Molecular assay for detecting HIV-1 drug-resistant mutations

Abstract

The present disclosure is based on methods for determining susceptibility of a human immunodeficiency virus type-1 (HIV-1) to one or more drugs. The present disclosure is also based on methods of performing drug resistance testing in a subject with HIV-1 or suspected of or having an HIV-1 infection. The present disclosure also relates to primers useful in these methods, and kits and articles of manufacture comprising the primers.

Description

[0001] MOLECULAR ASSAY FOR DETECTING HIV-1 DRUG-RESISTANT MUTATIONS FIELD

[0002] The present disclosure is based on methods for determining susceptibility of a human immunodeficiency virus type-1 (HIV-1) to one or more drugs. The present disclosure is also based on methods of performing drug resistance testing in a subject with HIV-1 or suspected of or having an HIV-1 infection. The present disclosure also relates to primers useful in these methods, and kits and articles of manufacture comprising the primers.

[0003] BACKGROUND

[0004] The human immunodeficiency virus type-1 (HIV-1) is a lentivirus that causes HIV-1 infection and over time is the causative agent of Acquired Immunodeficiency Syndrome (AIDS). HIV-1 belongs to the retrovirus family of viruses.

[0005] HIV-1 is transmitted as single-stranded, positive-sense enveloped RNA virus (ssRNA). The primary target of HIV-1 is CD4+T cells, macrophages and dendritic cells. The HIV-1 virion enters into the target cell by the adsorption of glycoproteins on its surface to receptors on the target cell followed by fusion of the viral envelope with the cell membrane and release of the HIV-1 capsid into the cell. Upon entry into the target cell the nucleocapsid containing the viral genome dissociates, releasing the contents of the virus, including the ssRNA, into the cytoplasm. The viral RNA genome is reverse transcribed into double stranded DNA by a virally encoded reverse transcriptase (RT) enzyme. The resulting viral DNA is then imported into the cell nucleus and integrated into the cellular DNA by a virally encoded integrase.

[0006] Treatments for HIV-1 include administration of one or more drugs in the form of antiretroviral therapy (ART). Types of antiretrovirals include nucleoside reverse transcriptase inhibitors (NRTIs or 'nukes'), non-nucleoside reverse transcriptase inhibitors (NNRTIs or 'nonnukes'), protease inhibitors, integrase inhibitors and entry inhibitors. Patients having HIV are usually prescribed several different antiretrovirals at the same time — typically around 3 or more medicines from at least 2 of the antiretroviral classes. This is known as combination therapy. Occasionally, as a result of combination therapy drug-resistant HIV-1 is observed, which arises due to selection pressure resulting from combination therapy.

[0007] A number of studies have identified drug resistance mutations, which are mutations associated with suboptimal therapeutic efficacy for particular drugs. These mutations are located in the protease (PR), reverse transcriptase (RT), and integrase (IN) genes of HIV- 1. However, drug resistance assays are costly, and commercially available assays also require a minimum plasma viral load (pVL) in samples so that there is enough starting material to amplify and detect the relevant mutations. The new class of HIV-1 treatment, Long-Acting Antiretroviral Drug Lenacapavir, PF-07463216, and ABX464 targeting HIV-1 capsid (gag) inhibitor has only been developed recently (Marazzo et al. (2022)). The resistance mutation for this new class of drug has been published (Segal-Maurer et al (2022), Nka et al. (2022), and Dvory-Sobol et al (2022)). However, the studies were based on intensive HIV culture analysis in in vitro experiments and the HIV resistance analyses were based on laboratory in vitro resistance selection assays in MT -2 cells and human peripheral blood mononuclear cells, which identified Q67H and N74D as the major resistance-associated mutations and additional variants included L56I, M66I, K70N, N74S, A105T, and T107N (Nka et al. 2022). Currently none of the assays are developed for diagnostic application, based on analysis of patient samples, which should include detection on various HIV- 1 subtypes.

[0008] Further, constant monitoring for detection of drug resistance mutations and hence efficacy of on-going ART is challenging in many resource-limited settings, due to factors such as a limited healthcare budget impacting on the collection and wide availability of samples, as well as infrastructural challenges surrounding storage requirements. Dried blood spot (DBS) samples are of particular interest as DBS samples storage requirements do not require cold chain or rapid transportation to the laboratory. The simple methodology of collecting DBS samples also means that more junior healthcare staff can be allocated to sample collection. However, to date there are no drug resistance assays available that are sufficiently sensitive to conduct analysis of the entire capsid- protease- reverse transcriptase- integrase (CA-PR-RT-IN) region, given the limited amount of whole blood used on a DBS specimen paper (less than lOOul of whole blood).

[0009] Furthermore, the future of HIV-1 clinical management aims for a "functional cure," where patients would no longer require ART treatment. Therefore, identifying any potential hidden HIV-1 in reservoir cells is essential in future clinical patient management. Currently even with the most advanced Next Generation Sequencing (NGS) approach at the single cell level and advanced bioinformatic analysis power, the single cell approach with NGS analysis failed to identify HIV-1 drug resistance mutations from deeply silenced CD4+ T cells of the reservoir. Achieving an extremely sensitive HIV-1 Drug Resistance Assay is crucial in the future HIV Clinical field.

[0010] Accordingly, there is a need in the art for the development of more sensitive assays that can detect drug resistance mutations for a broad number of HIV-1 drugs. There is also a need for assays that enable detection of these mutations in samples having a low amount of starting DNA or RNA amounts, such as DBS samples.

[0011] Summary

[0012] The present disclosure is based on methods of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs. In particular, the present disclosure is based on the inventors seeking to identify a drug resistance assay that amplifies a region of the HIV-1 genome which captures drug resistance locations and can be applied across multiple HIV-1 subtypes. The present inventors have developed a novel HIV-1 Drug resistance assay based on long PCR analysis to detect HIV-1 Drug resistance mutations in the four classes of HIV-1 inhibitors available for treatment of HIV infected patients: i) capsid inhibitors, ii) protease inhibitors, iii) reverse transcriptase inhibitors, and iv) integrase strand transfer inhibitors.

[0013] The present inventors have identified two regions, or two tight structures in the gag region and pol region, where HIV RNA forms a highly sophisticated structure. These regions make amplification of HIV-1 RNA difficult (as detailed in Examples 13 and 14). The present inventors have very carefully assessed and designed the forward and the reverse primer binding sites to avoid these tight HIV RNA structures of “Tight Structure gag (TS-gag) and Tight Structure pol (TS-pol) and achieve the highest sensitivity and specifically including the last integrase drug resistant mutation R263K. These primers show improved alignment particularly at the 3' end of HIV-1 which allows amplification across all HIV-1 subtypes. Additionally, these primers show low primer-dimer formation properties.

[0014] Based on the inventors work, the present disclosure provides a method of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0015] The present disclosure also provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

[0016] In one example, the HIV-1 nucleic acid is HIV-1 DNA. For example, the HIV-1 DNA is integrated into the genome of a cell. The HIV-1 DNA may be isolated from a cell.

[0017] In one example, the HIV-1 nucleic acid is HIV-1 RNA. For example, the HIV-1 RNA may be isolated from a cell or may be cell-free RNA.

[0018] In one example, the HIV-1 nucleic acid is complementary DNA (cDNA). In one example, the cDNA is reverse transcribed RNA. In one example, the cDNA is reverse transcribed RNA from the reverse primer.

[0019] The present disclosure provides a method of detecting or diagnosing HIV-1 in a subject with HIV-1 or a subject suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting the HIV-1 DNA, wherein detecting the HIV-1 DNA is indicative of the presence of HIV- 1 in the subject.

[0020] The present disclosure also provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection, wherein the level of HIV- 1 is not detectable in a plasma viral load test using serum or plasma from the subject, the method comprising performing PCR amplification of a RNA encoded by a HIV-1, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

[0021] The disclosure additionally provides a method of detecting a subject with a latent HIV-1 infection, in which the virus is integrated into the genome of a reservoir cell and is producing HIV-1 transcripts, wherein the subject has an undetectable level of HIV-1 in plasma, as determined by a plasma viral load test, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting the HIV-1 DNA, wherein detecting the HIV-1 DNA is indicative of the presence of the latent HIV-1 infection in the subject.

[0022] The disclosure also provides a method of detecting a subject suffering from HIV-1 and receiving treatment for the HIV-1 who is unlikely to respond to the treatment, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting the HIV-1 DNA, wherein detecting the HIV-1 DNA is indicative of the presence of HIV- 1 in the subject.

[0023] The disclosure additionally provides a method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid.

[0024] The present disclosure also provides a method of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0025] The present disclosure also provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization after a first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

[0026] The disclosure additionally provides a method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid.

[0027] The disclosure additionally provides a method of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto and a reverse primer selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0028] The disclosure additionally provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto and a reverse primer selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

[0029] The disclosure additionally provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid isolated from a latent reservoir cell obtained from the subject, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

[0030] The disclosure additionally provides a method of assessing human immunodeficiency virus type 1 (HIV-1) viral reservoir activity in a reservoir cell obtained from a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of the HIV-1 nucleic acid, wherein detecting amplification of the HIV-1 nucleic acid indicates an increased HIV-1 viral reservoir activity, compared to a subject wherein amplification of the HIV-1 nucleic acid was not detected.

[0031] The disclosure additionally provides a method of assessing the risk of a subject having one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities, the subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of the HIV-1 nucleic acid, wherein detecting amplification of the HIV-1 nucleic acid indicates an increased risk of having the one or more HIV-1 co-morbidities, compared to a subject wherein amplification of the HIV-1 nucleic acid was not detected.

[0032] The disclosure additionally provides a method of diagnosing brain injury in a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of the HIV-1 nucleic acid, wherein detecting amplification of the HIV-1 nucleic acid indicates that the subject has brain injury.

[0033] The disclosure additionally provides a method of assessing the risk of a subject having one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities, the subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid indicative of susceptibility of the HIV to the one or more drugs, wherein detecting the one or more mutations in the HIV-1 nucleic acid indicates an increased risk of having the one or more HIV-1 comorbidities, compared to a subject wherein the one or more mutations in the HIV-1 nucleic acid was not detected.

[0034] The disclosure additionally provides a method of diagnosing brain injury in a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid indicative of susceptibility of the HIV to the one or more drugs, wherein detecting the one or more mutations in the HIV-1 nucleic acid indicates that the subject has a brain injury.

[0035] The disclosure additionally provides a method of assessing the risk of a subject having one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities, the subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid to assess the risk of the subject having the one or more HIV-1 co-morbidities.

[0036] In some examples, detecting the one or more mutations in the HIV-1 nucleic acid indicates an increased risk of the subject having the one or more HIV-1 co-morbidities, compared to a subject wherein the one or more mutations in the HIV-1 nucleic acid was not detected.

[0037] In some examples, detecting the one or more mutations in the HIV-1 nucleic acid indicates a decreased risk of the subject having the one or more HIV-1 co-morbidities, compared to a subject wherein the one or more mutations in the HIV-1 nucleic acid was not detected.

[0038] The disclosure additionally provides a method of diagnosing one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities in a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid indicates that the subject has one or more HIV-1 co-morbidities.

[0039] The disclosure additionally provides a method of diagnosing brain injury in a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid indicates that the subject has brain injury.

[0040] In some examples, the one or more mutations in the HIV-1 nucleic acid comprises a premature stop codon. In some examples, the one or more mutations in the HIV-1 nucleic acid comprises an Apolipoprotein B mRNA-editing catalytic polypeptide-like 3 (APOBEC3) mediated premature stop codon.

[0041] The disclosure additionally provides a method of assessing the risk of a subject having one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities, the subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising determining susceptibility of a HIV-1 to one or more drugs according to a method described herein, wherein detecting one or more mutations in the HIV-1 nucleic acid that is indicative of resistance of the HIV-1 to one or more drugs indicates an increased risk of having the one or more HIV-1 comorbidities, compared to a subject wherein the one or more mutations in the HIV-1 nucleic acid was not detected.

[0042] The disclosure additionally provides a method of diagnosing brain injury in a subject having HIV-1 or is suspected of or having an HIV-1 infection, the method comprising determining susceptibility of a HIV-1 to one or more drugs according to a method described herein, wherein detecting one or more mutations in the HIV-1 nucleic acid that is indicative of resistance of the HIV-1 to one or more drugs indicates that the subject has brain injury.

[0043] In some examples, detecting an APOBEC3 mediated premature stop codon indicates that the subject is suffering from vascular inflammation. In some examples, detecting an APOBEC3 mediated premature stop codon indicates that the subject is suffering from arterial inflammation. In some examples, detecting an APOBEC3 mediated premature stop codon indicates that the subject is suffering from aortic inflammation.

[0044] In some examples, detecting an APOBEC3 mediated premature stop codon indicates a reduced likelihood that the subj ect is suffering from brain injury, compared to a subj ect wherein an APOBEC3 mediated premature stop codon was not detected. In some examples, detecting an APOBEC3 mediated premature stop codon indicates a reduced likelihood that the subject is suffering from neuronal injury, compared to a subject wherein an APOBEC3 mediated premature stop codon was not detected.

[0045] In one example, the method detects the one or more mutations in a mRNA transcript of the HIV-1 genome. In one example, the mRNA transcript is cell-associated mRNA. In one example, the cell-associated mRNA is obtained from a latent reservoir cell. In one example, the cell -associated mRNA is obtained from a CD4+ T cell. The CD4+ T cells can be isolated with in vitro stimulation using the viral outgrowth assay, as described in Example 14, and / or they can be isolated from ex vivo samples without any stimulation, as described in Example 15.

[0046] In some examples, the one or more mutations is detected by next-generation sequencing. In some examples, the one or more mutations is detected by Sanger sequencing.

[0047] The PCR is performed with a forward primer that binds to a region after a first region forming the TS-gag structure, and a reverse primer that binds to a region before a second region forming a TS-pol structure. Exemplary primer binding regions are those that are conserved across multiple subtypes of HIV- 1.

[0048] In one example, the one or more mutations are located in one or more of the following regions of HIV-1: capsid, protease (PR), reverse transcriptase (RT) and integrase (IN) regions.

[0049] In one example, the one or more mutations are located in the capsid and protease (PR), reverse transcriptase (RT) and integrase (IN) regions of HIV- 1.

[0050] In one example, the one or more mutations are detected in HIV-1 RNA without preamplification of the RNA prior to the PCR amplification.

[0051] In one example, the PCR amplification is long-range PCR.

[0052] In one example, the one or more mutations are associated with resistance to one or more HIV-1 drugs.

[0053] In one example, the one or more mutations are indicative of resistance to one or more HIV-1 drugs.

[0054] In one example, the one or more mutations are associated with low-level, intermediate, or high-level resistance to one or more HIV-1 drugs.

[0055] In one example, the one or more mutations are indicative of low-level, intermediate, or high-level resistance to one or more HIV-1 drugs.

[0056] In one example, the one or more mutations in the HIV-1 nucleic acid result in one or more amino acid substitutions in the HIV-1 virion selected from:

[0057] (i) substitutions in the capsid region selected from one or more of: L56I, M66I, Q67H, K70N / R, N74D, A105E and T107N; (ii) substitutions in the protease region selected from one or more of: L10F / I / R / V, K20M / R, V32I, L33F / I / V, M46I / L, I50V / L, F53L, I54V / M, A71V / T, G73S / C / A, V82A / F / T / S, L76V, I84V, N88S / D and L90M;

[0058] (iii) substitutions in the reverse transcriptase region selected from one or more of: M41L, E44A, E44D, K65R, D67N, D67G, T69N, K70R, L74V, L74I, M184I, M184V, L210W, T215D, T215E, K219R, K219E, L100I, K101E / P / H, K103N / S, V106M / A, E138K / A / G / Q, Y181C / I / V, Y188L / C / H, G190A / E / S, P225H; and / or

[0059] (iv) substitutions in the integrase region selected from one or more of: H51Y, T66I / K, E92Q, G140S / A, Y143C / H / R, S147G, Q148H / K / R, N155H, and R263K.

[0060] In one example, the one or more amino acid substitutions comprise one or more of: (i) substitutions in the capsid region selected from one or more of: M66I, Q67H, K70N / R, N74D and A105E;

[0061] (ii) substitutions in the protease region selected from one or more of: M46I / L, I50V / L, I54V / M, V82A / F / T / S, L76V, I84V, N88S / D and L90M;

[0062] (iii) substitutions in the reverse transcriptase region selected from one or more of: D67N, D67G, T69N, L74V, M184I, M184V, L210W, L100I, K101E / P / H, K103N / S, V106M / A, Y181C / I / V, Y188L / C / H, G190A / E / S; and / or

[0063] (iv) substitutions in the integrase region selected from one or more of: E92Q, G140S / A, Y143C / H / R, Q148H / K / R, N155H, and R263K.

[0064] In one example, the one or more amino acid substitutions comprise one or more of: (i) substitutions in the capsid region selected from L56I and / or T107N;

[0065] (ii) substitutions in the protease region selected from one or more of: L10F / I / R / V, K20M / R, V32I, L33F / I / V, F53L, A71V / T, G73S / C / A,

[0066] (iii) substitutions in the reverse transcriptase region selected from one or more of: M41L, E44A, E44D, K65R, K70R, L74I, Y181C, T215D, T215E, K219R, K219E, E138K / A / G / Q, P225H, and / or

[0067] (iv) substitutions in the integrase region selected from H51Y and / or T66I / K.

[0068] In one example, the one or more amino acid substitutions comprise substitutions in the capsid region selected from one or more of: L56I, M66I, Q67H, K70N / R, N74D, A105E and T107N.

[0069] In one example, the one or more amino acid substitutions comprise substitutions in the protease region selected from one or more of: L10F / I / R / V, K20M / R, V32I, L33F / W, M46I / L, I50V / L, F53L, I54V / M, A71V / T, G73S / C / A, V82A / F / T / S, L76V, I84V, N88S / D and L90M.

[0070] In one example, the one or more amino acid substitutions comprise substitutions in the reverse transcriptase region selected from one or more of: M41L, E44A, E44D, K65R, D67N, D67G, T69N, K70R, L74V, L74I, L100I, K101E / P / H, K103N / S, V106M / A, E138K / A / G / Q, Y181C / I / V, M184I, M184V, Y188L / C / H, G190A / E / S, L210W, T215D, T215E, K219R, K219E and P225H. In one example, the one or more amino acid substitutions comprise substitutions in the integrase region selected from one or more of: H51Y, T66I / K, E92Q, G140S / A, Y143C / H / R, S147G, Q148H / K / R, N155H, and R263K.

[0071] In one example, the PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and a sequence having 80% identity thereto.

[0072] In one example, the PCR is performed with a forward primer comprising a sequence at least 80% identical or 90% identical to a forward primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising a sequence at least 80% or 90% identical to a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0073] In one example, the PCR is performed with a forward primer comprising a sequence having one or two or three substitutions compared to a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising a sequence having one or two or three substitutions compared to SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0074] In one example, the PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0075] In one example, the PCR amplification is performed with a forward primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.

[0076] In one example, the PCR amplification is performed with a reverse primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0077] In one example, the PCR amplification is performed with a forward primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0078] In one example, the PCR amplification is performed with:

[0079] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0080] (ii)A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0081] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0082] (iv)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0083] (v) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0084] (vi)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0085] (vii) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0086] (viii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0087] (ix)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0088] (x) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0089] (xi)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto; (xii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0090] (xiii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0091] (xiv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0092] (xv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0093] (xvi) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0094] (xvii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0095] (xviii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0096] (xix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0097] (xx) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0098] (xxi) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0099] (xxii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0100] (xxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto; (xxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0101] (xxv) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0102] (xxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0103] (xxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0104] (xxviii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0105] (xxix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0106] (xxx) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0107] (xxxi) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0108] (xxxii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0109] (xxxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0110] (xxxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0111] (xxxv) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto; (xxxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0112] (xxxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; or

[0113] (xxxviii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0114] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0115] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0116] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0117] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto.

[0118] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0119] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto.

[0120] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto. In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0121] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto.

[0122] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0123] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto.

[0124] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0125] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto.

[0126] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0127] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0128] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto.

[0129] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto.

[0130] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0131] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto.

[0132] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0133] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto.

[0134] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0135] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0136] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto.

[0137] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0138] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto. In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto.

[0139] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto.

[0140] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto.

[0141] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto.

[0142] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto.

[0143] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto.

[0144] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0145] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0146] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0147] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0148] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0149] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0150] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0151] In one example, the PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0152] In one example, the PCR amplification is performed with:

[0153] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0154] (ii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto; or

[0155] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto.

[0156] In one example, the PCR amplification is a nested PCR amplification which further comprises a second PCR amplification.

[0157] In one example, the second PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 14, and a sequence having 80% identity thereto.

[0158] In one example, the second PCR amplification is performed with a forward primer comprising a sequence at least 80% identical or 90% identical to a forward primer selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising a sequence at least 80% or 90% identical to a reverse primer selected from the group consisting of: SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 14.

[0159] In one example, the second PCR amplification is performed with a forward primer comprising a sequence having one or two or three substitutions compared to a forward primer selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising a sequence having one or two or three substitutions compared to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 14.

[0160] In one example, the second PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer selected from the group consisting of: SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 14.

[0161] In one example, the second PCR amplification is performed with a forward primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.

[0162] In one example, the second PCR amplification is performed with a reverse primer comprising or consisting of a sequence according to any one of: SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 14.

[0163] In one example, the second PCR amplification is performed with a forward primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8; and a reverse primer comprising or consisting of a sequence according to any one of: SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 14.

[0164] In one example, the second PCR amplification is performed with:

[0165] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0166] (ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0167] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0168] (iv)A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0169] (v) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto; (vi)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0170] (vii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0171] (viii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0172] (ix)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0173] (x) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0174] (xi)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto; or

[0175] (xii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0176] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0177] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0178] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0179] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto. In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0180] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto.

[0181] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0182] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0183] In one example, the second PCR amplification is performed with a forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0184] In one example, the second PCR amplification is performed with:

[0185] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0186] (ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; or

[0187] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

[0188] In one example, the subject is undergoing ART and experiencing virologic suppression. In one example, the HIV-1 nucleic acid is obtained from a biological sample isolated from the subject.

[0189] In one example, the HIV-1 nucleic acid is obtained from a CD4+ T cell isolated from the subject, or isolated from the subject’s plasma or serum.

[0190] In one example, the HIV-1 nucleic acid is obtained from a latent reservoir cell isolated from the subject. In one example, the latent reservoir cell is selected from one or more of: a CD4+ T cell, macrophage or monocyte.

[0191] In one example, the latent reservoir cell is a CD4+ T cell.

[0192] In one example, the isolated CD4+ T cells are activated with T cell activators.

[0193] In one example, the CD4+ T cell is activated with T cell activators prior to detecting amplification.

[0194] In one example, the T cell activators comprise one or more of: IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0195] In one example, the T cell activators comprise IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0196] In one example, the method additionally comprises detecting the amplified nucleic acid. In one example, a method described herein is performed using RNA.

[0197] In one example, a method described herein is performed using reverse transcribed complementary DNA (cDNA) produced from RNA. In one example, the cDNA is reverse transcribed RNA from the reverse primer.

[0198] In one example, a method described herein is performed with RNA from PBMCs, cerebrospinal fluid (CSF), dried blood spot or a tissue. In one example, a method described herein is performed with reverse transcribed DNA (cDNA) produced from RNA from PBMCs, cerebrospinal fluid (CSF), dried blood spot or a tissue.

[0199] In one example, the method further comprises obtaining a biological sample and preparing the HIV-1 nucleic acid or RNA encoded by a HIV-1 from the biological sample.

[0200] In one example, the biological sample comprises sputum, blood, urine, cerebrospinal fluid and cervical / vaginal swab.

[0201] In one example, the biological sample is a dried blood spot (DBS) sample.

[0202] The disclosure additionally provides a method of selecting a treatment for a subject suspected of or having HIV-1, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, detecting amplification of one or more mutations in the HIV-1 nucleic acid, determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations, and selecting one or more drugs to which the HIV-1 is susceptible to treat the subject.

[0203] The disclosure additionally provides a method of treating a subject suspected of or having HIV-1, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, detecting amplification of one or more mutations in the HIV-1 nucleic acid, determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations, and treating the subject with an effective amount of one or more drugs based on the determination of the susceptibility of the HIV-1 to the one or more drugs.

[0204] The disclosure additionally provides a method of monitoring HIV-1 therapy in a subject suspected of or having HIV-1, the method comprising:

[0205] performing a first PCR amplification of a HIV-1 nucleic acid,

[0206] detecting amplification of one or more mutations located in the pol and gag regions of the HIV-1 nucleic acid,

[0207] determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations,

[0208] selecting one or more drugs to which the HIV-1 is susceptible to treat the subject, administering the one or more selected drugs to the subject,

[0209] obtaining a second biological sample from the subject,

[0210] performing a second PCR amplification of a HIV-1 nucleic acid,

[0211] detecting amplification of one or more mutations located in the pol and gag regions of the HIV-1 nucleic acid,

[0212] determining the susceptibility of the HIV-1 to one or more drugs, and

[0213] comparing the susceptibility of the HIV-1 to one or more drugs in the first biological sample and the second biological sample, thereby monitoring the HIV-1 therapy in the subject, wherein the first and second PCR amplification is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto.

[0214] The disclosure additionally provides a method for assessing or predicting the effectiveness of anti-retroviral therapy (ART) administered to an HIV-1 positive subject, the method comprising: T1

[0215] (i) performing a method described herein to a subject that is presently receiving ART, e.g., to determine susceptibility of a HIV-1 to one or more drugs by detecting amplification of one or more mutations in the HIV-1 nucleic acid;

[0216] (ii) comparing the detection of amplification of the one or more mutations to an earlier timepoint after the same subject had already commenced ART; and

[0217] (iii) detecting any change in the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of one or more mutations in the HIV-1 nucleic acid;

[0218] wherein detecting a change in the susceptibility of the HIV-1 to one or more drugs from the earlier timepoint indicates that the subject is or is likely not receiving optimal / effective ART; or wherein detecting no change in the susceptibility of the HIV-1 to one or more drugs from the earlier timepoint indicates that the subject is receiving optimal / effective ART.

[0219] In one example, the method comprises providing a biological sample from the subject prior to the step of performing PCR amplification of a HIV-1 nucleic acid.

[0220] In one example, the one or more drugs are selected from one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor and an integrase strand transfer inhibitor.

[0221] In one example, the one or more drugs comprise a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor and an integrase strand transfer inhibitor.

[0222] In one example, the one or more drugs comprise a capsid inhibitor such as lenacapavir, PF-07463216, and ABX464; a protease inhibitor (PI) such as atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir; a nucleoside reverse transcriptase inhibitor (NRTI) such as abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine; non-nucleoside reverse transcriptase inhibitor (NNRTI) such as doravirine, efavirenz, etravirine, nevirapine and rilpivirine; and an integrase strand transfer inhibitor (INSTI) such as bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0223] In one example, the one or more drugs comprise a protease inhibitor (PI) selected from the group consisting of: atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir.

[0224] In one example, the one or more drugs comprise a nucleoside reverse transcriptase inhibitor (NRTI) selected from the group consisting of: abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine.

[0225] In one example, the one or more drugs comprise a non-nucleoside reverse transcriptase inhibitor (NNRTI) selected from the group consisting of: doravirine, efavirenz, etravirine, nevirapine and rilpivirine.

[0226] In one example, the one or more drugs comprise an integrase strand transfer inhibitor (INSTI) selected from the group consisting of: bictegravir, cabotegravir, dolutegravir and raltegravir. In one example, the one or more drugs are selected from one or more of: lenacapavir, PF-07463216, ABX464, atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir, tipranavir, abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate, zidovudine, doravirine, efavirenz, etravirine, nevirapine, rilpivirine, bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0227] In one example, the one or more drugs comprise lenacapavir.

[0228] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more capsid inhibitors based on the detection of one or more mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the capsid region selected from the group consisting of: L56I, M66I, Q67H, K70N / R, N74D, A105E and T107N.

[0229] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more capsid inhibitors based on the detection of one or more primary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the capsid region selected from the group consisting of: M66I, Q67H, K70N / R, N74D and A105E.

[0230] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more capsid inhibitors based on the detection of one or more secondary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the capsid region selected from L56I and / or T107N.

[0231] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more protease inhibitors (Pls) based on the detection of one or more mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the protease region selected from the group consisting of: L10F / I / R / V, K20M / R, V32I, L33F / I / V, M46I / L, I50V / L, F53L, I54V / M, A71V / T, G73S / C / A, V82A / F / T / S, L76V, I84V, N88S / D and L90M.

[0232] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more protease inhibitors (Pls) based on the detection of one or more primary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the protease region selected from the group consisting of: M46I / L, I50V / L, I54V / M, V82A / F / T / S, L76V, I84V, N88S / D and L90M.

[0233] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more protease inhibitors (Pls) based on the detection of one or more secondary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the protease region selected from the group consisting of: L10F / I / R / V, K20M / R, V32I, L33F / W, F53L, A71V / T and G73S / C / A.

[0234] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more nucleoside reverse transcriptase inhibitors (NRTIs) based on the detection of one or more mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: M41L, E44A, E44D, K65R, D67N, D67G, T69N, K70R, L74V, L74I, Y181C, M184I, M184V, L210W, T215D, T215E, K219R and K219E.

[0235] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more nucleoside reverse transcriptase inhibitors (NRTIs) based on the detection of one or more primary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: D67N, D67G, T69N, L74V, M184I, M184V and L210W.

[0236] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more nucleoside reverse transcriptase inhibitors (NRTIs) based on the detection of one or more secondary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: M41L, E44A, E44D, K65R, K70R, L74I, Y181C, T215D, T215E, K219R and K219E.

[0237] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more non-nucleoside reverse transcriptase inhibitors (NNRTIs) based on the detection of one or more mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: L100I, K101E / P / H, K103N / S, V106M / A, E138K / A / G / Q, Y181C / I / V, Y188L / C / H, G190A / E / S, and P225H. In one example, the method comprises determining the susceptibility of the HIV-1 to one or more non-nucleoside reverse transcriptase inhibitors (NNRTIs) based on the detection of one or more primary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: L100I, K101E / P / H, K103N / S, V106M / A, Y181C / I / V, Y188L / C / H and G190A / E / S.

[0238] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more non-nucleoside reverse transcriptase inhibitors (NNRTIs) based on the detection of one or more secondary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the reverse transcriptase region selected from the group consisting of: E138K / A / G / Q and P225H.

[0239] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more integrase strand transfer inhibitors (INSTIs) based on the detection of one or more mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the integrase region selected from the group consisting of: H51Y, T66I / K, E92Q, G140S / A, Y143C / H / R, S147G, Q148H / K / R, N155H, and R263K.

[0240] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more integrase strand transfer inhibitors (INSTIs) based on the detection of one or more primary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the integrase region selected from the group consisting of: E92Q, G140S / A, Y143C / H / R, Q148H / K / R, N155H, and R263K. In one example, the method comprises determining the susceptibility of the HIV-1 to one or more integrase strand transfer inhibitors (INSTIs) based on the detection of one or more secondary mutations in the HIV-1 nucleic acid, which result in one or more amino acid substitutions in the integrase region selected from the group consisting of: H51Y and T66I / K.

[0241] In one example, the method comprises determining the susceptibility of the HIV-1 to one or more integrase strand transfer inhibitors based on the detection of the R263K mutation in the integrase region.

[0242] In one example, the method comprises selecting one or more drugs to which the HIV-1 is susceptible to treat the subject.

[0243] In one example, the method comprises selecting a treatment to which the HIV-1 is susceptible and administering the selected treatment to the subject.

[0244] In one example, determining the susceptibility of the HIV-1 to one or more drugs comprises determining resistance of the HIV-1 to the one or more drugs.

[0245] In one example, the method comprises determining that the HIV-1 is or is likely resistant to the one or more drugs, and selecting a different treatment for the subject.

[0246] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a capsid inhibitor, and selecting one or more of: a protease inhibitor, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0247] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a protease inhibitor, and selecting one or more of: a capsid inhibitor, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0248] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a nucleoside reverse transcriptase inhibitor, and selecting one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0249] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a non-nucleoside reverse transcriptase inhibitor, and selecting one or more of: a capsid inhibitor, a protease inhibitor, a nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0250] In one example, the method comprises determining that the HIV-1 is or is likely resistant to an integrase strand transfer inhibitor, and selecting one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor, and a nucleoside reverse transcriptase inhibitor.

[0251] In one example, the method comprises treating the subject with an effective amount of a capsid inhibitor (CP) such as lenacapavir, PF-07463216, and ABX464, a protease inhibitor (PI) such as atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir; a nucleoside reverse transcriptase inhibitor (NRTI) such as abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine; a non-nucleoside reverse transcriptase inhibitor (NNRTI) such as doravirine, efavirenz, etravirine, nevirapine and rilpivirine; or an integrase strand transfer inhibitor (INSTI) such as bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0252] In one example, the method comprises treating the subject with an effective amount of a capsid inhibitor (CP) such as lenacapavir, PF-07463216, and ABX464.

[0253] In one example, the method comprises treating the subject with an effective amount of a protease inhibitor (PI) such as atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir.

[0254] In one example, the method comprises treating the subject with an effective amount of a nucleoside reverse transcriptase inhibitor (NRTI) such as abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine.

[0255] In one example, the method comprises treating the subject with an effective amount of a non-nucleoside reverse transcriptase inhibitor (NNRTI) such as doravirine, efavirenz, etravirine, nevirapine and rilpivirine.

[0256] In one example, the method comprises treating the subject with an effective amount of an integrase strand transfer inhibitor (INSTI) such as bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0257] In one example, the method comprises determining that the HIV-1 is or is likely resistant to the one or more drugs, and treating the subject with a different treatment.

[0258] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a capsid inhibitor, and treating the subject with one or more of: a protease inhibitor, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0259] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a protease inhibitor, and treating the subject with one or more of: a capsid inhibitor, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0260] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a nucleoside reverse transcriptase inhibitor, and treating the subject with one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor.

[0261] In one example, the method comprises determining that the HIV-1 is or is likely resistant to a non-nucleoside reverse transcriptase inhibitor, and treating the subject with one or more of: a capsid inhibitor, a protease inhibitor, a nucleoside reverse transcriptase inhibitor, and an integrase strand transfer inhibitor. In one example, the method comprises determining that the HIV-1 is or is likely resistant to an integrase strand transfer inhibitor, and treating the subject with one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor, and a nucleoside reverse transcriptase inhibitor.

[0262] In one example, detecting a change in the susceptibility of the HIV-1 to one or more drugs indicates that the HIV-1 is or is becoming resistant to the treatment.

[0263] In one example, detecting a change in the susceptibility of the HIV-1 to one or more drugs indicates that the HIV-1 is or is becoming resistant to the treatment, and the method further comprises administering a different treatment to the subject.

[0264] In one example, detecting a change in the susceptibility of the HIV-1 to one or more drugs comprises detecting amplification of the one or more mutations.

[0265] In one example, detecting a change in the susceptibility of the HIV-1 to one or more drugs comprises detecting amplification of one or more mutations associated with low-level, intermediate, or high-level resistance to one or more HIV-1 drugs.

[0266] In one example, the subject is immune compromised.

[0267] In some examples, the nucleic acid is DNA or RNA.

[0268] In some examples, the nucleic acid is DNA.

[0269] In some examples, the nucleic acid is RNA.

[0270] In one example, a method described herein is part of a multiplex assay. For example, the method may additionally detect another nucleic acid from HIV-1 or another infectious organism.

[0271] The present disclosure additionally provides a primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0272] The present disclosure additionally provides a primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0273] The present disclosure additionally provides a primer comprising a sequence at least 80% identical or 90% identical to a primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0274] The present disclosure additionally provides a primer comprising a sequence having one or two or three substitutions compared to a primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17.

[0275] The disclosure additionally provides an article of manufacture comprising a forward primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto and a reverse primer selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0276] The disclosure additionally provides an article of manufacture comprising a forward primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto; and a reverse primer comprising or consisting of a sequence according to any one of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0277] The disclosure additionally provides an article of manufacture comprising a forward primer comprising a sequence at least 80% identical or 90% identical to a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto; and a reverse primer comprising a sequence at least 80% or 90% identical to a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0278] The disclosure additionally provides an article of manufacture comprising a forward primer comprising a sequence having one or two or three substitutions compared to a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto; and a reverse primer comprising a sequence having one or two or three substitutions compared to a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0279] In one example, the article of manufacture, comprises:

[0280] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto; (ii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0281] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0282] (iv)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0283] (v) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0284] (vi)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0285] (vii) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0286] (viii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;

[0287] (ix)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0288] (x) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0289] (xi)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0290] (xii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0291] (xiii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto; (xiv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0292] (xv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0293] (xvi) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0294] (xvii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0295] (xviii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0296] (xix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0297] (xx) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0298] (xxi) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;

[0299] (xxii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0300] (xxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0301] (xxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;

[0302] (xxv) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto; (xxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0303] (xxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;

[0304] (xxviii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0305] (xxix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;

[0306] (xxx) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0307] (xxxi) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0308] (xxxii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0309] (xxxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0310] (xxxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0311] (xxxv) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0312] (xxxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0313] (xxxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; (xxxviii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0314] (xxxix) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0315] (xl)A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

[0316] In one example, the article of manufacture, comprises:

[0317] (i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0318] (ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0319] (iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;

[0320] (iv)A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0321] (v) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0322] (vi)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;

[0323] (vii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;

[0324] (viii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto; or

[0325] (ix)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto; (x) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;

[0326] (xi)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto; or

[0327] (xii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

[0328] The disclosure additionally provides a kit for use in a method described herein, the kit comprising a forward primer of the disclosure and a reverse primer of the disclosure.

[0329] The disclosure additionally provides a kit for use in a method described herein, the kit comprising a forward primer of the disclosure and a reverse primer of the disclosure, wherein:

[0330] (i) the forward primer comprises a sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and a sequence having 80% identity thereto; and

[0331] (ii) the reverse primer comprises a sequence selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

[0332] The disclosure additionally provides a kit comprising a first receptacle comprising a forward primer of the disclosure and a second receptacle comprising a reverse primer of the disclosure.

[0333] The disclosure additionally provides a kit comprising a first receptacle comprising a forward primer of the disclosure and a reverse primer of the disclosure.

[0334] In one example, the kit comprises instructions for use in a method described herein. Any example of the present disclosure relating to HIV will be understood to encompass HIV-1.

[0335] KEY TO SEQUENCE LISTING SEQ ID NO: Identity

[0336] 1 CAP -IN Forward primer 3

[0337] 2 CAP -IN Forward primer 3 -long

[0338] 3 CAP -IN Forward primer 4

[0339] 4 CAP -IN Forward primer 5

[0340] 5 CAP -IN Forward primer 6

[0341] 6 CAP -IN Forward primer 7

[0342] 7 CAP -IN Forward primer 8 SEQ ID NO: Identity

[0343] 8 CAP -IN Forward primer 21

[0344] 9 CAP -IN Reverse primer 6

[0345] 10 CAP -IN Reverse primer 7

[0346] 11 CAP -IN Reverse primer 8

[0347] 12 CAP -IN Reverse primer 11

[0348] 13 CAP -IN Reverse primer 17

[0349] 14 CAP -IN Reverse primer 18

[0350] 15 CAP -IN Reverse primer 41

[0351] 16 CAP -IN Reverse primer 42

[0352] 17 CAP -IN Reverse primer 43

[0353] 18 HIV-1 HXB2 sequence

[0354] 19 Cap-IN Rv51

[0355] 20 Cap-IN Rv52

[0356] 21 Cap-IN Rv53

[0357] 22 Gag-nef IstFW

[0358] 23 Gag-nef 1 st Rev

[0359] 24 Gag-IN IstFW

[0360] 25 Gag-IN 1st Rev

[0361] 26 Gag-nef IstFW No. 2

[0362] 27 LTR F

[0363] BRIEF DESCRIPTION OF THE DRAWINGS

[0364] Figure 1-1 is a graphical representation showing the arrangement of the HIV-1 genome and the forward and reverse primer hybridization regions for the HIV-1 resistance assay of the present disclosure to analyse mutations of different classes of HIV- 1 drug inhibitors.

[0365] Figure 1-2 illustrates the forward primer location and Reverse primer location of various primers of the disclosure in relation to the gag-pol mRNA reading.

[0366] Figure 1-3 illustrates the alignment analysis for the eight forward primers designed in the “Forward primer hybridization region”.

[0367] Figure 1-4 illustrates the alignment analysis for the eleven reverse primers designed in the “reverse primer hybridization region”. The Figure also illustrates that the last primary mutation site of R263K is amplified by these primer sets.

[0368] Figures 2-1 to 2-3 illustrate examples of the forward and reverse primer pairs (Sets) used in the present assay.

[0369] Figure 3 A is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by forward primer Cap-IN F3 and reverse primer Cap-IN Rvl 1 after the 1st RT-PCR. The analysis was performed with 1% Agarose E-Gel system (ThermoFisher). The relative size of the PCR amplified bands is indicated on the right side of the gel image.

[0370] Figure 3B is a copy of a photographic image showing results of gel electrophoresis after nested PCR amplification by forward primer Cap-IN F3 and reverse primer Cap-IN Rvl 1 for dried blood spot (DBS) and intracellular RNA samples where more specific PCR amplification is needed due to low HIV-1 RNA levels. RNA extracted from Dried Blood Spot (DBS, ID1738), and Cell-Associated (CA, ID1725), and plasma samples (ID1738, 1739, 1740, 1741). The analysis was performed with 1% Agarose E-Gel system (ThermoFisher). The relative size of the PCR amplified bands is indicated on the right side of the gel image.

[0371] Figure 4-1 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by one-step (1st) RT-PCR. Forward and reverse primers belonging to Set-24 to Set-30 were assessed on their ability to amplify 10 times diluted HIV-1 RNA. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0372] Figure 4-2 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by one-step (1st) RT-PCR. Forward and reverse primers belonging to Set-31 to Set-35 were assessed on their ability to amplify 10 times diluted HIV-1 RNA. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher). M is a PCR marker to confirm the size of the PCR bands.

[0373] Figure 4-3 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by one-step (1st) RT-PCR. Forward and reverse primers belonging to Set-36 to Set-39 were assessed on their ability to amplify 10 times diluted HIV-1 RNA. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher). M is a PCR marker to confirm the size of the PCR bands.

[0374] Figure 4-4 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 2ndnested RT-PCR. Undiluted PCR amplified HIV-1 DNA sample was used with set- 100, and a 50 times diluted PCR amplified HIV-1 DNA sample was used with set-101 and set-104. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher). Note: the positive control (PC) did not work in this experiment.

[0375] Figure 5-1 shows the output of the alignment analysis of “Cap-IN F3” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0376] Figure 5-2 shows the output of alignment analysis of “Cap-IN F3-long” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel. Figure 5-3 shows the output of alignment analysis of “Cap-IN F4” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0377] Figure 5-4 shows the output of alignment analysis of “Cap-IN F5” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0378] Figure 5-5 shows the output of alignment analysis of “Cap-IN F6” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0379] Figure 5-6 shows the output of alignment analysis of “Cap-IN F7” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0380] Figure 5-7 shows the output of alignment analysis of “Cap-IN F8” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0381] Figure 5-8 shows the output of alignment analysis of “Cap-IN F21” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0382] Figure 5-9 shows the output of alignment analysis of “Cap-IN F3 long” for all HIV-1 subtypes. The analysis indicates that the primer aligns particularly well at the 3' end of the HIV-1 sequences, as highlighted in the shaded box.

[0383] Figure 6-1 shows the output of alignment analysis of “Cap-IN Rv6” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0384] Figure 6-2 shows the output of alignment analysis of “Cap-IN Rv7” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0385] Figure 6-3 shows the output of alignment analysis of “Cap-IN Rv8” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3 -prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0386] Figure 6-4 shows the output of alignment analysis of “Cap-IN Rvll” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0387] Figure 6-5 shows the output of alignment analysis of “Cap-IN Rvl7” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel. Figure 6-6 shows the output of alignment analysis of “Cap-IN Rvl8” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0388] Figure 6-7 shows the output of alignment analysis of “Cap-IN Rv41” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0389] Figure 6-8 shows the output of alignment analysis of “Cap-IN Rv42” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0390] Figure 6-9 shows the output of alignment analysis of “Cap-IN Rv43” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0391] Figure 6-10 shows the output of alignment analysis of “Cap-IN Rv51” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0392] Figure 6-11 shows the output of alignment analysis of “Cap-IN Rv52” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0393] Figure 6-12 shows the output of alignment analysis of “Cap-IN Rv53” is shown on the top panel. The arrow indicates that Taq polymerase will extend from the 3-prime end of the primer. Analysis of possible self-primer dimer formation is shown in the lower panel.

[0394] Figure 6-13 shows the output of alignment analysis of “Cap-IN Rvll” for all HIV-1 subtypes. The analysis indicates that the primer aligns particularly well at the 3' end of the HIV-1 sequences, as highlighted in the shaded box. Note that the reverse primer alignment analysis is based on the reverse complement sequences.

[0395] Figure 7-1 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3” and “Cap-IN Rvll” (experiment Figure 3A).

[0396] Figure 7-2 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3” and “Cap-IN Rv8” (experiment Figure 3B).

[0397] Figure 7-3 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F4” and “Cap-IN Rvll” (Set-24, experiment Figure 4).

[0398] Figure 7-4 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F5” and “Cap-IN Rvll” (Set-25, experiment Figure 4).

[0399] Figure 7-5 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F6” and “Cap-IN Rvll” (Set-26, experiment Figure 4).

[0400] Figure 7-6 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F6” and “Cap-IN Rvl7” (Set-27, experiment Figure 4). Figure 7-7 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F6” and “Cap-IN Rvl8” (Set-28, experiment Figure 4).

[0401] Figure 7-8 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F6” and “Cap-IN Rv42” (Set-29, experiment Figure 4).

[0402] Figure 7-9 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F6” and “Cap-IN Rv42” (Set-30, experiment Figure 4-1).

[0403] Figure 7-10 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3 long” and “Cap-IN Rvll” (Set-31, experiment Figure 4-2).

[0404] Figure 7-11 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3 long” and “Cap-IN Rvl7” (Set-32, experiment Figure 4-2).

[0405] Figure 7-12 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3 long” and “Cap-IN Rvl8” (Set-33, experiment Figure 4-2).

[0406] Figure 7-13 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3 long” and “Cap-IN Rv42” (Set-34, experiment Figure 4-2).

[0407] Figure 7-14 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F3 long” and “Cap-IN Rv41” (Set-35, experiment Figure 4-2).

[0408] Figure 7-15 shows the output of analysis of possible hetero-primer dimer formation for “Cap-IN F4” and “Cap-IN Rv51” (Set-36, experiment Figure 4-3).

[0409] Figure 8 is a copy of photographic images showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-29 and the subsequent 2ndnested RT-PCR with Set-100. Undiluted PCR amplified HIV-1 DNA sample was used with Set-29, and a 10 times diluted PCR amplified HIV-1 DNA sample was used with Set-100. The positive control was 2 copy / pl and 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0410] Figure 9 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-26 and compared with prior art primer pairs “gag-nef outer” and “gag-IN outer”. 5 times diluted PCR amplified HIV-1 DNA sample was used for these experiments. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0411] Figure 10 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-26 and compared with prior art primer pair “gag-nef outer No. 2”. Undiluted PCR amplified HIV-1 DNA from 5 patient samples were used for these experiments. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0412] Figure 11 is a copy of photographic images showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-74 and compared with prior art primer pairs “gag-nef outer No. 2”, “gag-nef outer primer” and “gag-IN outer primer”. Undiluted PCR amplified HIV-1 DNA from 4 patient samples were used for these experiments. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0413] Figure 12 is a copy of photographic images showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-9 and Set-19. Undiluted PCR amplified HIV-1 RNA from 2 patient of ID1734 and ID1745 samples were used for the Set-19 experiments. The positive control was 2000 copy / pl HIV-1 plasmid control. Gradient PCR analysis was performed for the RNA ID1743 and ID1735 analysis, changing annealing temperature 51°C, 54°C, 59°C and 63°C as identified in the Figure. 100-time diluted RNA sample of ID1630 and DNA obtained from ID 1273 was used for the Set-9 experiment. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0414] Figure 13-1 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-31, Set-32 and Set-33. 10 times diluted PCR amplified HIV-1 DNA was used for these experiments. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0415] Figure 13-2 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-36, Set-37 and Set-38. 10 times diluted PCR amplified HIV-1 DNA was used for these experiments. The positive control was 20 copy / pl HIV-1 plasmid control. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0416] Figure 14 is a copy of a photographic image showing results of gel electrophoresis after RT-PCR amplification by the 1stRT-PCR with Set-29. L indicates the DNA ladder. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0417] Figure 15-1 to 15-3 are graphical representations of the standard analysis for the Protease (PR), Reverse Transcriptase (RT), Integrase (IN), and Capsid (CA) regions.

[0418] Figure 16 is a copy of photographic images showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-29. Certain samples were then subjected to a subsequent 2ndnested RT-PCR with Set-100. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0419] Figure 17 is a copy of a photographic image showing results of gel electrophoresis after PCR amplification by the 1stRT-PCR with Set-29. 2cp indicates 2 copies / pl and 20cp indicates 20 copies / pl HIV-1 plasmid control. 58°C, 62°C, 66°C indicate PCR annealing temperature. M indicates the DNA marker. The analysis was performed with 1% Agarose E-Gel system (Thermo-Fisher).

[0420] Figure 18 is a scatter plot graph showing the correlation between HIV-1 RNA transcript levels within CD4+ T cells after 7 days activation in vitro, along with RNA transcript levels as measured in ex vivo analysis. The present assay was able to identify patients with resistance mutations, as indicated in the graph and illustrated in Table 4 and Example 14. Light filled circles indicate patients without resistance mutations; dark filled circles indicate patients with resistance mutations; and light filled circles with asterisk * indicates patients which could not be determined by intracellular analysis.

[0421] Figure 19 is a graphic representation of the tight structure in the gag region of HIV- 1 (TS-gag). The TS-gag structure is estimated to lie between residue 503 and residue 784 of HIV-1 based on the HXB2 genome. The present forward primers hybridize to a region after the TS-gag structure, resulting in improved sensitivity and specificity of the present assay.

[0422] Figure 20 is a graphic representation of the tight structure in the pol region of HIV- 1 (TS-pol). The TS-pol structure is estimated to lie between residue 5112 and residue 5229 of HIV-1 based on the HXB2 genome. The present reverse primers hybridize to a region before the TS-gag structure, resulting in improved sensitivity and specificity of the present assay.

[0423] Figure 21 is a graphic representation showing the association between putatively APOBEC3 -induced premature stop codons (PSCs) and arterial inflammation. (A) A significant correlation was observed between PSC putatively mediated by APOBEC3 and the aortic PET signal (p = 0.013, Pearson correlation). The regression line is shown with the 95% confidence interval (CI) as a dotted line. (B) There was no significant association between PSC and carotid inflammation. Note: Aortic and carotid inflammation were measured with PET and expressed as Target to background ratio (TBR) where higher values represent greater inflammation. Identified DRMs within viral reservoirs are shown across ART classes.

[0424] Figure 22 illustrates bar and scatter plots showing detection of short HIV-1 RNA transcripts in CD4+T cells from individuals with suppressed plasma viral load. (A) Comparison of detectable plasma HIV-1 RNA and short HIV-1 RNA transcript levels. Plasma viral load was undetectable in the majority of participants (14.8% had detectable levels). In contrast, short HIV-1 RNA transcripts were detected in all 27 individuals. (B) Plasma HIV-1 RNA levels across the cohort. The dotted line indicates the assay’s limit of detection (LOD = 20 copies / mL). Samples below the LOD were plotted at 10 copies / mL using open circles to indicate censored values. (C) Short HIV-1 RNA transcript levels in isolated CD4+T cells, expressed as copies per 106CD4+T cells (median: 4,405 copies). The dotted line represents the LOD (2 copies / 106CD4+T cells22). Individuals labelled at the bottom of the chart, with short RNA transcript levels <500 copies / 106CD4+T cells, failed to amplify long RNA transcripts.

[0425] Figure 23 is a graphic representation showing the phylogenetic relationship and major drug resistance mutations (DRMs). (A) Approximate maximum-likelihood tree of consensus pol sequences from each sample, constructed using FastTree with HXB2 (GenBank: K03455) as the reference. Samples from the same patient — including additional CA-vRNA and VOA-vRNA samples collected at the same or later time points (18 or 24 months) — are grey labeled and underlined, with an asterisk (*) indicating the extra samples. (B) Prevalence of major DRMs in pol sequences without PSCs, color-coded by sample. The prevalence of sequences containing PSCs in pol is also shown. Figures 24-1 and 24-2 are graphic representation showing that hidden reservoir DRMs reflect current and historical ART use. Nine individuals with the Reservoir DRMs from long RNA transcripts are shown by drug class (PI, NNRTI, NRTI) at the Analysis Point. Each DRM is aligned with current or past ART regimens, indicating start / stop dates or ongoing treatment. A prevalence bar below each point shows the proportion of DRMs potentially selected by current or prior ART. Note: Only previous ART relevant to resistance is shown.

[0426] Figures 25-1 and 25-2 are bar and scatter plots showing dual Impact of HIV-1 RNA transcripts and HIV-1 translation on brain injury. (A) Association of FWM NAA levels in FWM with absence or presence of the Reservoir DRMs (individuals denoted in square are identical as in Figure 22C). (B) Relationship of short RNA transcripts with absence or presence of the Reservoir DRMs (C). CA HIV-1 Short RNA transcripts showed an inverse correlation with FWM NAA levels. (D). CA HIV-1 Short RNA transcripts showed an inverse correlation with PCC NAA levels. (E). Relationship of CA HIV-1 Short RNA transcripts and with caudate nucleus NAA levels. (F). Impact of APOBEC-Induced Stop Codons Associate with Loss of gag / pol protein in viral reservoir cells on brain injury. Six individuals failed to amplify the long RNA transcripts: “no transcripts= 100% inhibition, indicated as dots denoted in the square (4 dark grey and 1 light grey). Note: No NAA in FWM, PCC, caudate nucleus data were available for LAT014 which is the dark grey colored individual with limited levels of short transcripts in Figure 22.

[0427] DETAILED DESCRIPTION

[0428] General

[0429] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter.

[0430] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0431] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0432] Any example of the present disclosure herein shall be taken to apply mutatis mutandis to any other example of the disclosure unless specifically stated otherwise. Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0433] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0434] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0435] Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0436] Reference to the singular forms “a”, “an” and “the” is also understood to imply the inclusion of plural forms unless the context dictates otherwise.

[0437] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

[0438] Selected Definitions

[0439] The term “lentivirus” as used herein refers to a genus of viruses of the Retroviridae family. The genome comprises two copies of a positive sense ssRNA inside a conical capsid. Examples of lentiviruses include human (HIV), simian (SIV) and feline (FIV).

[0440] The term “HIV” or “human immunodeficiency virus” as used herein refers to HIV-1 or HIV-2 including the various subtypes. The subtypes of HIV-1 include A, B (the most dominant form), C, D, E, F, G, H, J and K. HIV-1 is now classified into groups (e.g. HIV-1 M, N, O and P group) corresponding to phylogenetically associated groups or clades.

[0441] The term “tight structure” as used herein in relation to RNA refers to a tight RNA structure determined by the present inventors through extensive experimentation to interfere with PCR amplification.

[0442] The term “tight structure in the gag region” or “TS-gag” as used herein refers to a tight structure in HIV-1 first identified by the present inventors that has been found to interfere with PCR amplification when the forward primer hybridizes within or before this region.

[0443] The term “tight structure in the pol region” or “TS-pol” as used herein refers to a tight structure in HIV-1 first identified by the present inventors that has been found to interfere with PCR amplification when the reverse primer hybridizes within or after this region.

[0444] The term “before” (i.e., upstream) as used herein in relation to a nucleic acid, or a region on a nucleic acid, refers to a nucleic acid position or region having a lower number than the nucleic acid position being compared to. For example, a nucleic acid residue corresponding to position 1 based on the HIV-1 HXB2 genome is “before” a nucleic acid residue corresponding to position 5 based on the HIV-1 HXB2 genome. In another example, a region on a nucleic acid starting at nucleic acid residue corresponding to position 1 and ending at nucleic acid residue corresponding to position 5 is “before” a region on a nucleic acid starting at nucleic acid residue corresponding to position 10 and ending at nucleic acid residue corresponding to position 15.

[0445] The term “after” (i.e., downstream) as used herein in relation to a nucleic acid, or a region on a nucleic acid, refers to a nucleic acid position or region having a higher number than the nucleic acid position being compared to. For example, a nucleic acid residue corresponding to position 5 based on the HIV-1 HXB2 genome is “after” a nucleic acid residue corresponding to position 1 based on the HIV-1 HXB2 genome. In another example, a region on a nucleic acid starting at nucleic acid residue corresponding to position 10 and ending at nucleic acid residue corresponding to position 15 is “after” a region on a nucleic acid starting at nucleic acid residue corresponding to position 1 and ending at nucleic acid residue corresponding to position 5.

[0446] The term “before” or “after” as used herein in relation to a region on a nucleic acid, may also be used without an upper or lower boundary. For example, a region starting at the residue corresponding to 5112 of the HIV-1 HXB2 genome. However, the skilled person would understand that the HIV-1 genome being referred to has a finite number of nucleic acid residues. Thus, in the example above the region being referred to would start at the residue corresponding to 5112 of the HIV-1 HXB2 genome, and end at the last residue in the HIV-1 HXB2 genome.

[0447] The term “identity" and grammatical variations thereof, mean that two or more referenced entities are the same. Thus, where two nucleic acid sequences are identical, they have the same polynucleotide sequence, at least within the referenced region or portion. The identity can be over a defined area (region or domain) of the sequence. The % identity of a polynucleotide is determined by GAP (Needleman and Wunsch, J. Mol Biol. 48: 444-453.1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. Unless stated otherwise, the query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 100 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 100 nucleotides. Most preferably, the two sequences are aligned over their entire length.

[0448] The term “a sequence corresponding thereto” as used herein refers to a similar or equivalent sequence from a different strain or genome of HIV-1. In some examples, the nucleic acid residue positions are made in reference to that of the HIV-1 HXB2 strain, represented by the sequence according to SEQ IDNO: 18, or that of GENBANK accession number K03455.1. A sequence corresponding to the HIV-1 HXB2 strain may be a sequence from a different strain of HIV-1, such NL4-3. The skilled person would readily be able to identify the appropriate residue in the corresponding sequence based on published information regarding the gene start and stop positions, and using sequence alignment tools that are known in the art.

[0449] The term “next generation sequencing” or “next-generation sequencing” as used herein refers to a method of sequencing DNA or RNA by performing many parallel reads at once. Next generation sequencing enables high-throughput sequencing of entire genomes, or certain amplified nucleic acid products such as those described herein. Types of next generation sequencing include Nanopore, Ion Torrent (semiconductor sequencing) and Illumina / Solexa. In some examples, the next generation sequencing is nanopore sequencing.

[0450] The term “viral load or VL” as used herein is intended to refer to a measure of the number of viral particles (i.e. HIV-1) present in an organism, typically the number of viral particles per volume of plasma.

[0451] The term “susceptibility of a HIV-1 to one or more drugs” as used herein refers to the likely efficacy of the one or more drugs in controlling or treating the HIV-1 infection. Susceptibility of the HIV-1 to one or more drugs can be affected by mutations (HIV-1 variants). Certain mutations have been shown to reduce the susceptibility of the HIV-1 to one or more drugs.

[0452] The term “resistant” or “resistance” as used herein in relation to one or more drugs for treating HIV-1, refers to a reduced or significantly impaired ability of the one or more drugs to control or treat the HIV-1 infection. The term “drug resistance mutation(s)” as used herein refers to mutations in the HIV-1 genome that have been associated with suboptimal patient response to particular HIV-1 drugs, indicating that these mutations grant a level of resistance of the HIV-1 to these particular HIV-1 drugs. The term “primary mutations” or “major mutations” refer to mutations which have a direct impact on the effectiveness of certain HIV-1 drugs.

[0453] The term “secondary mutations” or “minor mutations” refer to mutations which when present alone do not cause significant resistance, but can enhance resistance when combined with primary mutations.

[0454] In the present description, mutations may be indicated as, e.g., “V82A / F / T / S”. This nomenclature indicates that the mutation may comprise V82A, V82F, V82T and V82S mutations.

[0455] The term “anti-retroviral therapy” or “ART” as used herein refers to treatment of an HIV-1 positive subject with typically a combination of several anti-viral medicines which are used to slow the rate at which HIV-1 multiplies in the body.

[0456] The term “optimal / effective ART” as used herein refers to subjects which have a suppressed plasma viral load (pVL) for greater than 6 months. By “suppressed viral load” it is meant under limit of detection according to pVL.

[0457] The term “primer” as used herein refers to an oligonucleotide which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand (template) is induced.

[0458] The term “sub-optimal / sub-effective ART” as used herein refers to subjects who have experienced at least one blip (BL) or who have virologic failure (VF). A blip refers to a transient viral increase where the viral load rises to between 50 and 100 copies / ml (or about <200 copies / mL). Sub-optimal ART subjects are those that exhibit frequent or persistent increases in viral load over a 6-month period, rather than isolated blips. Virologic failure is defined as persistent viral load above 200 copies / mL, despite ART.

[0459] The term “RNA” as used herein is also intended to include mRNA.

[0460] As used herein, the terms "treat", "treating", "treatment" and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject. Since every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population. Accordingly, a given subject or subject population may fail to respond or respond inadequately to treatment.

[0461] As used herein, the term “brain injury” refers to damage to brain cells, which can include neurons. When injury occurs to neurons, this is referred to as “neuronal injury”. Brain injury can occur in different parts of the brain, such as the frontal lobe, cortex, caudate nucleus or the posterior cingulate cortex, amongst others. Methods of assessing brain injury are known to the person skilled in the art. In one example, brain injury is indicated by the presence of one or more brain injury markers. For example, brain injury may be assessed by proton magnetic resonance spectroscopy ('H-MR. S). In one example, the brain injury is a white matter injury as determined by 'H MRS. In one example, brain injury is indicated by medical imaging. For example, brain injury may be assessed by magnetic resonance imaging (MRI) such as 'H MRI or proton magnetic resonance imaging, or computed tomography (CT). In one example, the brain injury is a white matter injury as determined by MRI imaging. In one example, the brain injury is a white matter injury as determined by1H MRI imaging.

[0462] As used herein, the term “inflammation” refers to the body’s biological response to harmful stimuli such as pathogens or damaged cells. This could refer to inflammation in the context of blood vessels, or the vasculature, e.g., “vascular inflammation”. Methods of assessing inflammation in the vasculature are known to the person skilled in the art. In one example, inflammation is indicated by the presence of one or more inflammatory markers. In one example, inflammation is indicated by medical imaging. For example, vascular inflammation may be assessed by positron emission tomography (PET) imaging using radioactive tracers such as 18F-fluorodeoxy glucose (FDG-PET) to detect and quantify inflammation in blood vessels like the aorta, carotid, and coronary arteries. The medical imaging may comprise PET imaging alone, or in combination with computed tomography (CT) (PET / CT) or magnetic resonance (MR) (PET / MR) imaging. In one example, the cardiovascular inflammation is aortic inflammation as determined by PET imaging.

[0463] The term “binds to” means that the oligonucleotide reacts or associates more frequently, more rapidly, with greater duration and / or with greater affinity with a particular nucleic acid sequence that it does with alternative nucleic acid sequences.

[0464] The term “hybridises” as used herein refers to the formation of a double stranded nucleic acid from complementary single stranded nucleic acids. The hybridisation may occur between two nucleic acid stands perfectly matched or substantially matched with some mismatches. The complementarity for hybridisation may depend on hybridisation conditions, particularly temperature. The detailed conditions for hybridisation can be found in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY (2001) and MLM Anderson, Nucleic acid hybridisation, Springer-Verlag, New York, NY (1999).

[0465] The term “PBMC” as used herein is intended to refer to any peripheral blood cell having a round nucleus such as T cells, B Cells, NK cells and monocytes. PBMCs also contain progenitor cells. They are typically separated from whole blood using Ficoll or Ficoll-Paque.

[0466] Susceptibility of HIV- 1 to one or more drugs

[0467] Most HIV- 1 infected patients are receiving antiretroviral therapy (ART). ART treatment is able to significantly and rapidly reduce plasma viral load (pVL) (HIV-1 RNA copy number in plasma) to levels below the limit of detection. ART treatment has markedly improved both morbidity and mortality associated with HIV-1 infection. However, widespread use of antiretroviral drugs has resulted in the emergence of drug-resistant HIV-1. It is typically recommended that HIV-1 drug resistance assays are used in determining initial ART, as administering HIV-1 drugs to a patient having resistance mutations to those drugs would lead to suboptimal ART. Further, it is important to monitor for HIV-1 drug resistance genes after ART has commenced, for example in the event of virologic failure. Resistance assays are important tools to inform treatment decisions for patients who experience virologic failure while on ART. Several prospective studies have noted that drug resistance testing to guide drug selection in patients who experience virologic failure produced better, early virologic response to salvage regimens than regimen changes guided only by clinical judgment. Further, monitoring for drug resistance genes should be used to inform and optimize on-going ART, for example switching individual or multiple drugs in a regimen is sometimes considered for patients with suppressed viral load to simplify a regimen, avoid drug interactions or toxicity, or for other reasons.

[0468] Of particular interest is the new class of HIV- 1 treatments, Long- Acting Antiretroviral Drug Lenacapavir, PF-07463216, and ABX464 targeting HIV-1 capsid (gag), which has recently become available for patients. At present there is no commercial based or researchbased HIV-1 drug resistance assay for diagnostic labs to assess HIV-1 drug mutations for this new drug.

[0469] The target of the new drug is in the Capsid region of HIV-1. The Capsid region in HIV- 1 genome is distant from the current conventional drug resistance assays which are focused on the PR / RT / IN region. The general expectation in the HIV-1 clinical field and HIV-1 research field is, most likely, to achieve a new drug resistance assay for Capsid region by developing a specific PCR based assay targeting only the Capsid region. The drugs resistance assay for PR / RT / IN region would be done separately, using the current established method, which in most genotypic assays involves conventional Sanger sequencing of the reverse transcriptase (RT), protease (PR), and integrase (IN) genes of circulating RNA in plasma to detect mutations that are known to confer drug resistance. However, this would increase costs and time of the analysis for a complete HIV-1 drug resistance analysis.

[0470] Additionally, while long PCR is an alternative to the above, to achieve consistent success for long PCR analysis of around 5000bp for HIV-1 samples is complex and difficult, due to the huge genetic diversity across HIV-1 subtypes, which have highly varied sequences. Thus, there is significant difficulty for researchers to amplify HIV-1 sequences across all subtypes with only one assay.

[0471] The methods of determining susceptibility of a HIV-1 to one or more drugs described herein are based on the identification of the two tight structures TS-gag and TS-pol lying within the gag and pol region of HIV-1 respectively. Through extensive experimentation, the inventors discovered that these regions interfere with PCR amplification, and carefully designed primers with these structures in mind. The inventors through further testing were able to develop primers that also had desirable properties, including the ability to conduct PCR amplification across all HIV-1 subtypes with high specificity and sensitivity. These primers also exhibited low primer-dimer formation, and good alignment to all subtypes of HIV-1.

[0472] Tight structures in HIV-1

[0473] The HIV-1 genome is primarily a coding RNA and contains nine open reading frames which produce 15 proteins. The Gag polyprotein precursor is proteolytically processed to generate the matrix (MA), capsid (CA), nucleocapsid (NC), and p6 proteins. The Gag-Pol polyprotein adds protease (PR), reverse transcriptase (RT), and integrase (IN). The env gene encodes a 30 amino acid signal peptide (SP), gpl20 and gp41. Additional sequences encode auxiliary proteins.

[0474] Studies have previously shown that the RNA structure of HIV- 1 has many structures and motifs that are important for roles such as HIV packaging, transcription and interaction with viral and host proteins. Many regulatory structures are present in HIV-1 precisely controlling HIV-1 gene expression and replication.

[0475] The inventors have conducted extensive experimentation to identify two specific tight structures in the pol and gag regions of HIV- 1: the tight structure gag (TS-gag) and the tight structure pol (TS-pol). This approach involves isolating HIV-1 DNA or synthesizing long cDNA that is reverse transcribed from a specific reverse primer hybridized to HIV-1 RNA, obtained from plasma and / or viral reservoir cells, followed by long DNA PCR amplification. The inventors use the specific reverse primers, described in the invention, to achieve highly sensitive amplification of the long DNA PCR. The method employs a one-step RT-PCR analysis that covers the HIV-1 CA-PR-RT-IN regions within a single reaction tube. To date, there are no published reports of such a one-step RT-PCR method, nor is there any disclosure which identifies the two tight structures, TS-gag and TS-pol, in HIV-1.

[0476] While the exact physical nature of these tight structures have not been verified, it has been shown previously that lower-order and higher-order structures are present in HIV-1 RNA and function as regulatory structures. Higher-order structures arise in HIV-1 when the RNA folds back onto itself, which can interfere with PCR amplification. Alternatively, it is possible that the sequence content within the tight structure regions determined by the present inventors is not suitable for sensitive PCR amplification. Regardless of the underlying cause for failure of amplification within these tight structure regions, this is the first time that these regions have been identified in HIV-1. Utilising the knowledge that these tight structures interfere with PCR amplification, the present inventors have carefully designed and extensively tested primers to arrive at the present set; comprising a forward primer that binds after the TS-gag structure, and a reverse primer that binds before the TS-pol structure. TS-gag

[0477] Through the testing of many forward and reverse primer pairs, the inventors have identified a first region forming a tight structure in the gag region of HIV- 1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto. Based on the experimental data shown in Example 13, and Figure 12 of the present disclosure, the 3' end of the TS-gag structure is estimated to be at the residue corresponding to position 784 of the HIV-1 HXB2 genome, as shown in Figure 19. Thus, the forward primers of the present invention hybridize after the residue corresponding to position 785 of the HIV-1 HXB2 genome. The Taq polymerase is then able to extend the DNA from the 3' end of the forward primer. The starting position of the TS-gag structure is estimated to be around the residue corresponding to position 503 of the HIV-1 HXB2 genome, which is based on the primer hybridization region of the LTR F forward primer:

[0478] LTRF: GAGCCTGGGAGCTCTCTG 503*^519*

[0479] In one example, the first region starts at the residue corresponding to position 503 of SEQ ID NO: 18, or a sequence corresponding thereto, and ends at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto.

[0480] The position of the forward primer is selected so that the forward primer hybridizes to a region after the first region which comprises the TS-gag structure. The position is selected to exclude the TS-gag structure from the PCR amplification step, to avoid interference of the TS-gag structure with the amplification of the HIV-1 nucleic acid.

[0481] In one example, the forward primer binds to a sequence downstream of the TS-gag structure. In one example, the forward primer binds to a sequence downstream of the first region that comprises TS-gag structure.

[0482] TS-pol

[0483] The inventors have also identified a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto. Based on the experimental data shown in Example 13, and Figure 13 of the present disclosure, the 5' end of the TS-pol structure is estimated to be at the residue corresponding to position 5112 of the HIV-1 HXB2 genome, as shown in Figure 20. Thus, the forward primers of the present invention hybridize before the residue corresponding to position 5112 of the HIV-1 HXB2 genome. The Taq polymerase is then able to extend the DNA from the 3' end of the reverse primer. The ending position of the TS-pol structure is estimated to be around the residue corresponding to position 5229 of the HIV-1 HXB2 genome, which is based on the primer hybridization region of the Rv51 and Rv52 reverse primers: Cap-INRv51: TCTAGCATCCCCTAGTGGGATGTGTACTTCYGA 5197*^5229* Cap-IN Rv52: TCTAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5229*

[0484] In one example, the first region starts at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and ends at the residue corresponding to position 5229 of SEQ ID NO: 18, or a sequence corresponding thereto.

[0485] The position of the reverse primer is selected so that the reverse primer hybridizes to a region before the second region which comprises the TS-pol structure. The position is selected to exclude the TS-pol structure from the PCR amplification step, to avoid interference of the TS-pol structure with the amplification of the HIV-1 nucleic acid.

[0486] In one example, the reverse primer binds to a sequence upstream of the TS-pol structure. In one example, the reverse primer binds to a sequence upstream of the second region that comprises TS-pol structure.

[0487] Methods of determining susceptibility of HIV- 1 to one or more drugs

[0488] The present disclosure provides a method of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, the method comprising performing amplification (e.g., PCR) of a HIV-1 nucleic acid, wherein the amplification comprises primers which hybridise to sequences within the HIV-1 nucleic acid that comprise one or more mutations, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0489] The present disclosure also provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of having an HIV-1 infection, the method comprising performing amplification (e.g., PCR) of a HIV-1 nucleic acid, wherein the amplification comprises primers which hybridise to sequences within the HIV-1 nucleic acid that comprise one or more mutations, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0490] The present disclosure also provides a method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of having an HIV-1 infection, wherein the level of HIV-1 is not detectable in a plasma viral load test using serum or plasma from the subject, the method comprising performing amplification (e.g., PCR) of a HIV-1 nucleic acid, wherein the amplification comprises primers which hybridise to sequences within the HIV-1 nucleic acid that comprise one or more mutations, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

[0491] In one example, the one or more mutations in the HIV-1 nucleic acid result in one or more amino acid substitutions in the HIV-1 virion selected from:

[0492] (i) substitutions in the capsid region selected from one or more of: L56I, M66I, Q67H, K70N / R, N74D, A105E and T107N;

[0493] (ii) substitutions in the protease region selected from one or more of: L10F / I / R / V, K20M / R, V32I, L33F / I / V, M46I / L, I50V / L, F53L, I54V / M, A71V / T, G73S / C / A, V82A / F / T / S, L76V, I84V, N88S / D and L90M;

[0494] (iii) substitutions in the reverse transcriptase region selected from one or more of: M41L, E44A, E44D, K65R, D67N, D67G, T69N, K70R, L74V, L74I, M184I, M184V, L210W, T215D, T215E, K219R, K219E, L100I, K101E / P / H, K103N / S, V106M / A, E138K / A / G / Q, Y181C / I / V, Y188L / C / H, G190A / E / S, P225H; and / or

[0495] (iv) substitutions in the integrase region selected from one or more of: H51Y, T66I / K, E92Q, G140S / A, Y143C / H / R, S147G, Q148H / K / R, N155H, and R263K.

[0496] In one example, the one or more drugs comprise a capsid inhibitor (CA) such as lenacapavir, PF-07463216, ABX464: a protease inhibitor (PI) such as atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir; a nucleoside reverse transcriptase inhibitor (NRTI) such as abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine; non-nucleoside reverse transcriptase inhibitor (NNRTI) such as doravirine, efavirenz, etravirine, nevirapine and rilpivirine; and an integrase strand transfer inhibitor (INSTI) such as bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0497] In one example, the one or more drugs are selected from one or more of: lenacapavir, PF-07463216, ABX464, atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir, tipranavir, abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate, zidovudine, doravirine, efavirenz, etravirine, nevirapine, rilpivirine, bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

[0498] In one example, the one or more drugs comprise lenacapavir PF-07463216, and ABX464.

[0499] Major HIV-1 drug resistance mutations are regularly published by the Stanford University HIV drug resistance database. The database identifies resistance mutations for particular HIV-1 drugs. The most recent Handbook published 28 March 2024 identifies the following resistance mutations, which are listed in Table 1. Mutations are also regularly updated on the Stanford University HIV drug resistance database website (https: / / hivdb.stanford.edu). Notably, the database only includes mutations for NRTI, NNRTI, INSTI and PI drugs. Mutations for the new capsid inhibitor class of HIV-1 treatment are as described in, for example, Segal-Maurer et al (2022), Nka et al. (2022), and Dvory-Sobol et al (2022). In particular, Q67H and N74D were identified as the major resistance-associated mutations and additional variants included L56I, M66I, K70N, N74S, A105T, and T107N (Nka et al. 2022).

[0500] Nomenclature used for identifying drug resistance mutations in HIV-1 is typically in relation to the region of the HIV-1 virion with which the drug interacts. For example, the L56I drug resistance mutation for capsid inhibitors refers to a leucine (L) to isoleucine (I) substitution at amino acid residue 56 of the capsid region of HIV-1. In another example, the K20M / R drug resistance mutation for protease inhibitors refers to a lysine (K) to methionine (M) or arginine (R) substitution at amino acid residue 20 of the protease region of HIV-1. This nomenclature is used throughout the present disclosure, including in Table 1 below.

[0501] Mutations identified in Table 1 with bold and bold / underlined text are also known as primary / major mutations, that is, mutations which result in high-level reduced susceptibility or virologic response. Mutations identified in Table 1 with plain text are also known as secondary / minor mutations, that is, mutations which result in reduced susceptibility in combination with other resistance mutations. As shown in Table 1, certain mutations have been identified as either primary or secondary mutations for particular HIV-1 drugs.

[0502] The present assay enables the assaying of at least the mutations listed in Table 1, as the amplicon generated by the present assay covers all the CA / PR / RT / IN regions of HIV- 1. Table 1: List of major HIV-1 drug resistance mutations

[0503]

[0504] Bold underline: High-level reduced susceptibility or virological response. Bold: Reduced susceptibility or virological response. Plain text: Reduced susceptibility in combination with other NRTI-resi stance mutations. Asterisk *: Increased susceptibility. Abbreviations: Lamivudine (3TC), emtricitabine (FTC), abacavir (ABC), zidovudine (AZT). TFV, TDF, & TAF: Tenofovir (TFV) disoproxil fumarate (TDF) and TFV alafenamide (TAF) are TFV triphosphate prodrugs. Although TDF and TAF have similar resistance profiles, TAF attains higher intracellular levels.

[0505] TAMs: Thymidine analog mutations. Selected by AZT and d4T; facilitate primer unblocking. Non-TAMs prevent NRTI incorporation. T215SCDEIVALN (T215 revertants) emerge from T215YF in the absence of NRTIs. MDR: Multidrug resistance mutations. T69 insertions occur with TAMs. Q151M occurs with non-TAMs and the accessory mutations A62V, V75I, F77L, and F116Y.

[0506]

[0507] Bold underline: High-level reduced susceptibility or virological response. Bold: Reduced susceptibility or virological response. Plain text: Reduced susceptibility in combination with other NNRTI-resi stance mutations. Abbreviations: Doravirine (DOR), efavirenz (EFV), etravirine (ETR), rilpivirine (RPV), nevirapine (NVP).

[0508]

[0509]

[0510] Bold underline: High-level reduced susceptibility or virological response. Bold: Reduced susceptibility or virological response. Plain text: Reduced susceptibility in combination with other INSTI-resi stance mutations. Abbreviations: Bictegravir (BIC), dolutegravir (DTG), cabotegravir (CAB), elvitegravir (EVG), raltegravir (RAL).

[0511]

[0512] Bold underline: High-level reduced susceptibility or virological response. Bold: Reduced susceptibility or virological response. Plain text: Reduced susceptibility in combination with other Pl-resi stance mutations. Abbreviations: atazanavir (ATV), darunavir (DRV), lopinavir (LPV), 7r’ (ritonavir). In one example, the method comprises detecting amplification of one or more primary mutations selected from one or more of

[0513] (i) substitutions in the capsid region selected from one or more of M66I, Q67H, K70N / R, N74D and A105E;

[0514] (ii) substitutions in the protease region selected from one or more of M46I / L, I50V / L, I54V / M, V82A / F / T / S, L76V, I84V, N88S / D and L90M;

[0515] (iii) substitutions in the reverse transcriptase region selected from one or more of D67N, D67G, T69N, L74V, M184I, M184V, L210W, L100I, K101E / P / H, K103N / S, V106M / A, Y181C / I / V, Y188L / C / H, G190A / E / S; and / or

[0516] (iv) substitutions in the integrase region selected from one or more of E92Q, G140S / A, Y143C / H / R, Q148H / K / R, N155H, and R263K.

[0517] In one example, the method comprises detecting amplification of one or more secondary mutations selected from one or more of

[0518] (i) substitutions in the capsid region selected from L56I and / or T107N;

[0519] (ii) substitutions in the protease region selected from one or more of L10F / I / R / V, K20M / R, V32I, L33F / I / V, F53L, A71V / T, G73S / C / A,

[0520] (iii) substitutions in the reverse transcriptase region selected from one or more of M41L, E44A, E44D, K65R, K70R, L74I, Y181C, T215D, T215E, K219R, K219E, E138K / A / G / Q, P225H, and / or

[0521] (iv) substitutions in the integrase region selected from H51Y and / or T66I / K.

[0522] In one example, the method further comprises obtaining a biological sample from the subject. In a further example, the biological sample is whole blood, plasma or peripheral blood mononuclear cells (PBMCs) or a tissue. In another example, RNA is extracted from the biological sample. In another example, RNA is reverse transcribed.

[0523] The HIV-1 may be any subtype of HIV-1.

[0524] Detecting HIV-1 drug resistance mutations in low copy number samples

[0525] Methods described herein provide for detection of one or more HIV-1 drug resistance mutations in samples with a low starting copy number of HIV-1. These samples include infant blood samples, and dried blood spot (DBS) samples.

[0526] In one example, the one or more mutations are detected in HIV-1 RNA without preamplification of the RNA prior to the PCR amplification.

[0527] While it is possible to perform a pre-amplification step of the RNA to increase the starting copy number of HIV-1 prior to analysis, such a pre-amplification step often introduces biasing in the way that results are analysed. The ability to detect the drug resistance mutations without a pre-amplification step also makes the workflow more efficient and enables a high-throughput analysis of a large number of samples. The inventors have also designed primer sets for performing a second / nested PCR reaction. In most cases, the present HIV-1 drug resistance assay was performed with one Reverse Transcriptase (RT)-PCR. However, if one-step RT-PCR did not sufficiently amplify the sample, it is possible to further proceed with a nested PCR analysis from the 1st Reverse Transcriptase (RT)-PCR amplified DNA to increase PCR sensitivity or specificity. The nested PCR amplification was generated using either one outer or the inner primer in the Forward primer hybridization region and using either one outer or inner primer in the reverse primer hybridization region.

[0528] It should be understood that nested PCR should only be utilised where amplification could not be detected using the one-step RT-PCR. Indeed, the inventors have identified a surprising and unexpectedly high sensitivity and specificity of amplification by the present primer sets using only one-step RT-PCR, which are able to amplify the specific HIV PCR amplified band from RNA / DNA obtained from DBS, which contains only around 100µl of whole blood. Using HIV-1 plasmid controls, samples as low as 2 cp (2 copies / µl) were able to be amplified using the present primer sets using one-step RT-PCR.

[0529] In one example, the second PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 14, and a sequence having 80% identity thereto.

[0530] However, as is evident in the Examples below the same forward and reverse primers defined above for use in the second PCR amplification can also be used for the first (one-step) PCR amplification.

[0531] Detecting HIV-1 drug resistance mutations and activity in the HIV-1 reservoir Methods provided herein provide for detection of one or more HIV-1 drug resistance mutations in latently infected reservoir cells in a subject.

[0532] The terms “reservoir cell(s)”, “latently infected cell(s)”, “latent reservoir cell(s)” or “latently infected reservoir cell(s)” refers to cells that harbour the HIV but are not actively producing new virus. In some examples, these cells are immune cells, such as CD4 T cells (CD4 T lymphocytes).

[0533] Most HIV infected patients are under antiretroviral therapy (ART). ART treatment is able to significantly and rapidly reduce plasma viral load (pVL) (HIV RNA copy number in plasma) to levels below the limit of detection. ART treatment has markedly improved both morbidity and mortality associated with HIV infection however, ART does not lead to a cure. Despite prolonged treatment with ART, HIV persists as integrated HIV DNA in many cell types forming long-lived cellular reservoirs. Upon cessation of ART, pVL levels rebound rapidly, usually within a few weeks in the vast majority of subjects. There is currently no reliable assay available to monitor and evaluate drug resistance mutations within the latent reservoir. Monitoring drug resistance mutations in these latent reservoir cells would more accurately guide appropriate treatment with anti-retroviral therapy. For example, identification of resistance mutations in the latent reservoir that are indicative of resistance for protease inhibitors would guide the clinician’s management of the patient’s ART, such as altering the subject’s medication if they are presently receiving a protease inhibitor to a more effective HIV-1 drug whereby the subject has not exhibited any resistance mutations for.

[0534] The inventors have found that the present assay described herein has sufficient sensitivity to allow detection of drug resistance mutations within the latent reservoir. This assay is surprisingly useful to assess and predict efficacy of ART treatment, especially in patients whose plasma viral load is less than detection level.

[0535] Further, the inventors have found that persistent HIV-1 reservoir activity may contribute to major co-morbidities in subjects having, or suspected of having HIV-1. This assay enables the assaying of viral reservoir activity, for example, to determine the risk of a subject having a HIV-1 co-morbidity. In particular, the inventors have found that persistent reservoir activity may contribute to major co-morbidities in people living with HIV.

[0536] The term “reservoir activity” as used herein in the context of HIV-1 refers to the transcription activity of HIV-1 in a reservoir cell of a subject. Such reservoir activity may be estimated based on the long HIV-1 transcripts as measured or detected by a method described herein. For example, presence of long HIV-1 transcripts would indicate that there is an increased or persistent HIV-1 reservoir activity. Advantageously, the inventors have found evidence for the dominant significance of transcriptional activity in the viral reservoirs and its association with HIV-1 co-morbidities, such as brain injury. This finding is surprising and unexpected, as it would be anticipated that low level whole virus replication may be a more suitable indicator of the risk of developing or having developed HIV-1 co-morbidities.

[0537] Accordingly, methods described herein provide for assessing HIV-1 viral reservoir activity in a reservoir cell from a subject.

[0538] The inventors have also found that the presence of one or more mutations in long HIV-1 transcripts in the viral reservoir are indicative of a higher risk of developing HIV-1 comorbidities in a subject with HIV-1. For example, the detection of low-frequency mutations linked to both current and historical ART exposures - with newly acquired drug resistance mutations (DRMs) frequently co-occurring with archived or historical DRMs on the same RNA genome - suggest ongoing evolution within the HIV-1 viral reservoir. These active RNA genomes exhibit relatively few premature stop codons (PSCs), a finding consistent with sustained HIV-1 transcriptional competence, and are associated with an increased risk of brain injury. Put differently, active RNA genomes are less likely to have PSCs in important genes such as APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) responsible for viral protein translation, thus the HIV-1 in these subjects’ viral reservoirs display transcriptional competence, which increases the likelihood of observing HIV-1 co-morbidities in a subject. APOBEC3 is of particular interest given that PSCs in APOBEC3 would disrupt viral protein translation, and HIV-1 proteins have been shown to contribute to chronic immune activation and inflammation even in the absence of replication-competent virus - thus providing a mechanism of action linking sustained HIV-1 transcriptional competence with the presence of HIV-1 co-morbidities in these subset of subjects.

[0539] In some examples, the HIV-1 co-morbidity is brain injury or cardiovascular inflammation.

[0540] In one example, the brain injury is neuronal injury.

[0541] In one example, the brain injury is a white matter injury.

[0542] In one example, the brain injury is a frontal white matter injury.

[0543] In one example, the cardiovascular inflammation is aortic inflammation.

[0544] Typically these reservoir cells are CD4+ T cells and / or monocytes / macrophages.

[0545] Assessment of the viral reservoir typically involves isolation of immune cells e.g., CD4+ T cells, followed by stimulation of the immune cells to activate HIV-1 transcriptional activity. Following this, drug resistance mutations may be detected in HIV-1 cell associated RNA.

[0546] In some examples, the HIV-1 nucleic acid is isolated from a latently infected cell obtained from the subject.

[0547] In one example, the latently infected cell is an immune cell.

[0548] In one example, the immune cell is a CD4+ T cell, monocyte and / or macrophage. In one example, the immune cell is a CD4+ T cell.

[0549] One way to stimulate the latent reservoir cells is by stimulation with one or more of: anti-CD3 / CD28 / CD2 and IL-2. Stimulation of the latent reservoir cells triggers HIV-1 transcription and can assist with detection of the HIV-1 nucleic acid.

[0550] In some examples, the latently infected cell is stimulated with one or more of: IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0551] In some examples, the latently infected cell is stimulated with IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0552] Selecting a treatment for a subject suspected of or having HIV-1

[0553] The methods herein also allow for the selection of treatment for a subject suspected of having HIV-1, that is, drug resistance testing prior to commencement of ART. Identification that the subject is infected with HIV-1 that comprises one or more mutations associated with drug resistance of a particular drug class may guide clinical management of the patient. For example, the clinical practitioner or medical professional may elect to administer a different ART combination therapy that the subject is not resistant to. Additionally, the methods herein also allow for the selection of treatment for a subject having HIV-1, that is, drug resistance testing after ART has commenced. Identification that following treatment, the subject is infected with HIV-1 that now comprises one or more mutations associated with drug resistance of a particular drug class, when these one or more mutations were not detected previously, would indicate that the HIV-1 is becoming less susceptible and potentially resistant to one or more drugs. Based on this information, the clinical practitioner or medical professional may then elect to administer a different ART combination therapy to ensure that the subject continues to receive optimal ART.

[0554] Certain subject populations are recommended to undergo drug resistance testing prior to commencement of ART.

[0555] In one example, the subject is pregnant.

[0556] In one example, the subject is an infant.

[0557] Methods of assessing risk and diagnosis of a subject suspected of or having HIV-1

[0558] The methods herein also allow for assessing risk of a subject having one or more human immunodeficiency virus type 1 (HIV-1) co-morbidities. The inventors have found that amplification of HIV- 1 transcripts by a method of the present disclosure indicates on-going and persistent HIV-1 transcription activity, which is associated with HIV-1 co-morbidities, such as brain injury. Additionally, the inventors have also found that the identification of one or more mutations, such as drug resistance mutations (DRMs) are an indicator of on-going evolution within the HIV-1 viral reservoir, which is linked to sustained transcriptional competence that is associated with the presence of co-morbidities.

[0559] Further, the methods herein also allow for diagnosing a HIV-1 co-morbidity in a subject. The inventors have also discovered that APOBEC3 -mediated premature stop codons are associated with HIV-1 co-morbidities. By analyzing long gag / pol transcripts using nanopore-based NGS, the inventors have been able to identify APOBEC3 -mediated mutations in HIV mRNA reads. APOBEC3 activity represents a host defense mechanism against HIV. The introduction of stop codons is a characteristic and significant outcome of this process — these mutations prevent the translation of full-length HIV proteins, thereby reducing viral replication but potentially contributing to inflammation and thus occurrence of HIV-1 comorbidities. On the other hand, HIV-1 viral proteins are also known to cause inflammation, and thus for certain co-morbidities, the presence of APOBEC3 PSCs has a protective effect due to its disruption of translation of HIV-1 proteins.

[0560] In some examples, the one or more mutations in the HIV-1 nucleic acid comprises a premature stop codon. In some examples, the one or more mutations in the HIV-1 nucleic acid comprises an Apolipoprotein B mRNA-editing catalytic polypeptide-like 3 (APOBEC3) mediated premature stop codon. In some examples, the HIV-1 co-morbidity is brain injury or cardiovascular inflammation. In some examples, the HIV-1 co-morbidity is brain injury. In some examples, the HIV-1 co-morbidity is cardiovascular inflammation.

[0561] In one example, the brain injury is neuronal injury.

[0562] In one example, the brain injury is a white matter injury.

[0563] In one example, the brain injury is a frontal white matter injury.

[0564] In one example, the cardiovascular inflammation is aortic inflammation.

[0565] In some examples, the HIV-1 nucleic acid is isolated from a latently infected cell obtained from the subject.

[0566] In one example, the latently infected cell is an immune cell.

[0567] In one example, the immune cell is a CD4+ T cell, monocyte and / or macrophage. In one example, the immune cell is a CD4+ T cell.

[0568] One way to stimulate the latent reservoir cells is by stimulation with one or more of: anti-CD3 / CD28 / CD2 and IL-2. Stimulation of the latent reservoir cells triggers HIV-1 transcription and can assist with detection of the HIV-1 nucleic acid.

[0569] In some examples, the latently infected cell is stimulated with one or more of: IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0570] In some examples, the latently infected cell is stimulated with IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

[0571] Monitoring HIV-1 therapy in a subject suspected of or having HIV-1

[0572] The methods herein also allow for methods for monitoring HIV-1 therapy (e.g., ART) in a subject suspected of or having HIV-1 that has received the HIV-1 therapy, comprising performing a PCR amplification of a HIV-1 nucleic acid, the method comprising detecting amplification of one or more mutations located in the pol and gag regions of the HIV-1 nucleic acid, determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations, and comparing the susceptibility of the HIV-1 to the one or more drugs to a reference value from the same subject, thereby monitoring the HIV-1 therapy in the subject. Thus, the methods herein comprise assessing if the subject is receiving optimal ART.

[0573] In assessing whether the subject is receiving optimal ART, the clinician may look to compare the susceptibility of the HIV-1 to the one or more drugs to a reference value from the same subject. If the susceptibility of the HIV-1 to the one or more drugs is decreased from the earlier timepoint, i.e., there is now detection of one or more mutations associated with drug resistance, then this would indicate to the clinician that the subject is not receiving optimal ART. This would suggest to the clinician to either adjust the dosage of ART or the type of ART. This might also include substituting one of the components in the combination therapy if the subject is receiving combination therapy. In one example, the reference value is obtained at the initiation of ART.

[0574] In one example, the reference value is obtained at the re-initiation of ART following virologic failure.

[0575] In one example, the subject is experiencing suboptimal ART.

[0576] In one example, the subject is experiencing suboptimal viral load reduction following initiation of ART.

[0577] In a further example, the method comprises adjusting the dosage or type of ART administered to the subject.

[0578] In another example, the susceptibility of the HIV-1 to one or more drugs is determined over at least two time points in the subject. In a further example, the ratio is determined over multiple time points over the life of the subject, including, but not limited to three, four, five, six, eight, ten, twelve, fifteen, twenty, twenty-five, thirty, thirty-five, forty time points etc. In another example, the period between the at least two time points is days, weeks or months. In another example, the period between the at least two time points is 1 week, 2 weeks, 1 month, 3 months, four months, six months, eight months, or twelve months.

[0579] In another example, a decrease in the ratio of greater than 50%, 45%. 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 2% indicates that the subject is receiving optimal ART.

[0580] It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. The present disclosure includes the following non-limiting examples.

[0581] Kits

[0582] Another example of the disclosure provides kits comprising a forward primer of the disclosure and a reverse primer of the disclosure useful for a method described herein. The kit may comprise suitable reagents and instructions for performing a method described herein.

[0583] In one example, there is provided a kit for determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs.

[0584] In one example, there is provided a kit for performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection.

[0585] In one example, there is provided a kit for selecting a treatment for a subject suspected of or having HIV-1.

[0586] In one example, there is provided a kit for monitoring HIV-1 therapy in a subject suspected of or having HIV-1.

[0587] In one example, there is provided a kit for assessing or predicting the effectiveness of anti-retroviral therapy (ART) administered to an HIV-1 positive subject. In one example, there is provided a kit for detecting or diagnosing HIV-1 in a subject with HIV-1 or a subject suspected of or having an HIV-1 infection.

[0588] In one example, there is provided a kit for detecting a subject having a latent HIV-1 infection in which the virus is integrated into the genome of a reservoir cell and is producing HIV-1 transcripts, wherein the subject has an undetectable level of HIV-1 in plasma, as determined by a plasma viral load test.

[0589] In one example, there is provided a kit for performing PCR amplification of a HIV-1 nucleic acid.

[0590] In one example, the kit comprises (a) a container comprising a forward primer of the disclosure and a reverse primer of the disclosure; and (b) a package insert with instructions for performing a method described herein.

[0591] In one example, the package insert is on or associated with the container. Suitable containers include, for example, ampoules, bottles, vials, microtiter plate well, microarray etc. The containers may be formed from a variety of materials such as glass or plastic paper, foil, micro-particles and the like. The label or package insert indicates that the composition is used for performing a method described herein, e.g., determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, with specific guidance regarding performance of PCR amplification. In some applications, one or more reaction components may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of a target nucleic acid can be added to the individual tubes and amplification carried out directly. The amount of a component supplied in the kit can be any appropriate amount, and may depend on the target market to which the product is directed. General guidelines for determining appropriate amounts may be found in, for example, Joseph Sambrook and David W. Russell, Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, 2001; and Frederick M. Ausubel, Current Protocols in Molecular Biology, John Wiley 30 Sons, 2003.

[0592] In one example, the kit comprises a container for collecting a nucleic acid-containing sample, for example a tube for collecting blood.

[0593] In one example, the kit comprises reagents for, e.g., performing nucleic acid amplification, positive controls for the extraction procedure for HIV-1 RNA such as HIV-1 denatured cell lysate, primer extension, detection and / or identification, PCR controls such as HIV-1 positive standards for DNA. To that end, one or more of the reaction components for the methods disclosed herein can be supplied in the form of a kit for use in the detection of a HIV-1 nucleic acid. In such a kit, an appropriate amount of one or more reaction components is provided in one or more containers or held on a substrate (e.g., by electrostatic interactions or covalent bonding). The kit can include one or more containers containing one or more primers. A kit can contain a single primer in a single container, multiple containers containing the same primer, a single container containing two or more different primers of the invention, or multiple containers containing different primers or containing mixtures of two or more primers.

[0594] In one example, the kit comprises a reagent for performing a PCR amplification. Some or all of the components of the kits can be provided in containers separate from the container(s) containing the primer of the invention. Examples of additional components of the kits include, but are not limited to, one or more different polymerases, one or more primers that are specific for a control nucleic acid or for a target nucleic acid.

[0595] The reaction components used in an amplification and / or detection process may be provided in a variety of forms. For example, the components (e.g., enzymes, nucleotide triphosphates and / or primers) can be suspended in an aqueous solution or as a freeze-dried or lyophilized powder, pellet, or bead. In the latter case, the components, when reconstituted, form a complete mixture of components for use in an assay.

[0596] In one example, the kit comprises an additional reagent or substance including, but not limited to: reagents (including buffers) for isolating cells, reagent for lysis of cells, divalent cation chelating agents or other agents that inhibit unwanted nucleases, control DNA / RNA for use in ensuring that primers, the polymerase and other components of reactions are functioning properly, RNA isolation reagents (including buffers), amplification reaction reagents (including buffers), and wash solutions.

[0597] Examples

[0598] Example 1 Materials and Methods

[0599] The genomic structure of HIV-1 is shown in Figure 1-1. The approximate first RT-PCR amplified regions, and the 2nd PCR amplified regions of this invention are illustrated in this figure. The reading frame-1, -2, -3 are indicated to the corresponding HIV-1 protein expressions in grey coloured boxes. HIV-1 drug mutations for the new class of drug capsid inhibitor is in the gag region. The conventional HIV-1 drug mutations for PR: protease inhibitors, RT: Reverse transcriptase inhibitors, and IN: integrase inhibitors are located in pol region. The forward primers and the reverse primer were designed within the approximate regions indicated as “Forward primer hybridization region” and the “Reverse primer hybridisation region” respectively. The numbers indicate the HIV-1 RNA number for HXB2 sequence base number, starting at HIV-1 mRNA No.l and end in pol sequence at No.5096.

[0600] Forward primer location and Reverse primer location along with gag-pol mRNA reading is shown in Figure 1-2. The HIV-1 gag / pol mRNA is generated as a long whole HIV mRNA from the HIV-1 promoter, which codes for Capsid (p24) and PR (proteinases), RT (reverse transcriptase), and IN (integrase). Capsid (p24) protein in Frame- 1 reading is indicated in grey box. The long pol protein of PR, RT, and IN, starts at 2253 and ends at 5096, and is translated in frame-3 reading due to a ribosomal frameshift. R263K is the last reported IN primary mutation, located 20 amino acids before the end of the IN gene. The reverse primer hybridization location was selected so that the amplicon generated also covers the R263K mutation (see detail in Figure 1-4). In the present assay, it is also possible to conduct nested PCR amplification using one outer and inner primer in the Forward primer hybridization region and one outer and inner primer in the reverse primer hybridization region.

[0601] The present developed PCR based assay comprises PCR amplification for HIV-1 RNA and HIV- 1 DNA with one of the designed forward primers in the “forward primer hybridization region” (Figure 1-3) and one of the designed reverse primers in the “reverse primer hybridization region” (Figure 1-4). The present PCR amplification for the present HIV-1 resistance assay was performed with one step of Reverse Transcriptase (RT)-PCR. This one-step method already provides improved and optimal sensitivity and specificity for the detection of these one or more mutations. As outlined above it is possible to then proceed with a nested PCR analysis from the 1st Reverse Transcriptase (RT)-PCR amplified DNA to further increase PCR sensitivity or specificity. The use of a second nested PCR is preferable for assaying samples with low DNA or RNA levels such as in infant blood testing or dried blood spot (DBS) testing. Importantly, the method is able to amplify HIV-1 without the requirement of preamplification typically used in the prior art for amplifying copy numbers of HIV-1 from samples having low DNA or RNA levels. The ability to amplify HIV-1 without the preamplification step is desirable for workflow optimisation and efficiency, particularly when assaying a large number of samples. Further, pre-amplification steps are known to potentially result in biasing and specificity issues.

[0602] Primer sets were designed based on the following criteria (a) ability to amplify all HIV-1 subtypes for reliable detection, (b) allows amplification of HIV-1 sequences despite the highly sophisticated HIV-1 RNA structure (c) primer length of between 18-45 bases long, and (d) no primer dimer formation but maintaining sensitive detection. The forward primer was designed to provide good alignment at the 3' end of the primer for all HIV-1 subtypes and the reverse primer was designed to provide good alignment at the 3 'end of the primer for all HIV-1 subtypes. In particular, the forward and reverse primer binding locations were carefully selected to avoid certain tight structures in the HIV-1 structure that have been first identified by the present inventors which would interfere with amplification and reduce the sensitivity and specificity of the assay. The forward and reverse primers are shown in Table 2 below. Table 2 Sequences of forward and reverse primers for PCR

[0603]

[0604]

[0605]

[0606]

[0607] The present primer sets were discovered after extensive testing for providing improved sensitivity and specificity for HIV-1 long PCR, as well as after assessing primer-dimer formation using a web-based software analysis (Oligo analyser https: / / sg.idtdna.com / calc / analyzer). The software analyses indicate possible formation of primer-dimers by checking if both primers can hybridize to each other and generate short around 40bp amplicon during PCR amplification. Primer-dimer formation can be a huge obstacle for generation of specific PCR amplification and thus impact sensitivity of the PCR reaction. Also, if primer-dimers occur in the PCR reaction, most of the primers will be consumed in the formation of primer-dimers. As a consequence of this lack of specificity, this would impact the ability to detect the target HIV-1 sequence, especially when small levels of target are present in the samples.

[0608] Nonetheless, software analysis tools are only able to generate artificial information that are predictive of good primer sets. Further fine tuning through extensive experimentation was conducted to select the primer pairs suitable for the present invention. Figures 7-1 to 7-15 show the software analysis for hetero-primer dimer formation for various forward and reverse primer combinations according to the present disclosure. The figures show prediction of possible hetero-primer dimer formation, indicating that only non-extensible primer dimers can be formed which is not going to be extended by the Taq-polymerase enzyme. The Delta G value is less than “ -7” indicative of no possible formation of primer dimers.

[0609] Alignment analysis and self-primer dimer formation of the forward primers of the present disclosure used herein is shown in Figure 5-1 to Figure 5-9. The eight forward primers of the present disclosure are listed below:

[0610] o Cap-1 N F3: TGGGTGCGAGAGCGTC SEQ ID NO: 1

[0611] o Cap-1 N F3-long: TGGGTGCGAGAGCGTCARTA SEQ ID NO: 2

[0612] o Cap-1 N F4: GAGAGATGGGTGCGAGAGC SEQ ID NO: 3

[0613] o Cap-1 N F5: GAGAGATGGGTGCGAGAGCGTCA SEQ ID NO: 4

[0614] o Cap-1 N F6: GAGATGGGTGCGAGAGCGTCA SEQ ID NO: 5

[0615] o Cap-1 N F7: AAACATATAGTATGGGCAAGC SEQ ID NO: 6

[0616] o Cap-1 N F8: AAACATATAGTATGGGCAAGCAGG SEQ ID NO: 7

[0617] o Cap-1 N F21: GCGAGAGCGTCAGTATTR SEQ ID NO: 8

[0618] Alignment analysis and self-primer dimer formation of the reverse primers of the present disclosure used herein is shown in Figure 6-1 to Figure 6-13. The nine reverse primers of the present disclosure are listed below:

[0619] o Cap-IN Rv6: GCCACACAATCATCACCTGCCATCTGTTTTCCATA SEQ ID NO: 9 o Cap-IN Rv7: CACAATCATCACCTGCCATCTGTTTTCCATA SEQ ID NO: 10 o Cap-IN Rv8: AATCATCACCTGCCATCTGTTTTCCATA SEQ ID NO: 11 o Cap-IN Rvll: CCACACAATCATCACCTGCC SEQ ID NO: 12 o Cap-IN Rvl7: ACACAATCATCACCTGCCATCTGTTTTCCAT SEQ ID NO: 13 o Cap-IN Rvl8: ATCATCACCTGCCATCTGTTTTCCAT SEQ ID NO: 14 o Cap-IN Rv41: KTKCCATGTTCTAATCCTCATCCTGTCYAC SEQ ID NO: 15 o Cap-IN Rv42: AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC SEQ ID NO: 16 o Cap-IN Rv43: AAACTKTKCCATGTTCTAATCCTCATCCTGTC SEQ ID NO: 17 The analysis supports that all the present primers align very well, especially at the 3-prime end of the HIV-1 sequences. The Taq-polymerase enzyme extends from the 3 -prime end of the primer (top panel). The prediction of self-primer dimer formation is also shown (bottom panel), indicating that only non-extensible primer dimer can be formed which is not going to be extended by the Taq-polymerase enzyme. The Delta G value is less than “ -7” indicative of no possible formation of primer dimers.

[0620] Notably, the Cap-IN Rv6 reverse primer and the Cap-IN Rv7 reverse primer have the same 3’ end binding regions. Thus, the Cap-IN Rv6 and Cap-IN Rv7 reverse primers are interchangeable in the presently described forward and reverse primer sets.

[0621] Plasmid standards

[0622] HIV-1 plasmid standards; 2, 20, 200, 200, 2xl03, 2xl04copies / pl were used for quantification of the HIV-1 copy numbers in the analysis samples. HIV-1 plasmid was obtained from genomic HIV-1 plasmid of pNL4-3 (NIH Cat No. 114).

[0623] HIV - 1 subj ect data

[0624] Plasma viral load data for subjects was obtained from the St Vincent’s Hospital diagnostic laboratory. Data was obtained regarding a subject’s HIV-1 status using the Roche COBAS® TaqMan HIV-1 assay, according to manufactures’ instructions. Whole blood samples were also obtained from the St Vincent’s Hospital diagnostic laboratory. This study was approved by the St. Vincent’s Hospital Human Research Ethics Committee (HREC LNR / 16 / SVH / 327).

[0625] Isolation and preparation of peripheral blood mononuclear cells (PBMCs)

[0626] Whole blood was obtained from subjects using standard protocols for blood collection. Fresh blood not older than 4 days was obtained from the HIV-1 diagnostics lab at St Vincent’s Hospital.

[0627] Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood using the conventional Ficoll gradient centrifugation method. Briefly, blood was collected in 9mL Acid Citrate Dextrose anticoagulant (ACD) tubes and 9mL of phosphate buffered saline (PBS) was added. After mixing by inversion, 15mL of Ficoll-plaque media was added and centrifuged at 400g for 40 mins at 18° to 20° C. The upper layer containing plasma and platelets was discarded and the mononuclear layer of cells transferred to a clean tube. 30mL of PBS was added, mixed and centrifuged at 400g for 15 mins at 18° to 20° C. The supernatant was removed and the mononuclear cells washed in lOmL PBS and centrifuged at 400g for 10 mins at 18° to 20° C. The supernatant was removed and mononuclear cells retained for future analysis. Isolation and preparation of whole blood

[0628] For whole blood experiments, 4 mL of Red blood cell lysis buffer (Roche) was added to a 15mL Falcon tube. The whole blood collection tube was inverted 10 times and then 2 mL of whole blood added to the 15mL Falcon tube containing 4mL of the Lysis buffer. The tubes were incubated on a rotating platform with slow rotation mode at room temperature (RT) for lOmin. The tube was then centrifuged at 500xg for 5 min with a table-top centrifuge at RT. After centrifugation, supernatant was decanted into a waste bottle. Cells were resuspended in 1800pl of PBS. Two aliquots of 900 pl of cell suspension were made into two O-ring tubes.

[0629] The tubes were then centrifuged at 7,800xg (9000rpm) for 3 min with a microfuge at RT. Supernatant was removed without disturbing the white cell pellets using Pl 000 pipette.

[0630] Two cell-pelleted tubes were prepared from one patient. One tube is for DNA extraction and the other tube for RNA extraction.

[0631] The concentration of extracted DNA in the sample was measured by absorbance at 260nm (A260) utilising an average extinction coefficient for double-stranded (ds) DNA (1A26O=5O pg / ml) to determine the nucleic acid concentration from the absorbance of the nucleic acid preparation. The concentration of extracted RNA in the sample was measured by absorbance at 260nm (A260) utilising an average extinction coefficient for single-stranded (ss) RNA (1 A26O= O pg / ml) to determine the nucleic acid concentration from the absorbance of the nucleic acid preparation.

[0632] DNA and RNA extraction

[0633] DNA and RNA were extracted using the Maxwell RSC automated extraction platform (Promega, Madison, Wisconsin, USA), with the Maxwell RSC Buffy Coat DNA kit (Promega) and Maxwell RSC Simply RNA Tissue kit (Promega), respectively, essentially according to the manufacturer’s protocol. WBCs were counted after red blood cell lysis using TC20 Automated Cell Counter (Bio-Rad, Hercules, California, USA).

[0634] HIV-1 RNA was extracted from plasma using QIAamp Viral RNA Mini Kit (Cat. No.

[0635] 52904).

[0636] 1st RT-PCR method

[0637] Generally, the 1stRT-PCR was conducted as follows. The PCR reaction in a 25 pl final volume contained: 1* PCR buffer, 0.20pM Forward primer, 0.20pM reverse primer, 0.5pl of SuperScript IV RT Mix (ThemoFisher 12594025), lOpl of RNA sample, and PCR-grade water. The cycling and melting conditions were as follows: 55°C RT step for 20 minutes, 98°C for 2 minutes followed by 50 cycles of: 10 seconds at 98°C, 45 seconds at 60°C and 2 minutes 15 seconds at 72°C. with a final cycle of 5 minutes at 72°C. HIV-1 Plasmid Standards (2, 20, 200 copies / pl) were used as Positive control and PCR-grade water was used as Negative control. The PCR was performed in a MiniAmp™ Thermal Cycler (ThemoFisher A37834). 2nd PCR / nested PCR method (optional step)

[0638] Generally, the 2ndPCR (nested PCR) was conducted as follows. The 2nd PCR / nested PCR used the 1st RT-PCR samples. The PCR reaction in a 25 pl final volume contained: 1* PCR buffer (ThemoFisher 12594025), 0.20pM the Forward primer, 0.20pMthe reverse primer, 3 pl of the diluted PCR amplified DNA sample, and PCR-grade water. The cycling and melting conditions were as follows: 98°C for 2 minutes followed by 50 cycles of: 10 seconds at 98°C, 45 seconds at 62°C and 2 minutes 15 seconds at 72°C, final cycle of 5 minutes at 72°C. HIV-1 Plasmid Standards (2, 20, 200 copies / pl) were used for Positive control and PCR-grade water was used for Negative control. The PCR was performed in a MiniAmp™ Thermal Cycler (ThemoFisher A37834).

[0639] DNA sequence analysis

[0640] DNA sequencing was conducted with Nanopore NGS Technology. Other suitable NGS technologies may also be applied, such as Illumina and Ion Torrent. Illumina sequencing uses short fragment analysis. This method is called “sequencing by synthesis”. As nucleotides are incorporated into the growing DNA strands, a device captures the fluorescence signal from each nucleotide, allowing the sequence to be read. It has been widely used in clinical field. Ion Torrent sequencing uses also short fragment analysis. This method is called “semiconductor sequencing”. As nucleotides are incorporated into the growing DNA strands, a device captures released a hydrogen ion, which changes in pH is detected by the device. It has been also widely used in clinical field.

[0641] To perform DNA sequencing analysis of the amplified product, the inventors utilised Nanopore sequencing, a third-generation sequencing technology that allows for the direct sequencing of long DNA molecules. Unlike other next-generation sequencing (NGS) methods, such as Illumina and Ion Torrent, which often require DNA amplification and produce shorter reads, Nanopore sequencing can analyse very long DNA fragments. However, any existing sequencing technologies can be used to analyse PCR-amplified DNA obtained through this method.

[0642] Nanopore sequencing platforms, such as the Oxford Nanopore Technologies MinlON, are highly portable and compact. The core component of nanopore sequencing is a tiny protein nanopore embedded in a membrane. This nanopore creates a small, stable hole that DNA or RNA molecules can pass through. As the nucleotides of the DNA strand pass through the nanopore, they cause changes in the electrical current across the pore. Each nucleotide (adenine, thymine, cytosine, guanine for DNA) disrupts the current in a characteristic way. A more detailed methodology is described in Example 11. Example 2 Amplification of RNA extracted from dried blood spot (DBS) and intracellular samples.

[0643] Initial assessment

[0644] Amplification of RNA extracted from clinical samples was conducted in accordance with the PCR method protocol above.

[0645] The PCR bands amplified with the present assay using clinical samples is shown in Figure 3. HIV-1 RNA was extracted from patients’ plasma, followed by one step RT-PCR. The PCR bands in Figure 3 A shows that the present assay achieved very specific amplification with a single PCR, using forward primer Cap-IN F3 and reverse primer Cap-IN Rvll. A nested PCR was performed with forward primer Cap-IN F3 and reverse primer Cap-IN Rv8, for Dried Blood Spot and intracellular RNA samples where more specific PCR amplification is needed due to small the amount of HIV- 1 RNA extracted from those specimens (left panel of Figure 3B). The results were confirmed with nested PCR the first PCR product in plasma RNA samples was the correct HIV-1 sequence (right panel of Figure 3B).

[0646] Validation of results in DBS samples

[0647] Further experimentation was conducted to verify the ability to achieve long PCR amplification from 18 DBS samples, extracted with the QIAamp Viral RNA Mini Kit.

[0648] In these set of experiments, Set-29 was used for the initial Long RT-PCR amplification. Set-100 was used for the nested PCR analysis.

[0649] Set-29: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA

[0650] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0651] Set-100: Cap-IN F7 (2nd) AAACATATAGTATGGGCAAGC

[0652] Cap-IN Rv8: AATCATCACCTGCCATCTGTTTTCCATA

[0653] Procedure

[0654] The initial RT-PCR analysis was performed in the same manner as described in Example 1. The nested PCR analysis was performed using GoTaq Long PCR kit (Promega, Cat No. M4021), in a total volume of 25pl, containing: lx GoTaq Long PCR Master Mix, 0.5pM forward primer, 0.5pM reverse primer, 3pl of the initial RT-PCR reaction, and PCR-grade water. The PCR was performed in a MiniAmp™ Thermal Cycler (ThemoFisher #A37834), using the following conditions: 95°C for 2min, 50 cycles of (94°C for lOsec, 60°C for 30s, 72°C for 2minl5s) and a final elongation at 72°C for 5 min. Results

[0655] The inventors observed very specific long RT-PCR in two samples (N171 and N229) using only initial RT-PCR analysis with the Set-29 primer (Figure 16).

[0656] The inventors also observed specific long PCR analysis forming single bands for the rest of the DBS samples using the Set-100 primer with the nested PCR analysis (Figure 16).

[0657] Example 3 1stevaluation of primer sets for HIV-1 RNA amplification.

[0658] To assess the detection sensitivity of the present PCR primer sets. Three different forward primers and four different Reverse primers were tested in seven different primer sets.

[0659] Set-24: Cap-INF4: GAGAGATGGGTGCGAGAGC

[0660] Cap-INRvll: CCACACAATCATCACCTGCC

[0661] Set-25: Cap-INF5: GAGAGATGGGTGCGAGAGCGTCA

[0662] Cap-INRvll: CCACACAATCATCACCTGCC

[0663] Set-26: Cap-INF6: GAGATGGGTGCGAGAGCGTCA

[0664] Cap-INRvll: CCACACAATCATCACCTGCC

[0665] Set-27: Cap-INF6: GAGATGGGTGCGAGAGCGTCA

[0666] Cap-IN Rvl7: ACACAATCATCACCTGCCATCTGTTTTCCAT

[0667] Set-28: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA

[0668] Cap-IN Rvl8: ATCATCACCTGCCATCTGTTTTCCAT

[0669] Set-29: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA

[0670] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0671] Set-30: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA

[0672] Cap-IN Rv43 AAACTKTKCCATGTTCTAATCCTCATCCTGTC

[0673] The results of the evaluation are shown in Figure 4-1. As shown in the Figure, 10 times diluted HIV-1 RNA (approx. pVL of 35,900 copies / ml) was able to be amplified by the present primer sets.

[0674] Example 4 2ndevaluation of primer sets for HIV-1 RNA amplification.

[0675] To assess detection sensitivity of more primer sets. One forward primer was combined with five different Reverse primers and tested in 5 different primer sets.

[0676] Set-31: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0677] Cap-INRvll: CCACACAATCATCACCTGCC

[0678] Set-32: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0679] Cap-IN Rvl7: ACACAATCATCACCTGCCATCTGTTTTCCAT

[0680] Set-33: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA Cap-IN Rvl8: ATCATCACCTGCCATCTGTTTTCCAT

[0681] Set-34: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0682] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0683] Set-35: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0684] Cap-IN Rv41 KTKCC ATGTTCT AATCCTC ATCCTGTC YAC

[0685] The results of the evaluation are shown in Figure 4-2. As shown in the Figure, 10 times diluted HIV-1 RNA (approx. pVL of 35,900 copies / ml) was able to be amplified by the present primer sets.

[0686] Example 5 3rdevaluation of primer sets for HIV-1 RNA amplification.

[0687] To assess detection sensitivity of other PCR primer sets. Two different forward primers and three different Reverse primers were tested in four different primer sets.

[0688] Set-36: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0689] Cap-IN Rv51 TCTAGC ATCCCCTAGTGGGATGTGTACTTC YGA

[0690] Set-37: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0691] Cap-IN Rv52 TCTAGC ATCCCCTAGTGGGATGTGTACTTC

[0692] Set-38: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0693] Cap-IN Rv53 TAGCATCCCCTAGTGGGATGTGTACTTC

[0694] Set-39: Cap-IN F3: TGGGTGCGAGAGCGTC

[0695] Cap-IN Rv53 TAGCATCCCCTAGTGGGATGTGTACTTC

[0696] The results of the evaluation are shown in Figure 4-3. As shown in the Figure, 10 times diluted HIV-1 RNA (approx. pVL of 35,900 copies / ml) was not able to be amplified by the present primer sets.

[0697] Example 6 Evaluation of primer sets in nested PCR for HIV-1 DNA amplification.

[0698] To assess the detection sensitivity of the PCR primer sets for nested PCR. Two different forward primers and three different Reverse primers were tested in four different primer sets.

[0699] Set- 100: Cap-IN F7 (2nd) AAACATATAGTATGGGCAAGC

[0700] Cap-IN Rv8: AATCATCACCTGCCATCTGTTTTCCATA

[0701] Set-101: Cap-IN F8 AAACATATAGTATGGGCAAGCAGG

[0702] Cap-IN Rv8 AATCATCACCTGCCATCTGTTTTCCATA

[0703] Set- 104: Cap-IN F21: GCGAGAGCGTCAGTATTR 51.4 °C

[0704] Cap-IN Rv8: AATCATCACCTGCCATCTGTTTTCCATA The results of the evaluation are shown in Figure 4-4. As shown in the Figure, nested PCR was successfully conducted with undiluted HIV-1 DNA with Set-100. Further, 50 times diluted HIV-1 DNA (approx. pVL of 7,180 copies / ml) was able to be amplified by the present primer sets Set-101 and Set-104. Note, the positive control (PC) was not successful in this experiment.

[0705] An additional experiment utilising two-step nested PCR was performed to validate the above findings. Set-29 was utilised for the 1stRT-PCR step, and Set-100 (as used above) was utilized for the nested PCR.

[0706] Set-29: Cap-INF6: GAGATGGGTGCGAGAGCGTCA

[0707] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0708] The following samples were used:

[0709] o ID1858: ex-vivo samples, RNA obtained from CD4+T cells (without culture).

[0710] o ID1983: in-vitro cultured samples, RNA obtained after 7 Days culture of CD4+T cells.

[0711] It was anticipated that long PCR amplification of the CA / PR / RT / IN regions in the first sample would be challenging, due to a significant amount of human cell originated RNA, which may obstruct the one-step RT PCR reaction.

[0712] Clinical information of the patients are as follows:

[0713] o ID1858: 2 blips within 2 years. pVL not detected in this sample. CD4 1,069 cells / pl o ID1983: 4 blips within 2 years. pVL not detected in this sample. CD4426 cells / pl Under current clinical practice, ID1858 is recognized as a Treatment Success Patient. Only two blips for two years and CD4 level of 1,069 cells (>450 counts: medium range of the healthy persons’ CD4 level) indicate that ART is working efficaciously to suppress plasma viral load and to maintain high levels of CD4 cells for this patient.

[0714] Note: the blip episodes in both patients (ID1858 and ID1983) were detected but patients exhibited less than <20 copies / mL. Thus, the elevated blips were observed in patients despite having extremely low levels of plasma Viral Load.

[0715] The results of the evaluation are shown in Figure 8.

[0716] 1st RT-PCR analysis

[0717] o Set-29 was able to amplify both the 2 copy / pl and 20 copy / pl HIV-1 plasmid control forming a strong single band.

[0718] o ID1858 and ID1983 were amplified to from target amplified DNA (indicated by the arrow), although some lower non-specific PCR bands were observed. Nested PCR analysis

[0719] o Set- 100 nested PCR was able to amplify the 20 copy / pl HIV-1 plasmid control to form a strong single band.

[0720] o ID1858 and ID1983 were amplified to form strong single band to indicate that the specific HIV target DNA was amplified by nested PCR (indicated by the arrow).

[0721] The results show that the “nested PCR” analysis resulted in a more sensitive and specific analysis. However, even the 1stRT-PCR step was able to amplify the 2 copy / pl and 20 copy / pl HIV-1 plasmid control, as well as the patient samples taken from patients without a detectable pVL.

[0722] The inventors conducted further analysis of sensitive and specificity of the Set-29 PCR primer set. To evaluate PCR amplification sensitivity with the set-29 primer, HIV-1 plasmid DNA with a defined copy number per pl was used.

[0723] Primer sets.

[0724] • Set-29: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA

[0725] Cap-IN Rv42 AACTKTKCCATGTTCTAATCCTCATCCTGTCYAC Procedure

[0726] For this DNA analysis, the reaction mixture in a 25 pl final volume contained: 1 x Reaction buffer, 0.4 pM forward primer, 0.4 pM reverse primer, and 7 pl of plasmid DNA. The PCR cycling conditions were as follows: 98°C for 2 minutes, followed by 50 cycles of: 98°C for 10 seconds, annealing at 58°C, 62°C, and 68°C for 20 seconds each, and extension at 72°C for 2 minutes and 15 seconds. A final extension was performed at 72°C for 5 minutes using the Kyratec SuperCycler Gradient PCR machine (j:ittp. / / ,kyralec.cori wp-content / tipioads / 201 l / 03 / SC--User-Marmai-3-- One-step RT-PCR analysis kit, Thermo Fisher SuperScript IV UniPrimer One- Step RT-PCR Kit (Cat No. 12596100, Thermo Fisher Scientific) was used.

[0727] Results

[0728] The results are shown in Figure 17. In summary, the results indicate:

[0729] • The experimental data indicates that the Set-29 PCR primer set is extremely sensitive, able to amplify HIV-1 DNA from as little as 2 copies / pl, forming clear, specific single bands across three different PCR annealing temperatures: 58°C, 62°C, and 66°C.

[0730] • The Set-29 primer set operates effectively within a broad annealing temperature range of 58°C to 66°C, producing specific amplification even after 50 PCR cycles, suggesting a very stable amplification with wide- ranging annealing conditions to get one single PCR band.

[0731] • This level of sensitivity is usually achieved with quantitative Real-Time PCR (qPCR) analysis using short PCR fragments of around 100 base pairs.

[0732] • Due to the high sensitivity of the Set-29 primer, the present assay enables performing long RT-PCR amplifications using only the first, one-step RT- PCR analysis with RNA extracted from plasma samples received at the clinical diagnostic laboratory (see Figure 14).

[0733] • Even with DBS samples, which contain around 100 pl of whole blood, the inventors were able to achieve long RT-PCR amplification using only the first RT-PCR analysis in certain samples (see Figure 16).

[0734] • These data represent an outstanding achievement, not typically expected in standard and ordinary molecular analysis.

[0735] Example 7 Comparison of sensitivity of the present assay against prior art long PCR.

[0736] The inventors identified a publication (Mori et al 2022, ASM Journals Microbiology Spectrum) reporting long PCR amplification of HIV- 1. Mori et al (2022) utilised two sets of primers reported to amplify the CA-PR-RT-IN (gag-IN) regions.

[0737] In order to assess the sensitivity of the present assay against other long PCR methods, the inventors conducted comparative experiments using the same PCR protocol as follows (Note: *numbering based on position on HXB2).

[0738] Experimental methods

[0739] Primer sets used for this experiment:

[0740] • Prior Art Test-1: gag-nef outer primer

[0741] gag-nef 1st FW: ATCTCTAGCAGTGGCGCCCGAACAG 625*^649* gag-nef 1st Rev: CACTCAAGGCAAGCTTTATTGAGGC 9630*^9696* • Prior Art Test-2: gag-IN outer primer

[0742] gag-IN 1st FW: ATCTCTAGCAGTGGCGCCCGAACAG 625*^649* gag-IN 1st Rev: CCTGT ATGCAGACCCC A ATATG 5243*^5264*

[0743] • Set-26:

[0744] Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^807* Cap-INRvll: CCACACAATCATCACCTGCC 5054*^5073*

[0745] RT-PCR (SuperScript IV One-Step RT-PCR kit (ThermoFisher, cat# 12594100))

[0746] DDW 6.5 pL

[0747] 2 x reaction Mix 12.5 pL

[0748] Forward primer (20pM) 0.25 pL

[0749] Reverse primer (20pM) 0.25 pL

[0750] SuperScript IV RT 0.50 pL

[0751] Viral RNA sample 5.0 pL

[0752] Total 25.0 pL PCR Protocol

[0753] 45°C(20 min), 98°C(2 min), [98°C(10 sec), 62°C (45sec), 72°C(2minl5sec)] x50 cycles, 72°C (5min).

[0754] Samples (total 3 samples per experiment)

[0755] • DDW (negative control)

[0756] • 20 copy / pl plasmid (positive control)

[0757] • 1 RNA sample extracted from plasma, diluted 5 times (ID 1814: pVL was 102,629 copies / ml).

[0758] Results

[0759] The results are shown in Figure 9. In summary, the results indicate:

[0760] • gag-IN outer primer set (Prior Art Test-1) failed to amplify both 20 copy / pl plasmid positive control and the RNA sample (ID1814 1 / 5).

[0761] • gag-IN outer primer set (Prior Art Test-2) amplified the 20 copy / pl plasmid positive control to the specific expected size band.

[0762] • gag-IN outer primer set (Prior Art Test-2) failed to amplify the RNA sample (ID 1814 1 / 5).

[0763] • Set-26 primer set succeeded to amplify the specific band in both the 20 copy / pl plasmid positive control and the RNA sample.

[0764] These results indicate that the Set-26 primer set of the present disclosure has much better sensitivity to amplify the specific PCR product, compared with the prior art Test-1 and Test-2 primer sets.

[0765] Example 8 2ndcomparison of sensitivity of the present assay against prior art long PCR.

[0766] To further assess the detection sensitivity of the PCR primer set of the present disclosure against the primers of Mori et al (2022), a second comparison experiment was conducted. In this assessment, more RNA samples with relatively higher pVL (>50,000 copes / ml) were included, without dilution. For the 2ndcomparison a different PCR kit was used, the “One Step RT-PCR Kit from Takara Bio (cat#R026A)” for the prior art primers.

[0767] Experimental methods

[0768] Primer sets used for this experiment:

[0769] • Prior Art Test-3: gag-nef outer primer No.2

[0770] gag-nef 1st FW No.2: CTCTCTCGACGCAGGACTCGGCTTG 681 *- 705* gag-nef 1st Rev: CACTCAAGGCAAGCTTTATTGAGGC 9630*^9696*

[0771] • Set-26:

[0772] Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^807* Cap-IN Rvll: CCACACAATCATCACCTGCC 5054;:^5073;':

[0773] Test-3 (PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, cat#R026A) DDW 6.75 pL

[0774] 2 x One Step High Fidelity Buffer 12.5 pL

[0775] Forward primer (20pM) 0.125 pL

[0776] Reverse primer (20pM) 0.125 pL

[0777] PrimeScript II RT Enzyme Mix 0.5 pL

[0778] PrimeSTAR GXL for 1 step RT-PCR 2.0 pL

[0779] Viral RNA sample 5.0 pL

[0780] Total 25.0 pL

[0781] PCR Protocol for Test-3

[0782] 45°C(15 min), 94°C(2 min), [98°C(10 sec), 68°C (90 sec)]x50 cycles)

[0783] The same “One-Step RT-PCR kit from ThermoFisher (cat# 12594100)” was used for the present primer set Set-26, and the amplification conducted as described above.

[0784] Samples (total 7 samples per PCR)

[0785] • DDW (negative control)

[0786] • 20 copy / pl plasmid (positive control)

[0787] • 5 RNA samples extracted from plasma, with very high levels of pVL.

[0788] ID 1947: plasma VL 102,126 copy / ml

[0789] ID 1948: plasma VL 113,160 copy / ml

[0790] ID 1949: plasma VL 93,160 copy / ml

[0791] ID1950: plasma VL 53,032 copy / ml

[0792] ID 1951: plasma VL 609,548 copy / ml

[0793] Results

[0794] The results are shown in Figure 10. In summary, the results indicate:

[0795] • The gag-nef outer primer No.2 set (Prior Art Test-3) has less capability to amplify the positive control HIV-1 DNA sample with 20 copies / pl, indicating that this primer set cannot efficiently hybridize to the target HIV binding site when the concentration of the target sequence is low.

[0796] • However, when the concentration of the target sequence is high such as in ID 1947, the primer set easily hybridizes to the target HIV binding site and generates strong HIV- 1 amplified band. • Yet, the prior art Test-3 primer set showed less consistent amplification of the target HIV-1 sequence for ID1948 and ID1951, where the pVL was higher > 110,000 copies / ml).

[0797] • Prior Art Test-3 primer set failed to amplify both RNA samples, ID1949 and ID1950 which had pVL < 100,000 copies / ml for the specific HIV target sequence.

[0798] • In contrast, Set-26 shows great ability to amplify the positive control of HIV- 1 DNA sample with 20 copy / pl, indicating that this primer set can efficiently hybridize to the target HIV binding site even when the concentration of the target sequence is low.

[0799] • Set-26 primers consistently amplify the target HIV-1 sequence in all tested samples to generate strong bands.

[0800] These results clearly indicate that the Set-26 primer set of the present disclosure has much better sensitivity to amplify the specific target, compared with Test-3 primer set.

[0801] Example 9 3rdcomparison of sensitivity of the present assay against prior art long PCR.

[0802] To expand the assessment of detection sensitivity of the present PCR primer sets, a third comparison experiment with the primer sets of Mori et al (2022) was conducted using lower plasma VL samples.

[0803] Experimental methods

[0804] Primer sets used are as follows:

[0805] • Prior Art Test-3: gag-nef outer primer No.2

[0806] gag-nef 1st FW No.2: CTCTCTCGACGCAGGACTCGGCTTG 681 *- 705* gag-nef 1st Rev: CACTCAAGGCAAGCTTTATTGAGGC 9630*^9696*

[0807] • Prior Art Test-1: gag-nef outer primer

[0808] gag-nef 1st FW: ATCTCTAGCAGTGGCGCCCGAACAG 625*^649*

[0809] gag-nef 1st Rev: CACTCAAGGCAAGCTTTATTGAGGC 9630*^9696*

[0810] • Prior Art Test-2: gag-IN outer primer

[0811] gag-IN 1st FW: ATCTCTAGCAGTGGCGCCCGAACAG 625*^649*

[0812] gag-IN 1st Rev: CCTGTATGCAGACCCCAATATG 5243*^5264*

[0813] • Set-74:

[0814] Cap-INF3: GAGAGATGGGTGCGAGAGC 791*^806*

[0815] Cap-INRv43: AAACTKTKCCATGTTCTAATCCTCATCCTGTC 5080*^5111*

[0816] The same “PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, cat#R026A)” was used for the Prior Art Test-1, Test-2 and Test-3, and the amplification conducted as described in the above Examples. The same “One-Step RT-PCR kit from ThermoFisher (cat# 12594100) was used for the present primer set Set-74, and the amplification conducted as described above.

[0817] Sample (total 7 samples)

[0818] • DDW (negative control)

[0819] • 20 copy / pl plasmid (positive control)

[0820] • 4 RNA samples extracted from plasma with low levels of pVL.

[0821] Sample ID pVL HIV-1 Subtype

[0822] ID1552: plasma VL 251,000 copy / ml CRF01 AE subtype ID1553: plasma VL 8,200 copy / ml B subtype

[0823] ID1555: plasma VL 3,170 copy / ml CRF01 AE subtype ID1558: plasma VL 3,500 copy / ml G & CRF02_AG subtype

[0824] Results

[0825] The results are shown in Figure 11. In summary, the results indicate:

[0826] • Prior Art Test-1, 2, 3 primer sets have less capability to amplify the PC HIV-1 DNA sample with 20 copies / pl, indicating that these primers cannot efficiently hybridize to the target HIV binding site when the concentration of the target sequence is low.

[0827] • The Prior Art Test-1, 2, 3 sets failed to amplify the RNA samples with pVL <8,500 copies / ml).

[0828] • The present Set-74 primer set showed significantly improved ability to amplify the PC HIV-1 DNA sample with 20 copy / pl and all tested RNA samples.

[0829] Example 10 Summary of findings from Examples 7-9

[0830] The results obtained from Examples 7-9 and as shown in Figures 9-11 support that the present primer sets have tremendous sensitivity and specificity to amplify the expected HIV target sequence, compared with Test-1, 2, 3 prior art primer sets.

[0831] The data illustrates that the present primer sets are able to amplify the specific HIV PCR target in the positive control having as low as 20 copies / pl HIV-1 DNA sample generating amplicons of over 4000 bp. This is an unexpected and surprisingly high amplification capability for long HIV DNA amplification. This level of sensitivity is nearly as high as the standard quantitative Real-Time PCR test for plasma viral load analysis which is based on TaqMan probe analysis (short PCR products are used for TaqMan assays).

[0832] The data also shows that the present primer sets are able to amplify the specific HIV PCR target in RNA samples extracted from plasma, with pVL ranging from 3000 copies to 8000 copies / ml and over. This amplification was performed with a single one-step RT PCR to generate a specific and single amplified band of more than 4000 bp. Again, this is an unexpected and surprisingly high amplification capability and allows the present assay to perform long HIV DNA amplification from an RNA sample.

[0833] Example 11 Further evaluation of present primers in plasma samples

[0834] RT-PCR amplification efficiency for the present primer Set-29 was conducted using 32 HIV+ plasma samples.

[0835] Set-29: Cap-INF6: GAGATGGGTGCGAGAGCGTCA

[0836] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0837] Experimental methods

[0838] HIV-1 RNA was extracted from the plasma samples using QIAamp Viral RNA Mini Kit (Qiagen, Cat No. 52904).

[0839] The plasma HIV-1 RNA was performed in the same manner as described in Example 1.

[0840] To assess the amplified product, DNA was sequenced with Oxford Nanopore Technology. Before sequencing, the DNA was purified using Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA) at a ratio of 0.8:1, and then analyzed with 1% E-Gel™ Agarose EX Gel (Cat No. G401001) and quantified using the Qubit IX dsDNA BR Assay Kit (Thermo Fisher Scientific).

[0841] DNA libraries for nanopore sequencing were prepared using either Native Barcoding kit 24 V12 (SQK-NBD112.24) or Native Barcoding Kit 96 V14 (SQK-NBD114.96), following protocols Ligation sequencing amplicons - Native Barcoding Kit 24 V12 (SQK-NBD112.24 -NBA_9135_vl 12_revJ_01Dec2021) or V14 (NBA_9168_v114_revH_15Sep2022), provided by Oxford Nanopore Technology (ONT, Oxford, UK). For all samples, 25 to 75 fmol of DNA amplicons were end-repaired, barcoded with unique adapter indexes and pooled, long fragment buffer was used for the final wash. The concentration of the prepared DNA library was measured with the Qubit dsDNA HS assay kit, before loading into the port of a R10.4 or R10.4.1 flow cell (ONT). The sequencing run was performed for one hour, with fastbasecalling, in a MinION Mk1C device and MinKNOW software (ONT). Super accurate basecalling was performed after sequencing using Guppy software. The sequences were evaluated with the Stanford HIV Drug Resistance Database (https: / / hivdb.stanford.edu), obtaining drug resistance profile for each sample. Mutations were reported using a Mutation Detection Threshold of 20%.

[0842] Archived Sanger sequencing data was obtained from the St Vincent’s Hospital Drug Resistance Assay for all samples and was used as reference to compare with the Nanopore sequences, only for PR / RT / IN regions, as Sanger does not include Capsid region. Results

[0843] The inventors observed a highly specific long RT-PCR analysis forming single bands for 32 plasma samples. In other words, excellent sensitivity with single bands was achieved from a single RT-PCR analysis, and this detection was consistent across all 32 samples. These plasma samples were from the SVH diagnostic laboratory (see Figure 14).

[0844] HIV-1 drug resistance data was generated using the Stanford HIV Drug Resistance Database web-based mutation analysis (https: / / hivdb.stanford.edu). Figure 15 provides an example of the standard analysis for Protease (PR), Reverse Transcriptase (RT), Integrase (IN), and Capsid (CA). The HIV Drug Resistance Analysis in this figure was based on the present assay.

[0845] The drug resistance mutations detected in these samples are indicated in Table 3.

[0846] The exact same resistance mutations were identified using two sequence analysis methods in all three classes of ART:

[0847] 1. Long RT-PCR amplification (based on the assay of the present disclosure) followed by Nanopore sequencing analysis.

[0848] 2. Two separate nested PCR analyses followed by Sanger sequencing analysis.

[0849] The data suggests that the present assay was able to detect all drug mutations as the gold-standard Sanger sequencing for drug resistance analysis. Analysis Method (ii) is based on the SVH standard service for the HIV-1 resistance assay for plasma samples obtained from patients. This is a similar assay to conventional HIV-1 resistance assay known in the art.

[0850] The assay has excellent sensitivity, being able to detect drug mutations in samples as low as 3,510 cp / ml pVL (NGS sample ID N140).

[0851] Capsid analysis data is available only for Analysis Method (i). Thus, the present method has the capability to detect capsid mutations that could not be detected by Analysis Method (ii), as well as all mutations in the PR / RT / IN regions. This supports that the present assay is achieving hospital-level service detection of mutations in the CA / PR / RT / IN regions which represents a significant improvement over present drug resistance assays. Table 3: Drug resistance mutations detected with the present assay and with Sanger sequencing

[0852]

[0853]

[0854]

[0855]

[0856] Notes

[0857] Under “Other mutations”, the first two letters indicate the region in which the detection is detected. E.g., INS119R indicates a S119R substitution in the EN region was detected.

[0858] The term “for both” indicates that the mutations were detected using both the present assay and with Sanger sequencing. Example 12 Evaluation of Detection Sensitivity of Long RT-PCR for HIV-1 Drug Resistance Analysis.

[0859] To further evaluate RT-PCR amplification sensitivity with the Set-29 primer, HIV-1 plasmid DNA with a defined copy number per pl was used for further analysis.

[0860] Set-29: Cap-INF6: GAGATGGGTGCGAGAGCGTCA

[0861] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0862] Results

[0863] The experimental data indicates that the Set-29 PCR primer set is extremely sensitive, able to amplify HIV-1 DNA from as little as 2 copies / pl, forming clear, specific single bands across three different PCR annealing temperatures: 58°C, 62°C, and 66°C.

[0864] The Set-29 primer set operates effectively within a broad annealing temperature range of 58°C to 66°C, producing specific amplification even after 50 PCR cycles, suggesting a very stable amplification with wide-ranging annealing conditions to get one single PCR band.

[0865] This level of sensitivity is usually achieved with quantitative Real-Time PCR analysis using short PCR fragments of around 100 base pairs.

[0866] Due to the high sensitivity of the Set-29 primer, this assay enables perform long RT-PCR amplifications using only the first RT-PCR analysis with RNA extracted from plasma samples received at the SVH diagnostic laboratory (see Figure 14).

[0867] Even with DBS samples, which contain around 100 pl of whole blood, it was possible to achieve long RT-PCR amplification using only the first RT-PCR analysis in these samples (see Figure 16).

[0868] This data supports that the present primer sets have a surprisingly high specificity and sensitivity, which would not typically be expected in a standard and routine molecular analysis using ordinary primers.

[0869] Example 13 Evaluation of HIV-1 RNA structure

[0870] The RNA from HIV forms a highly sophisticated loop structure, some of these structures are as described in Watts etal (2009), Nature 460, 711-716. The inventors conducted an exhaustive testing of numerous primer sets to better understand the relationship between these regulatory structures and the amplification of long amplicons from HIV-1.

[0871] The inventors discovered that there are two particular tight structures in specific regions within the gag region and pol region of HIV- 1, where HIV-1 RNA forms a highly sophisticated tight structure. The inventors discovered that primers having binding positions located within this region result in difficulties with amplifying HIV-1 RNA.

[0872] The inventors named the two regions as the Tight Structure gag (TS-gag) and Tight Structure pol (TS-pol) regions. Tight Structure gag (TS-gag)

[0873] The inventors conducted two set of PCR analysis to see impact of the forward primer location (Note: *numbering based on position on HXB2).

[0874] Set-9 LTRF: GAGCCTGGGAGCTCTCTG 503*^519*

[0875] Cap-IN Rev7: CACAATCATCACCTGCCATCTGTTTTCCATA Set-19 Cap-IN F3: TGGGTGCGAGAGCGTC 791*— >806*

[0876] Cap-IN Rev8: AATCATCACCTGCCATCTGTTTTCCATA

[0877] The sample used, RNA ID1630, was obtained from in-vitro HIV-1 cultured experiments, containing at least 1000 times higher HIV-1 RNA copy numbers compared with samples from patient plasma (ID1734, ID1735):

[0878] • RNA ID1734: pVL 1,435,451 copies / ml

[0879] • RNAID1735: pVL 354,000 copies / ml

[0880] As shown in Figure 12, there is a significant difference in amplification efficiency as shown by the specific PCR amplified band using “LTR F” and “Cap-IN F3”.

[0881] The Set-9 with the forward primer “LTR F” achieved a very weak PCR band of expected amplicon position with two additional strong non-specific bands in much lower position of the expected position in RNA ID1630 analysis.

[0882] However, when forward primer “Cap-IN F3” was used in the Set-19 analysis, the inventors were able to amplify strong PCR bands at higher annealing temperature 59°C and 63°C.

[0883] Detailed position of the “LTR F” and “Cap-IN F3” are shown below.

[0884] Forward Primers Position on HXB2

[0885] LTRF: GAGCCTGGGAGCTCTCTG 503^519

[0886] Cap-IN F3: TGGGTGCGAGAGCGTC 791^806

[0887] The inventors postulate based on this data that there is a region comprising highly tight structures in the gag region between the location of “LTR F: 503*— >519*” and “Cap-IN F3: 791*— >806*” (*numbering based on position on HXB2).

[0888] Thus, to achieve highly sensitive PCR analysis, it is necessary to avoid the Tight Structure gag (TS-gag) region.

[0889] In contrast, there was no impact of the alternative use of either reverse Cap-IN Rv7 and Cap-Rv8 on PCR amplification, as shown below (under line sequences are identical in both primers). Cap-IN Rev7: CACAATCATCACCTGCCATCTGTTTTCCATA

[0890] Cap-IN Rev8: AATCATCACCTGCCATCTGTTTTCCATA

[0891] As DNA polymerase extends DNA synthesis from the 3' end (ATA), the inventors hypothesize that since Cap-IN Rev7 and Cap-IN Rev8 have identical sequences at the 3' end, there is no impact on PCR amplification on using either Cap-IN Rev7 and Cap-IN Rev8.

[0892] The inventors performed further experiments for additional analysis of the TS-gag structure. The results of these additional experiments are shown in Figure 4-1 (Note: *numbering based on position on HXB2).

[0893] Set-24: Cap-IN F4: GAGAGATGGGTGCGAGAGC 785*^803* Cap-IN Rvll: CCACACAATCATCACCTGCC

[0894] Set-25: Cap-IN F5: GAGAGATGGGTGCGAGAGCGTCA 785*^808* Cap-IN Rvll: CCACACAATCATCACCTGCC

[0895] Set-26: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^808* Cap-IN Rvll: CCACACAATCATCACCTGCC

[0896] Set-27: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^808* Cap-IN Rvl7: ACACAATCATCACCTGCCATCTGTTTTCCAT

[0897] Set-28: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^808* Cap-IN Rvl8: ATCATCACCTGCCATCTGTTTTCCAT

[0898] Set-29: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^808*

[0899] Cap-IN Rv42 AAACTKTKCCATGTTCTAATCCTCATCCTGTCYAC

[0900] Set-30: Cap-IN F6: GAGATGGGTGCGAGAGCGTCA 787*^808* Cap-IN Rv43 AAACTKTKCCATGTTCTAATCCTCATCCTGTC

[0901] As shown in Figure 4-1, using all above primer sets, 10 times diluted HIV-1 RNA (approx. pVL of 35,900 copies / ml) was able to be amplified.

[0902] Therefore, the inventors identify that the TS-gag region is located from 503* to 784* (*numbering based on position on HXB2).

[0903] Tight Structure pol (TS-pol)

[0904] The inventors also conducted 6 set of PCR analyses to analyse the impact of the reverse primer location (Note: *numbering based on position on HXB2).

[0905] Set-31: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0906] Cap-IN Rvll: CCACACAATCATCACCTGCC 5045*^5073*

[0907] Set-32: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA Cap-IN Rvl7: ACACAATCATCACCTGCCATCTGTTTTCCAT 5041*^5071* Set-33: Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0908] Cap-IN Rvl8: ATCATCACCTGCCATCTGTTTTCCAT 5041*^5066*

[0909] Set-36: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0910] Cap-IN Rv51: TCTAGCATCCCCTAGTGGGATGTGTACTTCYGA 5197*^5229* Set-37: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0911] Cap-IN Rv52: TCTAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5229* Set-38: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0912] Cap-IN Rv53: TAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5227*

[0913] The sample used, RNA ID1755 had a pVL of 359,000 copies / ml. The sample 1 / 10 ID1755 contained an equivalent amount of HIV-1 RNA obtained from pVL 35,900 copies / ml, which was due to the 10 times dilution of the same sample.

[0914] As shown in Figure 13-1 and 13-2, there was a significant difference in amplification efficiency to form the specific PCR amplified band using “Cap-IN Rvll, Rvl7, Rvl8” and “Cap-IN Rv51, Rv52, Rv53”.

[0915] Set-31, 32, 33 with the reverse primer “Cap-IN Rvll, Rvl7, Rvl8” achieved strong PCR amplified bands at the expected size in RNA 1755 analysis. However, when reverse primer “Cap-IN Rv51, Rv52, Rv53” in Set-36, 37, 38 was used, the inventors noted a failure to amplify the specific PCR amplification in the RNA 1755 sample.

[0916] The inventors performed further confirmation experiments for additional analysis of the TS-pol structure. The results of the additional experiments are as shown in Figure 4-3 (Note: *numbering based on position on HXB2) with additional primer Set-39.

[0917] Set-36: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0918] Cap-IN Rv51: TCTAGCATCCCCTAGTGGGATGTGTACTTCYGA 5197*^5229* Set-37: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0919] Cap-IN Rv52: TCTAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5229* Set-38: Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0920] Cap-IN Rv53: TAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5227* Set-39: Cap-IN F3: TGGGTGCGAGAGCGTC

[0921] Cap-IN Rv53 TAGCATCCCCTAGTGGGATGTGTACTTC 5200*^5227*

[0922] As shown in Figure 4-3, using all above primer sets, 10 times diluted HIV-1 RNA (approx. pVL of 35,900 copies / ml) was not able to be amplified.

[0923] The inventors postulate based on this data that there is another tight structure in the pol region between the location of “Cap-IN Rvll, Rvl7, Rvl8: 5041*— >5073*” and “Cap-IN Rv51, Rv52, Rv53: 5197*— >5229*” (*numbering indicates position based on HXB2). Thus, to achieve highly sensitive PCR analysis, it is necessary to avoid the Tight Structure pol (TS-pol) region.

[0924] In contrast, there is no impact of the forward primer Cap-IN F4 and Cap-IN F3 long on PCR amplification, as shown below (under line sequences are identical in both primers).

[0925] Cap-IN F4: GAGAGATGGGTGCGAGAGC

[0926] Cap-IN F3 long: TGGGTGCGAGAGCGTCARTA

[0927] Cap-IN F5: GAGAGATGGGTGCGAGAGCGTCA

[0928] The primer binding sequences of associated with the above forward primers of Cap-IN F4 and Cap-IN F3 long are extremely conservative across all HIV-1 subtypes. In fact, the Cap-IN F5: GAGAGATGGGTGCGAGAGCGTCA: 785*^808*, described in above section of TS-gag region (Figure 4-1), is aligned well with Cap-IN F4 and Cap-IN F3 long sequences (under line sequences are identical in three primers). Therefore, there is no impact of the PCR amplification using Cap-IN F4 and Cap-IN F3 long, because both primers avoid the TS-gag region: TS-gag region is located from 503* to 784* (*numbering based on position on HXB2).

[0929] Therefore, the inventors identify that the TS-pol region is located from 5112* to 5229* (*numbering based on position on HXB2).

[0930] Summary

[0931] As described above, the inventors have very carefully assessed and designed the forward and the reverse primer binding sites to avoid this tight HIV RNA structure of “Tight Structure gag (TS-gag) and Tight Structure pol (TS-pol) and at the same time achieving the highest sensitivity and specifically including the last integrase drug resistant mutation R263K (as shown in Figure 1-4).

[0932] In fact, the inventors have analysed the binding positions of the prior art primer sets used in the comparative data in Examples 7 -9, and found that these forward and reverse primer sets were designed outside of the “Tight Structure gag (TS-gag) and Tight Structure pol (TS-pol). Thus, during PCR amplification, the TS-gag and TS-pol structures would interfere with proper amplification of HIV-1. As shown in the comparison data, less amplification efficiency was observed in the one-Step RT PCR analysis, due to two tight structure regions of TS-gag and TS-pol at both ends of the HIV-1 CA-PR-RT-IN region analysis.

[0933] Primers Position on HXB2 gag-nef 1st FW No.2: CTCTCTCGACGCAGGACTCGGCTTG 681*— >705*

[0934] gag-nef 1st FW: ATCTCTAGCAGTGGCGCCCGAACAG 625*— >645*

[0935] gag-nef 1st Rev: CACTCAAGGCAAGCTTTATTGAGGC 9630*^9606* gag-IN 1st Rev: CCTGTATGCAGACCCCAATATG 5243*^5264* The inability of the prior art primer sets to amplify the relevant areas of HIV-1 relates to the lack of consideration of these TS-gag and TS-pol regions when undertaking forward and reverse primer design.

[0936] In fact, the inventors have identified three major difficulties for developing optimal primer sets for long PCR amplification of the HIV-1 CA-PR-RT-IN region:

[0937] (i) Short PCR analysis is better than long PCR analysis in achieving sensitivity and specificity.

[0938] In general, it is established in the art that for quantitative Real-Time PCR analysis of DNA and RNA sequences, PCR analysis for short targets is better at achieving specific and sensitive PCR as compared with long PCR analysis. Thus, most prior art methods have focused on short PCR analysis using quantitative Real-Time PCR analyses.

[0939] The present invention relies on long PCR analysis to target amplification of the entire HIV-1 CA-PR-RT-IN region, which is not short PCR. However, the resulting amplicon of the present method is much shorter than the PCR amplicon described in the other prior art long PCR methods tested herein. The present PCR primer sets aim to amplify the minimal length of the HIV-1 gag-pol region for a complete drug resistance assay, to achieve the highest sensitivity. Specifically, as part of the prime design it was important that the location of the reverse primer was designed to be able to read R263K, the last major Integrase drug resistant mutation. The present reverse primer set to designed to cover all integrase mutations.

[0940] (ii) Effective Long PCR analysis is not easily achieved due to the highly sophisticated HIV- 1 RNA structure.

[0941] As shown above, the TS-Gag and TS-Pol structures were not previously known, despite recognition in the art of the sophisticated structure of HIV- 1. The inventors, having identified the location of certain tight structures as well as their interfering function with long PCR amplification, were able to achieve the high sensitivity and specificity as shown above.

[0942] (iii) Intensive analysis is required to achieve a highly sensitive long PCR

[0943] There is a tendency among molecular experts in HIV-1 detection to assume that there is no need to spend time to achieve specific PCR amplification in molecular analysis, given the powerful detection abilities of new technology such as NGS. The shift appears to be towards high resolution and high sensitivity detection of any sequences using Nanopore, Ion Torrent or Illumina NGS technology.

[0944] The inventors designed the present assays as a way of circumventing the need to achieve specific PCR amplification for whole HIV-1 genomic RNA analysis. The present methods also enable specific PCR to get maximal sensitivity and specificity for detection of HIV in samples with limited amount of whole blood, such as DBS testing and infant HIV testing, where only a small volume of blood is available to assess whether the infant has HIV-1 infection and associated HIV drug resistant mutations. For this purpose, the inventors expended significant efforts in finding the optimal HIV-1 primer sets for HIV-1 CA-PR-RT-IN region analysis.

[0945] The achieved sensitivity levels allow for the detection of as few as 2 copies of HIV in the long PCR amplification of the HIV-1 CA-PR-RT-IN region. This sensitivity is equivalent to that achieved by quantitative Real-Time PCR analyses based on short PCR amplicons. In addition to this sensitivity, the long PCR amplification of the HIV-1 CA-PR-RT-IN region is highly specific, consistently producing a single band of amplified DNA even after 50 cycles of PCR amplification. Achieving the highest sensitivity and specificity in long PCR amplification of the HIV-1 CA-PR-RT-IN region is essential for the current clinical HIV-1 Drug Resistance Assay and future cure analysis. This is particularly crucial for detecting deeply hidden HIV-1 in reservoir cells, such as CD4+ T cells. The future of HIV-1 clinical management aims for a "functional cure," where patients would no longer require ART treatment. Identifying any potential hidden HIV-1 in reservoir cells is therefore both important and essential.

[0946] Example 14 Evaluation of HIV-1 Drug Resistance Analysis within HIV-1 reservoir of CD4+T cells in peripheral blood.

[0947] The inventors have developed a novel HIV viral outgrowth assay (VOA) that can identify hidden HIV-1 Drug Resistant mutation of replication-competent HIV-1 in the viral reservoir of CD4+T cells, using a small volume of blood (around 5ml).

[0948] Procedure

[0949] CD4+ T cells were isolated from 3 to 4 ml of fresh ACD-anticoagulated whole blood using the RosetteSep CD4 Enrichment Cocktail (StemCell Technologies, Vancouver BC, Canada), following the manufacturer's instructions. The CD4+T cells isolated from the patient’s peripheral whole blood was resuspended in 2 ml of RPMI containing 20% FCS and 20 lU / ml of IL-2 (Roche, Basel, Switzerland; 10799068001). Cells were counted using TruCount tubes (BD Biosciences, San Jose, California, USA) and simultaneously analyzed for purity, by flow analysis on a 5-laser Fortessa. Typically, 1.5-2 x 106cells at more than 96% purity of CD45+CD4+ cells were obtained and incubated in two wells of a 48-well plate (Coming, Coming, New York, USA). After addition of 5 pl of anti-CD3 / CD28 / CD2 (StemCell Technologies) plus IL-2, the Cells were cultured for 3-8 days in 5% CO2 at 37 °C, before RNA extraction, using the Maxwell RSC SimplyRNA Tissue kit. HIV-1 RNA transcript numbers in these cultures were normalized to copy numbers / input 106CD4+ T cells.

[0950] Results

[0951] The inventors previously established method is able to quantify HIV-1 RNA transcriptional activity extracted from ex- vivo CD4+ T cells (Figure 18, x axis; transcripts per 106CD4 T cells, ex-vivo analysis, y axis; transcripts per 106CD4 T cells, in-vitro analysis after activation), using the inventors Double R assay for detecting HIV-1 (Suzuki et al 2021, AIDS), shows a significant correlation with the corresponding HIV-1 RNA transcripts within CD4+ T cells after 7 days activation in vitro using anti-CD3 / CD28 / CD2 plus IL-2 (p = 0.001). The Double R pi-code assay is described in International Patent Application PCT / AU2017 / 050974.

[0952] Importantly, this shows that relative transcriptional activity is maintained after optimal stimulation.

[0953] Note that two samples showed extremely low levels of HIV-1 transcriptional activity both in ex-vivo analysis, and after stimulation in vitro.

[0954] Further analysis of drug-resistance mutations using NGS of cell associated RNA revealed that 4 out of 15 samples showed HIV-1 drug-resistant mutations (Figure 18: dark filled circles; 1 patient with RT resistance, 1 with PR; 2 with both; see Table 4 below), 9 samples showed replication-competent wild type without any HIV-1 drug-resistant mutations, (light unfilled circles), and 2 were not determined by intracellular analysis (light unfilled circles with asterisk *).

[0955] The VOA analysis (Table 4) showed that 9 out of 21 samples (43%) exhibited HIV-1 ART Resistance mutations, which were hidden within CD4-T cells under suppressed therapy. In contrast, 11 samples (57%) showed no resistance mutations, indicating the dominance of wild-type HIV-1 in those patients. However, replication-competent virus was revealed from deeply silenced reservoir cells.

[0956] These data are substantial findings in the field of HIV-1 research. Currently, even with the most advanced Next Generation Sequencing (NGS) approach and advanced bioinformatic analysis power, NGS analysis failed to identify HIV-1 drug resistance mutations from deeply silenced CD4+ T cells of the reservoir. The experimental data presented here support that the present assay enables detection of HIV-1 drug resistance mutations from deeply silenced CD4+ T cells of the reservoir.

[0957] Importantly, these Drug-Resistant mutations were identified in the CD4+T cells in patients whose plasma HIV viral load (pVL) is undetectable by conventional assays and furthermore it is possible, using anti-CD3 / CD28 / CD2 reagents, to optimally and reliably stimulate purified CD4 T cells, isolated from 5ml of blood, to identify deeply hidden replication-competent HIV.

[0958] These findings are enabled by the development of the highly sensitive analysis method described herein. Table 4: Drug resistance mutations detected in CD4+ T cells in the reservoir using the present assay

[0959]

[0960]

[0961] Notes:

[0962] - Drug abbreviations:

[0963] 5 ABC abacavir IDV / r indinavir / r

[0964] ATV / r ab acaatazanavir / r LPV / r lopinavir / r

[0965] AZT zidovudine 15 NFV / r nelfinavir

[0966] DDI didanosine RAL raltegravir

[0967] D4T stavudine SQV / r saquinavir / r EVG elvitegravir TDF tenofovir

[0968] FPV / r fosamprenavir / r TPV / r tipranavir / r

[0969] FTC emtricitabine 20 3TC lamivudine

[0970] - ID number from 841 to 950 is reflecting Drug Resistant analysis in Figure 18, based on intracellular RNA analysis. - (B) indicates blip episode. Blip episode numbers during 2 years prior to the baseline was indicated in the next column.

[0971] (N) indicates no blip episode observed during 2 years prior to the baseline. Example 15 Evaluation of HIV-1 Drug Resistance Analysis of viral reservoir CD4+T cells in peripheral blood with direct ex-vivo analysis

[0972] The inventors have developed a novel HIV-1 assay for ex-vivo analysis that can identify hidden drug-resistant mutations in replication-competent HIV-1 within the viral reservoir cells, using a small blood volume (approximately 3 ml). This assay does not require any culture procedures. After isolating HIV reservoir cells from peripheral blood, the HIV-1 resistance assay is directly conducted using cell-associated HIV-1 RNA obtained from the blood. Due to the highly specific and sensitive long RNA HIV-1 analysis in this assay, the assay can effectively identify the presence of HIV-resistant mutations hidden within the viral reservoir.

[0973] Procedure

[0974] White blood cells were isolated from 3 ml of fresh ACD-anticoagulated whole blood using the Red Blood Cell Lysis Buffer (Cat. No. 11814389001, Roche Diagnostic). Cellular RNA extraction was performed using the Maxwell RSC RNA Tissue kit (Promega). Two analyses were then conducted: (i) the Double R assay for HIV-1 transcript activity, and (ii) the new HIV-1 resistance assay on the extracted RNA from ex-vivo samples, as described in Example 14.

[0975] Results

[0976] Ongoing, sustained high levels of HIV- 1 transcription activity were identified by the Double R assay. Further analysis of drug-resistance mutations using ex-vivo cell-associated RNA revealed that samples with ongoing sustained levels of HIV-1 transcription contain replication-competent HIV-1 with drug-resistant mutations (Table 5).

[0977] In the analysis of patient ID2094, resistant mutations were identified in three classes of ART: PR, RT, and IN inhibitors. High levels of potential resistant mutations were detected. Although this patient experienced four blips within two years, with each blip measuring <20 cp / ml in pVL, their pVL remains controlled under the current ART regimen. The resistant mutation analysis revealed that this patient harbored highly resistant mutated HIV-1 hidden within the viral reservoir in peripheral blood.

[0978] Similar findings were obtained in the analysis of ID2098, where the new resistance assay identified potential resistant mutated HIV-1 in two classes of ART: PR and RT inhibitors. The analyses of ID2095, ID2097, and ID2125 identified potential resistant mutated HIV-1 in RT inhibitors. Despite these findings, the patients' pVL remains controlled under their current ART regimens.

[0979] Although patient ID2125 experienced five blips within two years, the other three patients (ID2095, ID2097, and ID2115) had only a single blip within the same period. In all cases, the blip levels were <20 cp / ml in pVL, and their pVL continues to be controlled under the current ART regimens. The resistance mutation analysis revealed that these patients harbor highly resistant mutated HIV-1 hidden within the viral reservoir in peripheral blood. This demonstrates that the new resistance assay has significant potential for the future of HIV-1 clinical management.

[0980] To further expand on the viral reservoir analysis, the inventors applied a new resistance assay to a treatment failure (TF) patient. This patient’s plasma viral load (pVL) was consistently elevated, ranging between 200 and 1000 copies / mL, but did not show a significant rebound, maintaining around 200 copies / mL for more than 1 year.

[0981] Findings:

[0982] • HIV-1 Plasma Analysis: Clear detection of the Ml 84V resistance mutation in the RT region, indicating resistance to 3TC and FTC.

[0983] • HIV-1 Cell-Associated DNA Analysis: The Ml 84V mutation was also confirmed in the RT region, consistent with the plasma findings.

[0984] • HIV-1 Cell-Associated RNA Analysis: Results were split:

[0985] o Analysis 1: Detected the Ml 84V mutation, matching the plasma and DNA results.

[0986] o Analysis 2: Revealed potential resistance mutations across all three ART classes (PI, RT, and INSTI), along with numerous stop codons. These findings showed high-level resistance mutations in RT and INSTI, with intermediatelevel resistance mutations in PI.

[0987] o Note: Two PCR amplicons were able to be amplified from separate lOpL RNA extracts, corresponding to results from Analysis 1 and Analysis 2. Implications:

[0988] These results suggest that if these resistant strains are replication-competent, there is a risk of reactivation and complications, particularly if ART is interrupted or if the current regimen proves insufficient. There have been no previous reports showing this type of information, mainly due to the lack of detection sensitivity in traditional resistance assays.

[0989] In cancer clinical management, new research and diagnostic trends are emerging, utilizing single-cell analysis to identify early-stage cellular modifications that lead to cancer. In contrast, HIV-1 clinical management has relied on outdated strategies for over 20 years. This is partly due to the lack of sensitive assays to detect drug-resistant mutations within hidden HIV-1 reservoirs. The inventor’s present novel assay has the potential to open new diagnostic avenues for detecting early-stage hidden HIV reservoirs. This assay will play an important role in the pursuit of a "functional cure," where patients would no longer require ART. Identifying hidden HIV-1 in reservoir cells is essential for advancing clinical patient management and achieving long-term treatment goals. Table 5: The ex-vivo analysis using the present assay identified HIV ART resistance mutations.

[0990]

[0991]

[0992] Drug name abbreviations are as indicated below Table 4.

[0993] (B) indicates blip episode. Blip episode numbers during 2 years prior to the baseline was indicated in the following column. Example 16 APOBEC3 Signatures in HIV Reservoir Associate with Arterial Inflammation through Interferon Pathways

[0994] Despite durable viral suppression with antiretroviral therapy (ART), comorbidities (especially cardiovascular diseases - CVD) and inflammation are prevalent in people with HIV (PWH). Mechanisms may include HIV driven interferon (IFN)-mediated immune activation, low-level productive infection, HIV transcripts, and APOBEC3 (given its regulation by IFN and emerging links to atherosclerosis). These factors were investigated focusing on putatively APOBEC3 -mediated premature stop codons (PSCs), and drug resistance mutations (DRMs), as a surrogate for low level productive infection.

[0995] Methods

[0996] PBMCs from ART-suppressed individuals (n = 36) were analyzed for long HIV-1 gag / pol transcripts (>4.2 kb) and PSCs as APOB EC3 -mediated mutation signature within viral reservoirs. Total RNA was extracted from cryopreserved PBMCs, and DRMs were assessed using Oxford Nanopore sequencing. CVD health was evaluated by arterial inflammation on PET imaging.

[0997] Results

[0998] Persistent in-frame gag / pol transcripts were detected in 66% of participants despite ART. Increased PSCs within long HIV transcripts were associated with aortic but not carotid inflammation (p=0.013; Figure 21). Among participants with detectable transcripts, 46% harbored DRMs, including triple-class resistance, but these were not associated with aortic inflammation, nor were serum / plasma biomarkers.

[0999] In univariable analyses, PSCs predicted aortic inflammation (3=0.00834, *p=0.013), whereas sCD14 or sCD163 did not. Demographic adjustments did not affect this. In multivariable analyses including PSCs, sCD14, and sCD163, both PSCs (3 =0.00754, *p=0.023) and sCD14 (3 =4.011, *p=0.045) were contributors to aortic inflammation. With IP10 included, only PSCs remained significant (3=0.0074, *p=0.023).

[1000] Conclusions

[1001] APOBEC3 signatures within viral reservoirs independently associated with aortic inflammation, but not other markers including DRMs. sCD14 may reflect IFN-driven monocyte activation, supporting the role of the IFN-APOBEC3-macrophage axis provides a plausible link between persistent viral transcription and vascular inflammation. Targeting IFN-driven reservoir activity and APOBEC3 dysregulation may offer novel therapeutic strategies for comorbidities and cure in PWH. Ill

[1002] Example 17 Long HIV Transcripts and APOBEC3-Mediated Blocks: A Hidden Driver of Brain Injury

[1003] Despite effective antiretroviral therapy (ART) suppressing plasma HIV-1 RNA to undetectable levels for extended periods, certain individuals living with HIV (PLWH) develop brain injury which is clinically significant and demonstrated by various tests including proton magnetic resonance spectroscopy (1H MRS) of the brain. The risk of such injury is especially increased with aging and comorbidities.

[1004] The mechanisms driving this persistent brain injury remain poorly understood and warrant further investigation. In the context of chronic HIV-1 infection, several factors may contribute, including neurological and psychiatric comorbidities, aging-related conditions, legacy effects of previous suboptimal pre-ART treatment, limited central nervous system (CNS) penetration of ART, and potential ART -related neurotoxicity. Recently, accumulating evidence supports a continued role for HIV itself in CNS injury, even during effective ART. These studies have confirmed and extended earlier work showing the heterogeneity and compartmentalization of HIV reservoirs across the CNS especially the role of the frontal white matter (FWM) as a potential sanctuary site.

[1005] Next-generation sequencing (NGS) has revealed that the majority of HIV- 1 DNA in viral reservoirs is replication-incompetent. Additionally, APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like)-mediated hypermutation can introduce further defects that disrupt viral protein translation. Indeed, more than 95% of integrated HIV-1 proviruses are defective. Still, viral rebound generally occurs within weeks of treatment interruption, indicating that a minority of reservoir cells harbor replication-competent HIV capable of reactivation.

[1006] Moreover, HIV-1 proteins may contribute to chronic immune activation and inflammation even in the absence of replication-competent virus. Recent studies have shown that partially translated HIV-1 proteins can still be expressed from defective proviruses in reservoirs under suppressive ART.

[1007] Previous studies suggest persistent expression of long HIV-1 transcripts in a subset of individuals despite suppression. How these transcripts relate to short transcripts and whether they contribute to neuropathogenesis — via toxic viral RNA species, HIV protein expression, or low-level replication — remains an open and clinically relevant question. Further, long RNA transcripts may identify drug resistance mutations (DRM) and restriction factors such as the APOBEC family that can clarify which of viral RNA, protein or low level whole virus replication is important.

[1008] To do so, the inventors next sought to investigate the activity of circulating peripheral viral reservoirs in blood — a more accessible and clinically relevant compartment. Specifically, the present developed assay for long HIV-1 gag / pol frame RNA transcripts was assayed in CD4+T cells as well as the role of DRMs and APOBEC3 -derived premature stop codons (PSC). In particular, the inventors were interested in exploring how these measures relate to brain injury, providing new insights into the pathogenic role of HIV infection.

[1009] Methods

[1010] Twenty-seven HIV- 1 -infected male participants receiving fully suppressive antiretroviral therapy (ART) were enrolled in an ongoing prospective study of CNS HIV-1 latency and NeuroHIV biomarkers (ClinicalTrials.gov Identifier: NCT02989285). Inclusion criteria required stable HIV infection with sustained viral suppression. The study protocol was approved by the St. Vincent’ s Hospital Human Research Ethics Committee, and all participants provided written informed consent prior to enrolment.

[1011] Isolation of CD4+ T cells from peripheral blood mononuclear cells (PBMC)

[1012] PBMCs were isolated from acid-citrate dextrose (ACD) anti-coagulated blood by density centrifugation using Ficoll-Paque Plus (GE Healthcare, Chicago, IL, USA). Isolated PBMCs were cryopreserved in heat-inactivated, filter-sterilized bovine serum (ThermoFisher Scientific, Waltham, MA, USA) containing 10% dimethyl sulfoxide (DMSO; Sigma- Aldrich, MO, USA) using a controlled-rate freezer (Planer, Middlesex, UK) and stored in the vapor phase of liquid nitrogen.

[1013] CD4+T cells were isolated from thawed PBMCs using a previously described method22. Average of CD4+T Cell purity was exceeded 95%, as confirmed using the same protocol.

[1014] Short HIV-1 RNA transcripts analysis

[1015] RNA extraction and short HIV-1 RNA transcripts analysis as in the previously described method (Suzuki et al 2019 and Suzuki et al 2021).

[1016] Long HIV-1 RNA transcripts analysis

[1017] Long HIV-1 RNA transcripts (>4.5 kb in the gag / pol frame), encompassing four major ART -targeted regions (capsid, protease, reverse transcriptase, and integrase), were analyzed as in previously described method of the Australian Provisional Patent 2024903454. Briefly, long RNA transcripts were amplified using a one-step RT-PCR protocol followed by nested long-range DNA PCR. This approach generated >4.5 kb amplicons of the gag / pol frame region for downstream sequencing.

[1018] Nanopore Sequencing analysis

[1019] DNA samples for nanopore sequencing were prepared. Briefly, amplicons were purified using the AMPure XP beads (Beckman Coulter, Brea, CA, USA), and their concentration was measured using a Qubit 4 Fluorometer with the Qubit IX dsDNA HS Assay Kit (Thermo Fisher Scientific). DNA libraries for nanopore sequencing were prepared using the Native Barcoding Kit 96 V14 (SQK-NBD114.96), following the ONT protocol Ligation Sequencing Amplicons - Native Barcoding Kit 24 V14 (NBA_9168_v114_revH_15Sep2022; Oxford Nanopore Technologies, Oxford, UK).

[1020] Amplicons were end-repaired, barcoded with unique adapters, and pooled. Long Fragment Buffer was used for the final wash. The prepared DNA library was quantified using Qubit and then loaded onto an R10.4.1 flow cell (ONT). Sequencing was performed on a MinION Mk1C device using MinKNOW software (ONT), with fast base-calling enabled for a one-hour run.

[1021] Analyses of the Drug resistance mutations and phylogenetic tree

[1022] Based on duplex reads obtained from nanopore sequencing for each sample, prevalence of drug resistance mutations (DRMs) and PSCs within pol were examined. In this study, the majorDRMs listed in Stanford HIV database (https: / / hivdb.stanford.edu / ) were adopted for the analyses. DRMs that could arise from APOBEC3 editing were defined. To explore the DRMs and PSCs from the reads, reads were mapped on a partial HXB2 sequence (GenBank ID: K03455, 2,253-5,096 nt) as the reference. Then, reads that fully cover sequences between the 1st codon of protease (PR) and the 264th codon of integrase (IN) (2,253-5,021 nt according to HXB2 coordinate) were selected, because all the major DRMs appear between the PR 30th codon and IN 263rd codon. It was confirmed that coverage of the selected reads reaches more than 100 per sample. The subsequent analyses focused on the pol sequences between the PR 1st codon and IN 264th codon within the selected reads. By using the curated sequences, persite prevalence of each major DRM was examined for the respective samples. Prevalence of PSCs at any positions was investigated as well. In addition, prevalence of a genotype which carries unique combination pattern of major DRMs in the presence or absence of PSCs at any position within pol were also explored. A 5% cutoff was applied for identification of the DRMs in this analysis in order to reflect any potential signal of the DRMs due to a CA viral mRNA analysis within the viral reservoirs. The 5% cutoff applied the following justifications: i) Duplexed reads with bidirectional strand analysis, ii) >100 reads per site, with at least 100x depth, a 5% variant would be supported by >5 reads, iii) Even low-frequency variants (5-10%) can have clinical significance 40, especially in ART-experienced patients.

[1023] In contrast, consensus nucleotide sequence was generated for each sample based on the most dominant nucleobase at every position among the curated sequences. The consensus sequences were subjected to multiple alignment with MAFFT v 7.372 (https: / / pubmed.ncbi.nlm.nih.gov / 23329690 / ) followed by inference of approximately-maximum-likelihood phylogenetic tree with FastTree ver. 2.142. The inferred tree was drawn with FigTree vl.4.4 (http. / / tree bi

[1024]

[1025] ae j / oftwj e / figftge / ). Proton Magnetic Resonance Spectroscopy CH MRS)

[1026] The analysis of 'H MRS brain scans was performed as previously described (Suzuki et al 2022). Briefly, spectra were acquired using a Philips 3T Ingenia scanner (Philips, Best, Netherlands). Cerebral metabolite concentrations were quantified using point-resolved spectroscopy (PRESS) with echo time (TE) = 40 ms and repetition time (TR) = 2000 ms. Data were collected from the FWM, posterior cingulate cortex (PCC), and caudate nucleus.

[1027] Viral Outgrowth Assay (VOA)

[1028] VOA was performed for participants LAT015, LAT027, and LAT040 to assess the potential release of replication-competent HIV-1 from CD4+T cells. This assay measures the ability of latent HIV to reactivate and produce infectious virus under stimulating conditions. The procedure was conducted as previously described (Suzuki et al 2021).

[1029] Statistical analysis

[1030] HIV-1 RNA transcriptional activity in PBMCs was quantified as previously described (Suzuki et al 2021). Standard curves were generated from known concentrations of HIV-1 plasmid copy numbers using GraphPad Prism v9 (GraphPad Software). CA HIV-1 short RNA transcript copy numbers were measured using the Double-R assay.

[1031] Comparisons between the short RNA transcript levels and the number of ART drug classes with detected drug resistance mutations (DRMs) were performed using non-parametric Mann- Whitney U tests.

[1032] Similarly, comparisons of NAA values in three brain regions — FWM, PCC, and caudate nucleus caudate — based on differences in the number of ART drug classes with DRMs were also conducted using Mann-Whitney U tests.

[1033] Linear regression analysis between CA-short RNA transcript levels and NAA values in the three brain regions (FWM, PCC, caudate nucleus) was performed using Pearson correlation analysis.

[1034] Results

[1035] Detection of CA HIV-1 short transcripts in CD4+ T cells isolated from PBMCs Participants in this study were, on average, 56.0 years old and predominantly white Australian men with chronic, treated HIV. The median duration of HIV infection was 23 years without significant comorbidities. All were on suppressive ART. The median baseline CD4+ T-cell count was 669 cells / pL. Ten participants (37%) had a historical diagnosis of AIDS, with a median nadir CD4+ T cell count of 225 cells / pL.

[1036] CD4+T cells were isolated from stored PBMCs by depleting CD14+ monocytes, followed by negative selection of CD4+T cells, achieving an average purity >95% (see Methods for details). CA HIV-1 short RNA transcripts were quantified in these CD4+T cells. Short RNA transcripts were detected in all 27 individuals, with a median of 4,405 copies per 106CD4+T cells (Figure 22A, C). In contrast, plasma HIV-1 RNA was detectable in only 14.8% of individuals, with a median below detection limit (Figure 22A, B). These findings demonstrating high levels of short RNA transcripts within viral reservoir cells indicate that substantial transcriptional activity persists in these cells despite prolonged plasma viral suppression.

[1037] Detection of CA HIV-1 long gag / pol frame transcripts in CD4+T cells isolated from PBMCs The inventors next assessed the present long RNA approach to determine whether CA HIV-1 long gag / pol frame transcripts could be detected in those with RNA isolated from the viral reservoirs for hidden “Reservoir HIV-1 drug resistance mutations (DRMs)”. The long transcripts were successfully amplified in 21 of 27 individuals (78%) (Figure 23). In the individuals where long transcripts were not detected, lower levels of short transcripts were observed (e.g., LAT017, LAT041, LAT014, LAT002, LAT005: dots indicated in square of Figure 22). This suggests a potential relationship between short and long transcript levels, with possible implications for brain injury.

[1038] Next, Nanopore-based NGS was performed to assess the presence of DRMs and PSCs within the pol region of the 21 samples with detectable long transcripts at a variable range of prevalence across samples, and some samples contained pol sequences bearing DRMs but no PSCs. Full-length duplex reads were analyzed using a 5% variant frequency cutoff to capture potential low-frequency DRMs in the CA viral mRNA (see Methods). Detected DRMs were categorized into three classes: protease inhibitors (Pls), non-nucleoside reverse transcriptase inhibitors (NNRTIs), and nucleoside reverse transcriptase inhibitors (NRTIs), with prevalence illustrated using color-coded bars. Resistance mutations were identified in 9 of the 21 individuals: (i) Single-class resistance - NNRTI (1 case), NRTI (2 cases); (ii) Dual-class resistance - PI / NNRTI (2 cases), NNRTI / NRTI (1 case); (iii) Triple-class resistance -PI / NNRTI / NRTI (3 cases; see Figure 23).

[1039] Linking reservoir DRMs to current and past ART

[1040] The inventors then assessed whether Reservoir DRMs were linked to current ART or to prior regimens. In participant LAT027, who exhibited triple-class resistance, PI and NRTI DRMs aligned with current ART, whereas an NNRTI DRM reflected treatment from >21 years ago (Figure 24).

[1041] Nanopore NGS showed that DRMs from both past and present exposures coexisted within single viral genomes, indicating long-term persistence within the reservoir.

[1042] Similarly, LAT040 presented with NRTI and some PI DRMs associated with current ART, while additional PI and NNRTI DRMs were attributable to treatment >10 years earlier. Here, PI and NRTI DRMs were found on the same genomes, although NNRTI DRM linkage was inconclusive (<5% prevalence).

[1043] In the remaining participants (LAT018, LAT043, LAT008, LAT004, LAT033, LAT009, LAT029), DRMs were exclusively linked to current ART. Linkage analysis confirmed that multiple DRMs co-occurred within single viral genomes (Figure 24), demonstrating that the reservoir not only retains past resistance but also accumulates new mutations under long-term ART — supporting the hypothesis of ongoing low-level viral replication.

[1044] Viral Outgrowth Assay (VOA) and Phylogenetic Analysis

[1045] To assess whether replication-competent virus (virions containing intact gag / pol frames) could be recovered from CD4+T cell reservoirs, viral outgrowth assays (VOA) were performed in three participants (LAT015, LAT027, LAT040). CD4+T cells were successfully expanded using optimal anti-CD3 / CD28 / CD2 stimulation.

[1046] Long HIV-1 RNA transcripts were amplified from (i) supernatants and (ii) CA-RNA from cultured CD4+T cells. DRM analysis of VOA-derived virions matched the resistance profiles detected in ex vivo CA-RNA (Figure 23). Phylogenetic analysis across four datasets — baseline ex vivo CA-RNA, Month 24 ex vivo CA-RNA, CA-RNA from cultured cells, and VOA virions — showed high genetic concordance.

[1047] Amplification from VOA supernatants failed for LAT015 and LAT027, but CA-RNA was successfully recovered from cultured CD4+T cells of LAT015. In this case, phylogenetic analysis confirmed genetic similarity between Month 24 ex vivo CA-RNA and CA-RNA from cultured cells (Figure 23).

[1048] To evaluate longitudinal stability, CA-RNA was also analyzed at two time points in participants LAT033, LAT036, and LAT038. Long RNA transcripts remained genetically stable over time (Figure 23).

[1049] CA HIV-1 Short and Long RNA Transcripts and Their Relationship with Brain Injury Associations between HIV-1 transcriptional activity in CD4+T cells and brain injury were examined. Building on prior findings linking short HIV-1 RNA in CSF CD4+T cells to NAA in FWM, a similar significant inverse correlation between short RNA transcripts in PBMC-derived CD4+T cells and NAA levels in the FWM was observed, as measured by ’H-MRS (Figure 25). An additional inverse correlation was still observed in the posterior cingulate cortex though slightly less significant (PCC; Fig. 25D), but there was no relationship with the caudate nucleus (Fig. 25E).

[1050] The relationship between long CA-RNA transcripts and brain injury was next evaluated. A significant difference in FWM NAA levels was observed between individuals with and without detectable long transcripts (Figure 25A, p = 0.003). Participants in whom long HIV-1 RNA could not be amplified (LAT017, LAT041, LAT002, LAT005; highlighted in grey in Figure 25A and Figure 22C) had significantly higher FWM NAA levels and significantly lower levels of the short RNA transcripts (Figure 25B), suggesting less injury. Neither NAA levels in PCC or caudate were correlated with long transcripts.

[1051] Notably, individuals with long RNA transcripts containing DRMs across three ART classes exhibited significantly lower NAA levels in FWM compared with individuals failing to amplify the long RNA transcripts (Figure 25 A), indicating greater brain injury in association with persistent transcription and multidrug resistance.

[1052] APOBEC3 -Mediated Disruption of Gag / Pol Translation Protects Against HIV-Associated Brain Injury

[1053] Lastly, the potential impact of APOB EC3 -derived PSCs on HIV-1 gag / pol protein expression in viral reservoirs was assessed. APOB EC3 -induced PSCs in the pol region are expected to block full-length gag / pol protein translation. The inventors hypothesized that a higher prevalence of such PSCs would lead to greater inhibition of Gag-Pol polyprotein synthesis, reducing viral protein expression even in the presence of transcription.

[1054] For estimation purposes, the inventors assumed that the absence of long gag / pol frame (unspliced) genomic RNA corresponds to complete inhibition of gag / pol translation. Based on this model, a significant inverse correlation between inferred pol protein expression in CD4+T cells and brain injury was observed, as measured by NAA in FWM as shown in Figure 25F.

[1055] Most importantly, individuals with high levels of APOB EC3 -mediated editing in the gag / pol region — resulting in PSCs — also showed higher levels in NAA in FWM. In participants lacking detectable gag / pol transcripts in peripheral CD4+T cells, no evidence of brain injury was observed (shown as dark grey and light grey circles in Figure 25F).

[1056] These findings suggest a paradoxical but protective role for APOBEC3 activity: while introducing defective proviruses, APOB EC3 -induced PSCs may disrupt translation of neurotoxic HIV proteins from unspliced RNA, thereby limiting neuronal injury. Importantly, expression of the viral proteins Tat and Rev is essential for the transcription and nuclear export of full-length genomic HIV-1 RNA transcripts (gag / pol frame) in reservoirs. Among these, Tat has been identified as a significant contributor to HIV-associated brain injury.

[1057] Discussion

[1058] This study shows that both short and long RNA transcripts correlate with brain injury in the FWM but not the more “classical” caudate nucleus. Importantly, long transcripts contained DRMs from both current and past ART regimens. Perhaps most significantly, the inventors observed that APOBEC3 mediated PSCs correlate with less brain injury providing a solid evidence base for the significance of transcripts and their encoded proteins. The current data extends and confirms previous findings demonstrating that PBMC-derived analyses reflect active reservoir dynamics and that long HIV-1 long RNA transcripts in CD4+T cells contributes specifically to FWM injury.

[1059] Importantly, the relationships between DRMs and APOBEC3 -derived PSCs with brain injury provide evidence for the dominant significance of transcripts rather than low level whole virus replication. That the presence of DRMs but not the number correlated with brain injury argues against DRMs playing a significant role; one would expect increasing brain injury with increasing DRMs. The inverse relationship between APOBEC PSCs and brain injury provides a “natural experiment” testing the significance of the transcripts: increasing PSCs associated with progressively fewer transcripts and less brain injury, thereby confirming the importance of transcripts in brain injury.

[1060] The results of the DRM analyses showing low-frequency mutations linked to both current and historical ART exposures with newly acquired DRMs frequently co-occurring with archived DRMs on the same RNA genome, suggest ongoing evolution within the reservoir. Importantly, active RNA genomes exhibited relatively few premature stop codons, consistent with sustained transcriptional competence.

[1061] Phylogenetic analyses of viral outgrowth assays (VOA) further demonstrated the persistence and evolution of DRMs over time, with stable viral linkages across multiple sampling points. In contrast, individuals with a high burden of APOBEC-mediated PSCs displayed limited DRM development, suggesting that host restriction factors may constrain reservoir evolution in some cases.

[1062] The present findings also have important implications for HIV functional cure studies and treatment interruption trials. Individuals with no detectable long RNA transcripts and low levels of CA HIV-1 short RNA showed no evidence of brain injury. Notably, in 5 out of 6 individuals where long HIV-1 RNA transcripts could not be amplified, the short RNA levels were low (<500 copies per 106CD4+T cells; Figure 22). These individuals represent ideal candidates for cure and interruption studies. Monitoring CA HIV-1 short and long RNA transcripts could become a critical biomarker when plasma viral loads are undetectable by current diagnostic assays.

[1063] Overall, these findings confirm and extend the finding that ART induced suppression in the plasma does not equate to complete viral control. Persistent transcription of CA HIV-1 short and long RNA transcripts — and the continued evolution of DRMs within the reservoir likely contribute to ongoing neurocognitive injury which in turn is mitigated and possibly prevented by APOB EC3 -derived PSCs. Monitoring and targeting these transcripts will be critical for optimizing neurocognitive outcomes and advancing HIV cure strategies. Indeed, therapeutic targeting of APOBEC3 provides a novel approach to address these. Example 18 Discussion

[1064] The present disclosure describes the development of a highly sophisticated and exclusive primer set for long PCR analysis of four classes of HIV-1 inhibitors including i) capsid inhibitors, ii) protease inhibitors, iii) reverse transcriptase inhibitors, and iv) integrase strand transfer inhibitors. Such forward / reverse primer combinations that are able to capture mutations that are relevant to HIV drug susceptibility that can be conducted in a single, one-step long PCR is not easily discovered and is a substantial finding in the art.

[1065] The present inventors after careful and meticulous testing of numerous primer pairs have been able to identify the ideal “Forward primer hybridization region” and “Reverse primer hybridization region” for long PCR analysis as shown for example in Figure 1-2 and Figure 1-3. This represents a substantial improvement over prior art assays since a one-step Long PCR assay is not easily achieved due to the sophisticated HIV-1 RNA structure, which interferes with amplification and results in low sensitivity and specificity.

[1066] In most cases, PCR amplification for the present HIV-1 resistance assay can be performed with one step Reverse Transcriptase (RT)-PCR. After this, it is possible to proceed with a nested PCR analysis from the 1st Reverse Transcriptase (RT)-PCR amplified DNA to increase PCR sensitivity or specificity. This ability to add on an additional nested PCR is preferable for samples with low RNA / DNA levels, such as from dried blood spot (DBS) samples and for infant HIV testing. The data shown in Figure 3 illustrates that the present primer sets are able to amplify the specific HIV PCR amplified band from RNA / DNA obtained from DBS, which contains only around 100µl of whole blood. This level of sensitivity and specificity is not easily achieved by standard PCR primers routinely designed by a standard molecular scientist.

[1067] Considering the vast genetic diversity of HIV-1 subtypes, designing good primers for HIV-1 is not a routine and straightforward task. Ideal primer selection should be based on the following two factors:

[1068] • ability to amplify all HIV-1 subtypes: aiming especially at the 3 -prime end of the primer in both forward and reverse primer. The Taq-polymerase enzyme extends from the 3- prime end of the primer (detailed data for the present primers is described in Figure 5 and Figure 6)

[1069] • avoid primer dimer formation: The analysis of the present primer sets indicates that any possible primer dimer formation is not going to be extended by Taq-polymerase enzyme because they are non-extensible primer dimers (detailed data for the present primers is described in Figure 7).

[1070] The present assay allows multiplex PCR sequencing analysis with up to 96 samples of PCR amplicons, based on the Oxford Nanopore sequencing. Currently, the inventors analysed 16 samples in one sequencing run with a runtime of only one hour. Utilising the present assay with Oxford Nanopore Technologies (ONT) sequencing will be much cheaper and accurate compared with Sanger sequencing, which is the gold standard of HIV-1 sequence analysis. The method enables whole drug resistance analysis to be performed in much shorter turnaround time to get results to the doctor and patient.

[1071] As shown by the data above, the present assay that the inventors have developed is very specific, and can be used for samples from DBS. DBS samples are very convenient and easy to transfer to diagnostic laboratory for testing, especially for underdeveloped countries and remote areas.

[1072] Another advantage of the present method is that the long PCR amplicon can also be analysed with Sanger sequencing or other NGS technologies, in cases where those technologies are already available in the laboratory.

[1073] The ability of the present assay to be applied as a novel viral outgrowth assay also represents a substantial finding, that cannot be replicated even with NGS technologies at the single cell level and using advanced bioinformatic analytical power. The present assay may also be applied to ex-vivo analysis of cellular associated HIV mRNA isolated from the viral reservoir CD4+T cells without the requirement of in vitro stimulation. The ability to detect drug-resistance mutations within the HIV-1 reservoir of CD4+ T cells represents a substantial advance owing to the high sensitivity and specificity of the present assay. These mutations with present conventional assays would be hidden in the reservoir, particularly under suppressed therapy. Patients achieving virologic suppression experience intermittent increases in their plasma HIV-1 RNA, referred to as “blips”. HIV-1 blip episodes likely reflect ongoing activity within HIV reservoirs, where latent viruses occasionally become active. The relationship between HIV-1 blip episodes and the presence of drug-resistant mutations is atopic of ongoing investigation in HIV clinical field. While isolated HIV-1 blips are not typically associated with drug-resistant mutations, persistent or frequent blips may warrant further investigation. Resistance testing and careful monitoring are important for managing patients who experience such blips, to rule out emerging drug resistance or other complications.

[1074] The present data indicate that even a single blip episode within 2 years prior to analysis can identify the presence of resistant mutations. This finding is based on direct analysis of viral reservoir cells in CD4+ T cells from patients with fully suppressed plasma viral loads (pVL) of either undetectable (ND, n=2) or <20 copies / ml (n=l), indicating no detectable plasma HIV RNA in these patients at the time of analysis.

[1075] This novel assay possesses the ability to effectively identify HIV-resistant mutations in replication-competent viruses present in hidden viral reservoirs. It has potential for use in the future of HIV-1 clinical management, particularly in the pursuit of a "functional cure," where patients would no longer require ART. Identifying hidden HIV-1 in reservoir cells is essential for advancing clinical patient management and achieving long-term treatment goals. The ability to detect drug resistance mutations from HIV-1 in the reservoir cells would also allow better clinical management of these patients in order to optimize virologic suppression through better selection of HIV- 1 drugs in ART.

[1076] Further, the inventors have identified a dual effect involving both long HIV RNA transcripts and premature stop codons with markers of brain injury, indicating that the present assay has utility in identifying patients who are at risk of neurocognitive injury. The inventors have also shown a strong correlation between cardiovascular disease and APOB EC3 -induced premature stop codons in the HIV genome, suggesting that persistent reservoir activity may contribute to major comorbidities in people living with HIV. These results confirm the robustness of the present assay and further demonstrate its power to generate clinically significant insights. The method holds clear potential as a biomarker tool for risk stratification and personalised HIV care, and this progress substantially strengthens both the scientific and translational impact of the present assay.

[1077] References

[1078] 1. Segal-Maurer et al. (2022) N Engl J Med; 386(19): 1793 -1803.

[1079] 2. Nka et al. (2022) J Antimicrob Chemother; 78(l):272-275.

[1080] 3. Dvory-Sobol et al (2022) Curr Opin HIV AIDS; 17(1): 15-21.

[1081] 4. Marrazzo et al (2022) N Engl J Med 2022; 386(19): 1848-1849.

[1082] 5. Mori et al. (2022) Microbiol Spectr; 10(4):e0150722.

[1083] 6. Suzuki et al. (2021) AIDS 35(13):p 2095-2103.

[1084] 7. Suzuki et al (2019) Journal of AIDS HIV Treatment 1, 68

[1085] 8. Suzuki et al (2022) PNAS 119, e2210584119 Table of sequences

[1086]

[1087]

[1088]

[1089]

[1090]

[1091]

Claims

Claims:

1. A method of determining susceptibility of a human immunodeficiency virus type 1 (HIV-1) to one or more drugs, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of susceptibility of the HIV to the one or more drugs.

2. A method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

3. The method of claim 1 or 2, wherein the HIV-1 nucleic acid is HIV-1 DNA.

4. The method of claim 3, wherein the HIV-1 DNA is integrated into the genome of a cell.

5. The method of claim 1 or 2, wherein the HIV-1 nucleic acid is HIV-1 RNA or complementary DNA (cDNA) reverse transcribed from RNA.

6. The method of claim 5, wherein the complementary DNA (cDNA) is reverse transcribed from the reverse primer.

7. A method of performing drug resistance testing in a subject with human immunodeficiency virus type 1 (HIV-1) or suspected of or having an HIV-1 infection, wherein the level of HIV-1 is not detectable in a plasma viral load test using serum or plasma from the subject, the method comprising performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, and subsequently detecting amplification of one or more mutations in the HIV-1 nucleic acid, wherein detecting the one or more mutations in the HIV-1 nucleic acid is indicative of resistance of the HIV-1 to one or more drugs.

8. The method of any one of claims 5 to 7, wherein the RNA is obtained from a cell or is cell-free RNA.

9. The method of any one of claims 1 to 8, wherein the one or more mutations are located in one or more of the following regions of HIV-1: capsid, protease (PR), reverse transcriptase (RT) and integrase (IN) regions.

10. The method of claim 9, wherein the one or more mutations are located in the capsid, PR, RT and IN regions.

11. The method of any one of claims 5 to 10, wherein the one or more mutations are detected in HIV-1 RNA without pre-amplification of the RNA prior to the PCR amplification.

12. The method of any one of claims 1 to 11, wherein the PCR amplification is long-range PCR.

13. The method of any one of claims 1 to 12, wherein the one or more mutations in the HIV-1 nucleic acid result in one or more amino acid substitutions in the HIV-1 virion selected from:(i) substitutions in the capsid region selected from one or more of: L56I, M66I, Q67H, K70N / R, N74D, A105E, T107N;(ii) substitutions in the protease region selected from one or more of: L10F / I / R / V, K20M / R, V32I, L33F / VV, M46I / L, I50V / L, F53L, I54V / M, A71V / T, G73S / C / A, V82A / F / T / S, L76V, I84V, N88S / D, L90M;(iii) substitutions in the reverse transcriptase region selected from one or more of: M41L, E44A, E44D, K65R, D67N, D67G, T69N, K70R, L74V, L74I, L100I, K101E / P / H, K103N / S, V106M / A, E138K / A / G / Q, Y181C / I / V, M184I, M184V, Y188L / C / H, G190A / E / S, L210W, T215D, T215E, K219R, K219E and P225H; and / or(iv) substitutions in the integrase region selected from one or more of: H51Y, T66I / K, E92Q, G140S / A, Y143C / H / R, S147G, Q148H / K / R, N155H, and R263K.

14. The method of claim 13, wherein the one or more amino acid substitutions comprise one or more of:(i) substitutions in the capsid region selected from one or more of: M66I, Q67H, K70N / R, N74D and A105E;(ii) substitutions in the protease region selected from one or more of: M46I / L, I50V / L, I54V / M, V82A / F / T / S, L76V, I84V, N88S / D and L90M;(iii) substitutions in the reverse transcriptase region selected from one or more of: D67N, D67G, T69N, L74V, M184I, M184V, L210W, L100I, K101E / P / H, K103N / S, V106M / A, Y181C / I / V, Y188L / C / H, G190A / E / S; and / or(iv) substitutions in the integrase region selected from one or more of: E92Q, G140S / A, Y143C / H / R, Q148H / K / R, N155H, and R263K.

15. The method of any preceding claim, wherein the PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and a sequence having 80% identity thereto.

16. The method of claim 15, wherein the PCR amplification is performed with:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(iv)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(v) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vi)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(vii) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(viii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(ix)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(x) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xi)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xiii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xiv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xvi) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xvii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xviii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xx) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxi) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xxii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xxv) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxviii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxx) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxi) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxv) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xxxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xxxviii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xxxix) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; or(xl)A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

17. The method of claim 16, wherein the PCR amplification is performed with:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto; or(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto.

18. The method of any preceding claim, wherein the PCR amplification is a nested PCR amplification which further comprises a second PCR amplification.

19. The method of claim 18, wherein the second PCR amplification is performed with a forward primer selected from the group consisting of: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of: SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 14, and a sequence having 80% identity thereto.

20. The method of claim 18 or 19, wherein the second PCR amplification is performed with:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(iv)A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(v) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vi)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(viii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(ix)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(x) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xi)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto; or(xii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

21. The method of claim 20, wherein the second PCR amplification is performed with:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; or(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto.

22. The method of any one of claims 6 to 21, wherein the subject is undergoing ART and experiencing virologic suppression.

23. The method of any preceding claim, wherein the HIV-1 nucleic acid is obtained from a CD4+ T cell isolated from the subject, or isolated from the subject’s plasma or serum.

24. The method of claim 23, wherein the isolated CD4+ T cells are activated with T cell activators.

25. The method of claim 24, wherein the T cell activators comprise one or more of: IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

26. The method of claim 25, wherein the T cell activators comprise IL-2, an anti-CD3 antibody, an anti-CD28 antibody and an anti-CD2 antibody.

27. The method of any preceding claim, additionally comprising detecting the amplified nucleic acid.

28. The method of any one of claims 1 to 27, further comprising obtaining a biological sample and preparing the HIV-1 nucleic acid or RNA encoded by a HIV-1 from the biological sample.

29. The method of claim 28, wherein the biological sample comprises sputum, blood, urine, cerebrospinal fluid and cervical / vaginal swab.

30. The method of claim 29, wherein the biological sample is a dried blood spot (DBS) sample.

31. A method of selecting a treatment for a subject suspected of or having HIV-1, the method comprising providing a biological sample from the subject, performing PCR amplification of a HIV-1 nucleic acid, wherein the PCR is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a tight structure in the pol region of HIV- 1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto, detecting amplification of one or more mutations in the HIV-1 nucleic acid, determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations, and selecting one or more drugs to which the HIV-1 is susceptible to treat the subject.

32. A method of monitoring HIV-1 therapy in a subject suspected of or having HIV-1, the method comprising:providing a first biological sample from the subject,performing a first PCR amplification of a HIV-1 nucleic acid,detecting amplification of one or more mutations located in the pol and gag regions of the HIV-1 nucleic acid,determining the susceptibility of the HIV-1 to one or more drugs based on the detection of amplification of the one or more mutations,selecting one or more drugs to which the HIV-1 is susceptible to treat the subject, administering the one or more selected drugs to the subject,obtaining a second biological sample from the subject,performing a second PCR amplification of a HIV-1 nucleic acid,detecting amplification of one or more mutations located in the pol and gag regions of the HIV-1 nucleic acid,determining the susceptibility of the HIV-1 to one or more drugs, andcomparing the susceptibility of the HIV-1 to one or more drugs in the first biological sample and the second biological sample, thereby monitoring the HIV-1 therapy in the subject, wherein the first and second PCR amplification is performed with a forward primer that binds to a forward primer hybridization region after a first region forming a tight structure in the gag region of HIV-1 (TS-gag), the first region ending at the residue corresponding to position 784 of SEQ ID NO: 18, or a sequence corresponding thereto, and a reverse primer that binds to a reverse primer hybridization region before a second region forming a looped structure in the pol region of HIV-1 (TS-pol), the second region starting at the residue corresponding to position 5112 of SEQ ID NO: 18, or a sequence corresponding thereto,.

33. The method of any one of claims 1 to 32, wherein the one or more drugs are selected from one or more of: a capsid inhibitor, a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor and an integrase strand transfer inhibitor.

34. The method of claim 33, wherein the one or more drugs comprise a capsid inhibitor such as lenacapavir, PF-07463216, and ABX464, a protease inhibitor (PI) such as atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir and tipranavir; a nucleoside reverse transcriptase inhibitor (NRTI) such as abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate and zidovudine; non-nucleoside reverse transcriptase inhibitor (NNRTI) such as doravirine, efavirenz, etravirine, nevirapine and rilpivirine; and an integrase strand transfer inhibitor (INSTI) such as bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

35. The method of any one of claims 1 to 34, wherein the one or more drugs are selected from one or more of: lenacapavir, PF-07463216, ABX464, atazanavir, darunavir, fosamprenavir, indinavir, lopinavir, nelfinavir, ritonavir, saquinavir, tipranavir, abacavir, didanosine, emtricitabine, lamivudine, stavudine, tenofovir disoproxil fumarate, zidovudine, doravirine, efavirenz, etravirine, nevirapine, rilpivirine, bictegravir, cabotegravir, dolutegravir, elvitegravir and raltegravir.

36. A primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and a sequence having 80% identity thereto.

37. An article of manufacture comprising a forward primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and a sequence having 80% identity thereto; and a reverse primer selected from the group consisting of: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and a sequence having 80% identity thereto.

38. The article of manufacture of claim 37, comprising:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(iv)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(v) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vi)A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(vii) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(viii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto;(ix)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(x) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xi)A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xiii) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xiv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xv) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xvi) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xvii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xviii) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xix) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xx) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxi) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 13 or a sequence having 80% identity thereto;(xxii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 4 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 16 or a sequence having 80% identity thereto;(xxv) A forward primer comprising the sequence set forth in SEQ ID NO: 5 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(xxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxviii) A forward primer comprising the sequence set forth in SEQ ID NO: 2 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 15 or a sequence having 80% identity thereto;(xxix) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxx) A forward primer comprising the sequence set forth in SEQ ID NO: 3 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 17 or a sequence having 80% identity thereto;(xxxi) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxiii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(xxxiv) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxv) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxvi) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xxxvii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xxxviii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xxxix) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(xl)A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto; or(xli) A forward primer comprising the sequence set forth in SEQ ID NO: 1 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 12 or a sequence having 80% identity thereto.

39. The article of manufacture of claim 33, further comprising:(i) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(ii)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(iii)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 11 or a sequence having 80% identity thereto;(iv)A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(v) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vi)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 14 or a sequence having 80% identity thereto;(vii) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(viii) A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(ix)A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 9 or a sequence having 80% identity thereto;(x) A forward primer comprising the sequence set forth in SEQ ID NO: 6 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto;(xi)A forward primer comprising the sequence set forth in SEQ ID NO: 7 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto; or(xii) A forward primer comprising the sequence set forth in SEQ ID NO: 8 or a sequence having 80% identity thereto and a reverse primer comprising a sequence set forth in SEQ ID NO: 10 or a sequence having 80% identity thereto.

40. A kit comprising a receptacle comprising a primer of claim 36 or an article of manufacture of any one of claims 37 to 39.

Images