Method for producing vascular endothelial cells derived from pluripotent stem cells

Abstract

This method for producing vascular endothelial cells derived from pluripotent stem cells comprises: a preparation step for preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress application step for applying a fluid shear stress to the vascular endothelial progenitor cells.

Description

Method for producing vascular endothelial cells derived from pluripotent stem cells

[0001] This invention relates to a method for producing vascular endothelial cells derived from pluripotent stem cells.

[0002] In order to apply pluripotent stem cells, such as human induced pluripotent stem cells (iPS cells), to regenerative medicine or disease models, the development of efficient differentiation induction methods is crucial. The same applies to differentiation induction into cardiovascular cells, and several studies have been reported on this topic. For example, International Publication No. 2014 / 192925 (Patent Document 1) discloses a method for producing endothelial cells from pluripotent stem cells, which includes a) a step of applying differentiation stimulation to pluripotent stem cells to form a cell population containing 20% ​​or more endothelial cell progenitor cells from the pluripotent stem cells; b) a step of culturing the cell population in a medium containing cAMP and VEGF so that the proportion of endothelial cell progenitor cells becomes 40% or more of the total cells; and c) a step of culturing the cell population obtained in b) in a medium containing VEGF to induce endothelial cells from endothelial cell progenitor cells.

[0003] International Publication No. 2014 / 192925

[0004] Cell sorting techniques such as fluorescence-activated cell sorting (FACS) are highly versatile techniques for separating and purifying specific cell types from heterogeneous cell populations. For example, Patent Document 1 discloses that performing cell sorting on a cell population containing differentiated vascular endothelial cells improves the purity of the vascular endothelial cells from 70% to 99%.

[0005] However, it is known that cell purification using cell sorting technology results in the physical destruction of some viable cells during the purification process. Furthermore, cell purification using cell sorting technology may introduce unwanted microorganisms. Under these circumstances, there is a need to develop a new method for producing highly purified vascular endothelial cells derived from human iPS cells for application in regenerative medicine.

[0006] This invention has been made in view of the above circumstances, and aims to provide a method for producing vascular endothelial cells derived from pluripotent stem cells that can be produced with high purity.

[0007] As a result of diligent research, the inventors have discovered that vascular endothelial cells can be generated with high purity by applying fluid shear stress to vascular endothelial progenitor cells (mesoderm-stage cells) derived from pluripotent stem cells, and have completed the present invention. In other words, the present invention is as follows.

[0008] [1] A method for producing vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from the pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells. [2] The method for producing vascular endothelial cells derived from pluripotent stem cells according to [1], wherein the stress loading step is performed by shaking culture, perfusion culture, or stirring culture of the vascular endothelial progenitor cells in vitro in a culture medium capable of differentiating into vascular endothelial cells. [3] The method for producing vascular endothelial cells derived from pluripotent stem cells according to [1] or [2], wherein the stress loading step is performed for a period of 2 days or more and 9 days or less. [4] The method for producing vascular endothelial cells derived from pluripotent stem cells according to any one of [1] to [3], which does not involve purifying the vascular endothelial cells by fluorescence-activated cell sorting (FACS), magnetic bead cell sorting (MACS), or both. [5] A method for producing vascular endothelial cells derived from pluripotent stem cells according to any one of [1] to [4], wherein the preparation step includes culturing the pluripotent stem cells to differentiate them into vascular endothelial progenitor cells, and the stress loading step is performed from the fifth day after the start of culturing the pluripotent stem cells. [6] A method for producing vascular endothelial cells derived from pluripotent stem cells according to any one of [1] to [5], wherein the pluripotent stem cells are iPS cells. [7] A method for purifying vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells. [8] A method for purifying vascular endothelial cells derived from pluripotent stem cells according to [7], wherein the stress loading step is performed by shaking culture, perfusion culture or stirring culture of the vascular endothelial progenitor cells in vitro in a culture medium capable of differentiating them into vascular endothelial cells. [9] A method for purifying vascular endothelial cells derived from pluripotent stem cells according to [7] or [8], wherein the stress loading step is performed for a period of 2 days or more and 9 days or less.

[10] A method for purifying vascular endothelial cells derived from pluripotent stem cells according to any one of [7] to [9], wherein the vascular endothelial cells are purified by fluorescence-activated cell sorting (FACS), magnetic bead cell sorting (MACS), or both thereof.

[11] A method for purifying vascular endothelial cells derived from pluripotent stem cells according to any one of [7] to

[10] , wherein the preparation step includes culturing the pluripotent stem cells to differentiate them into vascular endothelial progenitor cells, and the stress loading step is performed on or after the fifth day from the start of culturing the pluripotent stem cells.

[12] A method for purifying vascular endothelial cells derived from pluripotent stem cells according to any one of [7] to

[11] , wherein the pluripotent stem cells are iPS cells.

[13] A method for maturing vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells.

[14] The stress loading step is performed in vitro by shaking culture, perfusion culture or stirring culture of the vascular endothelial progenitor cells in a culture medium capable of differentiating into the vascular endothelial cells, as described in

[13] for maturation of vascular endothelial cells derived from pluripotent stem cells.

[15] The stress loading step is performed for a period of 2 days or more and 9 days or less, as described in

[13] or

[14] for maturation of vascular endothelial cells derived from pluripotent stem cells.

[16] The method for maturation of vascular endothelial cells derived from pluripotent stem cells according to any one of

[13] to

[15] , which does not include purifying the vascular endothelial cells by fluorescence-activated cell sorting (FACS), magnetic bead cell sorting (MACS), or both thereof.

[17] The preparation step is to culture the pluripotent stem cells and differentiate them into the vascular endothelial progenitor cells, and the stress loading step is performed 5 days or more after the start of culture of the pluripotent stem cells, as described in any one of

[13] to

[16] for maturation of vascular endothelial cells derived from pluripotent stem cells.

[18] The pluripotent stem cells are iPS cells, a method for maturing vascular endothelial cells derived from pluripotent stem cells as described in any of

[13] to

[17] .

[19] A cell population comprising vascular endothelial cells derived from pluripotent stem cells, wherein the vascular endothelial cells express endothelial nitric oxide synthase, and the proportion of vascular endothelial cells is 80% or more and 100% or less based on the total number of cells in the cell population.

[20] The cell population according to

[19] , wherein the vascular endothelial cells express CD31 or VE-Cadherin.

[21] The cell population according to

[19] or

[20] , which may further comprise cardiomyocytes or vascular wall cells.

[0009] According to the present invention, it is possible to provide a method for producing vascular endothelial cells derived from pluripotent stem cells with high purity.

[0010] Figure 1 is a schematic diagram showing the schedule for differentiation induction by shaking culture. Figure 2A is a schematic diagram (right side) showing the period of applying fluid shear stress (shearing culture period) and a graph (left side) showing the percentage of vascular endothelial cells in the cultured cells (horizontal axis). In the graph, the vertical axis shows the group name of each cell population. Figure 2B is a graph showing the percentage of vascular endothelial cells in the cultured cells (vertical axis). In the graph, the horizontal axis shows the group name of each cell population. Figure 2C is a graph showing the expression level of endothelial nitric oxide synthase (eNOS) in each cell population. In the graph, the horizontal axis shows the group name of each cell population, and the vertical axis shows the relative expression ratio relative to the control group. Figure 2D is a graph showing the percentage of vascular endothelial cells, viability, total cell number, number of vascular endothelial cells, number of cardiomyocytes, and number of vascular wall cells in each cell population. In the graph, the horizontal axis shows the group name of each cell population, and the vertical axis shows each parameter. Figure 3A is a graph showing the expression levels of eNOS in each cell population. In the graph, the horizontal axis shows the group name of each cell population, and the vertical axis shows the relative expression ratio relative to the expression of GAPDH, an endogenous control. Figure 3B is a microscopic image showing the results of the angiogenesis assay. Figure 3C is a graph showing the total length, total branch length, branch count, and mesh count obtained by the angiogenesis assay. The horizontal axis shows the group name of each cell population, and the vertical axis shows each parameter. Figure 4 is a graph showing the analysis results using an M-A plot. The horizontal axis shows the expression ratio relative to the expression level of the control (static culture), and the vertical axis shows the average expression level.

[0011] Hereinafter, one embodiment of the present invention (hereinafter referred to as "this embodiment") will be described. However, this embodiment is not limited thereto. In this specification, the notation in the form of "A to Z" means the upper and lower limits of the range (i.e., A or more and Z or less), and if no unit is specified for A and only a unit is specified for Z, the unit for A and the unit for Z are the same.

[0012] ≪Method for producing vascular endothelial cells derived from pluripotent stem cells≫ The method for producing vascular endothelial cells derived from pluripotent stem cells according to this embodiment includes a preparation step of preparing vascular endothelial progenitor cells derived from the above-mentioned pluripotent stem cells, and a stress loading step of applying fluid shear stress to the above-mentioned vascular endothelial progenitor cells.

[0013] <Preparation Step> In this step, vascular endothelial progenitor cells derived from pluripotent stem cells are prepared. In this embodiment, "vascular endothelial progenitor cells" means cells that have the ability to differentiate into vascular endothelial cells and express at least KDR (Kinase Domain-containing Receptor) or PDGFRα (α-type platelet-derived growth factor receptor). In other aspects of this embodiment, vascular endothelial progenitor cells can also be understood as cells committed to differentiation into vascular endothelial cells. "Vascular endothelial progenitor cells derived from pluripotent stem cells" means vascular endothelial progenitor cells differentiated from said pluripotent stem cells.

[0014] In this embodiment, the cell population (sample) containing vascular endothelial progenitor cells is not particularly limited, but may be, for example, in the form of a cell suspension, a cell aggregate, or a three-dimensional structure. The shape of the three-dimensional structure is not particularly limited and may include, for example, a tube, a cylindrical shape, or a sheet shape.

[0015] The above-mentioned vascular endothelial progenitor cells can be produced by differentiating them from pluripotent stem cells. Examples of such pluripotent stem cells include the following cells.

[0016] (A) Embryonic stem cells Embryonic stem cells (ES cells) are stem cells that are established from the inner cell mass of early embryos (e.g., blastocysts) of mammals such as humans and mice, and possess pluripotency and the ability to proliferate through self-renewal.

[0017] ES cells are embryonic stem cells derived from the inner cell mass of the blastocyst, which is the 8-cell stage of a fertilized egg after the morula stage. They possess the ability to differentiate into any cell that makes up an adult, known as pluripotency, and the ability to proliferate through self-renewal. ES cells were discovered in mice in 1981 (MJ Evans and MH Kaufman (1981), Nature 292:154-156), and subsequently, ES cell lines were established in primates such as humans and monkeys (JA Thomson et al. (1998), Science 282:1145-1147; JA Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; JA Thomson et al. (1996), Biol. Reprod., 55:254-259; JA Thomson and VS Marshall (1998), Curr. Top. Dev. Biol., 38:133-165).

[0018] ES cells can be established by extracting the inner cell mass from the blastocyst of a fertilized egg of a target animal and culturing the inner cell mass on a fibroblast feeder. Furthermore, cell maintenance through subculturing can be carried out using a culture medium supplemented with substances such as leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF). For methods of establishing and maintaining human and monkey ES cells, see, for example, USP5,843,780; Thomson JA, et al. (1995), Proc Natl. Acad. Sci. U S A. 92:7844-7848; Thomson JA, et al. (1998), Science. 282:1145-1147; H. Suemori et al. (2006), Biochem. Biophys. Res. Commun., 345:926-932; M. Ueno et al. (2006), Proc. Natl. Acad. Sci. USA, 103:9554-9559; H. Suemori et al. (2001), Dev. Dyn., 222:273-279; H. Kawasaki et al. (2002), Proc. Natl. Acad. This is described in Sci. USA, 99:1580-1585; Klimanskaya I, et al. (2006), Nature. 444:481-485, etc.

[0019] For ES cell production, a DMEM / F-12 culture medium supplemented with, for example, 0.1 mM 2-mercaptoethanol, 0.1 mM non-essential amino acids, 2 mM L-glutamic acid, 20% KSR, and 4 ng / ml bFGF was used, at 37°C and 5% CO2. ２ Human ES cells can be maintained in a moist atmosphere (H. Suemori et al. (2006), Biochem. Biophys. Res. Commun., 345:926-932). Furthermore, ES cells need to be passaged every 3-4 days, and this passage is performed using, for example, 1 mM CaCl ２This can also be done using 0.25% trypsin and 0.1 mg / ml collagenase IV in PBS containing 20% ​​KSR.

[0020] ES cell selection can generally be performed using Real-Time PCR, with the expression of gene markers such as alkaline phosphatase, Oct-3 / 4, and Nanog as indicators. In particular, for the selection of human ES cells, the expression of gene markers such as OCT-3 / 4, NANOG, and ECAD can be used as indicators (E. Kroon et al. (2008), Nat. Biotechnol., 26:443-452).

[0021] Human ES cell lines, such as WA01(H1) and WA09(H9), are available from the WiCell Research Institute. Additionally, KhES-1, KhES-2, and KhES-3 are available from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan).

[0022] (B) Spermatogonial stem cells Spermatogonial stem cells are pluripotent stem cells derived from the testes and are the cells that originate from spermatogenesis. These cells, like ES cells, can be differentiated into various cell lineages and have properties such as being able to create chimeric mice when transplanted into mouse blastocysts (M. Kanatsu-Shinohara et al. (2003) Biol. Reprod., 69:612-616; K. Shinohara et al. (2004), Cell, 119:1001-1012). Spermatogonial stem cells can self-replicate in a culture medium containing glial cell line-derived neurotrophic factor (GDNF), and can also be obtained by repeatedly subculturing under the same culture conditions as ES cells (Masayuki Takebayashi et al. (2008), Experimental Medicine, Vol. 26, No. 5 (Suppl.), pp. 41-46, Yodosha (Tokyo, Japan)).

[0023] (C) Embryonic germ cells Embryonic germ cells are pluripotent cells similar to ES cells, established from primordial germ cells during the embryonic stage, and can be established by culturing primordial germ cells in the presence of substances such as LIF, bFGF, and stem cell factor (Y. Matsui et al. (1992), Cell, 70:841-847; JL Resnick et al. (1992), Nature, 359:550-551).

[0024] (D) Induced Pluripotent Stem Cells Induced pluripotent stem cells (iPS cells) are artificial stem cells derived from somatic cells that possess characteristics nearly equivalent to those of embryonic stem cells (ES cells), such as differentiation pluripotency and the ability to proliferate through self-renewal, and can be produced by introducing specific reprogramming factors into somatic cells in the form of DNA, RNA, or protein (K. Takahashi and S. Yamanaka (2006) Cell, 126:663-676; K. Takahashi et al. (2007), Cell, 131:861-872; J. Yu et al. (2007), Science, 318:1917-1920; Nakagawa, M. et al., Nat. Biotechnol.26:101-106 (2008); International Publication WO 2007 / 069666). Reprogramming factors may consist of genes specifically expressed in ES cells, their gene products or non-coding RNAs, or genes that play an important role in maintaining the undifferentiated state of ES cells, their gene products or non-coding RNAs, or small molecule compounds. Examples of genes included in the reprogramming factors include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, or Glis1. These reprogramming factors may be used individually or in combination. The combinations of initialization factors are WO2007 / 069666, WO2008 / 118820, WO2009 / 007852, WO2009 / 032194, WO2009 / 058413, WO2009 / 057831, WO2009 / 075119, WO2009 / 079007, WO2009 / 091659, WO2009 / 101084, WO2009 / 101407, WO2009 / 102983, WO2009 / 114949, WO2009 / 117439, WO2009 / 126250, WO2009 / 126251, WO2009 / 126655, W O2009 / 157593, WO2010 / 009015, WO2010 / 033906, WO2010 / 033920, WO2010 / 042800, WO2010 / 050626, WO 2010 / 056831, WO2010 / 068955, WO2010 / 098419, WO2010 / 102267, WO 2010 / 111409, WO 2010 / 111422, WO2010 / 115050, WO2010 / 124290, WO2010 / 147395, WO2010 / 147612, Huangfu D, et al. (2008), Nat. Biotechnol., 26: 795-797, Shi Y, et al. (2008), Cell Stem Cell, 2: 525-528, Eminli S, et al.(2008), Stem Cells. 26:2467-2474、HuangfuD, et al. (2008), Nat Biotechnol. 26:1269-1275, Shi Y, et al. (2008), Cell StemCell, 3, 568-574、Zhao Y, et al. (2008), Cell Stem Cell, 3:475-479、Marson A, (2008), Cell Stem Cell, 3, 132-135、Feng B, et al. (2009), Nat Cell Biol. 11:197-203、RL Judson et al., (2009), Nat. Biotech., 27:459-461、Lyssiotis CA, et al.(2009), Proc Natl Acad Sci U S A. 106:8912-8917、Kim JB, et al. (2009), Nature. 461:649-643、Ichida JK, et al. (2009), Cell Stem Cell. 5:491-503、Heng JC, et al. (2010), Cell Stem Cell. 6:167-74、Han J, et al. (2010), Nature. 463:1096-100、Mali P, et al. (2010), Stem Cells. 28:713-720, Maekawa M, et al. (2011), Nature. 474:225-9.

[0025] The above-mentioned reprogramming factors include histone deacetylase (HDAC) inhibitors [e.g., small molecule inhibitors such as valproic acid (VPA), trichostatin A, sodium butyrate, MC 1293, M344, etc., nucleotide expression inhibitors such as siRNA and shRNA against HDAC (e.g., HDAC1 siRNA Smartpool® (Millipore), HuSH 29mershRNA Constructs against HDAC1 (OriGene), etc.)], MEK inhibitors (e.g., PD184352, PD98059, U0126, SL327, and PD0325901), and Glycogen. Synthasekinase-3 inhibitors (e.g., Bio and CHIR99021), DNA methyltransferase inhibitors (e.g., 5-azacytidine), histone methyltransferase inhibitors (e.g., small molecule inhibitors such as BIX-01294, nucleoside expression inhibitors such as siRNA and shRNA for Suv39hl, Suv39h2, SetDBl, and G9a), L-channel calcium agonist (e.g., Bayk8644), butyrate, TGFβ inhibitors or ALK5 inhibitors (e.g., LY364947, SB431542, 616453 and A-83-01), p53 inhibitors (e.g., siRNA and shRNA against p53), ARID3A inhibitors (e.g., siRNA and shRNA against ARID3A), miRNAs such as miR-291-3p, miR-294, miR-295 and mir-302, WntSignaling (e.g., soluble) Factors used to improve the establishment efficiency of Wnt3a), neuropeptide Y, prostaglandins (e.g., prostaglandin E2 and prostaglandin J2), hTERT, SV40LT, UTF1, IRX6, GLISl, PITX2, DMRTBl, etc. are also included, and in this specification, factors used for the purpose of improving the establishment efficiency of these factors are not distinguished from initialization factors.

[0026] If the reprogramming factor is in the form of a protein, it may be introduced into somatic cells by methods such as lipofection, fusion with cell membrane-permeable peptides (e.g., HIV-derived TAT and polyarginine), or microinjection.

[0027] On the other hand, when the reprogramming factor is in the form of DNA, it can be introduced into somatic cells by methods such as vectors (viruses, plasmids, and artificial chromosomes), lipofection, liposomes, and microinjection. Examples of viral vectors include retroviral vectors, lentiviral vectors (Cell, 126, pp.663-676, 2006; Cell, 131, pp.861-872, 2007; Science, 318, pp.1917-1920, 2007), adenovirus vectors (Science, 322, 945-949, 2008), adeno-associated virus vectors, and Sendai virus vectors (WO 2010 / 008054). Examples of artificial chromosome vectors include human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), and bacterial artificial chromosomes (BAC, PAC). Mammalian cell plasmids can be used as plasmids (Science, 322:949-953, 2008). The vector may contain regulatory sequences such as promoters, enhancers, ribosome-binding sequences, terminators, and polyadenylation sites to enable the expression of nuclear reprogramming material. Furthermore, the vector may optionally contain drug resistance genes (e.g., kanamycin resistance gene, ampicillin resistance gene, puromycin resistance gene, etc.), select marker sequences such as thymidine kinase genes and diphtheria toxin genes, and reporter gene sequences such as green fluorescent protein (GFP), β-glucuronidase (GUS), and FLAG. In addition, the above vector may have LoxP sequences before and after the gene encoding the reprogramming factor or the promoter and the gene encoding the reprogramming factor that binds to it, in order to excise them together after introduction into somatic cells.

[0028] Furthermore, if the reprogramming factor is in the form of RNA, it may be introduced into somatic cells by methods such as lipofection or microinjection. To suppress degradation, RNA incorporating 5-methylcytidine and pseudouridine (TriLink Biotechnologies) may be used (Warren L, (2010) Cell Stem Cell. 7:618-630).

[0029] Examples of culture media for iPS cell induction include DMEM, DMEM / F12, or DMEM culture media containing 10-15% FBS (these culture media may further contain LIF, penicillin / streptomycin, puromycin, L-glutamine, non-essential amino acids, β-mercaptoethanol, etc. as appropriate) or commercially available culture media [for example, mouse ES cell culture medium (TX-WES culture medium, ThromboX), primate ES cell culture medium (primate ES / iPS cell culture medium, ReproCELL), serum-free medium (mTeSR, Stemcell Technology)].

[0030] Examples of culture methods include the following: First, 37°C, 5% CO2 ２ In the presence of 10% FBS, somatic cells and reprogramming factors are brought into contact on DMEM or DMEM / F12 culture medium and cultured for approximately 4 to 7 days. Subsequently, the cultured somatic cells are re-seed onto feeder cells (e.g., mitomycin C-treated STO cells, SNL cells, etc.) and cultured in a bFGF-containing primate ES cell culture medium approximately 10 days after contact between the somatic cells and the reprogramming factors. iPS-like colonies can be induced approximately 30 to 45 days or longer after this contact.

[0031] Alternatively, 37°C, 5% CO ２In the presence of FBS, feeder cells (e.g., mitomycin C-treated STO cells, SNL cells, etc.) are cultured in a 10% FBS-containing DMEM culture medium (which may further contain LIF, penicillin / streptomycin, puromycin, L-glutamine, non-essential amino acids, β-mercaptoethanol, etc. as appropriate) and ES-like colonies can be produced after approximately 25 to 30 days or longer. Preferably, instead of feeder cells, the somatic cells to be reprogrammed themselves are used (Takahashi K, et al. (2009), PLoS One. 4:e8067 or WO2010 / 137746), or an extracellular matrix (e.g., Laminin-5 (WO2009 / 123349) and Matrigel (BD)) is used as an example.

[0032] In addition, methods using serum-free culture media are also exemplified (Sun N, et al. (2009), Proc Natl Acad Sci U S A. 106:15720-15725). Furthermore, to increase establishment efficiency, iPS cells may be established under hypoxic conditions (oxygen concentration of 0.1% or higher and 15% or lower) (Yoshida Y, et al. (2009), Cell Stem Cell. 5:237-241 or WO2010 / 013845).

[0033] During the above culture process, the culture medium should be replaced with fresh medium once daily, starting from the second day of culture. The number of somatic cells used for nuclear reprogramming is not limited, but a 100 cm² culture dish is required. ２ Approximately 5 x 10 ３ ~Approx. 5×10 ６ It is the range of a cell.

[0034] iPS cells can be selected based on the shape of the formed colonies. On the other hand, when a drug resistance gene that is expressed in conjunction with genes expressed when somatic cells are reprogrammed (for example, Oct3 / 4, Nanog) is introduced as a marker gene, iPS cells established by culturing in a culture medium containing the corresponding drug (selection culture medium) can be selected. Also, when the marker gene is a fluorescent protein gene, iPS cells can be selected by observing with a fluorescence microscope, when it is a luminescent enzyme gene by adding a luminescent substrate, and when it is a chromogenic enzyme gene by adding a chromogenic substrate.

[0035] As used herein, the term "somatic cell" refers to any animal cell (preferably mammalian cells including humans) excluding germline cells or totipotent cells such as eggs, oocytes, and ES cells. Somatic cells include, without limitation, somatic cells of a fetus (fetus), somatic cells of a newborn (fetus), and mature healthy or diseased somatic cells, and also include any of primary cultured cells, subcultured cells, and immortalized cells. In one aspect of this embodiment, the somatic cells are preferably mature healthy somatic cells (somatic cells derived from a healthy individual). Specifically, somatic cells include, for example, (1) tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, dental pulp stem cells, (2) tissue progenitor cells, and (3) differentiated cells such as lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts (such as skin cells), hair cells, hepatocytes, gastric mucosal cells, intestinal cells, spleen cells, pancreatic cells (such as pancreatic exocrine cells), brain cells, lung cells, kidney cells, and fat cells.

[0036] Also, when using iPS cells as a material for transplantation cells, from the viewpoint of avoiding rejection reactions, it is desirable to use somatic cells with the same or substantially the same HLA genotype as the individual at the transplantation site. Here, "substantially the same" means that the HLA genotype is identical to such an extent that the immune response can be suppressed by an immunosuppressant against the transplanted cells, for example, somatic cells having an HLA type in which three gene loci of HLA-A, HLA-B, and HLA-DR or four gene loci including HLA-C are identical.

[0037] (E) ES cells derived from cloned embryos obtained by nuclear transfer ES cells derived from cloned embryos obtained by nuclear transfer (nt ES cells) are ES cells derived from cloned embryos produced by nuclear transfer technology and have almost the same characteristics as ES cells derived from fertilized eggs (T. Wakayama et al. (2001), Science, 292:740-743; S. Wakayama et al. (2005), Biol. Reprod., 72:932-936; J. Byrne et al. (2007), Nature, 450:497-502). That is, ES cells established from the inner cell mass of blastocysts derived from cloned embryos obtained by replacing the nucleus of an unfertilized egg with the nucleus of a somatic cell are nt ES (nuclear transfer ES) cells. For the production of nt ES cells, a combination of nuclear transfer technology (J.B. Cibelli et al. (1998), Nature Biotechnol., 16:642-646) and ES cell production technology is used (Kiyoshi Wakayama et al. (2008), Experimental Medicine, Vol. 26, No. 5 (Extra Issue), pp. 47-52). In nuclear transfer, the nucleus of a somatic cell can be injected into an enucleated unfertilized egg of a mammal and cultured for several hours to be reprogrammed.

[0038] (F) Multilineage-differentiating Stress Enduring cells Multilineage-differentiating Stress Enduring cells (Muse cells) are pluripotent stem cells produced by the method described in WO2011 / 007900. Specifically, Muse cells are cells with pluripotency obtained by subjecting fibroblasts or bone marrow stromal cells to trypsin treatment for a long time, preferably 8 hours or 16 hours, and then culturing them in suspension, and are cells positive for SSEA-3 and CD105.

[0039] In this embodiment, preferred pluripotent stem cells are iPS cells. In this embodiment, preferred iPS cells are human iPS cells. In one aspect of this embodiment, the human iPS cells may be human iPS cells derived from mature, healthy somatic cells (human iPS cells derived from healthy individuals) or human iPS cells derived from diseased somatic cells (disease-specific iPS cells). In another aspect of this embodiment, it is preferable that the human iPS cells are human iPS cells derived from healthy individuals.

[0040] (Vascular Endothelial Cells) In this embodiment, "vascular endothelial cells" (hereinafter sometimes simply referred to as "endothelial cells") means cells that express one of the following: PE-CAM, VE-cadherin, and von Wilbrandt factor (vWF). For humans, NCBI access number NM_000442 is an example of PE-CAM, and for mice, NM_001032378 is an example. For humans, NCBI access number NM_001795 is an example of VE-cadherin, and for mice, NM_009868 is an example. For humans, NCBI access number NM_000552 is an example of vWF, and for mice, NM_011708 is an example.

[0041] The method for inducing vascular endothelial cells from pluripotent stem cells is not particularly limited as long as it is a known method, but for example, a method carried out in the absence of feeder cells is exemplified. In this embodiment, an example of a method for inducing vascular endothelial cells from pluripotent stem cells in the absence of feeder cells is a method comprising: (i) culturing pluripotent stem cells in a medium containing Activin A; (ii) culturing the cells after step (i) in a medium containing BMP and bFGF; and (iii) culturing the cells obtained in step (ii) in a medium containing VEGF.

[0042] (i) Step of culturing in a medium containing Activin A In this step, pluripotent stem cells may be separated by any method and cultured by suspension culture, or adherent culture may be performed using a coated culture dish. Preferably, it is adherent culture. Here, as the separation method, a method of mechanically separating may be used, or a separation solution having protease activity and collagenase activity (for example, Accutase ＴＭ and Accumax ＴＭ (examples include) or a separation method using a separation solution having only collagenase activity may be used. Preferably, it is a method of dissociating using a separation solution having only collagenase activity and mechanically separating finely. Here, the pluripotent stem cells to be used are preferably colonies cultured until they become about 80% confluent with respect to the dish used.

[0043] Suspension culture means culturing cells in a non-adherent state in a culture dish. The suspension culture is not particularly limited, but a culture dish that has not been artificially treated (for example, coated with an extracellular matrix or the like) for the purpose of improving the adhesion to cells, or a culture dish that has been artificially treated to suppress adhesion (for example, coated with poly-hydroxyethyl methacrylate (poly-HEMA)) can be used.

[0044] Adherent culture is a culture method performed in an arbitrary medium using a coated culture dish. Examples of the coating agent include Matrigel (BD), collagen, gelatin, laminin, heparan sulfate proteoglycan, or entactin, and combinations thereof. Preferably, the coating agent is Matrigel. More preferably, it is adherent culture by the Matrigel sandwich method in which pluripotent stem cells are adhered to a culture dish coated with Matrigel, and further Matrigel is added to the medium to coat the entire pluripotent stem cells with Matrigel.

[0045] The medium in this step (i) can be prepared by adding Activin A to a basal medium, which is a medium used for culturing animal cells, as the basal medium.

[0046] Examples of basal media include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Doublebecco's modified Eagle's Medium (DMEM) medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and mixed media of these. Preferably, RPMI 1640 medium is used. The basal medium may contain serum or may be serum-free. If necessary, the basal medium may contain one or more serum substitutes, such as albumin, transferrin, Knockout Serum Replacement (KSR) (a serum substitute for FBS in ES cell culture), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, and 3'-thiolglycerol. The basal medium may also contain one or more substances, such as lipids, amino acids, L-glutamine, Glutamax (Invitrogen), non-essential amino acids, vitamins, antibiotics, antioxidants, pyruvate, buffers, and inorganic salts. A preferred basal medium in step (i) is RPMI medium containing L-glutamine and B27 supplement.

[0047] In step (i), the culture medium may contain, in addition to Activin A, one or more growth factors consisting of Wnt1, Wnt3, Wnt3a, Wnt4, Wnt7a, TGF-β, Nodal, BMP2, BMP4, BMP6, BMP7, GDF, bFGF, and VEGF added to the basal medium. The preferred growth factor is Wnt3a.

[0048] The concentration of Activin A added to the culture medium is, for example, 10 ng / mL, 25 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 110 ng / mL, 120 ng / mL, 130 ng / mL, 140 ng / mL, 150 ng / mL, 175 ng / mL, or 200 ng / mL, but is not limited to these values. Preferably, the concentration of Activin A added to the culture medium is 100 ng / mL. In one aspect of this embodiment, the concentration of Activin A added to the culture medium may be 10 ng / mL or more and 200 ng / mL or less.

[0049] The culture temperature is not particularly limited, but is, for example, about 30-40°C, preferably about 37°C. ２ The culture is carried out in an atmosphere containing CO. ２ The concentration is preferably about 2-5%. The incubation period is, for example, 1 to 5 days, preferably 1 day.

[0050] (ii) Step of culturing in a medium containing BMP and bFGF In step (ii), if the preceding step was performed in suspension culture, the obtained cell population may be cultured in any medium in a coated culture dish. Examples of coating agents include Matrigel (BD), collagen, gelatin, laminin, heparan sulfate proteoglycan, or entactin, and combinations thereof. Matrigel is preferred. Alternatively, if the preceding step was performed in adherent culture, the culture may be continued by changing the medium.

[0051] The culture medium used in step (ii) can be prepared by using a culture medium used for animal cell culture as the base medium, and adding BMP (bone morphogenetic protein) and bFGF (basic fibroblast growth factor) to the base medium. The same base medium as in step (i) described above can be used.

[0052] The BMP used in this step (ii) is preferably a BMP belonging to the TGFβ superfamily, with BMP2, BMP4, and BMP7 being examples. The preferred BMP is BMP4.

[0053] The concentration of BMP4 added to the culture medium is, for example, 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 2.5 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, 15 ng / mL, 17.5 ng / mL, 20 ng / mL, 30 ng / mL, 40 ng / mL, or 50 ng / mL, but is not limited to these values. Preferably, the concentration of BMP4 added to the culture medium is 10 ng / mL. In one aspect of this embodiment, the concentration of BMP4 added to the culture medium may be 0.1 ng / mL or more and 50 ng / mL or less.

[0054] The concentration of bFGF added to the culture medium is, for example, 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 2.5 ng / mL, 5 ng / mL, 6 ng / mL, 7 ng / mL, 8 ng / mL, 9 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, 15 ng / mL, 17.5 ng / mL, 20 ng / mL, 30 ng / mL, 40 ng / mL, or 50 ng / mL, but is not limited to these values. Preferably, the concentration of bFGF added to the culture medium is 10 ng / mL. In one aspect of this embodiment, the concentration of bFGF added to the culture medium may be 0.1 ng / mL or more and 50 ng / mL or less.

[0055] The culture temperature is not particularly limited, but is, for example, about 30-40°C, preferably about 37°C. ２ The culture is carried out in an atmosphere containing CO. ２ The concentration is preferably about 2-5%. The incubation period is, for example, 1 to 10 days, preferably 4 days.

[0056] Through steps (i) and (ii) described above, pluripotent stem cells differentiate to produce vascular endothelial progenitor cells. In other words, the above preparation step may include culturing the pluripotent stem cells to differentiate them into vascular endothelial progenitor cells.

[0057] (iii) A step in which the cells obtained in step (ii) are cultured in a medium containing VEGF. In this step (iii), if the preceding step was performed in suspension culture, the obtained cell population may be cultured in any medium in a coated culture dish. Examples of coating agents include Matrigel (BD), collagen, gelatin, laminin, heparan sulfate proteoglycan, or entactin, and combinations thereof. Matrigel is preferred. Alternatively, if the preceding step was performed in adherent culture, the culture may be continued by changing the medium.

[0058] The culture medium used in this step (iii) can be prepared by using a culture medium used for culturing animal cells as the base medium and adding VEGF (vascular endothelial growth factor) to the said base medium. The same base medium as in step (i) described above can be used.

[0059] The concentration of VEGF added to the culture medium may be, for example, within the range of 10 ng / mL to 500 ng / mL, 25 ng / mL to 300 ng / mL, 40 ng / mL to 200 ng / mL, 50 ng / mL to 100 ng / mL, 60 ng / mL to 90 ng / mL, or 65 ng / mL to 85 ng / mL. Preferably, the concentration of VEGF added to the culture medium is 25 ng / mL to 75 ng / mL. Furthermore, the concentration of VEGF added to the culture medium may be, but is not limited to, 10 ng / mL, 25 ng / mL, 50 ng / mL, 55 ng / mL, 60 ng / mL, 65 ng / mL, 70 ng / mL, 75 ng / mL, 80 ng / mL, 85 ng / mL, 90 ng / mL, 95 ng / mL, 100 ng / mL, 110 ng / mL, 120 ng / mL, 130 ng / mL, 140 ng / mL, 150 ng / mL, or 200 ng / mL. Preferably, the concentration of VEGF added to the culture medium is 200 ng / mL.

[0060] The culture temperature is not particularly limited, but is, for example, about 30-40°C, preferably about 37°C. ２ The culture is carried out in an atmosphere containing CO. ２The concentration is preferably about 2 to 5%. The culture time in step (iii) is, for example, 2 to 20 days, preferably 8 to 10 days. In step (iii), the vascular endothelial progenitor cells differentiate to produce vascular endothelial cells. Also in step (iii), the stress loading step described later is performed.

[0061] In this embodiment, cAMP for inducing endothelial cells may be further added in step (iii). The concentration of cAMP is, for example, in the range of higher than 0.5 mM and less than 2 mM, for example, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, 1.1 mM, 1.2 mM, 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM, 1.7 mM, 1.8 mM, and 1.9 mM, but is not limited to these. Preferably, it is 1 mM. The period for adding cAMP is not particularly limited, but is preferably 1 to 5 days, and particularly preferably 3 days.

[0062] (Cardiomyocytes) In one aspect of this embodiment, the cell population containing the above-mentioned vascular endothelial progenitor cells may further include cardiomyocytes or their progenitor cells. "Cardiomyocytes" means muscle cells that constitute the cardiac muscle and express at least cardiac troponin (cTnT) or αMHC. For humans, NCBI access number NM_000364 is an example of cTnT, and for mice, NM_001130174 is an example of cTnT. For humans, NCBI access number NM_002471 is an example of αMHC, and for mice, NM_001164171 is an example of αMHC. Cardiomyocytes can be produced, for example, by differentiation induction from pluripotent stem cells. Alternatively, cardiomyocytes may be cardiomyocytes that are inevitably generated in the process of differentiating the above-mentioned vascular endothelial cells from the above-mentioned pluripotent stem cells.

[0063] The method for inducing cardiomyocytes from pluripotent stem cells is not particularly limited as long as it is a known method, but examples include (1) a method carried out in the absence of feeder cells and (2) a method carried out in the presence of feeder cells.

[0064] In this embodiment, an example of a method for inducing cardiomyocytes from pluripotent stem cells in the absence of feeder cells is provided, which includes (A) the step of culturing pluripotent stem cells in a medium containing Activin A, and (B) the step of further culturing them in a medium containing BMP and bFGF after step (A).

[0065] In this embodiment, (2) as a method for inducing cardiomyocytes from pluripotent stem cells in the presence of feeder cells, an example is a method of co-culturing OP9 cells (Nishikawa, SI et al, Development 125, 1747-1757 (1998)) or END-2 cells (Mummery C, et al, Circulation. 107:2733-40 (2003)) with pluripotent stem cells or Flk1-positive cells derived from pluripotent stem cells.

[0066] (Vascular wall cells) In this embodiment, the cell population containing the above-mentioned vascular endothelial progenitor cells may further include vascular wall cells or their progenitor cells. "Vascular wall cells" (hereinafter sometimes simply referred to as "wall cells") means cells expressing Smooth muscle actin (SMA) and / or PDGFRB. Examples of SMA include NCBI accession number NM_001141945 in humans and NM_007392 in mice. Examples of PDGFRB include NCBI accession number NM_002609 in humans and NM_001146268 in mice.

[0067] The method for inducing parietal cells from pluripotent stem cells is not particularly limited as long as it is a known method, but examples include a method comprising: (I) culturing pluripotent stem cells in a medium containing Activin A; (II) culturing the cells obtained in step (I) in a medium containing BMP and bFGF; and (III) culturing the cells obtained in step (II) in a medium that does not contain VEGF. The parietal cells may also be parietal cells that are inevitably generated in the process of differentiating the above-mentioned vascular endothelial cells from the above-mentioned pluripotent stem cells.

[0068] <Stress Loading Process> In this process, fluid shear stress is applied to the vascular endothelial progenitor cells. In this embodiment, "fluid shear stress" refers to shear stress induced by water or an aqueous solution (e.g., culture medium).

[0069] In this embodiment, the stress loading step may be carried out by shaking culture, perfusion culture, or agitation culture of the vascular endothelial progenitor cells in vitro in a culture medium capable of differentiating into vascular endothelial cells. Here, "culture medium capable of differentiating into vascular endothelial cells" refers, for example, to the culture medium used in step (iii) above.

[0070] In this embodiment, "shaking culture" means culturing cells while generating a flow of culture medium by shaking the culture vessel. This flow of culture medium generates fluid shear stress that is applied to the vascular endothelial progenitor cells. For example, one method is to apply fluid shear stress to the vascular endothelial progenitor cells using the compact digital rocker (ThermoFisher Scientific, catalog number #88882001) described in the example.

[0071] In this embodiment, "perfusion culture" means culturing cells while continuously supplying fresh culture medium to a culture vessel and continuously draining an equal amount of old culture medium (culture supernatant) from the culture vessel, thereby generating a flow of culture medium. This flow of culture medium generates fluid shear stress that is applied to the vascular endothelial progenitor cells. For example, one method is to apply fluid shear stress to the vascular endothelial progenitor cells using a cell perfusion device (manufactured by Tokai Hit Co., Ltd., product name: 35mm dish compatible programmable fluid control system PMD-D35).

[0072] In this embodiment, "stirred culture" means culturing cells while generating a flow of culture medium by rotating a stirring bar or screw. This flow of culture medium generates fluid shear stress that is applied to the vascular endothelial progenitor cells. For example, one method is to apply fluid shear stress to the vascular endothelial progenitor cells using a bioreactor (Able Co., Ltd., product name: Bio Jr. 8 100 mL x 8-unit culture device).

[0073] The above stress loading process may be carried out for a period of 2 days or more and 9 days or less, for a period of 3 days or more and 9 days or less, or for a period of 5 days or more and 9 days or less.

[0074] The fluid shear stress described above may be applied to the vascular endothelial progenitor cells continuously or intermittently during the stress loading process. From the viewpoint of stabilizing the efficiency of differentiation induction into vascular endothelial cells, it is preferable that the fluid shear stress be applied to the vascular endothelial progenitor cells continuously during the stress loading process.

[0075] The intensity of the fluid shear stress applied to the vascular endothelial progenitor cells may be constant, gradually increase, gradually decrease, or periodically increase and decrease during the stress loading process. From the viewpoint of stabilizing the efficiency of differentiation induction into vascular endothelial cells, it is preferable that the intensity of the fluid shear stress be constant during the stress loading process. In another aspect of this embodiment, from the viewpoint that it is desirable to apply a stimulus similar to the shear stress pattern applied to blood vessels in living organisms, it is preferable that the intensity of the fluid shear stress periodically increase and decrease during the stress loading process.

[0076] The intensity of the fluid shear stress applied to the vascular endothelial progenitor cells may be the same as the fluid shear stress applied to the inner wall of arteries in the body (for example, 0.01 Pa to 5 Pa). For example, when applying fluid shear stress to the vascular endothelial progenitor cells using the compact digital rocker described above, this can be achieved by setting the compact digital rocker to a 13° inclination and an oscillation period of 30 rpm.

[0077] Conventionally, fluid shear stress has been applied to mature vascular endothelial cells in circulating blood. However, in methods for producing vascular endothelial cells from pluripotent stem cells in vitro, applying fluid shear stress to improve the purity of the vascular endothelial cells had not been attempted. As a result of diligent research, the inventors have discovered for the first time that applying fluid shear stress to vascular endothelial progenitor cells derived from pluripotent stem cells reduces the number of cardiomyocytes and vascular wall cells, and consequently improves the purity of vascular endothelial cells. The manufacturing method according to this embodiment can produce a cell population (high-purity vascular endothelial cells) with a vascular endothelial cell content of 80% to 100% without performing cell sorting. In other words, the manufacturing method according to this embodiment does not involve purifying the vascular endothelial cells by fluorescence-activated cell sorting (FACS), magnetic bead cell sorting (MACS), or both. Therefore, this manufacturing method is suitable for the development and production of cell-based therapies for regenerative medicine.

[0078] In one aspect of this embodiment, the preparation step includes culturing the pluripotent stem cells and differentiating them into vascular endothelial progenitor cells, and the stress loading step may be performed on or after the fifth day from the start of culturing the pluripotent stem cells, or on or after the sixth day.

[0079] In other words, the above preparation step includes culturing the pluripotent stem cells to differentiate them into vascular endothelial progenitor cells, and the above stress loading step may be started on the fifth day after the start of culturing the pluripotent stem cells, or on the sixth day after the start of culturing the pluripotent stem cells.

[0080] <Recovery Step> In one aspect of this embodiment, the method for producing vascular endothelial cells derived from pluripotent stem cells may further include a recovery step after the stress loading step, in which the cell population containing the vascular endothelial cells is recovered.

[0081] ≪Method for Purifying Vascular Endothelial Cells Derived from Pluripotent Stem Cells≫ In this embodiment, the method for producing vascular endothelial cells derived from pluripotent stem cells can also be understood as a method for purifying vascular endothelial cells derived from pluripotent stem cells. That is, the method for purifying vascular endothelial cells derived from pluripotent stem cells according to this embodiment includes a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells, and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells. Details of each step are the same as those described in the section on the method for producing vascular endothelial cells derived from pluripotent stem cells.

[0082] ≪Method for Maturating Vascular Endothelial Cells Derived from Pluripotent Stem Cells≫ In this embodiment, the method for producing vascular endothelial cells derived from pluripotent stem cells can also be understood as a method for maturing vascular endothelial cells derived from pluripotent stem cells. That is, the method for maturing vascular endothelial cells derived from pluripotent stem cells according to this embodiment includes a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells, and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells. Details of each step are the same as those described in the section on the method for producing vascular endothelial cells derived from pluripotent stem cells.

[0083] ≪Cell population including vascular endothelial cells derived from pluripotent stem cells≫ The cell population according to this embodiment is a cell population including vascular endothelial cells derived from pluripotent stem cells, wherein the vascular endothelial cells express endothelial nitric oxide synthase, and the proportion of vascular endothelial cells is 80% or more and 100% or less based on the total number of cells in the cell population.

[0084] In one aspect of this embodiment, the cell population can also be understood as a cell population that includes vascular endothelial cells produced by the method for producing vascular endothelial cells derived from pluripotent stem cells according to this embodiment. In one aspect of this embodiment, "vascular endothelial cells derived from pluripotent stem cells" can also be understood as vascular endothelial cells having a genome of the same origin as the pluripotent stem cells before differentiation induction.

[0085] In this embodiment, the expression of endothelial nitric oxide synthase (eNOS) can be evaluated by RT-qPCR, as described in the examples below.

[0086] In this embodiment, the proportion of vascular endothelial cells is 80% to 100% of the total number of cells in the cell population, and may be 90% to 100%. The number of vascular endothelial cells can be counted, for example, by flow cytometry using VE-Cadherin as a marker molecule.

[0087] The above cell population may further contain cardiomyocytes or vascular wall cells. In this embodiment, the proportion of cardiomyocytes may be 0% to 30% or 0% to 20% based on the total number of cells in the above cell population. The number of cardiomyocytes can be counted, for example, by flow cytometry using cTnT as a marker molecule.

[0088] In this embodiment, the content of the vascular wall cells may be 0% to 30% or 0% to 20% based on the total number of cells in the cell population. The number of vascular wall cells can be counted, for example, by flow cytometry using SMA or PDGFRB as a marker molecule.

[0089] In one aspect of this embodiment, the cell population may further include an extracellular matrix. In this embodiment, the extracellular matrix refers to proteins secreted outside the cell, and examples of the extracellular matrix include collagen, gelatin, laminin, heparan sulfate proteoglycans, entactin, fragments thereof, or combinations thereof.

[0090] In one aspect of this embodiment, the state of the cell population is not particularly limited, but may be, for example, a cell suspension, a cell aggregate, or a three-dimensional structure. The shape of the three-dimensional structure is not particularly limited, and examples include tubular, cylindrical, and sheet-like shapes.

[0091] In another aspect of this embodiment, the cell population may be artificial vascular tissue derived from pluripotent stem cells. "Artificial vascular tissue" means an artificially manufactured three-dimensional structure, which is vascular tissue or a similar structure. "Artificial vascular tissue derived from pluripotent stem cells" means artificial vascular tissue that includes at least vascular endothelial cells differentiated from pluripotent stem cells. In one aspect of this embodiment, "artificial vascular tissue derived from pluripotent stem cells" can also be understood as artificial vascular tissue having a genome of the same origin as the pluripotent stem cells before differentiation induction. The artificial vascular tissue may further include cardiomyocytes, vascular wall cells, or both.

[0092] The method for producing the artificial blood vessel tissue described above is not particularly limited, and known methods can be employed. For example, artificial blood vessel tissue can be obtained by mixing the cardiomyocytes, vascular endothelial cells, and parietal cells described above, culturing them in the presence of an extracellular matrix, and forming a three-dimensional structure.

[0093] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0094] ≪Experimental Procedure≫ ≪Culture and Differentiation Induction of Human iPS Cells≫ Maintenance culture and subsequent differentiation induction of human iPS cells were performed according to the following procedure. Two types of human iPS cell lines were used: Four-factor (Oct3 / 4, Sox2, Klf4 and c-Myc) cell line (human iPS cell line derived from healthy individuals): 201B6 and 201B7

[0095] (Maintenance Culture of Human iPS Cells) First, each iPS cell was cultured and maintained in StemFit AK02N medium (manufactured by Ajinomoto Co., Inc., hereinafter sometimes referred to as "AK02N medium"). After the cultured iPS cells reached confluence, the iPS cells were dissociated by adding TrypLE Select (manufactured by Thermo Fisher Scientific), and then the iPS cells were suspended by adding an equal volume of PBS (0.5 mM ethylenediaminetetraacetic acid) to the added TrypLE Select. Subsequently, the iPS cells were cultured as single cells (3000-4000 cells / cm²).２ The cultures were subculturised every seven days in AK02N medium with iMatrix-511 silk (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) (final concentration 0.125 μg / cm³). ２ A culture medium supplemented with (uncoated laminin fragment) and a ROCK inhibitor (Y-27632, final concentration 10 μM) (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) was used.

[0096] (Pre-processing steps in the differentiation induction of vascular endothelial cells) First, we will explain the pre-processing steps in the differentiation induction of vascular endothelial cells (EC) (Figure 1). First, iPS cells, which are in a single-cell state, are cultured in a culture plate coated with Matrigel (dilution ratio 1:60) at a rate of 400,000 to 500,000 cells / cm². ２ The iPS cells were seeded in AK02N medium (containing Y-27632 at a final concentration of 10 μM) in the following manner. After the cultured iPS cells reached confluence, they were coated with Matrigel (diluted 1:60 with AK02N medium) one day before differentiation induction. After one day, the medium was changed from AK02N medium to RPMI+B27 medium (differentiation induction day 0; d0), and the cells were cultured for 24 hours (step (i)). The composition of RPMI+B27 medium is shown below. (Composition of RPMI + B27 medium) RPMI 1640 medium (Thermo Fisher Scientific) L-glutamine (final concentration 2 mM) (Thermo Fisher Scientific) 1 × B27 supplement without insulin (Thermo Fisher Scientific) Activin A (final concentration 100 ng / mL) (R&D) CHIR99021 (final concentration 5 μM, as needed) (Tocris Bioscience)

[0097] Subsequently, on day 1 of differentiation induction (d1), bone morphogenetic protein 4 (BMP4, final concentration 10 ng / mL) (manufactured by R&D) and basic fibroblast growth factor (bFGF, final concentration 10 ng / mL) were added to the culture medium and cultured for 4 days (step (ii)). The culture medium was not changed at this time. This step corresponds to the preparation step according to this embodiment.

[0098] (Post-processing steps in differentiation induction of vascular endothelial cells) In differentiation into EC, the culture medium was changed to RPMI1640+B27 medium on day 5 of differentiation induction (d5). The RPMI1640+B27 medium used at this time contained vascular endothelial growth factor (VEGF) 165 (final concentration 200 ng / ml) (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) and 8-bromo-cAMP (final concentration 1 mM) (manufactured by Nacalai Tesque Co., Ltd.). On day 7 of differentiation induction (d7), the culture medium was changed to RPMI+B27 medium supplemented with VEGF 165 (final concentration 200 ng / ml), and the culture medium was changed every two days (step (iii)) (Figure 1). In this manner, vascular endothelial cells derived from human iPS cells (hereinafter sometimes referred to as "hiPSC-EC") were obtained.

[0099] <Agitation Culture> In the pre- and post-processes of the differentiation induction of vascular endothelial cells described above, agitation culture was performed for a predetermined period (Figure 1). Specifically, a compact digital rocker (ThermoFisher Scientific, catalog number #88882001) was used to generate periodic fluid shear stress on cultured cells in a 24-well plate at 30 rpm or 60 rpm and a 13° tilt for the entire period from day 0 (d0) to day 13 (d13) of differentiation induction, or for part of the period (stress loading process).

[0100] ≪Flow Cytometry≫ To optimize the frequency and duration of Digital Locker application, the purity of EC was evaluated by flow cytometry. For cells on day 13 of differentiation induction (d13), flow cytometry was performed with some modifications according to conventional techniques. First, a cell population containing human iPS cell-derived EC was incubated with Accutase (Nacalai Tesque Co., Ltd.) to dissociate the cell population. Subsequently, the cell population was stained using the following surface marker-specific antibodies (one antibody alone or a combination of two antibodies, dilution ratio 1:100). (Surface marker-specific antibodies) Phycoerythrin (PE) conjugated anti-PDGFRβ antibody, clone 28d4 (BD Inc.) Allophycocyanin (APC) conjugated anti-VE-cadherin antibody, clone 55-7h1 (BD Inc.)

[0101] Furthermore, to exclude dead cells from the analysis, the cell population was stained using the LIVE / DEAD fixable Aqua dead cell staining kit (Thermo Fisher). Cell surface markers were stained with PBS containing 5% FBS. Intracellular proteins were stained using cell populations fixed with PBS containing 4% paraformaldehyde (PFA). The cell population was stained with APC-labeled anti-cardiac troponin T (cTnT) antibody (clone 13-11) (Thermo Fisher Scientific) using Zenon technology (Thermo Fisher Scientific) (1:50). Staining was performed with PBS containing 5% FBS and 0.75% saponin (Sigma). Stained cell populations were analyzed using CytoFLEX S (Beckman Coulter). Data were collected from at least 10,000 events. This data was analyzed using CytExpert software (Beckman Coulter).

[0102] <<Culturing of HUVEC and HUAEC>> Maintenance culture of human umbilical vein endothelial cells (HUVEC) and human umbilical artery endothelial cells (HUAEC) was performed using the following procedure. The cells used are as follows: Human umbilical vein endothelial cells (HUVEC): PromoCell, #C-12200 Human umbilical artery endothelial cells (HUAEC): PromoCell, #C-12202

[0103] First, the frozen cells were thawed using the prescribed method, and expansion and maintenance cultures were performed using EGM-2 medium (Endothelial Growth Medium-2, PromoCell, #C-22011) and EGM-2 Supplement Mix (PromoCell, #C-39216) according to the manufacturer's protocol. After the cultured cells reached confluence, the cells were dissociated by adding 0.25% Gibcotrypsin-EDTA (1×) (Thermo Fisher Scientific) and incubating for 10 minutes. Subsequently, the cells were cultured as single cells (4000-5000 cells / cm²).２ The cells were seeded in uncoated culture dishes. These cells were subcultured every 5-7 days. Cells that had been subcultured 3-7 times were used in the experiment. Cultured cells showing abnormal cell morphology were excluded from subsequent experiments.

[0104] ≪Gene Expression Analysis: RNA Extraction, cDNA Synthesis, and Quantitative RT-PCR≫ Gene expression analysis was performed using real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR). Total RNA was isolated using Qiashredder (Qiagen) and purified using RNeasy Mini Kit (Qiagen). These procedures were carried out according to the manufacturer's protocol. The purification process described above also included DNase treatment using RNase-free DNase Set (Qiagen). RNA yield and purity were measured using NanoDrop One (TermoFisher Scientifc). First-strand cDNA was synthesized using RiverTra Ace® qPCR RT Master Mix (FSQ-201, manufactured by TOYOBO Corporation) according to the manufacturer's protocol.

[0105] For each sample, reverse transcription to cDNA was performed using 200 ng of total RNA. The RNA was processed according to the manufacturer's protocol using PowerUp. ＴＭThe samples were analyzed by quantitative real-time polymerase chain reaction (RT-PCR) using Applied Biosystems StepOne Plus (TermoFisher Scientifc) with SYBR Green Master Mix (TermoFisher Scientifc). The RT-PCR was performed using specific primers for endothelial nitric oxide synthase (eNOS) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of each specific primer are shown below. eNOS Forward: GCGGCTGCATGACATTGAG (Sequence ID 1) eNOS Reverse: GTCGCGGTAGAGATGGTCAAG (Sequence ID 2) GAPDH Forward: GCACCGTCAAGGCTGAGAAC (Sequence ID 3) GAPDH Reverse: TGGTGAAGACGCCAGTGGA (Sequence ID 4)

[0106] Relative gene expression levels were calculated using the ΔΔCt method and normalized to the expression of the GAPDH gene.

[0107] ≪RNA-Seq≫ Total RNA from hiPSC-EC was extracted according to the procedure for "Gene Expression Analysis" described above. cDNA libraries were prepared using Next GEM Single Cell 3' Gel Bead Kit v3.1 (1,000,129), Chromium Next GEM Chip G Single Cell Kit v3 (PN-1000127), Next GEM Single Cell 3' Kit v3.1 (1,000,130), Next GEM Single Cell 3' Library Kit v3.1 (1,000,158), and i7 Multiplex Kit (PN-120262) (10x Genomics) according to the manufacturer's protocol. The obtained cDNA libraries were sequenced using Illumina's Nextseq 500 and HiSeq 4000. The ENCODE project analysis pipeline (version 2.3.4) was used to quantify gene expression (https: / / www.encodeproject.org / pipelines / ENCPL002LPE / ). GRCh38 ENSEMBL release 105 was used as the reference genome, and GRCh38 GENCODE release 39 was used for gene definition. Expression levels were calculated using STAR-RSEM, with TPM and FPKM values ​​(https: / / github.com / gisrpd / pipelines / tree / master / rnaseq / star-rsem). For comparative analysis, one replicate (N=1) of samples from static culture (control) and rocking culture (Rocking d5-13) were used for each. Genes showing Log2FC > log2(1.5) were judged as "upregulated" (increased expression) in the "Rocking d5-13" group, while genes showing Log2FC <-Log2(1.5) were judged as "downregulated" (decreased expression). Gene ontology analysis (GO analysis) was performed using an online platform for data analysis and visualization (https: / / www.bioinformatics.com.cn). Differentially expressed genes were visualized using M-A plots generated with RStudio (version 4.4.0) (Figure 4).Gene ontology enrichment analysis (GO enrichment analysis) was performed using ShinyGO (version 0.82, http: / / bioinformatics.sdstate.edu / go / ).

[0108] ≪Angiogenesis Assay≫ The angiogenesis assay was performed using a μ-Slide 15 Well 3D (ibidi Cells in focus) for the tube formation assay, following the manufacturer's protocol. Tube formation was observed under a microscope. Tube formation was also quantified using the Angiogenesis Analyzer, a simple tool in ImageJ software (NIH) for quantifying tube formation assay experimental images.

[0109] ≪Statistical Analysis≫ Data were expressed as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 10 software version 10.2.3 (GraphPad Software). The normal distribution of the data was verified using the Kolmogorov-Smirnov test. Samples with values ​​below negative SD indicate that differentiation induction was not progressing effectively. Therefore, in this experiment, samples with values ​​below negative SD were excluded. Differences between experimental groups were analyzed using Student's two-tailed t-test or Dunn's post-hoc test following the Kurskal-Wallis test. A p-value < 0.05 was considered statistically significant.

[0110] ≪Experimental Results≫ ≪Generation of Vascular Endothelial Cells Derived from Human iPS Cells≫ Vascular endothelial cells (ECs) were generated by differentiation induction from human iPS cells (201B6 or 201B7) according to the experimental procedure described above. On day 5 of differentiation induction (d5), to investigate the commitment of endothelial progenitor cells (EPCs) from the undifferentiated stage to the mesodermal stage, PDGFR-α and KDR, established mesodermal stage markers, were evaluated using flow cytometry. As a result, similar to previous reports, PDGFR-α-positive cells increased on day 5 of differentiation induction and decreased by day 13 of differentiation induction. However, in contrast to previous reports, KDR-positive cells continued to increase over time. To analyze in more detail, we evaluated whether KDR-positive cells on day 13 of differentiation induction were also positive for VE-cadherin, an established marker for endothelial cells. As a result, KDR-positive cells were present on both day 5 and day 13 of differentiation induction, but VE-cadherin-positive cells were detected only on day 13. This suggests that the KDR-positive cells on day 5 of differentiation induction are endothelial progenitor cells, while the cells on day 13 are not. Endothelial progenitor cells were present on day 5 but had disappeared by day 13 of differentiation induction.

[0111] ≪Optimization of rocking speed, rocking period, and EC purification in rocking culture≫ EC exists in a fluid-flowing environment in the human body and is continuously exposed to fluid shear stress. Fluid shear stress is known to promote differentiation from EPC to EC, while inhibiting differentiation from EPC to smooth muscle cells. Therefore, in the pre- and post-processing steps of the differentiation induction of vascular endothelial cells described above, a digital rocker was implemented and rocking culture was performed for a predetermined period (Figure 1). First, the inventors optimized the rocking speed in two stages of testing. In the first stage, tests were conducted using a control (13° tilt at 15 cycles / min (15 rpm)) and rocking from day 5 to day 13 of differentiation induction (30 rpm) (30 rpm Rocking d5-13). In the second stage, a second optimization was performed using the control, 30 rpm Rocking d5-13, and 60 rpm Rocking d5-13. Of these three conditions, the 30 rpm Rocking d5-13 group showed the most stable EC purification (P=0.0512) (n=3), (P=0.1431) (n=8) (Figure 2A).

[0112] To evaluate the effect of the duration of agitation culture, four groups of plate culture sets were used. Each group was divided as follows (Figure 2A): control (static culture), rocking from day 0 to day 13 of differentiation induction (rocking culture, 30 rpm), rocking from day 0 to day 5 of differentiation induction (rocking culture, 30 rpm), and rocking from day 5 to day 13 of differentiation induction (rocking culture, 30 rpm).

[0113] As a result, the Rocking d5-13 group showed the highest EC purity among the four groups (Figure 2A) (n = 3).

[0114] Next, we investigated whether the purity of EC depends on the timing of the agitation culture period or on the characteristics of EPC. Therefore, we established 11 additional groups in which agitation culture was performed for any period between day 5 and day 13 of differentiation induction (Figure 2B). The induction culture cycle was set to 30 rpm in all cases. In Figure 2B, "R ５－７ The notation " indicates the group that underwent rocking culture from day 5 to day 7 of differentiation induction (Rocking d5-7). The same applies to other notations.

[0115] Of these groups, the Rocking 5-7 group, Rocking 5-8 group, Rocking 5-9 group, Rocking d5-13 group, and Rocking d6-13 group showed higher EC purity compared to the other groups (Figure 2B) (n = 3). Interestingly, the Rocking d9-13 group and others showed slightly lower EC purity compared to the Rocking d5-9 group and Rocking d5-13 group and others. This result suggests that the purification process is dependent on the timing of the start of the rocking culture.

[0116] Next, RT-qPCR analysis was performed to compare the gene expression levels in the Rocking d5-9 group and the Rocking d5-13 group. Despite achieving similar levels of EC purity, the two groups showed different relative gene expression levels. The Rocking d5-13 group had a higher level of eNOS expression (Figure 2C).

[0117] Based on these experimental results, we concluded that the optimal culture conditions for purification experiments were 30 rpm Rocking d5-13. The purification results for 46 samples are shown in Figure 2D (EC% P<0.0001) (n=46). In Figure 2D, "CM#" and "MC#" represent cardiomyocytes and vascular wall cells, respectively.

[0118] ≪Bulk RNA-seq Evaluation≫ First, GO analysis was performed on both upregulated and downregulated genes in EC cells cultured under 30 rpm Rocking d5-13 conditions. Analysis of all 1309 upregulated genes revealed increased expression of genes related to biological processes (BPs) associated with the has 04115 p53 signaling pathway, such as the Ras signaling pathway and the has 04072 phospholipase D signaling pathway. Similarly, analysis of all 3273 downregulated genes revealed that they were important genes for cholesterol metabolism. M-A plot analysis did not reveal any specific genes whose expression was significantly increased by the application of fluid shear stress (Figure 4). On the other hand, the expression of marker genes indicating endodermal differentiation, mesenchymal or fibroblast identity, and even embryonic cells, such as AFP, APOA1, FN1, FGB, APOA2, GPC3, SERPINA1, TF, and APOE, was significantly decreased (Figure 4). The results in Figure 4 suggest that shaking culture (applying fluid shear stress) suppresses the differentiation of cells other than vascular endothelial cells, resulting in the purification of vascular endothelial cells.

[0119] ≪Investigation of hiPSC-EC Function≫ eNOS is an enzyme that produces nitric oxide. The produced nitric oxide controls vasodilation, maintains endothelial health, and regulates inflammatory responses. Therefore, eNOS is an extremely important enzyme for the function of vascular endothelial cells. To evaluate the functionality of hiPSC-ECs, eNOS expression was assessed by RT-qPCR analysis. As a result, it was found that eNOS expression was significantly higher in the Rocking group compared to the control group (Figure 3A) (n=11). Specifically, the relative expression level of eNOS in the Rocking d5-13 group was 2.5 ± 0.3 times higher than in the control group (p = 0.0001). This result suggests that the functional maturation of hiPSC-ECs was promoted by culturing under conditions of fluid shear stress (oscillating culture). Notably, eNOS expression levels in the Rocking group were significantly elevated compared to the control group and even higher than in the positive control groups for both human umbilical artery endothelial cells (HUAECs) and human umbilical vein endothelial cells (HUVECs) (P<0.0001) (n = 11) (Figure 3A). These results suggest that the shaking culture conditions applied to Rocking d5-13 are particularly effective in promoting hiPSC-EC function. High eNOS expression is known to be essential for the function of both arterial and venous endothelium.

[0120] ≪Angiogenesis Assay≫ Angiogenesis assays are important for elucidating the mechanisms of angiogenesis, evaluating the effectiveness of new therapeutic agents, and investigating the role of angiogenesis in various pathological conditions. An angiogenesis assay was performed to evaluate the angiogenic capacity of hiPSC-derived endothelial cells (hiPS-ECs). Using ibidi 15 μm 3D slides, the same number of cells were seeded in the control group, the Rocking d5-13 group, and the positive control HUVEC group. Furthermore, the Angiogenesis Analyzer for ImageJ macro developed by Gilles Carpentier et al. was used to quantify angiogenesis parameters. As a result, it was found that total tube length, an important indicator of angiogenesis, was significantly improved in the Rocking d5-13 group (P = 0.0147) (Figures 3B and 3C). The quantitative results for total length, total branches length, branch count, and mesh count are shown in Figure 3C.

[0121] As described above, embodiments and examples of the present invention have been explained, but it is also intended from the outset that the configurations of each of the above embodiments and examples may be combined as appropriate.

[0122] The embodiments and examples disclosed herein should be considered in all respects to be illustrative and not restrictive. The scope of the present invention is indicated by the claims rather than the embodiments and examples described above, and all modifications within the scope of the claims are intended to be included in the meaning of equivalents and within the scope.

Claims

1. A method for producing vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells.

2. The method for producing vascular endothelial cells derived from pluripotent stem cells according to claim 1, wherein the stress loading step is performed by shaking culture, perfusion culture, or agitation culture of the vascular endothelial progenitor cells in vitro in a culture medium capable of differentiating into vascular endothelial cells.

3. The method for producing vascular endothelial cells derived from pluripotent stem cells according to claim 1 or claim 2, wherein the stress loading step is performed for a period of 2 days or more and 9 days or less.

4. A method for producing vascular endothelial cells derived from pluripotent stem cells according to claim 1 or claim 2, wherein the vascular endothelial cells are not purified by fluorescence-activated cell sorting, cell sorting using magnetic beads, or both thereof.

5. The method for producing vascular endothelial cells derived from pluripotent stem cells according to claim 1 or claim 2, wherein the preparation step includes culturing the pluripotent stem cells and differentiating them into vascular endothelial progenitor cells, and the stress loading step is performed on or after the fifth day from the start of culturing the pluripotent stem cells.

6. The method for producing vascular endothelial cells derived from pluripotent stem cells according to claim 1 or claim 2, wherein the pluripotent stem cells are iPS cells.

7. A method for purifying vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells.

8. A method for maturing vascular endothelial cells derived from pluripotent stem cells, comprising: a preparation step of preparing vascular endothelial progenitor cells derived from pluripotent stem cells; and a stress loading step of applying fluid shear stress to the vascular endothelial progenitor cells.

9. A cell population comprising vascular endothelial cells derived from pluripotent stem cells, wherein the vascular endothelial cells express endothelial nitric oxide synthase, and the proportion of vascular endothelial cells is 80% or more and 100% or less based on the total number of cells in the cell population.

10. The cell population according to claim 9, wherein the vascular endothelial cells express CD31 or VE-Cadherin.

11. The cell population according to claim 9 or claim 10, which may further contain cardiomyocytes or vascular wall cells.

Images