and 30 contiguous nucleotides differing no more than 5Aty. Docket No. 40574-137 nucleotides from a sequence comprising SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, or SEQ ID NO: 128.
108. An inhibitory compound that inhibits the expression of an metabotropic glutamate receptor 5 (MGLUR5) gene, or the activity or a protein encoded thereby.
109. The inhibitory compound of claim 108, wherein the inhibitory compound comprises a small molecule, a protein, an antibody, or an inhibitory RNA (iRNA).
110. The inhibitory compound of claim 108 or claim 109, wherein the iRNA comprises an antisense oligonucleotide (ASO), siRNA, a ribozyme or a miRNA.
111. The inhibitory compound of any one of claims 108-110, wherein the iRNA inhibits expression of the MGLUR5 gene.
112. The inhibitory compound of any one of claims 108-111, wherein the inhibitory compound comprises an iRNA.
113. The inhibitory compound of claim 112, wherein the iRNA comprises a region of complementarity to a target sequence in an MGLUR5 mRNA transcript.
114. The inhibitory compound of claim 113, wherein the target sequence comprises at least 12 contiguous nucleotides differing from no more than 4 nucleotides from the region of complementarity.
115. The inhibitory compound of claim 113 or claim 114, wherein the target sequence is between 12 and 30 nucleotides in length.
116. The inhibitory compound of any one of claims 112-115, wherein the MGLUR5 mRNA transcript comprises SEQ ID NO:29.
117. The inhibitory compound of any one of claims 112-116, wherein the target sequence is in an untranslated region of the MGLUR5 mRNA transcript.
118. The inhibitory compound of claim 117, wherein the target sequence comprises between 15 and 30 contiguous nucleotides from SEQ ID NO:30.
119. The inhibitory compound of claim 113, wherein the target sequence comprises between 12 and 19 contiguous nucleotides from a sequence comprising SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO 35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:44, SEQ IDNO:47, SEQ IDNO:48, SEQ ID NO:51, SEQ IDNO:52, SEQ IDNO:79, SEQ IDNO:81, SEQ IDNO:83, SEQ IDNO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, or SEQ ID NO:99.Aty. Docket No. 40574-137120. The inhibitory compound of claim 113 or claim 119, wherein the region of complementarity comprises between 12 and 30 contiguous nucleotides differing no more than 5 nucleotides from a sequence comprising SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:49, SEQ IDNO:50, SEQ IDNO:53, SEQ ID NO:54, SEQ IDNO:80, SEQ IDNO:82, SEQ IDNO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, or SEQ ID NO: 100.
121. A method for treating an acute or chronic inflammatory or fibrotic disorders in a subject comprising administering to the subject an ABHD14B inhibitory compound, a CB1R inhibitory compound, and / or an MGLUR5 inhibitory compound.
122. The method according to claim 121, wherein the subject is administered an ABHD14B inhibitory compound.
123. The method according to claim 121, wherein the subject is administered a CB1R inhibitory compound.
124. The method according to claim 121, wherein the subject is administered an MGLUR5 inhibitory compound.
125. The method according to claim 121, wherein the subject is administered an ABHD14B inhibitory compound and a CB1R inhibitory compound.
126. The method according to claim 121, wherein the subject is administered an ABHD14B inhibitory compound and an MGLUR5 inhibitory compound.
127. The method according to claim 121, wherein the subject is administered a CB1R inhibitory compound and an MGLUR5 inhibitory compound.
128. The method according to claim 121, wherein the subject is administered an ABHD14B inhibitory compound, a CB1R inhibitory compound, and an MGLUR5 inhibitory compound.
Citation Information
Patent Citations
Functional and hyperfunctional sirna
WO2004045543A2