Kit for treating or alleviating traumatic brain injury comprising antibiotics used for normalization of pulmonary microbiome
Regulating the lung microbiome with neomycin addresses pulmonary complications and neuroinflammation in TBI by reducing microbial imbalance and inflammation, improving cognitive function and neurological outcomes.
Patent Information
- Application Number
- PCT/KR2025/014631
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-18
- Filing Date
- 2025-09-19
- Publication Date
- 2026-04-23
AI Technical Summary
Conventional treatments for traumatic brain injury (TBI) fail to effectively address pulmonary complications and neuroinflammation, leading to systemic damage and cognitive impairment, with the lung microbiome dynamics being overlooked as a therapeutic target.
Administering neomycin locally into the lungs to regulate the lung microbiome, thereby reducing microbial imbalance and inflammation, which in turn alleviates neuroinflammation and cognitive impairment.
Neomycin treatment significantly improves neuroinflammation and cognitive impairment, stabilizes the blood-brain barrier, and reduces systemic inflammation by modulating the lung microbiome, providing a novel therapeutic approach for TBI.
Smart Images

Figure 00000011_0000 
Figure 00000012_0000 
Figure 00000013_0000
Abstract
Description
A kit for treating or improving traumatic brain injury containing antibiotics used to normalize the lung microbiome
[0001] The present invention relates to a kit for treating or improving traumatic brain injury comprising an antibiotic used to normalize the lung microbiome, and a method for treating traumatic brain injury using the kit.
[0002] Traumatic brain injury (TBI) is a leading cause of mortality and disability that poses a significant socioeconomic burden worldwide. TBI is a complex condition that causes not only brain damage but also systemic damage, including respiratory, cardiovascular, gastrointestinal, renal, and endocrine complications. According to nationwide population-based studies, pneumonia and acute respiratory failure are the most common complications in patients following TBI. Accumulated evidence suggests that the interaction between the brain and the lungs, often referred to as the brain-lung axis, is likely a more fundamental mechanism for the deterioration of lung status following acute brain injury. Among the various interactions involving neuroanatomical, endocrine, immune, metabolite, and microbial pathways, the double-impact theory has been widely accepted as the proposed mechanism for the brain-lung axis in acute TBI. Immediately after brain injury, a catecholamine storm accompanied by a systemic inflammatory response increases pulmonary capillary permeability and vascular resistance, and enhances alveolar phagocytosis, leading to neurogenic pulmonary edema or ventilator-associated pneumonia (VAP). Pulmonary hemodynamic complications subsequently lead to cerebral hypoxia, which then increases intracranial pressure and exacerbates neurological outcomes. As with severe TBI, mild TBI can also induce acute pulmonary interstitial edema accompanied by alveolar changes and noticeable tumor necrosis factor (TNF)-α levels in the lungs six hours after injury. Based on these results, it is important to prevent pulmonary complications and effectively manage brain injury to achieve a favorable neurological prognosis.
[0003] With the advancement of omics technology, there are increasing attempts to understand the role of the microbiome in the pathogenesis of various brain diseases. Previous studies have demonstrated interactions between the gut microbiome and brain dysfunction through the microbiome-gut-brain axis or neuroendocrine-immune networks. Nevertheless, gut microbial imbalances caused by TBI cannot fully explain acute pulmonary complications. While lung and gut microbiomes change after TBI, it is unclear whether these are direct effects from TBI itself or indirect effects through the gut. Yang et al. observed that on day 7 after injury, the Chao 1 indices of Lachnoclostridium, Acinetobacter, Bacteroides, and Streptococcus in the gut microbiome increased, while the relative abundance of Acinetobacter in the lungs peaked and Chao 1 and Simpson indices were at high levels. Analysis of lung tissue microbial communities using SourceTracker suggested that 49.69% were potentially of gut origin, implying the possibility that gut bacteria were transferred to the lungs in TBI mice. TBI patients on mechanical ventilation also showed different characteristics in the bronchoalveolar lavage ("BAL") microbial community at admission or on day 7 after brain injury. However, unlike the animal studies mentioned above, changes in the gut microbial community by the enteral nutrition formula did not alter the lung microbial community structure in terms of abundance and uniformity without changes in the incidence of VAP.
[0004] The present invention aims to provide a method and kit for treating or improving traumatic brain injury that are more effective than conventional technology.
[0005] Unlike the gut microbiome, the lung microbiome exhibits a dynamic bidirectional microbial flow characterized by low biomass and limited nutrient availability. The lungs are a well-known organ where autoreactive T cells can reside in and mature within broncho-associated lymphoid tissues, altering their gene expression profiles to migrate to the central nervous system (CNS). In rodent models of autoimmune brain disease, dysregulation of the lung microbiome led to migration to lipopolysaccharide-rich "phyla," influencing CNS immune reactivity and increasing susceptibility to CNS autoimmune diseases. Interestingly, local treatment with neomycin, which targets lipopolysaccharide-producing lung phyla, reduced neuroinflammation and immune cell recruitment in the brain. These results reinforced our hypothesis to evaluate lung microbiome regulation as a therapeutic target for alleviating neuroinflammation and consequent cognitive impairment in patients with severe TBI, particularly in the early post-injury period.
[0006] To verify our hypothesis, we explored the potential neuroprotective effects of injecting local neomycin into the lungs of mice with traumatic brain injury (TBI) for the first time. First, we analyzed changes in the bronchoalveolar (BAL) microbiome, BAL / serum inflammatory chemokines, and lung tissue following TBI. Second, we investigated histopathological changes in the brain and cognitive impairment resulting from local neomycin injection. More specifically, adult male Sprague-Dawley rats were used in the study, and neomycin injections were administered over a period of three days. A total of 40 rats were randomly divided into four groups: normal, normal rats treated with neomycin, TBI rats, and TBI rats treated with neomycin (10 rats in each group). On day 3, lung microbiome composition and cytokine mRNA expression in bronchoalveolar lavage fluid (BAL) were evaluated. Subsequently, neuropathological changes, neuroinflammation, brain fluid content, inflammatory cytokine assessments, and cognitive tests were performed on day 7 post-injury. Serum levels of inflammatory cytokines (IL-1β, IL-6, IL-10) were measured sequentially.
[0007] As a result, TBI caused neutrophil infiltration in the alveoli along with interstitial edema in the lungs, and levels of Caspase-1, IL-1β, and RAGE decreased. TBI mice treated with neomycin showed a decrease in Acinetobacter levels in the BAL and a reduction in the α-diversity Shannon index compared to mice without neomycin. In the brain, FJB or TUNEL-positive cells, the Bcl-2 / Bax ratio, GFAP, and IBA-1 activation decreased after neomycin treatment, accompanied by reduced tight junction damage, synaptic damage proteins, and brain water content. TBI mice administered neomycin showed better discrimination indices for novel object recognition, suggesting an improvement in cognitive impairment. Serum inflammatory cytokines in traumatized mice tended to increase until day 7, but no increase was observed in TBI mice administered neomycin starting from day 3.
[0008] In conclusion, injecting neomycin into the lungs immediately after TBI effectively improved neuroinflammation and cognitive impairment through the regulation of the lung microbiome.
[0009] By using the method and kit of the present invention, traumatic brain injury and the resulting neuroinflammation and cognitive impairment, which are difficult to treat or improve, can be significantly improved in an easy manner, and additional brain damage can be alleviated.
[0010] Fig. 1. Changes in lung inflammatory response and lung microbial community composition following moderate traumatic brain injury (TBI). Fig. 1a: Description of the experimental design of the study and TBI induction. Fig. 1b: H&E staining and alveolar morphological changes in the lungs of TBI rats show increased neutrophil infiltration (arrows) and structural changes in alveoli (asterisks) compared to the control group. The scale bar is 200 μm. Lung microbial communities were compared using taxonomic composition (Fig. 1c), alpha diversity (Fig. 1d), PCoA2 plot (Fig. 1e), and LEfSe analysis between rats with and without TBI (Fig. 1f). LEfSe, linear discriminant effect size; LDA, linear discriminant analysis.
[0011] Fig. 2. Neomycin infusion alleviates TBI-induced lung inflammation through microbiome modulation. (Figs. 2a and 2b) Comparison of lung Western blots and mRNA expression in bronchoalveolar lavage fluid (BAL) following neomycin treatment after TBI. (Fig. 2c) Neutrophil infiltration (arrows) and alveolar structural changes (asterisks) were improved in neomycin-treated traumatic rats compared to rats not treated with neomycin. Scale bars are 200 μm. Changes in the lung microbiome after neomycin treatment are measured using taxonomic composition (Fig. 2d), alpha diversity (Fig. 2e), PCoA2 plot (Fig. 2f), and LEfSe analysis (Fig. 2g). LEfSe, linear discriminant analysis effect size; LDA, linear discriminant analysis. Error bars represent SEM. *P < 0.05(Normal vs. TBI), # P < 0.05(TBI vs. TBI with neomycin), ## P < 0.01(TBI vs. TBI with neomycin), #### P < 0.001(TBI vs. TBI with neomycin).
[0012] Fig. 3. Neuroprotective effects in traumatized mice after neomycin injection into the lungs. (Figs. 3a, 3b, 3c) Cortical damage was alleviated, brain water content decreased, and chemokine gene expression decreased following neomycin treatment after TBI. (Figs. 3d, 3e) The number of FJB and TUNEL-positive cells and the relative expression ratio of Bax / Bcl-2 decreased in neomycin-treated TBI mice. Scale bars are 50 μm. (Figs. 3f, 3g) Comparison of immunofluorescence and protein expression of GFAP and Iba-1 in the cortex. Scale bars are 50 μm. Error bars represent SEM. *P < 0.05(Normal vs. TBI), **P < 0.01(Normal vs. TBI), ***P < 0.005(Normal vs. TBI), # P<0.05(TBI vs. TBI with neomycin), ## P <0.01(TBI vs. TBI with neomycin), #### P<0.001(TBI vs. TBI with neomycin).
[0013] Fig. 4. Tight-junction proteins after neomycin injection into the lungs following traumatic brain injury
[0014] Changes and cognitive impairment. (Figs. 4a and 4b) Increased expression area of Occludin and ZO-1 in the damaged cortex and increased expression in Western blotting suggest improved tight junction integrity (scale bar = 50 μm). (Fig. 4c) PSD-95 and Synapsin-1 expression show an upward trend after neomycin treatment. (Figs. 4d and 4e) Cognitive impairment in traumatized rats improves after neomycin, showing a tendency for a significant increase in preference index scores and a decrease in escape latency time. Error bars represent SEM. *P < 0.05 (Normal vs. TBI), **P < 0.01 (Normal vs. TBI), #P<0.05 (Neomycin-administered TBI vs. TBI), #### P<0.001 (Neomycin-administered TBI vs. TBI).
[0015] Fig. 5. Interactional schematic summary of brain-lung axis modulation by local neomycin infusion after TBI. TBI induces pulmonary inflammation due to microbial imbalance, contributing to systemic inflammation and ultimately exacerbating neuroinflammation and cognitive impairment. Local neomycin infusion alters the pulmonary microbial community composition, thereby alleviating pulmonary / systemic inflammation and neuroinflammation, and improving BBB stability and cognitive impairment. Modifying the pulmonary microbial community immediately after TBI can be a novel therapeutic target for mitigating post-traumatic brain injury.
[0016] The composition of the present invention is explained in more detail below through the embodiments and results thereof. However, it is obvious to those skilled in the art that the scope of the present invention is not limited only to the description of the embodiments. In particular, although neomycin was used as an antibiotic to normalize the lung microbiome in the embodiments of the present invention, it is stated that the scope of the present invention is not limited by this.
[0017] In vivo modeling of traumatic brain injury
[0018] A severe in vivo TBI model was induced in adult male Sprague-Dawley rats weighing 280–400g (8–10 weeks) using a stereoscopic impactor (RWD-68099, RWD Life Science Co., Guangdong, China). After placing the rats in a stereoscopic frame under 3% isoflurane anesthesia, a 2mm blunt tip was applied at a speed of 3.5m / s and a retention time of 1.0m / s to target a parameter point on the scalp (M / L = -4.0mm, A / P = -2.8mm from the bregma, depth = 2.5mm). The groups were randomly divided into four groups: normal, normal with neomycin, TBI with neomycin, and TBI with neomycin (n = 10 per group). Neomycin (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was prepared by dissolving the powder in sterile phosphate-buffered saline (PBS) (Gibco; Thermo Fisher Scientific, USA) and administered intratracheally once daily at a daily dose of 3 mg / kg per rat (volume: 500 μl) for 3 days after TBI. The Sham group was treated with the same surgical procedure and the same dose of PBS infusion, except for body weight loss. Intratracheal treatment was well tolerated, and no respiratory distress was observed. Figure 1a describes the experimental procedure. Bronchoalveolar fluid (BALF) was collected under sterile conditions on the 3rd day after TBI. The lungs were inflated and deflated with 6 ml of PBS for 30 seconds. After the repeated procedure, a total of 8 ml of lavage fluid was recovered. The BALF was centrifuged at 2,000 rpm for 5 minutes at 4°C. The supernatant was discarded, and the pellet was flash-frozen in liquid nitrogen and stored at -80°C. Seven days after TBI induction, mice were anesthetized with 4% isoflurane (Piramal Critical Care, Bethlehem, PA, USA), and lung tissue and serum were collected. All animal experiments were performed in laboratories affiliated with the Institute of New Frontier Research.
[0019] Real-time reverse transcription PCR, Western blotting, and serum cytokine ELISA
[0020] Total RNA was extracted and isolated from mouse lung and brain tissues using easy-BLUE reagent (iNtRON Biotechnology, Seongnam, Korea). First-strand cDNA was synthesized using the Maxime RT PreMix Kit (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer's protocol. Real-time PCR was performed on Rotor-Gene Q using SYBR Green I as the double-stranded DNA-specific dye according to the manufacturer's instructions. PCR amplification consisted of 40 cycles of denaturation at 94°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. Relative expression was calculated as ddCt, and data were normalized to the β-actin mRNA expression of each sample. The primer sequences used for each gene are shown in Table 1. For immunoblot analysis, lung and brain tissues were lysed in RIPA buffer containing a protease inhibitor cocktail (GenDEPOT, Baker, TX, USA). Membranes were incubated overnight at 4°C with each primary antibody. Actin, Caspase-3, Cleaved Caspase-3, PSD-95, Synapsin-1 (Cell Signaling Technology, Danvers, MA, USA), GFAP (Abcam, Cambridge, MA, USA), Iba-1 (Wako Chemicals USA, Richmond, VA, USA), Ocludin, ZO-1, Bcl-2 (Thermo Fisher Scientific, USA), and Bax (Santa Cruz Biotechnology, Dallas, TX, USA). After washing the blots in TBS containing Tween-20, the blots were incubated with the horseradish peroxidase-conjugated secondary antibody corresponding to each primary antibody. Signal enhancement and detection were performed using ECL detectors (Thermo Fisher Scientific, USA). Quantification was calculated based on the optical density of specific proteins for β-actin.Mouse BAL IL-6, IL-1β, TNF-α, and IL-17 were measured in serum using an ELISA kit (R&D systems, Inc., MN, USA) according to the manufacturer's protocol.
[0021] GeneForward primerReverse primerIL-6TCCTACCCCAACTTCCAATGCTCTTGGATGGTCTTGGTCCTTAGCCTNF-αAAATGGGCTCCCTCTCATCAGTTTCCTGCTTGGTGGTTTGCTACGACIL-1bCACCTCTCAAGCAGAGCACAGGGGTTCCATGGTGAAGTCAACNos2GGAGAAGGGGACGAACTCAGTGCATTGGAAGTGAAGGCGTTTCCXCL9TGTGGAG TTCGAGGAACCCTTGCCTTGGCTGGTGCTGCXCL10AGAACGGTGCGCTGCACCCTATGGCCCTGGGTCTCACXCL11GCTGCTCTCTGCGAAGAAAGCAGCGCCCCCCTTTGAACATIFN-γCGGCACAGTCATTGAAAGCCTAGTTGCTGATGGCCTGATTGTCActinAAGTCCCTCACCCTCCCAAAAGAAGCAAATGCTGTCACCTTCCC
[0022] H&E staining and immunofluorescence staining
[0023] After harvesting brain and lung tissues, they were perfused through the heart with 4% paraformaldehyde, as in previous studies. The brain and lung tissues were post-fixed in paraformaldehyde for 48 hours and cryoprotected in 30% sucrose for 72 hours. The tissues were then embedded in an optimal cutting temperature compound and stored at -80°C until tubular sections were formed. Hematoxylin and eosin (H&E) staining was performed to assess the extent of cell and lung tissue damage following TBI. Each slice was attached to a saline-coated slide, rehydrated in distilled water, and then stained with H&E at room temperature. H&E staining was well visualized using an optical microscope (Nikon, Akishima, Tokyo, Japan). Brain tissue slides were hydrated in 100% ethanol for 3 minutes, 70% ethanol for 1 minute, and distilled water for 1 minute, and then incubated in 0.06% potassium permanganate at room temperature for 15 minutes. Then, the slides were stained in the dark with a 0.001% Fluoro-Jade B (FJB) solution (HistoChem Inc., Jefferson, AR, USA) for 30 minutes. After staining, the stained slides were washed three times for 1 minute each, and then dried with dibutyl phthalate polystyrene xylene (SigmaAldrich Co., Saint Louis, MO, USA) at room temperature for at least 10 minutes. Finally, the stained brain tissue was observed using a fluorescence microscope with a wavelength range of 450–490 nm (Carl Zeiss, Carl Zeiss-Straße, Oberkochen, Germany). For immunohistochemical staining, the frozen brain sections were hydrated in distilled water for 1 minute and immersed three times in 1 X PBS for 5 minutes each at room temperature. Endogenous peroxidase activity was removed by adding 3% H2O2 to 100% methanol, and epitopes were restored by boiling the tissue in 1 X TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).Tissues were blocked with 5% horse serum for 60 minutes and then incubated overnight at 4°C with primary antibodies GFAP (1:200, Abcam, Cambridge, MA, USA), IBA-1 (1:200, Wako Chemicals USA, Richmond, VA, USA), Occludin (1:50, Invitrogen, Carlsbad, CA, USA), and ZO-1 (1:50, Invitrogen, Carlsbad, CA, USA). Secondary antibodies, goat anti-rabbit Alexa flour 488 and 594 (Invitrogen, Carlsbad, CA, USA), were applied. Stained brain tissues were observed under a fluorescence microscope in the wavelength ranges of 450–490 nm and 594–590 nm (Carl Zeiss, Germany).
[0024] TUNEL analysis method and brain moisture content
[0025] Apoptotic cells in the hippocampus and cortex were evaluated on tissue slices permeable to 0.2% Triton X-100 (TX1061, Georgiachem, Nocross, GA, USA) using the DeadEnd Fluorometric TUNEL system (G3250, Promega, Madison, WI, USA) at room temperature for 5 minutes. TUNEL labeling was performed by incubating brain slices with a mixture of recombinant terminal deoxynucleotide transferase (rTdT) enzyme and equilibrium buffer at 37°C for 1 hour. For the negative control, the rTdT enzyme was replaced with autoclaved deionized water. The reaction was stopped by placing the slides in rTdT stop buffer for 15 minutes. The reacted tissue slices were counterstained with 1 μg / mL 4'6-diamidino-2-phenylindole (Thermo Fisher Scientific, USA) and then rinsed three times in PBS for 5 minutes each. Stained tissues were captured using a fluorescence scanning microscope (Carl Zeiss, Germany). The number of TUNEL-positive nuclei was determined using the Image J program (Image J, 1.49v, National Institutes of Health, Bethesda, MD, USA). Brain tissue samples were carefully collected after sacrificing the mice. The tissues were dried at 60°C. The measurement of brain water content, indicating cerebral edema, was performed using the following formula: % water content = 100 * (wet weight - dry weight) / wet weight.
[0026] cognitive function test
[0027] Cognitive impairment was assessed using Novel Object Recognition (NOR) and Morris Water Maze (MWM) tests. For NOR training, mice were acclimatized in an open field arena (size: 45×45×45 cm, length×width×height) for 5 minutes daily for 2 consecutive days. Then, the mice were placed in the same box containing two identical objects named A1 and A2 for 5 minutes daily for 5 days. Three days after TBI induction, the distance traveled within the box was analyzed while interacting with either the familiar object (A1) or the new object (C1) for 10 minutes. Preference for the objects was considered to be within 2 cm for the mice. Prior to brain injury, mice underwent a 2-minute MWM training test daily for 5 consecutive days to learn and remember the location of a hidden platform (diameter 8 cm, height 23.5 cm).
[0028] Experimental mice were immersed in a round pool (100 cm in diameter, 45 cm in depth) filled with water at a temperature of 21–23°C. On the 7th day after injury, MWM tests were performed on mice with TBI, and the time taken to find the platform was recorded and analyzed. All data were collected using a video tracking system and analyzed based on a heat map (Noldus Ethovision, Leesburg, VA, USA).
[0029] Lung microbiome analysis
[0030] DNA from BALF samples was extracted using the DNeasy® PowerSoil® Pro Kit (Qiagen, Germantown, MD, USA) according to the manufacturer's recommendations. The V3-V4 regions of the 16S rRNA gene were amplified using upstream primer 338 F (ACTCCTACGGGGAGCAG) and downstream primer 806 R (GGACTACHVGGGTWTCTAAT). The purified PCR products were sequenced on an Illumina MiSeq instrument (San Diego, CA, USA). Paired-end reads obtained from the MiSeq system were merged using FLASH software, and quality filtering of raw reads was performed using fqtrim (v0.94). DADA2 software and Vsearch (version 2.15.0) were used to infer amplicon sequence variant (ASV) clustering and to remove chimeric sequences, respectively. Taxonomy was assigned to representative sequences using the SILVA version 138 database.
[0031] Principal Coordinate Analysis (PCoA) for the Shannon Index and Bray-Curtis Discrepancy Index was calculated using QIIME2. Additionally, microbial communities were compared by performing Linear Discriminant Analysis Effect Size (LEfSe).
[0032] Statistical analysis
[0033] All statistical tests were performed using R version 4.1 and GraphPad Prism software (v.8.02; GraphPad Software Inc., San Diego, CA, USA). Data are described using the mean and the standard error of the mean (SEM). For pairwise comparisons, post-hoc tests using Student t-tests or one-way analysis of variance (ANOVA) are used. Significance levels <0.05, 0.01, 0.005, and 0.001 are defined as *, **, ***, and ****, respectively.
[0034] Result 1: Changes in the lungs according to microbiome composition induced by TBI
[0035] Experimental details are shown in Fig. 1a. Immediately after TBI, neomycin was administered intratracheally for three consecutive days. TBI induced morphological changes, interstitial edema, and alveolar thickening in the lungs, along with neutrophil infiltration (Fig. 1b). 16S rRNA sequencing of BAL fluid revealed that the dominant phyla in the control group were Firmicutes and Proteobacteria, and the dominant genus was Streptococcus. Three days after TBI, the relative abundance of Acinetobacter in BAL increased to 5.31%, which was significantly higher than that of the control group (Fig. 1c). The Shannon index of α-diversity, reflecting community diversity and abundance, showed an increasing trend in the TBI group (Fig. 1d). Microbial β-diversity, as seen in the PCoA2 plot, did not show a significant difference between the TBI group and the control group (Fig. 1e). However, LEfSe analysis at the genus level showed that Acinetobacter abundance was higher in the TBI group compared to the normal group (Fig. 1f, LDA score > 3, p < 0.05).
[0036] Result 2: Degree of Inflammation and Lung Microbiome Imbalance After Neomycin Infusion
[0037] TBI increased the expression of IL-6, IL-1β, HMGB1, and RAGE in the lungs, along with chemokine mRNA expression in BAL cells. Neomycin treatment reduced the expression of IL-6, IL-1β, HMGB1, and RAGE in the lungs and decreased mRNA expression of chemokine genes in BAL (Figs. 2a and 2b). Additionally, the degree of neutrophil infiltration and interstitial thickening improved (Fig. 2c). Acinetobacter, Staphylococcus, Pseudomonas, and Klebsiella species, which had increased after TBI, showed a decreasing trend after neomycin treatment (Fig. 2d). After neomycin injection, the α-diversity index decreased significantly, but microbial β-diversity did not decrease (Figs. 2e and 2f). According to LEfSe, the abundance of Acinetobacter in TBI supplemented with neomycin was significantly lower than in TBI administered alone (LDA score > 3, p < 0.05, Fig. 2g).
[0038] Result 3: Neuroprotective effect of damaged brain after neomycin treatment
[0039] Compared to the case of TBI alone, TBI mice that underwent neomycin injection showed reduced cortical tissue damage and brain edema (Figs. 3a and 3b). In addition, mRNA expression of chemokines involved in neuroinflammation was significantly reduced overall (Fig. 3c).
[0040] Topical neomycin inoculation treatment reduced the number of FJB and TUNEL-positive cells in the damaged area in terms of the relative expression ratio of Bax / Bcl-2 (Figs. 3d and 3e). Activation of astrocytes and microglia, indicated by GFAP and IBA-1 as confirmed by immunofluorescence staining and Western blot, was significantly reduced in TBI with neomycin compared to TBI without neomycin (Figs. 3f and 3g).
[0041] Result 4: Changes in tight-junction proteins and improvement in cognitive impairment
[0042] To indirectly assess BBB damage caused by TBI, we evaluated the tight-junction proteins Occludin and ZO-1. Neomycin-treated TBI showed enhanced protein expression compared to non-neomycin-treated TBI, with increased expression regions of Occludin and ZO-1, suggesting improved tight-junction integrity (Figs. 4a and 4b). Additionally, neomycin-treated TBI showed a tendency for increased PSD-95 and Synapsin-1 expression in the damaged cortex compared to the group treated only with TBI (Fig. 4c). Cognitive function tests were evaluated on day 7 after TBI. TBI indicates impairment in short-term cognitive memory, as the preference index score decreased in the NOR test. Neomycin treatment significantly improved the discrimination index score (Fig. 4d). Traumatized mice showed a significantly increased escape latency, which appeared to decrease after neomycin treatment (Fig. 4e).
[0043] Result 5: Continuous changes in serum inflammatory cytokines
[0044] We measured serum cytokines by ELISA to evaluate systemic inflammation following the infusion of neomycin into the lungs. Over time after TBI, serum cytokines on day 7 increased compared to day 3 (IL-6, 944 pg / ml on day 3 vs. 1633 pg / ml on day 7; TNFα, 100 pg / ml on day 3 vs. 200 pg / ml on day 7; IL-1β, 55 pg / ml on day 3 vs. 140 pg / ml on day 7). Interestingly, in TBI mice treated with neomycin, serum inflammatory cytokines did not increase further starting from day 3, unlike in TBI mice not treated with neomycin.
Claims
1. 1) Antibiotics used for the normalization of the lung microbiome; and 2) A kit for treating traumatic brain injury comprising instructions to use the above antibiotic by local inhalation into the lungs or administration into the trachea immediately after traumatic brain injury or within 72 hours.
2. In Claim 1, The above antibiotic is one or more selected from neomycin, penicillin, penicillin derivatives, azithromycin, erythromycin, clarithromycin, tetracycline, Ricavrio, or Lepamulin, in a kit. 3.1) Antibiotics used for the normalization of the lung microbiome; and 2) A kit for improving traumatic brain injury for reducing neuroinflammation, cerebral edema, and blood-brain barrier damage or improving cognitive function after traumatic brain injury, comprising: an instruction manual describing instructions to use the above antibiotic by local inhalation into the lungs or intratracheal administration within 72 hours immediately after traumatic brain injury.
4. In Claim 3, The above antibiotic is one or more selected from neomycin, penicillin, penicillin derivatives, azithromycin, erythromycin, clarithromycin, tetracycline, Ricavrio, or Lepamulin, in a kit.
5. In claim 1 or claim 3, The above antibiotic is neomycin, Kit.
6. A method of inhibiting the progression of traumatic brain injury by administering antibiotics locally inhaled or intratracheally into the lungs immediately after traumatic brain injury and within 72 hours.
7. In Claim 6, The above antibiotic is one or more selected from neomycin, penicillin, penicillin derivatives, azithromycin, erythromycin, clarithromycin, tetracycline, ricabrio, or lepamulin, in a method.
8. In Claim 6, The above antibiotic is neomycin, method.
9. In Claim 6, A method in which the above antibiotic local inhalation or intratracheal administration reduces pulmonary and systemic inflammatory responses to inhibit the progression of traumatic brain injury.