Method for producing induced pluripotent stem cells, induced pluripotent stem cells, and method for using induced pluripotent stem cells.

Abstract

This invention provides a method for producing induced pluripotent stem cells. [Solution] The present disclosure includes the step of producing induced pluripotent stem cells by expressing exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, in umbilical cord amniotic stem cells under conditions suitable for reprogramming stem cells. The present disclosure also includes the induced pluripotent stem cell population obtainable by this method, the induced pluripotent stem cell population obtained by this method, a pharmaceutical composition containing the induced pluripotent stem cells of the present invention, a method for differentiating the induced pluripotent stem cells of the present invention, a pharmaceutical composition containing the differentiated induced pluripotent stem cells obtained by this method, and a method for treating congenital or acquired degenerative disorders in a subject, comprising the step of administering target cells differentiated from pluripotent stem cells to the subject.

Description

Technical Field

[0001] Cross - reference to related applications This application claims the benefit of priority of U.S. Provisional Application No. 63 / 054,206, filed on July 20, 2020, the contents of which are hereby incorporated by reference in their entirety for all purposes.

Background Art

[0002] Background of the Invention The present invention relates to a method for producing induced pluripotent stem cells. Further, the present invention relates to a population of induced pluripotent stem cells obtainable by this method, and to a population of induced pluripotent stem cells obtained by this method. The present invention also relates to a pharmaceutical composition comprising the induced pluripotent stem cells of the present invention. The present invention also relates to a method for differentiating the induced pluripotent stem cells of the present invention. Further, it also relates to a pharmaceutical composition comprising the differentiated induced pluripotent stem cells obtained by this method. Furthermore, the present invention relates to a method for treating congenital or acquired degenerative disorders in a subject, comprising administering to the subject a target cell differentiated from a pluripotent stem cell.

[0003] Field of the Invention Stem cells are a population of cells that possess the ability to self - renew indefinitely and the ability to differentiate into multiple cell or tissue types. The ability of stem cells to self - renew is important for their function as a reservoir of primitive undifferentiated cells, and the "plasticity" of stem cells depends on their ability to differentiate and transform into tissues different from their origin and perhaps across embryonic germ layers. In contrast, most somatic cells have limited self - renewal ability due to telomere shortening (e.g., reviewed in Dice, J.F. (1993) Physiol. Rev. 73, 149 - 159 (Non - Patent Document 1)). Thus, stem cell - based therapies may be useful for treating a number of human and animal diseases.

[0004] Embryonic stem cells (approximately 3 to 5 days after fertilization) can proliferate infinitely and spontaneously differentiate into all tissue types: Therefore, they are called pluripotent stem cells (for example, as outlined in Smith, A.G. (2001) Annu. Rev. Cell. Dev. Biol. 17, 435-462 (Non-Patent Document 2)). Although the potential of embryonic stem cells is quite large, there are many ethical issues associated with their use. Therefore, non-embryonic stem cells have been proposed as an alternative source.

[0005] Adult stem cells are more tissue-specific and may have a lower replication ability: Therefore, they are called multipotent stem cells (for example, as outlined in Paul, G. et al. (2002) Drug Discov. Today 7, 295-302 (Non-Patent Document 3)). These cells can be derived from bone marrow stroma, adipose tissue, and dermis, and have the ability to differentiate particularly into chondrocytes, adipocytes, osteoblasts, myoblasts, cardiomyocytes, astrocytes, and tendon cells. However, in many cases, the number of stem cells extracted from bone marrow stroma, adipose tissue, dermis, and umbilical cord blood is quite small.

[0006] A comprehensive source of very young and adaptable adult stem cells, also known as neonatal stem cells, is umbilical cord blood or tissue or the placenta. For example, a large number of stem cells can be obtained from umbilical cord tissue, i.e., Wharton's jelly, the matrix of the umbilical cord (Mitchell, KE et al. (2003) Stem Cells 21, 50-60 (Non-Patent Literature 4); U.S. Patent No. 5,919,702 (Patent Literature 1); U.S. Patent Application No. 2004 / 0136967 (Patent Literature 2)). These cells have been shown to have the ability to differentiate into, for example, neuronal phenotypes and cartilage tissues. Mesenchymal stem cells have also been isolated from the subendothelium of the umbilical vein, one of the three blood vessels (two arteries and one vein) found in the umbilical cord (Romanov, YA et al. (2003) Stem Cells 21, 105-110 (Non-Patent Literature 5); Covas, DT et al. (2003) Braz. J. Med. Biol. Res. 36, 1179-1183 (Non-Patent Literature 6)). Furthermore, mesenchymal stem cells, as well as epithelial stem cells, have been successfully isolated from the amniotic tissue of the umbilical cord (US2006 / 0078993 (Patent Literature 3)). For example, because mesenchymal stem cells can differentiate in vitro and in vivo, these stem cells are promising candidates for mesoderm defect repair and disease management, but the use of adult stem cells is limited by their pluripotency. To overcome this limitation, non-embryonic cells can be reprogrammed into pluripotent stem cells, so-called induced pluripotent stem cells (iPS).

[0007] iPS cells were first created by Takahashi and Yamanaka by reprogramming non-embryonic cells into a pluripotent state through the overexpression of four transcription factors, OCT3 / 4, SOX2, KLF4, and C-MYC, also known as Yamanaka factors (Takahashi, K. and Yamanaka, S. (2006), Cell, 126(4), pp. 663-676 (Non-Patent Literature 7)). In detail, Takahashi and Yamanaka used mouse embryonic fibroblasts and introduced Yamanaka factors via retroviral transduction, thereby enabling the overexpression of transcription factors and creating cells that exhibited the morphological and growth characteristics of embryonic cells. While this method was a major breakthrough, the transduction process means that the transferred DNA may be integrated into the host cell's genome, making iPS cells essential for therapeutic treatments in humans. In 2011, Okita, K. et al., Nature Methods, 8(5), pp. 409-412 (Non-Patent Literature 8) established a non-integrational alternative method for generating iPS cells. Okita et al. used electroporation to transfer three episomal plasmid vectors encoding the Yamanaka factor and p53-shRNA for p53 repression into human dermal fibroblasts and dental pulp, thus enabling the overexpression of exogenous DNA and generating integration-free human iPS cells. To support the growth and maintenance of integration-free human iPS cells, Okita et al. cultured the iPS cells in a feeder layer consisting of STO cell lines or mouse embryonic fibroblasts (MEFs) transformed with neomycin resistance and the mouse LIF gene (SNL). However, culture in a feeder layer carries the risk of introducing foreign DNA into the iPS cells. Therefore, the integration-free iPS cells developed by Okita et al. may also be essential for therapeutic treatment in humans.

[0008] Ten years after its initial conception, iPS cell technology has entered the clinical application stage, with initial human trials underway for age-related macular degeneration (AMD) (Mandai, M., et al,. N Engl J Med, 2017. 376(11): p. 1038-1046 (Non-patent Literature 9)) and Parkinson's disease (PD) (Reardon, S. and Cyranoski, D. (2014) 'Japan stem-cell trial stirs envy', Nature. England, pp. 287-288. doi: 10.1038 / 513287a (Non-patent Literature 10)). The greatest expectation for iPS cell technology lies in its potential to enable autologous cell therapy that can avoid the need for long-term immunosuppression or tissue compatibility matching to prevent transplant cell rejection. This paradigm has been demonstrated in fibroblasts and bone marrow-derived iPS cells in non-human primate models (Morizane, A., et al., Stem Cell Reports, 2013. 1(4): p. 283-92 (Non-Patent Literature 11); Hallett, PJ, et al., Cell Stem Cell, 2015. 16(3): p. 269-74 (Non-Patent Literature 12); Wang, S., et al., Cell Discov, 2015. 1: p. 15012 (Non-Patent Literature 13); Shiba, Y., et al., Nature, 2016. 538(7625): p. 388-391 (Non-Patent Literature 14)), and forms the basis for the first human trials of iPS-based cell therapy for AMD (Mandai, M., et al., N Engl J Med, 2017. 376(11): p. 1038-1046). However, due to the considerable time and cost involved in producing clinical-grade iPS cells, it is unlikely that this will be carried out on a large scale for human treatment. Furthermore, there are situations in which producing autologous iPS cells from patients is not practical. For example, in the case of patients who carry disease-causing mutations, these mutations must first be corrected before it becomes possible to use iPS cells derived from these patients.This is achievable when mutations are manageable, but gene modification strategies may not be viable when mutations are difficult to manage, such as those underlying sporadic forms of many diseases.

[0009] Therefore, there is still a need for alternative methods for generating iPS cells that can differentiate into target cells suitable for therapeutic treatment in humans. As a result, the object of the present invention is to provide a method for generating and differentiating iPS cells that meet these needs. [Prior art documents] [Patent Documents]

[0010] [Patent Document 1] U.S. Patent No. 5,919,702 [Patent Document 2] U.S. Patent Application No. 2004 / 0136967 [Patent Document 3] US2006 / 0078993 [Non-patent literature]

[0011] [Non-Patent Document 1] Dice, JF (1993) Physiol. Rev. 73, 149-159 [Non-Patent Document 2] Smith, AG (2001) Annu. Rev. Cell. Dev. Biol. 17, 435-462 [Non-Patent Document 3] Paul, G. et al. (2002) Drug Discov. Today 7, 295-302 [Non-Patent Document 4] Mitchell, KE et al. (2003) Stem Cells 21, 50-60 [Non-Patent Document 5] Romanov, YA et al. (2003) Stem Cells 21, 105-110

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Summary of the Invention

[0012] The present invention relates to a method for producing induced pluripotent stem cells as described herein, the obtained induced pluripotent stem cells, a method for differentiating the obtained induced pluripotent stem cells, and a method for treating a disorder in a subject using differentiated cells derived from induced pluripotent stem cells.

[0013] In the first aspect, the present invention provides a method for producing induced pluripotent stem cells, comprising the step of expressing exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, in umbilical cord amniotic stem cells under conditions suitable for reprogramming stem cells, thereby producing induced pluripotent stem cells. In aspects of this method, umbilical cord amniotic stem cells are umbilical cord mesenchymal stem cells or umbilical cord epithelial stem cells.

[0014] In a second aspect, the present invention similarly provides an induced pluripotent stem cell population that can be obtained by this method, and an induced pluripotent stem cell population obtained by this method. The induced pluripotent stem cell population may be either an induced pluripotent stem cell population derived from mesenchymal stem cells (population) of the amniotic membrane of the umbilical cord, or an induced pluripotent stem cell population derived from epithelial stem cells (population) of the amniotic membrane of the umbilical cord.

[0015] In a third aspect, the present invention similarly provides a pharmaceutical composition comprising the induced pluripotent stem cells of the present invention.

[0016] In a fourth aspect, the present invention provides a method for differentiating induced pluripotent stem cells into target cells, wherein the induced pluripotent stem cells are differentiated into target cells under conditions suitable for differentiation. As a result, the present invention also provides a pharmaceutical composition comprising differentiated induced pluripotent stem cells obtained by the present invention.

[0017] In a fifth aspect, the present invention provides a method for treating a congenital or acquired degenerative disorder in a subject, comprising the step of administering target cells differentiated from pluripotent stem cells obtained by the present invention to the subject.

[0018] In a sixth aspect, the present invention provides extracellular vesicles produced by the induced pluripotent stem cell population of the present invention or by cells obtained by differentiation of the induced pluripotent stem cells of the present invention. This sixth aspect further includes the use of such extracellular vesicles of the present invention as delivery carriers for therapeutic agents.

[0019] In the seventh aspect, the present invention provides a cell culture medium comprising Mammary Epithelial Basal Medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's Modified Eagle Medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum). [Invention 1001] In the amniotic membrane stem cells of the umbilical cord, exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, are expressed under conditions suitable for reprogramming stem cells, thereby generating induced pluripotent stem cells. A method for producing induced pluripotent stem cells, including [the specified term]. [Invention 1002] The method of the present invention 1001, wherein the stem cells of the amniotic membrane of the umbilical cord are mesenchymal stem cells of the amniotic membrane of the umbilical cord or epithelial stem cells of the amniotic membrane of the umbilical cord. [Invention 1003] The method of the present invention 1001 or 1002, wherein the mesenchymal stem of the amniotic membrane of the umbilical cord is a population of mesenchymal stem cells, and at least about 90% or more of the cells in the stem cell population express each of the following markers: CD73, CD90, and CD105. [Invention 1004] The method of the present invention 1003, wherein at least about 90% or more of the cells in a population of mesenchymal stem cells lack the expression of the following markers: CD34, CD45, and HLA-DR. [Invention 1005] The method of the present invention 1003 or 1004, wherein at least about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, and about 99% or more cells of a mesenchymal stem cell population express CD73, CD90, and CD105 respectively, and lack expression of CD34, CD45, and HLA-DR respectively. [Invention 1006] The method of the present invention 1001, wherein exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, are provided by one, two, or three vectors, preferably, the first vector encoding proteins OCT3 / 4 and p53-shRNA, the second vector encoding proteins SOX2 and KLF4, and the third vector encoding proteins L-MYC and LIN28. [Invention 1007] A method according to any one of the present invention 1001 to 1006, wherein stem cells from the amniotic membrane of the umbilical cord are subjected to transfection to transfer exogenous nucleic acids into the stem cells. [Invention 1008] The method of the present invention 1007, wherein stem cells from the amniotic membrane of the umbilical cord are subjected to electroporation to transfer exogenous nucleic acids into the stem cells. [Invention 1009] The method of the present invention 1008, wherein mesenchymal stem cells of the amniotic membrane of the umbilical cord are subjected to one pulse of electroporation having a duration of about 15 to 25 ms and a voltage of about 1550 to 1650 V, preferably one pulse of electroporation having a duration of about 20 ms and a voltage of about 1600 V. [Invention 1010] The ratio of the amount of vector (plasmid) DNA of each vector to the number of mesenchymal stem cells in the umbilical cord amniotic membrane subjected to electroporation is approximately 1 × 10⁻⁶. 6 Approximately 1.5 μg of plasmid DNA per CLMC is equivalent to approximately 1 × 10⁶ units. 6in the range of about 2.5 μg of DNA for each CLMC, and the ratio is, for example, about 2.5 μg of plasmid DNA : 1×10 6 cells, about 2.25 μg of plasmid DNA : 1×10 6 cells, about 1.8 μg of plasmid DNA : 1×10 6 cells, about 1.7 μg of plasmid DNA : 1×10 6 cells, about 1.6 μg of plasmid DNA : 1×10 6 cells, about 1.5 μg of plasmid DNA : 1×10 6 cells, or preferably about 1.67 : 1×10 6 cells, the method of the present invention 1009. [The present invention 1011] The epithelial stem cells of the amnion of the umbilical cord are subjected to two-pulse electroporation having a duration of about 25 to 35 ms and a voltage of about 1300 to 1400 V, preferably two-pulse electroporation having a duration of about 30 ms and a voltage of about 1350 V, the method of the present invention 1008. [The present invention 1012] The ratio of the amount of vector (plasmid) DNA of each vector to the number of epithelial stem cells of the amnion of the umbilical cord cells subjected to electroporation is about 1×10 6 cells with about 1.5 μg of DNA to about 1×10 6 cells with about 2.5 μg of DNA, and the ratio is, for example, about 1.5 μg of plasmid DNA : 1×10 6 cells, about 1.6 μg of plasmid DNA : 1×10 6 cells, about 1.7 μg of plasmid DNA : 1×10 6 cells, about 1.8 μg of plasmid DNA : 1×10 6 cells, about 1.9 μg of plasmid DNA : 1×10 6 cells, about 2.0 μg of plasmid DNA : 1×10 6 cells, about 2.5 μg of plasmid DNA : 1×10 6One cell, preferably about 1.67 μg of plasmid DNA: 1 × 10⁶ 6 The method of the present invention 1011, which involves individual cells. [Invention 1013] A method according to any of items 1007 to 1012 of the present invention, wherein transfected stem cells are cultured in a medium suitable for cell regeneration. [Invention 1014] The method of the present invention 1013, wherein the culture medium suitable for cell recovery is a serum-free medium. [Invention 1015] The method of the present invention 1013, wherein the culture medium suitable for the restoration of transfected mesenchymal stem cells of the umbilical cord amniotic membrane consists of approximately 85-95% (v / v) of a defined medium and 5-15% (v / v) of fetal bovine serum. [Invention 1016] The culture medium of the present invention 1015, suitable for the restoration of transfected mesenchymal stem cells of the umbilical cord amniotic membrane, comprising approximately 90% (v / v) chemically defined medium and approximately 10% (v / v) fetal bovine serum. [Invention 1017] A culture medium according to the present invention 1014 or 1015, comprising approximately 85-95% (v / v) CMRL 1066 and approximately 5-15% (v / v) FBS. [Invention 1018] The method of the present invention 1013 or 1014, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's modified Eagle medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum). [Invention 1019] The method of the present invention 1018, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises approximately 10–30% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 20–40% (v / v) final concentration of EpiLife medium, approximately 5–15% (v / v) final concentration of F12, approximately 30–45% (v / v) final concentration of DMEM, and approximately 0.1–2% (v / v) final concentration of FBS. [Invention 1020] The method of Invention 1019, wherein the culture medium suitable for the recovery of transfected umbilical cord amniotic membrane epithelial stem cells comprises approximately 15–25% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 25–35% (v / v) final concentration of EpiLife medium, approximately 7.5–13% (v / v) final concentration of F12, approximately 35–40% (v / v) final concentration of DMEM, and approximately 0.5–1.5% (v / v) final concentration of FBS. [Invention 1021] The method of Invention 1020, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises approximately 20% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 30% (v / v) final concentration of EpiLife medium, approximately 12.5% ​​(v / v) final concentration of F12, approximately 37.5% (v / v) final concentration of DMEM, and approximately 1.0% (v / v) final concentration of FBS. [Invention 1022] A culture medium suitable for the regeneration of transfected umbilical cord amniotic membrane epithelial stem cells is obtained by mixing the following to obtain a final volume of 1000 ml of culture medium, according to any method 1018 to 1021 of the present invention: 200 ml of mammary epithelial basal medium MCDB 170, 300 ml of EpiLife medium, 250 ml of DMEM, 250 ml of DMEM / F12, 1% fetal bovine serum. [Invention 1023] A method according to any of the invention 1018 to 1022, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells contains insulin at a final concentration of approximately 1 to approximately 7.5 μg / ml. [Invention 1024] A method according to any of the invention 1018 to 1024, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells contains human epithelial growth factor at a final concentration of approximately 1 to approximately 15 ng / ml. [Invention 1025] A medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells further comprising at least one of the following supplements: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3), according to any method of the present invention 1018 to 1025. [Invention 1026] The method of Invention 1025, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells contains all three: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3). [Invention 1027] Any method of the present invention 1018 to 1026, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells further comprises one or more transforming growth factors (TGFs). [Invention 1028] The method of the present invention 1027, wherein the culture medium contains transforming growth factor β (TGF-β) and / or transforming growth factor α. [Invention 1029] Any method of the present invention 1018 to 1028, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane stem cells further comprises cholera toxin derived from Vibrio cholerae. [Invention 1030] The method according to any of items 1014 to 1029 of the present invention, wherein the culture medium suitable for cell recovery contains a compound that suppresses the inflammatory response and enhances cell survival. [Invention 1031] The method of the present invention 1030, wherein the compound is a glucocorticoid. [Invention 1032] The method of the present invention 1031, wherein the glucocorticoid is selected from the group consisting of prednisolone, methylprednisolone, dexamethasone, betamethasone, corticosterone, and hydrocortisone. [Invention 1033] The method of the present invention 1031 or 1032, wherein the hydrocortisone concentration is approximately 0.5 μM to approximately 2 μM. [Invention 1034] A method according to any one of the present invention 1013 to 1033, wherein the culture is performed in a coated cell culture vessel, the cell culture vessel is preferably coated with a serum-derived substrate or a serum-free substrate. [Invention 1035] Any method of the present invention 1009 to 1036, wherein the culture medium suitable for cell recovery is replaced with a mixture of two different cell culture media about 1, 2, or 3 days after transfection, preferably about 2 days after transfection, thereby obtaining induced pluripotent stem cell colonies. [Invention 1036] The method of the present invention 1035, wherein two different cell culture media are a medium suitable for cell recovery and a second cell culture medium. [Invention 1037] The method of the present invention 1035 or 1036, wherein two different cell culture media are mixed in a ratio of approximately 1:1 (v / v), prepared by contacting one volume of a cell recovery-suitable medium with one volume of a second cell culture medium. [Invention 1038] The method of the present invention 1036 or 1037, wherein the second cell culture medium is a maintenance medium for culturing induced pluripotent stem cells, and the medium is preferably selected from the group consisting of mTeSR1, StemMACS(trademark) iPS-Brew XF, TeSR(trademark)-E8, mTeSR(trademark)Plus, TeSR(trademark)2, mTeSR(trademark)1, Corning(registered trademark) NutriStem(registered trademark) hPSC XF Medium, Essential 8 Medium, StemFlex, StemFit Basic02, and PluriSTEM. [Invention 1039] Any method of the present invention 1035 to 1038, wherein the cell culture medium mixture is replaced with the same cell culture medium mixture within about 3, 4, or 5 days from transfection, preferably within about 4 days from transfection. [Invention 1040] The method according to any one of the present invention 1035 to 1039, wherein the cell culture medium mixture is replaced with a second cell culture medium within about 5, 6, or 7 days from transfection, preferably within about 6 days from transfection. [Invention 1041] The method of the present invention 1040, wherein the second cell culture medium is replaced daily, every two days, every three days, preferably every two days. [Invention 1042] The method of the present invention 1040 or 1041, wherein induced pluripotent stem cell colonies are selected when they reach a size of approximately 0.5 mm to approximately 1.5 mm in diameter, and the selected induced pluripotent stem colonies are transferred to coated cell culture vessels for culture and proliferation. [Invention 1043] The method of the present invention 1042, wherein induced pluripotent stem cell colonies are selected under a bright-field microscope. [Invention 1044] The method of the present invention 1042 or 1043, wherein the cell culture medium is replaced daily or every two days, preferably daily. [Invention 1045] The method according to the present invention 1043 or 1044, wherein induced pluripotent stem cell colonies are detached from a coated cell culture device when they reach a concentration density of approximately 50%. [Invention 1046] The method of the present invention 1045, wherein induced pluripotent stem cell colonies are detached with a reagent selected from the group consisting of a dissociation reagent, a dispase, or an EDTA solution. [Invention 1047] The method of the present invention 1045 or 1046, wherein the cell population formed from the induced pluripotent stem cell colony is passaged when it reaches a concentration density of approximately 60-90%, preferably 70-80%. [Invention 1048] The method of the present invention 1047, wherein a cell population formed from an induced pluripotent stem cell colony is passaged at a ratio of approximately 1:3 (v / v), and this passage at a ratio of approximately 1:3 (v / v) is carried out by dividing approximately 1 volume of dissociated induced pluripotent stem cells into approximately 2 volumes of dissociated induced pluripotent stem cells. [Invention 1049] The method of the present invention 1047 or 1048, wherein a cell population formed from an induced pluripotent stem cell colony is dissociated with approximately 0.5 mM EDTA for passage. [Invention 1050] The method according to invention 1048 or 1049, wherein a passaged cell population formed from an induced pluripotent stem cell colony is cultured in a culture medium containing a substance that enhances the survival of induced pluripotent stem cells. [Invention 1051] The method of the present invention 1050, wherein the substance that enhances the survival of induced pluripotent stem cell colonies is a ROCK inhibitor. [Invention 1052] An induced pluripotent stem cell population that can be obtained by any of the methods described in 1001 to 1051 of this invention. [Invention 1053] A population of induced pluripotent stem cells obtained by any of the methods described in 1001 to 1051 of this invention. [Invention 1054] A pharmaceutical composition comprising induced pluripotent stem cells according to invention 1052 or 1053. [Invention 1055] A method for differentiating induced pluripotent stem cells according to invention 1052 or 1053 into target cells, wherein the induced pluripotent stem cells are differentiated into target cells under conditions suitable for differentiation. [Invention 1056] The method of the present invention 1055, wherein the target cells are selected from the group consisting of dopaminergic neurons, oligodentrocytes, hepatocytes, cardiomyocytes, hematopoietic progenitor cells, blood cells, nerve cells, motor neurons, chondrocytes, muscle cells, osteocytes, odontocytes, hair follicle cells, inner ear hair cells, skin cells, melanocytes, immune cells, astrocytes, germ cells, corneal cells, intestinal cells, lung cells, kidney cells, gastric cells, mesenteric cells, and adipocytes. [Invention 1057] The method of the present invention 1056, wherein immune cells are selected from the group consisting of T lymphocytes, B lymphocytes, microglia, and natural killer cells. [Invention 1058] The method of the present invention 1056, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into dopaminergic neuronal cells. [Invention 1059] The method of the present invention 1056, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into hepatocytes. [Invention 1060] The method of the present invention 1056, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into cardiomyocytes. [Invention 1061] The method of the present invention 1060, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into oligodentrocytes. [Invention 1062] A pharmaceutical composition comprising differentiated induced pluripotent stem cells obtained by any of the methods described in 1056 to 1061 of the present invention. [Invention 1063] A pharmaceutical composition of the present invention 1062, adapted for parenteral administration. [Invention 1064] A step of administering target cells differentiated from pluripotent stem cells by any of the methods described in 1056 to 1061 of the present invention. A method for treating congenital or acquired degenerative disorders in a subject, including [mention specific method / condition]. [Invention 1065] The method of the present invention 1064, wherein the disorder is a neurological disorder. [Invention 1066] The method of the present invention 1065, wherein the disease is a neurological disorder selected from the group consisting of Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, and Batten's disease. [Invention 1067] The method of the present invention 1064, wherein the disorder is liver damage. [Invention 1068] Extracellular membrane vesicles produced by an induced pluripotent stem cell population according to Invention 1052 or 1053, or by cells obtained by differentiation of induced pluripotent stem cells according to Invention 1052 or 1053. [Invention 1069] An extracellular membrane vesicle according to the present invention 1068, wherein the vesicle is an exosome. [Invention 1070] Use of extracellular membrane vesicles of the present invention 1068 or 1069 as a delivery carrier for therapeutic agents. [Invention 1071] Cell culture media containing mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's modified Eagle medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum). [Invention 1072] A cell culture medium according to Invention 1071, comprising mammary epithelial basal medium MCDB 170 at a final concentration of approximately 10-30% (v / v), EpiLife medium at a final concentration of approximately 20-40% (v / v), F12 at a final concentration of approximately 5-15% (v / v), DMEM at a final concentration of approximately 30-45% (v / v), and FBS at a final concentration of approximately 0.1-2% (v / v). [Invention 1073] A cell culture medium according to Invention 1072, comprising mammary epithelial basal medium MCDB 170 at a final concentration of approximately 15-25% (v / v), EpiLife medium at a final concentration of approximately 25-35% (v / v), F12 at a final concentration of approximately 7.5-13% (v / v), DMEM at a final concentration of approximately 35-40% (v / v), and FBS at a final concentration of approximately 0.5-1.5% (v / v). [Invention 1074] A cell culture medium according to Invention 1073, comprising approximately 20% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 30% (v / v) final concentration of EpiLife medium, approximately 12.5% ​​(v / v) final concentration of F12, approximately 37.5% (v / v) final concentration of DMEM, and approximately 1.0% (v / v) final concentration of FBS. [Invention 1075] A cell culture medium according to any of the inventions 1071 to 1074, obtained by mixing the following to obtain a final volume of 1000 ml of culture medium: 200 ml of mammary epithelial basal medium MCDB 170, 300 ml of EpiLife medium, 250 ml of DMEM, 250 ml of DMEM / F12, and 1% fetal bovine serum. [Invention 1076] A cell culture medium according to any of the inventions 1071 to 1075, containing insulin at a final concentration of approximately 1 to approximately 7.5 μg / ml. [Invention 1077] A cell culture medium according to any of the inventions 1071 to 1076, containing human epidermal growth factor (EGF) at a final concentration of approximately 1 to approximately 15 ng / ml. [Invention 1078] A cell culture medium suitable for the regeneration of transfected umbilical cord amniotic membrane epithelial stem cells, comprising any of the following supplements: adenine, hydrocortisone, and at least one of 3,3',5-triiodo-L-thyronine sodium salt (T3), according to any of the inventions 1071 to 1077. [Invention 1079] A cell culture medium according to Invention 1078, comprising all three elements: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3). [Invention 1080] A cell culture medium according to Invention 1079, comprising adenine at a final concentration of approximately 0.05 to approximately 0.1 mM, hydrocortisone at a final concentration of approximately 0.1 to 0.5 μM, and / or 3,3',5-triiodo-L-thyronine sodium salt (T3) at a final concentration of approximately 0.1 to approximately 5 ng / ml. [Invention 1081] A cell culture medium according to any of the present invention 1071 to 1080, comprising one or more transforming growth factors (TGFs). [Invention 1082] A cell culture medium according to Invention 1081, comprising transforming growth factor β1 (TGF-β1) at a final concentration of approximately 0.1 to approximately 5 ng / ml and / or transforming growth factor α (TGF-α) at ​​a final concentration of approximately 1.0 to approximately 10 ng / ml. [Invention 1083] Approximately 1×10 -11 M ~ approx. 1×10 -10A culture medium according to any one of the invention 1071 to 1082, containing cholera toxin derived from Vibrio cholerae at a final concentration of M. [Brief explanation of the drawing]

[0020] The present invention will be better understood by referring to the detailed description, in conjunction with non-limiting embodiments and drawings.

[0021] [Figure 1]A schematic flowchart illustrating the experimental steps of an exemplary embodiment of the method for producing induced pluripotent stem cells of the present invention is shown. The stem cells used herein are isolated from the amniotic membrane of the umbilical cord and are also called umbilical cord-lining stem cells (CLSCs). This embodiment begins with the recovery of isolated CLSCs by dissociating the cells from a cell culture device (however, it should be noted that CLSCs can also be supplied in an isolated form for the method of the present invention). Next, the CLSCs are counted and approximately 700,000 cells are dispensed into a microcentrifuge tube and pelletized. The cell pellet is resuspended in a buffer suitable for electroporation before adding the plasmid encoding the Yamanaka factor to the cell-buffer mixture. Electroporation is performed in one pulse with a duration of approximately 20 ms and a voltage of approximately 1600 V, or in two pulses with a duration of 30 ms and a voltage of approximately 1350 V, for umbilical cord-lining mesenchymal cells (CLMCs) and umbilical cord-lining epithelial cells (CLECs), respectively. After electroporation, the stem cells are immediately transferred to a medium suitable for recovery, which contains compounds that suppress inflammatory responses and enhance cell viability. After a suitable recovery time, the recovery medium is replaced with a 1:1 mixture of two different cell culture media, the recovery medium and the second cell culture medium. To refresh the cell culture medium, the medium mixture is replaced with the same cell culture medium mixture approximately 4 days after electroporation. This creates colonies of umbilical cord-lined induced pluripotent stem cells, also known herein as CLiPS. Approximately 2 days later, the 1:1 mixture of the two different cell culture media is replaced with the second cell culture medium. This medium is also replaced approximately every 2 days to maintain freshness. When the CLiPS colonies reach a size of approximately 0.5 mm to 1.5 mm in diameter, they are picked and transferred to coated cell culture vessels suitable for cell culture and proliferation. In this case, as before, the cell culture medium is periodically replaced with the same medium. After reaching a concentration density of approximately 50%, the CLiPS colonies are detached from the coated culture device and transferred to another cell culture vessel suitable for cell culture and proliferation. In this way, the CLiPS colonies are further dissociated.Once the concentration density reaches approximately 70-80%, the CLiPS are subcultured at a ratio of approximately 1:3 (v / v), where this ratio is achieved by contacting 1 volume of dissociated CLiPS with 2 volumes of fresh culture medium. Next, the CLiPS are cultured in a medium containing a substance that enhances cell viability until the concentration density reaches approximately 30-60%. At this point, the CLiPS can differentiate into any desired target cell. [Figure 2] An exemplary comparison of the reprogramming efficiency of individual CLSC populations is shown. Stem cells were subjected to different electroporation settings to transfect them with exogenous nucleic acids. Electroporation was performed using the electroporation parameters shown above by Okita et al. (1650 V, 10 ms, 3 pulses), as well as the parameters used in the present invention for the transfection of umbilical cord amniotic epithelial stem cells (hereinafter also referred to herein as “umbilical cord-lining epithelial stem cells” or CLEC; 1350 V, 30 ms, 2 pulses) and umbilical cord mesenchymal stem cells (hereinafter also referred to herein as umbilical cord-lining mesenchymal stem cells or CLMC (1600 V, 20 ms, 1 pulse)). Transfected cells at 200K were plated in triplets in 6-well plates. Approximately 21 days after transfection, the percentage of reprogramming efficiency was calculated as colony count / 200,000 × 10⁻⁶. [Figure 3-1]This shows exemplary colony development of induced pluripotent stem cells from human CLMCs. Figures 3a-3f show typical time progression of colony development, where Figure 3a depicts the typical morphology of human CLMCs cultured in maintenance medium on day 0 of culture. Figure 3b depicts the typical morphology of human CLMCs cultured in maintenance medium on day 15 of culture. Figure 3c depicts the typical morphology of human CLMCs cultured in maintenance medium on day 24 of culture. Figure 3d depicts the typical morphology of human CLMCs cultured in maintenance medium on day 29 of culture. Figure 3e shows a 4x magnified view of the typical morphology of an iPS colony in its first passage, and Figure 3f shows a 10x magnified view of the typical morphology of an iPS colony at its first passage. Figures 3g-l: Exemplary immunofluorescence staining of iPS cells derived from human umbilical cord-lining cells, showing activation of endogenous expression of pluripotent embryonic stem cell markers. Here, Figure 3g shows KLF4 expression, Figure 3h shows NANOG expression, Figure 3i shows OCT3 / 4 expression, Figure 3j shows SOX2 expression, Figure 3k shows SSEA4 expression, and Figure 3l shows Tra-1-60 expression. Figure 3m: Exemplary karyotype analysis demonstrating normal chromosome number and G-banding pattern of CLiPS cells in individual cell lines CLEC23 (EC23-CLiPS), CLMC23 (MC23-CLiPS), CLEC44 (EC44-CLiPS), and CLMC44 (MC44-CLiPS). Figure 3n: Exemplary human CLMSC-DTHN cultures that appeared 10 days after reprogramming are shown at 20x magnification. Figure 3o: Typical morphology of expanded human CLMSC-DTHN cultured on laminin-511 substrate, magnified 4x. Figure 3p: Typical morphology of expanded human CLMSC-DTHN cultured on laminin-511 substrate, magnified 10x. Figure 3q: Typical morphology of expanded human CLMSC-DTHN cultured on laminin-511 substrate, magnified 20x. Figure 3r: Exemplary expression of the human pluripotency marker NANOG in CLMSC-DTHN iPS cells at passage 3. Figure 3s: Exemplary expression of the human pluripotency marker OCT3 / 4 in CLMSC-DTHN iPS cells at passage 3.Figure 3t: Exemplary expression of the human pluripotency marker SOX2 in passage 3 CLMSC-DTHN iPS cells. Figure 3u: Exemplary expression of the human pluripotency marker NTRA-1-81 in passage 3 CLMSC-DTHN iPS cells. Scale bars: All 100 μm. Figure 3v: Exemplary RT-PCR analysis of reprogramming gene expression and pluripotency gene expression in primary parental cells, parental cells 11 days after vector transfection (D11 transfected cells), and established iPS clones (CLiPS). "Vec" indicates amplification specific to vector-derived sequences. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Genomic contamination of all primer pairs was controlled using PCR of human (homo sapiens) (H1) total RNA without reverse transcription. [Figure 3-2] See the explanation in Figure 3-1. [Figure 3-3] See the explanation in Figure 3-1. [Figure 3-4] See the explanation in Figure 3-1. [Figure 3-5] See the explanation in Figure 3-1. [Figure 4-1]This shows an exemplary histological analysis of teratomas formed in immunodeficient non-obese diabetic severe combined immunodeficiency (NOD-SCID) mice after CLiPS injection. Teratoma formation assays reveal the formation of all three germ layers. Figure 4a inset: Teratomas obtained from human CLEC-derived iPS cells 3 months after subcutaneous injection. Teratoma sections were further analyzed by hematoxylin-eosin staining. Figure 4a: Shows the presence of respiratory-like epithelium in the teratoma. Figure 4b: Shows the presence of glandular structures representing the endoderm in the teratoma. Figure 4c: Arrows indicate the presence of cartilage in the teratoma. Figure 4d: Arrows indicate the presence of bone representing the mesoderm in the teratoma. Figure 4e: Shows the presence of renal tissue in the teratoma. Filled arrows indicate glomeruli, and hollow arrows indicate tubules. Figure 4f: Arrows indicate the presence of neuroepithelium representing the ectoderm in the teratoma. Using a directed differentiation protocol, CLiPS cells were induced to differentiate into specific tissues. Figure 4g: CLiPS differentiated into hepatocytes visualized with α-fetoprotein (AFP) and 4',6-diamidino-2-phenylindole (DAPI). Figure 4h: CLiPS differentiated into hepatocytes visualized with human serum albumin (HAS), cytokeratin 18 (CK18), and DAPI. Figure 4i: CLiPS differentiated into hepatocytes visualized with Oil Red O. Figure 4j: CLiPS differentiated into cardiomyocytes visualized with α-actinin (αACT), cardiac troponin I (cTnl), myosin-regulated light chain 2a (MLC2a), and DAPI. Figure 4k: CLiPS differentiated into dopaminergic neurons visualized with the base plate marker FOXA2, the lid plate marker LMX1A, and DAPI. Figure 4l: CLiPS differentiated into dopaminergic neurons visualized with neuron-specific class III β-tubulin (TUJI) and tyrosine hydroxylase (TH). Figure 4m: CLiPS differentiated into oligodendrocyte progenitor cells visualized with OLIG2 and DAPI. Figure 4n: CLiPS differentiated into oligodendrocyte progenitor cells visualized with O4 and DAPI. Figure 4o: Electrophysiological analysis of mature human CLiPS-derived dopaminergic neurons at day 45 of differentiation.Human CLiPS-derived dopaminergic neurons fire action potential trains in response to injected current. Scale bars: 200 μm in Figures 4a, 4c, and 4d; 100 μm in Figures 4b, 4e, and 4f; 50 μm in Figures 4g, 4h, 4i, 4k, 4l, and 4m; 25 μm in Figures 4j and 4n. [Figure 4-2] See the explanation in Figure 4-1. [Figure 5-1] This shows exemplary directed differentiation of human CLiPS into various different cell types, where Figure 5a depicts human CLiPS-derived neurons visualized with TH, Tuik, and DAPI; Figure 5b depicts human CLiPS-derived hepatocytes visualized with CK18, HAS, and DAPI; Figure 5c depicts human CLiPS-derived cardiomyocytes visualized with cTnl, αAct, and DAPI; and Figure 5d shows electrophysiological analysis of contractile human CLiPS-derived cardiomyocytes illustrating cells that generate spontaneous action potentials. [Figure 5-2] See the explanation in Figure 5-1. [Figure 6-1] Exemplary flow cytometry analyses of major histocompatibility complex (MHC) class I and II, as well as T cell costimulatory protein expression, in iPS cells and dopaminergic neural progenitor cells differentiated therefrom are shown. Figure 6a: Flow cytometry profile of immune-related gene expression in undifferentiated iPS cells. Figure 6b: Flow cytometry analysis of neuronal adhesion molecule (NCAM)-positive populations. These populations were gated for analysis of immune-related protein expression. Figure 6c: Analysis of immune-related protein expression in differentiated dopaminergic neural progenitor cells at day 25. [Figure 6-2] See the explanation in Figure 6-1. [Figure 6-3] See the explanation in Figure 6-1. [Figure 6-4] See the explanation in Figure 6-1. [Figure 6-5] See the explanation in Figure 6-1. [Figure 6-6] See the explanation in Figure 6-1. [Figure 6-7]See the explanation in Figure 6-1. [Figure 6-8] See the explanation in Figure 6-1. [Figure 6-9] See the explanation in Figure 6-1. [Figure 6-10] See the explanation in Figure 6-1. [Figure 7]This report compares the in vivo engraftment of dopaminergic neural progenitor cells (NPCs) derived from human CLiPS and human adult fibroblast iPS cells (asF-iPS) in NOD-SCID mice. Dopaminergic NPCs were injected into the striatum of NOD-SCID mice at day 25, and their engraftment and differentiation potential in an immunodeficient environment was evaluated. TH-immunoreactive dopaminergic neurons were found among the abundant human NCAM-positive engrafted neurons. Figure 7a: In vivo engraftment of dopaminergic NPCs derived from human asF-iPS at day 25. Figure 7b: In vivo engraftment of dopaminergic NPCs derived from human CLEC-iPS (EC23-CLiPS) at day 25. Figure 7c: In vivo engraftment of dopaminergic NPCs derived from CLMC-iPS (MC23-CLiPS) at day 25. Figure 7d: Antibody staining of the transplanted hemisphere of a Parkinson's disease (PD) mouse model created in immunocompetent C57BL / 6NTac mice one month after transplantation of a dopaminergic NPC derived from human CLEC-iPS cells. Abundant human NCAM (green) and TH (red) bipositive neurons are present at the injection site. Figure 7e: Shows long neurites originating from the transplant site projecting along the large forceps of the corpus callosum to the distal region of the brain. Arrow in Figure 7f: Shows abundant human NCAM and TH bipositive neurons at the injection site, as indicated by the arrow. Figure 7g: Shows the contralateral non-transplanted hemisphere of the same section shown in Figure 7d. Figure 7h: Exemplifies the absence of viable cells in the striatum transplanted with a human adult asF-iPS-derived NPC, suggesting immune rejection. Figure 7i: Shows abundant microglia / macrophage aggregation in the transplanted hemisphere. Figure 7j: Shows the absence of microglia / macrophage aggregation in the non-transplanted hemisphere. Figure 7k: Shows a higher magnification than Figure 7i. Microglia located proximal and internal to the graft can be seen to exhibit a more amoeboid morphology characteristic of activated microglia. Figure 7l: Shows a higher magnification than Figure 7k, showing the expression of CD68, a marker of microglial activation. Scale bars: 100 μm in Figures 7a-c and 7k; 200 μm in Figures 7d, 7g and 7h; 50 μm in Figures 7e, 7f and 7l. [Figure 8-1] Figure 8g illustrates the survival of human CLEC-derived (EC23-CLiPS) dopaminergic neurons in a mouse PD model 9 months after transplantation. Figure 8a: Shows HuNu+ / hNCAM+ / TH+ neurons in the transplanted hemisphere. Figure 8b: A superposition of Figures 8c-f, showing a higher magnification of the area enclosed in the frame in Figure 8a. Figure 8c: Shows hNCAM+ neurons in the transplanted hemisphere. Figure 8d: Shows HuNu+ neurons in the transplanted hemisphere. Figure 8e: Shows TH+ neurons in the transplanted hemisphere. Figure 8f: Shows the nuclei of neurons in the transplanted hemisphere. Figure 8g schematically illustrates the experimental steps starting with induction of PD lesions by injection of 6-hydroxydopamine (6-OHDA) into the striatum of C57BL / 6NTac mice. Pre-transplant rotational behavior assays were performed 1 and 2 weeks before NPC transplantation. Figure 8h: Results of apomorphine-induced rotational asymmetry assay in mice transplanted with dopaminergic NPCs derived from human EC23-CLiPS and asF-iPS, as well as in sham controls. The assay was performed every two weeks until 22 weeks post-transplant. Animals in the human EC23-CLiPS group showed statistically significant rotational recovery compared to the asF-iPS group from 20 weeks post-transplant (n=5, p<0.05). No recovery was observed in the sham treatment group. Figure 8h: Representative in vivo positron emission tomography (PET) images of [18F]PE-P2I ligand uptake to assess the recovery of dopamine transporter (DAT) function in striatal dopaminergic neurons 6 months post-transplant. Mice transplanted with human EC23-iPS NPCs showed recovery of DAT activity compared to mice transplanted with asF-iPS NPCs or sham controls. Scale bar: 200 μm in Figure 8a; 100 μm in Figures 8b-f. [Figure 8-2] See the explanation in Figure 8-1. [Figure 9]Exemplary in vivo PET imaging of striatal dopamine production in transplanted mice is shown. PET exemplifies the uptake of [18F]PE-P2l ligand to assess the recovery of dopamine transporter (DAT) function in striatal dopaminergic neurons 6 months after iPS-derived NPC transplantation. Mice transplanted with human CLEC-iPS-derived NPCs show a clear recovery of DAT activity compared to mice transplanted with human adult iPS-derived NPCs or sham transplant controls. [Figure 10] This study illustrates the in vivo maintenance of human CLiPS-derived grafts at 6 and 9 months after transplantation into mouse brains. The grafts stained positively for the human antigen NCAM and TH dopaminergic marker. No tumor formation was recorded. Scale bar: 50 μm. [Figure 11] This paper presents the results of histological and functional analysis of transplanted human EC23-CLiPS dopaminergic NPCs in a medial forebrain bundle (MFB) lesion model of PD generated in fully immunocompetent Wistar Hannover rats. Figure 11a: Engraftment of human EC23-CLiPS neurons in the striatal region of rat brains 3 months after transplantation, demonstrated by positive double staining for human cytoplasm (STEM 121) and human nuclear antigen (HuNu) antibodies. Staining indicates functional recovery. Figure 11b: Shows co-localization of synapsin 1 immunoreaction with hNCAM+ / TH+ neurons, suggesting the possibility of integration between transplanted human CLiPS-derived cells and host tissue 3 months after transplantation. Figure 11c: Shows retrograde dopaminergic lesions in the substantia nigra of rat brains. Figure 11d: Shows non-lesioned rat brain confirming the retrograde dopaminergic lesions in the substantia nigra of Figure 11c by tyrosine hydroxylase (TH) immunostaining. Figure 11e: Results of an apomorphine-induced rotational asymmetry assay in rats transplanted with dopaminergic NPCs derived from human CLEC23-iPS. These results indicate that CLiPS-NPC transplantation mediated the recovery of functional motor impairment in a rat MFB model of PD over a 6-month study period. Scale bars: 100 μm in Figures 11a and 11b; 200 μm in Figures 11c and 11d. [Figure 12a]The following are exemplary colonies of induced pluripotent stem cells derived from human CLEC, prepared using PTTe-3 medium as the recovery medium. [Figure 12b] See the explanation in Figure 12a. [Figure 12c] See the explanation in Figure 12a. [Modes for carrying out the invention]

[0022] Detailed description of the invention This invention relates to a method for producing induced pluripotent stem cells from umbilical cord amniotic membrane stem cells under conditions suitable for reprogramming stem cells, and thereby producing induced pluripotent stem cells (iPS).

[0023] In this invention, iPS cells, also known as induced pluripotent stem cells or "CLiPS" as used herein, are produced using both mesenchymal stem cells and epithelial stem cells of the amniotic membrane of the umbilical cord, collectively referred to herein as umbilical cord-lining stem cells (CLSCs). Surprisingly, the umbilical cord-lining-derived induced pluripotent stem cells of this invention were found to be robust and homogeneous stem cells capable of differentiating into functional target cells of different lineages (see Examples 3 and 4). For example, the umbilical cord-lining-derived induced pluripotent stem cells have the ability to differentiate into multiple cell types, such as hepatocytes representing endodermal tissue (see Example 8), cardiomyocytes representing mesodermal tissue (see Example 9), and dopaminergic neurons (see Example 7) and oligodendrocytes (see Example 10) representing ectoderm. Even more surprisingly and importantly, for example, human CLiPS-derived dopaminergic neurons were found to be functionally engraftable in different species, surviving for up to 9 months in an immunosuppressed mouse Parkinson's disease (PD) model and 6 months in an immunosuppressed rat PD model (see Examples 12 and 13). Therefore, in summary, we have created a low immunogenicity cell source capable of engrafting, integrating, and mediating therapeutic recovery in a fully immunocompetent host. The umbilical cord lining-derived induced pluripotent stem cells of the present invention can potentially be used as a universal cell source for allogeneic cell transplantation in humans without requiring immunosuppression, thereby making them ideal candidates for therapies based on such cells. As a further advantage, it has been found herein that the umbilical cord lining-derived induced pluripotent stem cells of the present invention can be produced by an integration and feeder-free method, and thus can produce iPS under current Good Manufacturing Practices (cGMP) conditions. In recent years, GMP processes for the mass production of mesenchymal stem cells from umbilical cord amniotic membranes have been established (see International Patent Application WO 2018 / 067071 or U.S. Patent Application US2018127721), so the present invention provides an ideal platform for producing iPS cells for subsequent cell-based therapies in humans or animals.

[0024] First, the method for producing iPS cells according to the present invention will be described. This method may involve expressing exogenous nucleic acids encoding the proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA. The nucleic acid encoding OCT3 / 4 (SEQ ID NO: 1), sometimes called POU5FL, OCT3, or OCT4, encodes octamer-binding transcription factor 4. OCT3 / 4 (SEQ ID NO: 2) forms a heterodimer with SOX2 to regulate intracellular pluripotency factors. SOX2 (SEQ ID NO: 3), sometimes called SEY, encodes sex-determining region Y-box 2 transcription factor (SEQ ID NO: 4). When SOX2 binds to OCT3 / 4, it binds to non-palindromic genome sequences, activating the transcription of intracellular pluripotency factors. KLF4 (SEQ ID NO: 5), sometimes called GKLF, encodes Krueppel-like factor 4. KLF4 (SEQ ID NO: 6) is a zinc finger transcription factor that functions as a tumor suppressor that regulates the G1-G2 transition of the cell cycle by mediating the tumor suppressor p53. L-MYC (SEQ ID NO: 7) encodes a transcription factor (SEQ ID NO: 8) that activates the expression of proliferative genes. LIN28 (SEQ ID NO: 9) encodes RNA-binding protein Lin-28 homolog A (SEQ ID NO: 10) that regulates the self-renewal of stem cells. p53-shRNA (SEQ ID NO: 11) encodes a small hairpin RNA directed towards p53, a protein that can regulate the cell cycle by arranging it when it accumulates in cells. To avoid cell cycle arrest by p53, p53-shRNA may silence the expression of p53 after transcription. To produce CLiPS, exogenous nucleic acids encoding OCT3 / 4, SOX2, KLF4, LIN28, LMYC, and p53-shRNA may be transferred into CLSC for expression. Alternatively, the proteins OCT3 / 4, SOX2, KLF4, LIN28, L-MYC, and p53 shRNA may be directly transferred into the CLSC.

[0025] As described above, the induced pluripotent stem cell population of the present invention can be obtained by reprogramming stem cells from the amniotic membrane of the umbilical cord. The stem cells from the umbilical cord may be (isolated) mesenchymal stem cells from the amniotic membrane of the umbilical cord, also known as umbilical cord-lining mesenchymal stem cells (CLMC), or (isolated) epithelial stem cells from the amniotic membrane of the umbilical cord, also known as umbilical cord-lining epithelial stem cells (CLEC). The CLEC and CLMC used to produce the iPS cells of the present invention may be derived from any mammalian species such as mouse, rat, guinea pig, rabbit, goat, horse, dog, cat, sheep, monkey, or human, and in one embodiment, human-derived stem cells are preferred. Similarly, the iPS cells of the present invention may be derived from any mammalian species such as mouse, rat, guinea pig, rabbit, goat, horse, dog, cat, sheep, monkey, or human, and in one embodiment, human-derived stem cells are preferred.

[0026] When using epithelial stem cells from the amniotic membrane of the umbilical cord as a starting material, these epithelial stem cells can be obtained, for example, as described in U.S. Patent Application No. 2006 / 0078993 (leading to U.S. Patent Nos. 9,085,755 and 9,737,568) or the corresponding International Patent Application WO2006 / 019357. When using mesenchymal stem cells from the amniotic membrane of the umbilical cord as a starting material, they can similarly be obtained as described in U.S. Patent Application No. 2006 / 0078993 (leading to U.S. Patent Nos. 9,085,755 and 9,737,568) or the corresponding International Patent Application WO2006 / 019357.

[0027] As starting material, it is also possible to use a mesenchymal stem cell population such as that described in the published U.S. Patent Application No. 2018 / 127721 or the corresponding International Application WO 2018 / 067071. The mesenchymal stem cell population of International Application WO 2018 / 067071 has the advantage that 99% or more of the stem cells in this population are positive for three mesenchymal stem cell markers CD73 and CD90, while simultaneously lacking expression of CD34, CD45, and HLA-DR. This means that 99% or more of the cells in the mesenchymal stem population of International Application WO 2018 / 067071 express the stem cell markers CD73, CD90, and CD105, while not expressing the markers CD34, CD45, and HLA-DR. This extremely homogeneous and well-defined cell population is an ideal candidate for clinical trials and cell-based therapies because it fully meets the generally accepted criteria for human mesenchymal stem cells used for cell therapy, as defined, for example, Dominici et al., "Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement," Cytotherapy (2006) Vol. 8, No. 4, 315-317; Sensebe et al., "Production of mesenchymal stromal / stem cells according to good manufacturing practices: a, review," Stem Cell Research & Therapy 2013, 4:66); Vonk et al., Stem Cell Research & Therapy (2015) 6:94; or Kundrotas Acta Medica Lituanica. 2012. Vol. 19. No. 2. P. 75-79. Therefore, the mesenchymal stem population of international application WO 2018 / 067071 is an ideal starting material for producing CLiPS of the present invention under GMP conditions.

[0028] In this regard, it should be noted that CLMCs transfected with transgenes may maintain their stem cell nature and characteristics, but may show a decrease in the proportion of cells expressing mesenchymal stem cell markers such as CD73, CD90, and CD105, while simultaneously showing an increase in the proportion of cells expressing negative markers such as CD34, CD45, or HLA-DR. See Yap et al., Malaysian J Pathol 2009; 31(2): 113-120); similarly, see Madeira et al, Journal of Biomedicine and Biotechnology. Volume 2010, Article ID 735349, 12 pages. In light of this, the CLiPS of the present invention, produced by reprogramming CLMC as described herein and isolated from the amniotic membrane of the umbilical cord, may be a stem cell population in which at least about 81% or more, about 82% or more, at least 83% or more, at least 84% or more, at least about 85%, or about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more cells express the following markers: CD73, CD90, and CD105, respectively.Furthermore, in such CLMC-derived populations of induced pluripotent stem cells of the present invention, at least about 81% or more, about 82% or more, at least 83% or more, at least 84% or more, at least about 85%, or about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, and about 99% may be populations lacking expression of CD34, CD45, and HLA-DR, respectively. A preferred example of such a CLMC-derived population of induced pluripotent stem cells of the present invention may be a population in which at least about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more cells express CD73, CD90, and CD105 respectively, and lack expression of CD34, CD45, and HLA-DR respectively.

[0029] Turning back to the production of induced pluripotent stem cells (populations) of the present invention, it is important to note again that such induced pluripotent stem cells can be obtained by any suitable method of reprogramming umbilical cord amniotic stem cells (populations) into such induced pluripotent stem cells (populations). One method for producing such induced pluripotent stem cells includes the step of expressing exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, in umbilical cord amniotic stem cells under conditions suitable for reprogramming stem cells, thereby producing induced pluripotent stem cells, but the present invention is by no means limited to CLiPS obtained by this method. Rather, CLiPS can be obtained by any suitable method, as described, for example, in the review by Cieslar-Probuda et al., “Transdifferentiation and reprogramming: Overview of the processes, their similarities and differences,” BBA - Molecular Cell Research, Volume 1864, Issue 7, July 2017, Pages 1359-1369. For example, reprogramming can be carried out in the present invention chemically by using small molecules, or biologically by expressing exogenous nucleic acids encoding reprogramming factors in cells. Alternatively, exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, L MYC, and p53 shRNA can be provided as any nucleic acid suitable for expression. For example, the nucleic acid may be ribonucleic acid (RNA), including deoxyribonucleic acid (DNA), messenger RNA (mRNA), and microRNA (miRNA). Exogenous nucleic acids may be transferred as is, or they may be incorporated into one or more vectors suitable for transfer into cells. In this regard, any vector suitable for transfer into CLSCs can be used. An example of such a vector may be a plasmid. In the present invention, exogenous nucleic acids may be provided by one, two, three, or four vectors suitable for transfer into stem cells.For example, three vectors, which may be pCXLE-hOCT3 / 4-shp53-F (Addgene plasmid number 27077; SEQ ID NO: 12), pCXLE-hSK (Addgene plasmid number 27078, SEQ ID NO: 13), and pCXLE-hUL (Addgene plasmid number 27080; SEQ ID NO: 14), can provide exogenous nucleic acids for reprogramming CLSC into CLiPS.

[0030] In accordance with the above, any method suitable for transferring exogenous nucleic acids or proteins into a CSLC can be used. For example, a viral vector may be used to transfer the exogenous nucleic acid into the CSLC. Examples of such viral vectors may be retroviruses, lentiviruses, inducible lentiviruses, Sendai viruses, or adenoviruses. Alternatively, transfection may be performed to transfer the exogenous nucleic acid into the CSLC. In the present invention, transfection may include electroporation, microinjection, liposome-mediated and non-liposome-mediated transfection, and sonoporation.

[0031] In a preferred example, since CLMCs may require different electroporation conditions than CLECs, CLSCs may be subjected to electroporation, with electrical parameters being adjusted depending on the type of CLSC used. These electrical parameters may include the number of electrical pulses applied to the stem cells, the duration of the applied electrical pulses, and the voltage of the applied electrical pulses. Each electrical parameter may be adjustable to further optimize the electroporation of the present invention. If so, each electrical parameter may be adjusted independently or in combination with one or more other electrical parameters (see Example 1). In the present invention, any parameter setting suitable for enabling the transfer of exogenous nucleic acids into CLSCs may be applied. In one example of the present invention, CLMCs may be subjected to electroporation. In such a case, electroporation may be performed with one electrical pulse having a duration of about 15 milliseconds (ms) to about 25 ms and a voltage of about 1550 V to about 1650 V. Therefore, in one example, CLMCs may be subjected to electroporation with a single electrical pulse that may have a duration of approximately 20 ms and a voltage of approximately 1600 V. Furthermore, it has been found herein that the amount / number of usable CLiPS derived from CLMCs depends on the ratio of each vector (plasmid) DNA to be transfected to the number of CLMCs used for transfection. This ratio is expressed herein as the number of CLMCs subjected to electroporation (1 × 10⁶ cells). 6 It is expressed in terms of the amount (in μg) of each vector (plasmid) DNA used per cell. For example, the ratio of the amount of vector (plasmid) DNA of each vector to the number of cells is approximately 1 × 10⁻⁶. 6 Approximately 1.5 μg of DNA per CLMC (Cellular Microorganism) ~ about 1 × 10⁻⁶ 6 This can range from approximately 2.5 μg of DNA per CLMC. Therefore, this ratio is approximately 1 × 10⁻⁶. 6 Approximately 2.5 μg of DNA per CLMC, approximately 1 × 10⁻⁶ 6 Approximately 2.25 μg of DNA per CLMC, approximately 1 × 10⁶ 6Approximately 1.8 μg of DNA per CLMC, approximately 1 × 10⁶ 6 Approximately 1.7 μg of DNA per CLMC, approximately 1 × 10⁻⁶ 6 Approximately 1.67 μg of DNA per CLMC, approximately 1 × 10⁻⁶ 6 Approximately 1.6 μg of DNA per CLMC, or approximately 1 × 10⁶ 6 It can be approximately 1.5 μg of DNA per CLMC (approximately 1 × 10⁻⁶). 6 See Table 1, which shows that an effective transformation yield was obtained by using a ratio of approximately 1.67 μg of DNA per CLMC, or the amount of vector (plasmid) DNA of each vector to the number of cells. Therefore, in one embodiment of producing CLiPS derived from CLMC, it is preferable to use the same amount of each vector in the electroporation of CLMC. Alternatively, CLEC may be subjected to electroporation to obtain the CLiPS of the present invention. In the case of CLiPS derived from CLEC, electroporation may be performed with two electrical pulses, each having a duration of approximately 25 ms to approximately 35 ms and a voltage of approximately 1300 V to approximately 1400 V. Therefore, in one example, CLEC may be subjected to electroporation with two electrical pulses, each having a duration of approximately 30 ms and a voltage of approximately 1350 V. Regarding CLMCs, it was also found that the electroporation required to obtain the usable amount / number of CLiPS derived from CLECs depends on the ratio of the amount of each plasmid DNA to be transfected to the number of CLECs used for transfection. Furthermore, this ratio is expressed herein as the number of CLECs to be transfected (1 × 10⁶ cells). 6 It is expressed in terms of the amount of vector (plasmid) DNA used for transfection (in μg) per cell. For example, the ratio of the amount of vector (plasmid) DNA to the number of cells is approximately 1 × 10⁻⁶. 6 Approximately 1.5 μg of DNA per CLEC ~ approximately 1 × 10⁻¹⁶ 6 This can range from approximately 2.5 μg of DNA per CLEC. Therefore, this ratio is approximately 1 × 10⁻⁶. 6Approximately 1.5 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 1.6 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 1.67 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 1.7 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 1.8 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 1.9 μg of DNA per CLEC, approximately 1 × 10⁶ 6 Approximately 2.0 μg of DNA per CLEC, or approximately 1 × 10⁶ 6 Approximately 2.5 μg of DNA can be found per CLEC (approximately 1 × 10⁻⁶). 6 See Table 1, which shows that an effective transformation yield was obtained by using a ratio of plasmid DNA amount of each vector to the number of cells, approximately 1.67 μg of DNA per CLEC. Therefore, in one embodiment of producing CliPS derived from CLEC, it is preferable to use the same amount of each vector in the electroporation of CLEC. Electroporation of both CLEC and CLMC can be carried out in a uniform electric field in the method of the present invention. This can minimize significant effects of electroporation such as pH changes, ion formation, or heat generation. A uniform electric field can be created by maximizing the gap between electrodes while minimizing the surface area of ​​each electrode. An example of a system that provides such a uniform electric field is ThermoFisher Scientific's Neon® Transfection System. Another example of a suitable commercially available transfection system is The Gene Pulser MXcell electroporation system, available from Bio-Rad. Finally, transfection can be carried out using any suitable electroporation buffer. When commercially available transfection systems, such as the Neon™ transfection system, are used, the electroporation buffers provided by the transfection system manufacturer are typically used for electroporation.

[0032] After transfection, the stem cells may be transferred to a medium suitable for cell regeneration and cell culture. In this invention, any cell culture medium suitable for cell regeneration and / or proliferation can be used. Examples of such applicable cell culture media may be media commonly used for culturing (proliferating) human induced pluripotent stem cells, such as mTeSR1, StemMACS® iPS-Brew XF, TeSR®-E8, mTeSR®Plus, TeSR®2, and mTeSR®1. Any medium capable of supporting the proliferation (without differentiation) / healthy growth of CLEC or CLMC can also be used for cell regeneration culture. Examples of culture media suitable for culturing CLECs are described, for example, in U.S. Patent Application No. 2006 / 0078993 and include EpiLife medium, Medium 171, MEGM-Mammary Epithelial Cell Medium, or mixtures of such media, such as medium PTT-e3 (used herein for the production of CLiPS derived from CLECs and described in detail below herein). Examples of media suitable for this culture of CLMCs are described, for example, in U.S. Patent Applications 2006 / 0078993 and 2018 / 127721 and International Patent Application WO2007 / 046775, and include media such as DMEM / 10% FBS, DMEM:F12 medium (a 1:1 mixture of DMEM and Ham's F-12 medium), or PPT-6 (a medium containing DMEM, F12- medium, Medium 171, and FBS, see U.S. Patent Application 2018 / 127721) or PTT4 (the latter used in the Examples section of this specification for the production of CLiPS derived from CLMCs). For this cell recovery culture, mixtures of these media (e.g., a mixture of mTeSR1 and medium PTTe-3 or medium PTT-4) may also be used. The cell culture medium suitable for the cell recovery of transfected CLEC or CLMC described herein may further contain growth factors that can stimulate cell growth and proliferation. The growth factors may be added directly to the cell culture medium. Furthermore, the recovery medium may contain serum, such as fetal bovine serum (FBS).Therefore, suitable media for cell recovery after transfection may be serum-free media or serum-containing media.

[0033] In accordance with the above disclosure, the composition of the culture medium suitable for cell recovery may vary depending on the CLSC used.

[0034] For example, a suitable medium for the recovery of transfected CLMCs may consist of a (chemically) defined medium and FBS. Thus, a suitable medium for the recovery of transfected CLMCs may consist of approximately 80% (v / v), approximately 85% (v / v), approximately 90% (v / v), or approximately 95% (v / v) of a chemically defined medium and approximately 20% (v / v), approximately 15% (v / v), approximately 10% (v / v), or approximately 5% (v / v) FBS. In a preferred example, CLMCs are cultured in medium PTT-4 for cell recovery after transfection, as described in international patent application WO2007 / 046775, medium PTT-4 consists of 90% (v / v) CMRL-1066 and 10% (v / v) FBS. A suitable medium for the recovery of transfected CLMCs may also be a serum-free medium, in which the medium may contain cytokines and growth factors.

[0035] Furthermore, a suitable medium for the recovery of transfected CLEC may be a defined medium. Such recovery media may include mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's modified Eagle medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum).

[0036] For example, such a medium may contain mammary epithelial basal medium MCDB 170 at a final concentration of approximately 10–30% (v / v), EpiLife medium at a final concentration of approximately 20–40% (v / v), F12 at a final concentration of approximately 5–15% (v / v), DMEM at a final concentration of approximately 30–45% (v / v), and FBS at a final concentration of approximately 0.1–2% (v / v). One such medium may contain mammary epithelial basal medium MCDB 170 at a final concentration of approximately 15–25% (v / v), EpiLife medium at a final concentration of approximately 25–35% (v / v), F12 at a final concentration of approximately 7.5–13% (v / v), DMEM at a final concentration of approximately 35–40% (v / v), and FBS at a final concentration of approximately 0.5–1.5% (v / v). Another such medium may contain approximately 20% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 30% (v / v) final concentration of EpiLife medium, approximately 12.5% ​​(v / v) final concentration of F12, approximately 37.5% (v / v) final concentration of DMEM, and approximately 1.0% (v / v) final concentration of FBS. As used herein, the value "% (v / v)" refers to the volume of each component relative to the final volume of the medium. This means that if DMEM is present in the medium at a final concentration of, for example, approximately 35–40% (v / v), then 1 liter of medium contains approximately 350–400 ml of DMEM. In one embodiment, a medium suitable for the recovery of transfected CLEC cells was obtained by mixing the following to obtain a final volume of 1000 ml of culture medium: 200 ml of MCDB 170 mammary epithelial basal medium, 300 ml of EpiLife medium, 250 ml of DMEM, • 250 ml of DMEM / F12, and • 1% fetal bovine serum.

[0037] Suitable growth factors in the culture medium for the recovery of transfected CLEC may include insulin-like growth factors (IGF) such as IGF-1 or IGF-2, epidermal growth factors (EGF) such as HB-EGF or EPR, transforming growth factors (TGF) such as TGF-α or TGF-β1, activin, bone morphogenetic protein (BMP), platelet-derived growth factor (PDGF), transferrin, and insulin. In one example, CLEC is cultured in medium PTTe-3 for post-transfection cell recovery, where medium PTTe-3 contains human epidermal growth factor (EGF), one or more transforming growth factors such as TGF-α and / or TGF-β (TGF-β1, TGF-β2 and / or TGF-β3), or insulin.

[0038] Accordingly, a medium suitable for the recovery of transfected CLEC may contain human epidermal growth factor (EGF) at a final concentration of approximately 1 to approximately 15 ng / ml. The recovery medium may also contain insulin at a final concentration of approximately 1 to approximately 7.5 μg / ml. This recovery medium may further contain at least one of the following supplements: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3). In one embodiment, the medium contains all three: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3). In this case, the medium may contain adenine at a final concentration of approximately 0.05 to approximately 0.1 mM, hydrocortisone at a final concentration of approximately 0.1 to 0.5 μM, and 3,3',5-triiodo-L-thyronine sodium salt (T3) at a final concentration of approximately 0.1 to approximately 5 ng / ml. The recovery medium may contain one or more transforming growth factors (TGFs), such as transforming growth factor β1 (TGF-β1) and / or transforming growth factor α (TGF-α). In such a medium, TGF-β1 may be present at a final concentration of about 0.1 to about 5 ng / ml, and TGF-α may be present at a final concentration of about 1.0 to about 10 ng / ml. Furthermore, the CLEC recovery medium may contain cholera toxin derived from Vibrio cholerae (this is commercially available, for example, from Sigma Aldrich under catalog number C8052). If cholera toxin derived from Vibrio cholerae is used, it contains about 1 × 10⁻⁶ ng / ml. -11 M ~ approx. 1×10 -10 It may exist at the final concentration of M.

[0039] "DMEM" refers to Dulbecco's Modified Eagle Medium, a modified version of the basic Eagle medium (BME), developed in 1969 (see Figure 1, which shows the datasheet for DMEM available from Lonza). The first DMEM formulation contained 1000 mg / L of glucose and was first reported for the culture of embryonic mouse cells. Since then, DMEM has become a standard medium for cell culture and is commercially available from various sources, including ThermoFisher Scientific (catalog no. 11965-084), Sigma Aldrich (catalog no. D5546), or Lonza, to name just a few suppliers. Therefore, any commercially available DMEM can be used in this invention. In a preferred embodiment, the DMEM used herein is DMEM medium available from Lonza under catalog no. 12-604F. This medium is DMEM supplemented with 4.5 g / L of glucose and L-glutamine. In another preferred embodiment, the DMEM used herein is Sigma Aldrich catalog number D5546 DMEM medium, which contains 1000 mg / L glucose and sodium bicarbonate but does not contain L-glutamine.

[0040] "F12" medium refers to Ham F12 medium. This medium is also a standard cell culture medium and is a nutrient mixture originally designed to culture a wide variety of mammalian and hybridoma cells when used with serum in combination with hormones and transferrin. Any commercially available Ham F12 medium (for example, from ThermoFisher Scientific (catalog no. 11765-054), Sigma Aldrich (catalog no. N4888), or Lonza, to name just a few suppliers) can be used in this invention. In a preferred embodiment, Ham F12 medium from Lonza is used. "DMEM / F12" or "DMEM:F12" refers to a 1:1 mixture of DMEM and Ham F12 culture medium. DMEM / F12 (1:1) medium is also a widely used basic medium for supporting the growth of many different mammalian cells and is commercially available from various suppliers such as ThermoFisher Scientific (catalog no. 11330057), Sigma Aldrich (catalog no. D6421), or Lonza. Any commercially available DMEM:F12 medium can be used in the present invention. In a preferred embodiment, the DMEM:F12 medium used herein is DMEM / F12 (1:1) medium available from Lonza under catalog no. 12-719F (DMEM:F12 with L-glutamine, 15 mM HEPES, and 3.151 g / L glucose).

[0041] "M171" refers to Culture Medium 171, which was developed as a basic culture medium for the proliferation of normal human mammary epithelial cells. This basic medium is also widely used and is commercially available from suppliers such as ThermoFisher Scientific or Life Technologies Corporation (catalog number M171500). Any commercially available M171 medium can be used in this invention. In a preferred embodiment, the M171 medium used herein is the M171 medium available from Life Technologies Corporation under catalog number M171500.

[0042] "Mammary epithelial basal medium MCDB 170" refers to a basal nutrition medium used for the growth of mammary epithelial cells, available in powder form, commercially sold for example from United States Biological, Salem Massachusetts, USA under catalog number M2162, or from Bio-Connect BV, Huissen, The Netherlands under catalog number (MBS652676_10l).

[0043] EpiLife medium refers to a HEPES and bicarbonate buffer medium prepared without calcium chloride, commonly used for serum-free long-term culture of human epidermal keratinocytes and human corneal epithelial cells, and designed for use in an incubator with a 5% CO2 and 95% air atmosphere. It is available from ThermoFisher Scientific, catalog number MEPICF500, or from Sigma Aldrich, product code E 0151.

[0044] "CMRL medium" refers to the medium originally developed by Connaught Medical Research Laboratories for the proliferation of R's "L" cells under serum-free conditions. CMRL medium is also known to be particularly useful for cloning monkey kidney cells and for the proliferation of other mammalian cell lines when supplemented with horse or bovine serum. CMRL medium is commercially available, for example, from ThermoFisher Scientific (catalog number 11530037).

[0045] "FBS" refers to fetal bovine serum (also known as "bovine fetal serum"), that is, the blood fraction remaining after natural blood coagulation, followed by centrifugation to remove any remaining red blood cells. Fetal bovine serum is the most widely used serum supplement for in vitro cell culture of eukaryotic cells because it contains very low levels of antibodies, more growth factors, and allows for versatility in many different cell culture applications. It is preferable to obtain FBS from members of the International Serum Industry Association (ISIA), whose main focus is on the safety and safe use of serum and animal-derived products through proper origin tracing, truthfulness of labeling, and proper standardization and monitoring. ISIA member suppliers of FBS include, to name a few, Abattoir Basics Company, Animal Technologies Inc., Biomin Biotechnologia LTDA, GE Healthcare, Gibco by Thermo Fisher Scientific, and Life Science Production. In the currently preferred embodiment, FBS is available from GE Healthcare under catalog number A15-151.

[0046] A medium suitable for cell regeneration may contain compounds that can suppress the inflammatory response and / or enhance the survival and proliferation of cells after transfection. Examples of such compounds may be glucocorticoids. Glucocorticoids are steroid hormones that can upregulate the expression of anti-inflammatory proteins in the nucleus and suppress the expression of pro-inflammatory proteins in the cytosol. The glucocorticoids used herein may include, to name just a few examples of suitable glucocorticoids, prednisolone, methylprednisolone, dexamethasone, betamethasone, corticosterone, or hydrocortisone. It is also possible to use two or more such glucocorticoids together, for example, a mixture of corticosterone and hydrocortisone. Glucocorticoids can be used at any suitable concentration, for example, from about 0.1 μM to about 2.5 μM or from 0.1 μM to about 5 μM. As one example, a suitable glucocorticoid in the culture medium for the recovery of transfected CLSCs may be hydrocortisone used at a concentration of approximately 0.1 μM to approximately 2.5 μM. In one example, the hydrocortisone concentration in the culture medium suitable for the recovery of transfected CLSCs is approximately 0.5 μM to approximately 2 μM. In one such example, the hydrocortisone concentration is approximately 1 μM.

[0047] The recovery of transfected CLSCs can be performed in a cell culture apparatus such as a cell culture vessel. Cell culture vessels may be, but are not limited to, culture flasks, Petri dishes, roller bottles, and multi-wall plates. Furthermore, cell culture vessels may be coated to provide a layer that can promote cell growth by supplying metabolites to the cells. The coating of the cell culture vessel may be serum-derived or serum-free. An example of a serum-derived coating may be a coating with gelatinous proteins from a basement membrane-like matrix such as Matrigel. Alternatively, serum-free coatings of cell culture vessels are characterized by being animal-free and heterogene-free, and thus may enable cell culture under cGMP conditions. Examples of serum-free coatings for cell culture vessels may be coatings with recombinant proteins or parts thereof, such as coatings with extracellular matrix proteins like collagen, fibronectin, elastin, laminin including, for example, laminin-511 E8 fragment or laminin 521, or a commercially available citronectin XF®, CELLstart, or Synthemax® vivonectin substrate. In one example of the present invention, transfected CLECs may be cultured in cell culture vessels having a serum-derived coating, while CLMCs may be cultured in cell culture vessels having a serum-free coating.

[0048] A medium suitable for the recovery of transfected CLSCs may be replaced with another cell culture medium after an appropriate period of time. An appropriate period may be, for example, about 1 day, 2 days, or 3 days after transfection. Thus, in one example, the medium change may be performed about 2 days after transfection. The other cell culture medium used for the medium change may be a mixture of different cell culture media. In the present invention, any cell culture medium or cell culture medium mixture suitable for iPS production can be used. Furthermore, a suitable cell culture medium or cell culture medium mixture may contain compounds that can suppress inflammatory responses and enhance cell viability. In the present invention, a medium suitable for cell recovery after transfection may be replaced with a mixture of two different cell culture media after an appropriate period of time to ensure adequate supply of nutrients and an appropriate blend of growth factors to the cells so that the cells transition from their original state to a more pluripotent state when somatic cell reprogramming occurs. Thus, the cell culture medium mixture of the present invention may consist of a medium suitable for cell recovery that may contain hydrocortisone, and a second cell culture medium. In a preferred example, two different cell culture media are mixed in a ratio of approximately 1:1 (v / v), where the mixture may be prepared by contacting one volume of cell recovery medium with one volume of a second cell culture medium. In another preferred example, two different cell culture media are mixed in a ratio of approximately 1:2 (v / v) or 2:1, where the mixture may be prepared by contacting one volume of cell recovery medium with two volumes of a second cell culture medium (or two volumes of cell recovery medium with one volume of a second cell culture medium). The second cell culture medium used to prepare the cell culture mixture may be any cell culture medium suitable for enhancing or maintaining iPS cell proliferation (such a medium is also referred to herein as the “maintenance medium”). Using a mixture such as a 1:1 mixture of the cell recovery medium and the maintenance medium has the advantage that CLiPS cells can be gradually migrated from homogeneous medium to ES / iPSC medium rather than a sudden switch that could impair their viability.While we do not wish to be constrained by theory, it is assumed that approximately two days after transfection, some of the successfully transfected umbilical cord-lining stem cells will begin to acquire the characteristics of pluripotent stem cells and simultaneously acquire the nutrient requirements of PSCs. Examples of suitable cell culture media include, but are not limited to, commercially available maintenance media such as mTeSR1, StemMACS® iPS-Brew XF, TeSR®-E8, mTeSR®Plus, TeSR®2 or mTeSR®1, Corning® NutriStem® hPSC XF Medium, Essential 8 Medium (ThermoFisher Scientific), StemFlex (ThermoFisher Scientific), StemFit Basic02 (Ajinomoto Co. Inc.), or PluriSTEM (Merck Millipore). Since the culture medium mTeSR(trademark)1 is manufactured under GMP conditions, it can preferably be used when iPS colonies are cultured under animal-free and foreign-free GMP conditions. Therefore, in one preferred example, mTeSR1 may be a second cell culture medium used to prepare a cell culture mixture. In the present invention, a 1:1 (v / v) cell culture medium mixture may be replaced with the same cell culture medium mixture within a suitable period of time. This suitable period may be about 3, 4, 5, or 6 days after transfection. Therefore, in one example, a 1:1 (v / v) cell culture medium mixture may be replaced with the same mixture 4 days after transfection. After a suitable period of time, the 1:1 (v / v) cell culture medium mixture may be further replaced with a second cell culture medium used solely to prepare a cell culture mixture. In this regard, a suitable period may be about 4, 5, 6, or 7 days after transfection. In one example, a 1:1 (v / v) cell culture medium mixture may be replaced with a second cell culture medium 6 days after transfection. In a preferred example, a 1:1 (v / v) cell culture medium mixture may be replaced with mTeSR1 and mTeSR®1, respectively, 6 days after transfection.Regular changes and replacements of cell culture media can contribute to an increase in the number of surviving CLiPS. Therefore, CLiPS colonies can grow and proliferate.

[0049] After changing the cell culture medium mixture to a single cell culture medium, CLiPS may be further cultured. For this purpose, the cell culture medium may be periodically replaced with the same medium to ensure a proper supply of nutrients and a suitable blend of growth factors to the cells. For example, the cell culture medium may be replaced daily, every two days, every three days, or every four days. In one example of the present invention, the cell culture medium may be replaced every two days. As a result, the CLiPS colonies can further grow and proliferate.

[0050] CLiPS colonies may become visible to the naked eye about 10, 11, 12, 13, 14, 15, or 16 days after transfection (see Example 2). Once a suitable size is reached, the CLiPS may be selected and transferred to another coated culture vessel for further culture and growth. In this regard, a suitable colony size may include a diameter of about 0.1 mm to a length of about 2 mm. In one example of the present invention, CLiPS colonies may be selected when they reach a diameter of about 0.5 mm to a length of about 1.5 mm, where the CLiPS colonies may reach this size about 20 days after transfection. CLiPS colonies may be picked to transfer CLiPS colonies of a suitable size to another culture vessel. This may be done manually if necessary. To facilitate colony picking, a device that allows for a magnified view of the colonies may be used. Examples of such devices may be a magnifying glass or a microscope. In the present invention, CLiPS may be selected and picked under a bright-field microscope. Turning to the cell culture vessels, the picked CLiPS colonies may be transferred to another cell culture vessel, where the coating of the cell culture vessel may be different from or the same as the coating of the cell culture vessel used to recover the transfected CLSCs. In a preferred example, the culture vessel coating is the same because CLiPS derived from CLMCs cultured under appropriate cGMP conditions are maintained free of animal matter and foreign substances, thereby adhering to cGMP conditions. As a result, for example, CLiPS colonies derived from CLMCs may be transferred to a cell culture vessel coated with a serum-free substance such as laminin-511 E8 fragment for further culture (see Example 3). Alternatively, CLiPS colonies derived from CLECs and / or CLMCs may be transferred to a cell culture vessel coated with a serum-derived substance such as Matrigel for further culture. Preferably, the cell culture medium is the same as that used before colony picking. In the examples of the present invention, the cell culture medium may be changed periodically after colony picking. For example, the medium may be changed daily, every two days, or every three days.In a preferred example of the present invention, the cell culture medium may be replaced daily after colony picking.

[0051] Once an appropriate concentration is reached, the CLiPS colonies or cell populations formed from colonies are typically detached from the coated cell culture vessel and transferred to a larger cell culture vessel for further culture under the same culture conditions used immediately after colony picking. Appropriate concentrations can be at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, and at least about 65%. In this regard, it should be noted that CLiPS cells do not take on a colony-like appearance when they reach a concentration of about 70%–80%, so the term “cell population” is more appropriate when used in relation to the proliferation of colony-forming CLiPS. Any dissociative agent suitable for disrupting cell adhesion or hydrolyzing peptide bonds can be used to detach the CLiPS colonies or cell populations formed from colonies from the coated cell culture vessel. Examples of suitable dissociation agents may be solutions containing a chelating agent such as ethylenediaminetetraacetic acid (EDTA), or solutions containing an enzyme such as trypsin or dispase (dispase is used to detach CLiPS colonies from coated cell culture vessels; see the experimental section of this application). The cell culture medium may be changed periodically, for example, daily, every two days, or every three days. In a preferred example of the present invention, the cell culture medium may be changed daily. In this way, CLiPS can grow and proliferate further.

[0052] In the present invention, CLiPS colonies or cell populations formed from colonies may be subcultured when they reach an appropriate size. Appropriate sizes may correspond to colonization densities of about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, and about 95%. In an example of the present invention, CLiPS colonies or cell populations formed therefrom may be subcultured when the culture reaches a colonization density of about 60-90%. Therefore, in a preferred example, CLiPS colonies or cell populations formed therefrom may be subcultured when they reach a colonization density of about 70-80%. In the case of subculture, CLiPS may be subcultured in an appropriate ratio, where one volume of CLiPS may be in contact with multiple volumes of cell culture medium. In the present invention, CLiPS may be subcultured in a ratio of approximately 1:3 (v / v), approximately 1:4 (v / v), approximately 1:5 (v / v), or approximately 1:6 (v / v), where subculture may be carried out by dividing one volume of dissociated CLiPS into approximately 2, approximately 3, approximately 4, or approximately 5 volumes of dissociated CLiPS. In a preferred example, CLiPS may be subcultured in a ratio of approximately 1:3 (v / v). To enable subculture of cultured CLiPS in the present invention, as before, any enzyme suitable for detaching cells from the culture vessel can be used. For example, dispase may be used for this purpose. Furthermore, any chemical substance suitable for removing cell-cell adhesion can be used in CLiPS subculture in connection with the present invention, where the concentration of the chemical substance may be appropriate for removing cell-cell adhesion without harming the cells. An example of such a chemical substance may be EDTA. Since EDTA can kill cells at higher concentrations, a suitable EDTA concentration for this invention may be approximately 0.5 mM. In this invention, the cell culture medium used for subculturing may be supplemented with a substance suitable for enhancing the survival of CLiPS upon dissociation. For this purpose, any substance suitable for enhancing the survival of CLiPS upon dissociation may be used. Examples of such suitable substances may be inhibitors of signaling pathways, such as the rho-related protein kinase (ROCK) signaling pathway.Therefore, the RHO / ROCK pathway inhibitor Y-27632 may be an example of a suitable substance for enhancing the survival of dissociated CLiPS. Alternatively, supplements defined for single-cell cloning of human iPS cells, such as CloneR® (available from StemCell Technologies), may be used to enhance the survival of dissociated cells. In this invention, passaged CLiPS may be cultured for an appropriate period in a medium supplemented with a substance suitable for enhancing the survival of dissociated CLiPS before differentiation into target cells.

[0053] A master cell bank containing (primary) isolated CLiPS can be obtained by culturing the passaged CLiPS. To create a master cell bank of CLiPs, CLiPS cells obtained by the process described herein can be seeded into culture vessels such as cell culture plates. For this purpose, the CLiPS can be suspended and cultured in any suitable medium, typically a maintenance medium for iPS cells such as mTeSR1, StemMACS® iPS-Brew XF, TeSRTM E8, mTeSRTMPlus, TeSRTM2 or mTeSRTM1, Corning® NutriStem® hPSC XF Medium, Essential 8 Medium (ThermoFisher Scientific), StemFlex (ThermoFisher Scientific), StemFit Basic02 (Ajinomoto Co. Inc.), or the above-mentioned commercially available media such as PluriSTEM (Merck Millipore). Both CLiPS derived from CLMC and CLiPS derived from CLEC can be cultured in such iPS maintenance media. In the case of subculturing, CLiPS cells (both CLiPS derived from CLMC and CLEC) can be cultured at any appropriate concentration, for example, or about 0.5 × 10⁶. 6 Cells per ml ~ approximately 5.0 × 10⁻⁶ 6 It can be seeded at a concentration of cells / ml. In one example, the number of cells is approximately 1.0 × 10⁶. 6The cells are suspended for subculturing at a concentration of 100 cells / ml. Subculturing can be carried out not only in simple culture flasks but also in multi-layer systems such as CellSTACK (Corning, NY, USA) or Cell Factory (Nunc, part of Thermo Fisher Scientific Inc., Waltham, MA, USA), which can be stacked in an incubator. Alternatively, subculturing can be carried out in closed, self-contained systems such as bioreactors. Different designs of bioreactors, such as parallel plate, hollow fiber, or microfluidic bioreactors, are known to those skilled in the art. See, for example, Sensebe et al. "Production of mesenchymal stromal / stem cells according to good manufacturing practices: a review," above. Examples of commercially available hollow fiber bioreactors include the Quantum® Cell Expansion System (Terumo BCT, Inc.), which has been used, for example, for the expansion of bone marrow mesenchymal stem cells for clinical trials (see Hanley et al, Efficient Manufacturing of Therapeutic Mesenchymal Stromal Cells Using the Quantum Cell Expansion System, Cytotherapy. 2014 August; 16(8): 1048-1058) and for the expansion of high-purity umbilical cord-lined mesenchymal stem cell populations as described in international patent application WO 2018 / 067071. Another example of a commercially available bioreactor that can be used for subculturing the CLiPS populations of the present invention is the Xuri Cell Expansion System, available from GE Healthcare. Culturing CLiPS populations in automated systems such as the Quantum® Cell Expansion System is particularly useful when there is a need to produce a practical cell bank for therapeutic use under GMP conditions and when a large number of cells are required.In the case of subculturing, CLiPS can be cultured until a suitable number of cells have grown. For example, CLiPS are subculturished until they reach a concentration of approximately 70% to 80%. Isolation / culturing of CLiPS populations can be performed under standard conditions for mammalian cell culture. Once the desired / suitable number of CLiPS have been obtained from subculturing, the cells are recovered by removing the CLiPS from the culture vessel used for subculturing. Recovery of CLiPS is typically carried out by enzymatic treatment. The isolated CLiPS are then collected and either used immediately or stored for further use. Typically, storage is carried out by cryopreservation. The term "cryopreservation" is used herein in its usual sense to describe the process by which CLiPS are stored by cooling to a sub-zero temperature, such as (typically) -80°C or -196°C (the boiling point of liquid nitrogen). Cryopreservation can be carried out as is known to those skilled in the art and may include the use of cryoprotective agents such as dimethyl sulfoxide (DMSO) or glycerol to slow the formation of ice crystals in CLiPS cells.

[0054] The present invention also applies to CLiPS that can be obtained by the methods described herein, and to CLiPS obtained by the methods described herein. CLiPS that can be obtained / obtained by the present invention can grow and proliferate robustly (see Examples 2 and 3). Thus, CLiPS culture may be more efficient compared to the culture of iPS derived from, for example, bone marrow stroma, adipose tissue, dermis, or Wharton's jelly. Analysis of CLiPS functionality reveals the expression of human embryonic stem cell markers exhibiting self-renewal properties and a normal karyotype (see Examples 4 and 5). Furthermore, CLiPS can differentiate into multiple cell types (functional target cells) that exhibit pluripotency in vitro and in vivo (see Example 6). Therefore, CLiPS are very suitable for medical and therapeutic applications. Consequently, the present invention also applies to pharmaceutical compositions containing iPS that can be obtained / obtained by the methods described herein.

[0055] The present invention further relates to a method for differentiating CLiPS into target cells under conditions suitable for differentiation. Suitable target cells include, but are not limited to, neurons, dopaminergic neurons, oligodentrocytes, astrocytes, cortical neurons, hepatocytes, chondrocytes, muscle cells, osteocytes, odontocytes, hair follicle cells, inner ear hair cells, skin cells, melanocytes, cardiomyocytes, hematopoietic progenitor cells, blood cells, immune cells, T lymphocytes or B lymphocytes, microglia, natural killer cells, or motor neurons. To promote targeted differentiation into target cells, CLiPS may be exposed to a priming substance under conditions known to those skilled in the art, typically from the differentiation of iPS from other sources into target cells. Exposure may be carried out under suitable conditions, which may include culturing in a cell culture vessel filled with a cell culture medium suitable for priming and subsequent culture of CLiPS differentiation. In the present invention, any cell culture medium suitable for priming, proliferation, and differentiation of iPS cells can be used, where the medium composition and therefore the differentiation method may depend on the target cells and may be adopted from known protocols for the differentiation of iPS cells into desired target cells (in this regard, see the reviews of Hirschi et al. "Induced Pluripotent Stem Cells for Regenerative Medicine" Annu Rev Biomed Eng. 2014 July 11; 16: 277-294) or Shi et al. "Induced pluripotent stem cell technology: a decade of progress" Nat Rev Drug Discov. 2017 February; 16(2): 115-130). For example, CLiPS cells may be cultured in a medium adapted for the proliferation and differentiation of CLiPS cells into dopaminergic neuronal cells.In such cases, the medium may be Neurobasal medium supplemented with growth factors that induce neuronal differentiation, such as B-27 minus vitamin A, transforming growth factor 3-β (TGFβ3), glial cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ascorbic acid, dibutyl cAMP, glycogen synthase kinase 3 inhibitors such as CHIR99021, and γ-secretase inhibitors such as (2S)-N-[(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine 1,1-dimethylethyl ester (DAPT). An example of such a medium is NB27. Differentiation of CLiPS into dopaminergic neurons is illustrated in Example 7. In another example, CLiPS may be cultured in a medium adapted for CLiPS proliferation and differentiation into hepatocytes. In this case, the medium may be a protein, lipid, and growth factor-free medium supplemented with compounds that induce differentiation into mesoendoderm fate. RPMI 1640-B27 supplemented with activin A may be an example of a suitable medium for CLiPS differentiation into hepatocytes. Differentiation of CLiPS into hepatocytes is illustrated in Example 8. As another example, CLiPS may be cultured in a medium adapted for CLiPS proliferation and differentiation into cardiomyocytes. In such cases, the medium may be a protein, lipid, and growth factor-free medium supplemented with a glycogen synthase kinase 3 inhibitor such as CHIR99021. RPMI / 2%-B27 minus insulin may be an example of a suitable medium for CLiPS differentiation into hepatocytes. Differentiation of CLiPS into cardiomyocytes is illustrated in Example 9. As a further example, CLiPS may be differentiated into oligodendrocytes using a chemically defined growth factor-rich medium that enables differentiation into paired box 6-positive (PAX6+) neural stem cells, thereby resulting in oligodendrocyte transcription factor-positive (OLIG2+) progenitor cells (see Example 10). In this regard, it should be noted that the differentiation of CLiPS into target cells can also be carried out under conditions suitable for cGMP production.

[0056] The present invention also includes pharmaceutical compositions comprising differentiated CLiPS obtained by methods described herein. Analysis of the immunogenicity of CLiPS and their neuronal derivatives revealed reduced immunogenicity (Example 11). Examples of pharmaceutical compositions comprising differentiated CLiPS are injectable solutions or grafts of any kind suitable for transplanting differentiated CLiPS. In one example, such a graft may comprise a multilayer tissue derived from differentiated CLiPS, such as an organ or a portion thereof. In another example, a graft suitable for transplanting differentiated CLiPS may comprise a transplantable matrix coated with differentiated CLiPS. Pharmaceutical compositions may be formulated / adapted for parenteral administration. In such cases, parenteral administration may comprise sterile preparations intended for injection, infusion, or transplantation in the body of a human or animal. Transplantation of CLiPS-derived dopaminergic neurons in fully immunocompetent mouse and rat Parkinson's disease models demonstrated functional engraftment and even significant recovery of dopamine reuptake function (see Examples 12 and 13).

[0057] The present invention further includes methods for treating congenital or acquired degenerative disorders in subjects that may be selected from a group including mice, rats, rabbits, pigs, dogs, cats, non-human primates, or humans. In a preferred example, the subject is human. In this regard, treatment may include administering target cells differentiated from CLiPS by the method described herein to the subject. The disease may be any known disease that has been considered treatable by cell-based therapies, see, for example, Shi et al. "Induced pluripotent stem cell technology: a decade of progress" above. Congenital or acquired degenerative disorders may have different origins. For example, such congenital or acquired degenerative disorders may be neurological disorders such as Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), and Batten's disease. Examples of hepatic degenerative disorders may, among others, be hepatic failure, cirrhosis, and viral hepatitis. Congenital or acquired degenerative disorders may include, among other things, cardiac disorders such as acute Danon disease, short QT syndrome, Brugada syndrome, myocardial infarction, and Jarbel and Lange-Nielsen syndromes. Disorders may also be autoimmune diseases such as multiple sclerosis.

[0058] The present invention also relates to extracellular membrane vesicles that can be produced by CLiPS or differentiated derivatives of CLiPS. Such vesicles may, but are not exclusive, include vesicles with diameters ranging from 30 to 150 nanometers (nm), also known as exosomes. Initially, exosomes were thought to be primarily responsible for excretory function, but they are now known to be involved in a variety of important biological processes, including intercellular communication, cellular senescence, proliferation and differentiation, tissue homeostasis, tissue repair and regeneration, antigen presentation, and immunomodulation (see, for example, Pegtel, DM and SJ Gould, Exosomes. Annu Rev Biochem, 2019. 88: p. 487-514 or Kalluri, R. and VS LeBleu, The biology, function, and biomedical applications of exosomes. Science, 2020. 367(6478). Exosomes are also involved in cancer (see, for example, Visan, KS, RJ Lobb, and A. Moller, The role of exosomes in the promotion of epithelial-to-mesenchymal transition and metastasis. Front Biosci (Landmark Ed), 2020. 25: p. 1022-1057 or Zhang, L. and See D. Yu, Exosomes in cancer development, metastasis, and immunity. Biochim Biophys Acta Rev Cancer, 2019. 1871(2): p. 455-468), osteoarthritis (Asghar, S., et al., Exosomes in intercellular communication and implications for osteoarthritis. Rheumatology (Oxford), 2020. 59(1): p.57-68), central nervous system diseases such as stroke, Alzheimer's disease (AD), Parkinson's disease (PD), prion diseases and amyotrophic lateral sclerosis (ALS) (see, for example, Liu, W., et al., Role of Exosomes in Central Nervous System Diseases. Front Mol Neurosci, 2019. 12: p. 240 or Quek, C. and AF Hill, The role of extracellular vesicles in neurodegenerative diseases. Biochem Biophys Res Commun, 2017. 483(4): p. 1178-1186), mental disorders (Saeedi, S., et al., The emerging role of exosomes in mental disorders. Transl Psychiatry, 2019. 9(1): p. 122), cardiovascular diseases (Wang, Y., et al., Exosomes: An emerging factor in atherosclerosis. It is believed to be associated with a wide range of diseases, including, for example, metabolic diseases (see Dini, L., et al., Microvesicles and exosomes in metabolic diseases and inflammation. Cytokine Growth Factor Rev, 2020. 51: pp. 27-39 or Soazig, LL, A. Ramaroson, and MM Carmen, Exosomes in metabolic syndrome, in Exosomes: A Clinical Compendium, LR Edelstein, et al., Editors. 2020, Academic Press. pp. 343-356), and many others.

[0059] Exosome cargo is known to consist of a variety of biomolecules, including proteins, lipids, and nucleic acids. RNA species such as tRNA, mRNA, lncRNA, circular RNA, and miRNA can potentially regulate gene expression in target cells and tissues. Exosomes produced by certain cell types have been shown to possess therapeutic properties. In this regard, mesenchymal stem cells (MSCs) isolated from different sources such as bone marrow, adipose tissue, and umbilical cord have emerged as particularly favorable. Among many examples, MSC-derived exosomes have shown potential therapeutic effects in animal models of cornea, cardiovascular disease, Alzheimer's disease, Parkinson's disease, and inflammatory bowel disease. In addition to endogenous cells, it has been shown that embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) and other in vitro cultured pluripotent stem cells (PSCs) produce exosomes (see YH, et al., Exosomes Derived from Embryonic Stem Cells as Potential Treatment for Cardiovascular Diseases. Adv Exp Med Biol, 2017. 998: p. 187-206. or Jeske, R., et al., Human Pluripotent Stem Cell-Derived Extracellular Vesicles: Characteristics and Applications. Tissue Eng Part B Rev, 2020. 26(2): p. 129-144). Due to the risk of tumor formation from residual undifferentiated cells, administration of cell-free iPS-derived exosomes is considered safer than administration of iPS-derived cells (see Riazifar, M., et al., Stem Cell Extracellular Vesicles: Extended Messages of Regeneration. Annu Rev Pharmacol). (Toxicol, 2017. 57: p. 125-154). Notably, therapeutic properties have also been demonstrated for exosomes isolated from differentiated derivatives of iPS cells.For example, treatment with exosomes purified from iPS-derived cardiomyocytes enhanced myocardial recovery in a mouse model of myocardial infarction, resulting in a significant reduction in apoptosis and fibrosis compared to untreated animals. These exosomes also rescued in vitro cultures of iPS-derived cardiomyocytes from hypoxia and exosome biosynthesis inhibition (Liu, B., et al., Cardiac recovery via extended cell-free delivery of extracellular vesicles secreted by cardiomyocytes derived from induced pluripotent stem cells. Nat Biomed Eng, 2018. 2(5): p. 293-303). In another study, exosomes from iPS-derived MSC-derived exosomes, isolated from iPS-derived MSCs, accelerated the proliferation of human dermal fibroblasts and human keratinocytes and enhanced wound healing in an in vitro scratch assay. Compared to those isolated from primary MSCs, there was no significant difference in the effectiveness of these exosomes (Kim, S., et al., Exosomes Secreted from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Accelerate Skin Cell Proliferation. Int J Mol Sci, 2018. 19(10).

[0060] Therefore, according to these reports, the extracellular membrane vesicles or exosomes produced by the CLiPS (either derived from CLMC or CLEC) or differentiated derivatives of CLiPS of the present invention are considered useful in treating diseases including the above-mentioned exemplary diseases such as cancer, central nervous system diseases such as osteoarthritis, stroke, Alzheimer's disease (AD), Parkinson's disease (PD), prion diseases and amyotrophic lateral sclerosis (ALS), mental disorders or metabolic diseases.

[0061] Furthermore, exosomes are being actively pursued as delivery carriers to facilitate the cellular uptake of various therapeutic agents, such as microRNAs, drugs, and peptides, by leveraging their efficient cargo delivery capabilities (see Antimisiaris, SG, S. Mourtas, and A. Marazioti, Exosomes and Exosome-Inspired Vesicles for Targeted Drug Delivery. Pharmaceutics, 2018. 10(4), Liao, W., et al., Exosomes: The next generation of endogenous nanomaterials for advanced drug delivery and therapy. Acta Biomater, 2019. 86: p. 1-14 or Wang, X., et al., Cell-derived Exosomes as Promising Carriers for Drug Delivery and Targeted Therapy. Curr Cancer Drug Targets, 2018. 18(4): p. 347-354). In line with this, the CLiPS of the present invention Extracellular membrane vesicles or exosomes produced by either CLMC or CLEC-derived CLiPS or CLiPS-derived derivatives are also considered to be usable as delivery carriers to promote the uptake of therapeutic agents into cells. Therefore, the present invention also encompasses the use of CLiPS or CLiPS-derived derivatives for the purpose of delivering exogenously loaded molecules or transgenically expressed molecules.

[0062] Extracellular membrane vesicles and exosomes produced by CLiPS (either derived from CLMC or CLEC) or differentiated derivatives of CLiPS can be isolated using the methods described in the literature. Typically, exosomes are purified from the extracellular environment in which they are secreted. Known methods for exosome isolation include ultracentrifugation, ultrafiltration, size exclusion chromatography, field flow fractionation, polymer coprecipitation, immunoaffinity, microfluidics, or acoustic nanofilters. All of these methods can be used to isolate exosomes produced by CLiPS or differentiated derivatives of CLiPS described herein.

[0063] The present invention is further illustrated by the following non-limiting experimental examples. [Examples]

[0064] Experimental Examples Example 1: Development of electroporation parameters suitable for CLiPS Okita et al. found that electroporation using the protocol described above was completely ineffective. Okita et al. also reported that when the CLMC reaction mixture was electroporated with the episomatic vectors pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL according to the protocol described above, no IPS colonies were detected. In the case of CLEC, Okita et al. also reported that when the episomatic vectors pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL (Addgene plasmid numbers 27077 (SEQ ID NO: 12), 27078 (SEQ ID NO: 13), and 27080) were electroporated according to the protocol described above, no IPS colonies were detected. An average reprogramming efficiency (expressed in units of iPS colony count) of only 0.2% was found after electroporation of CLMC using (SEQ ID NO: 14). Therefore, it was necessary to develop an electroporation protocol suitable for the CLiPS method derived from CLMC from scratch, or, in the case of CLEC, to provide a significantly improved electroporation protocol. To this end, electroporation conditions usable with CLSC were developed by varying the electrical parameters constituting the electroporation, such as the number of electrical pulses, duration, and voltage. In this experiment, numerous different electroporation settings were tested for each individual CLMC and CLEC sample cultured under cell-specific conditions as described herein. After each electroporation, approximately 200,000 cells were plated in triplets in 6-well plates for culture. Approximately 21 days after electroporation, the viability of the CLSC colonies that had developed up to that point was counted. The viability was used to draw conclusions about the electroporation efficiency. Percent efficiency was calculated as colony count / 200,000 × 100%.

[0065] The results shown in Table 1 and Figure 2 suggest that suitable electroporation conditions could be found for both CLMC and CLEC. The optimal electroporation setting for CLEC found herein is 1 × 10⁻⁶6 For each cell number, 1.67 μg (plasmid) DNA of each of the three vectors (pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL) was used, with two electrical pulses of 30 ms and 1350 V, respectively. Four individual CLEC strains (CLEC42, CLEC44, CLEC23, and CLEC30) transfected with these settings showed viability rates of 4.67%, 7.33%, 9.33%, and 7.50%, respectively. Compared to Okita et al., the electroporation settings used for CLEC increased electroporation efficiency by approximately 23.35% for CLEC42 and 36.65% for CLEC44. Thus, it was surprisingly found that these electroporation parameters / settings increased electroporation efficiency for CLEC by an average of approximately 30% compared to the conditions used by Okita et al. for the electroporation of human dermal fibroblasts. Of note, the electroporation settings used herein are the same conditions reported for successful electroporation of epithelial cells such as corneal epithelial cells (30 ms and 1300 V, 1 electrical pulse) and cell number (1 × 10⁶). 6 The ratio of plasmid DNA amount (μg) to individual cells (1:1) is quite different (see Png, E. et al. (2011), Journal of Cellular Physiology. United States, 226(3), pp. 693-699).

[0066] As mentioned above, since CLMC survival was not achieved at all with the electroporation method described by Okita et al., the effect of optimizing the electroporation protocol is even more important for CLMC. Four individual CLMC strains (CLMC42, CLMC44, CLMC23, and CLMC30) survived with one electrical pulse of 20 ms and 1600 V, and approximately 1 × 10⁻⁶ 6This specification demonstrates successful transfection with 1.67 μg (plasmid) DNA per CLMC, using a ratio of plasmid DNA amount for each episomal vector (pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL) relative to the number of cells. The resulting transgenic cells exhibited viability rates of 6.17%, 7.50%, 5.00%, and 7.33%, respectively. Notably, the electroporation / transfection conditions found herein to be optimal for CLiPS generation from CLMC differ from previously reported electroporation conditions. In this regard, see, for example, Sprangers, AJ, Freeman, B., and Ogle, BM (2011), pp. 62-66, which investigated the possible negative effects of electroporation of mesenchymal stem cells derived from human embryonic stem cells (hESCs). By doing so, Sprangers et al. used one electrical pulse of 20 ms and 1400 V to obtain 1 × 10⁻¹⁶ 6 Transfecting individual mesenchymal stem cells with a total of 4 μg of (plasmid) DNA was found to be optimal for MSC transfection. Therefore, the present invention provides unique and efficient protocols for CLEC and CLMC electroporation, respectively. The variability in transfection efficiency across the four individual CLSC strains (cells from different donors) is individual variability, which is an inherent and proven characteristic of iPS induction. To confirm the sex of the donor CLSC strains and the CLiPS derived therefrom, PCR amplification was performed on genomic DNA isolated from each CLSC strain using gene-specific primers to confirm the presence or absence of the DYS439 and SRY loci, both located on the Y chromosome. Adult dermal fibroblasts of aSF4, which have been confirmed to be obtained from male donors, were used as a positive control.

[0067] (Table 1) Optimized electroporation conditions for CLiPS preparation TIFF2026086827000002.tif114153

[0068] Example 2: Transgene integration and induction of feeder-free human iPS cells Umbilical cord-lining epithelial cells (CLECs) and umbilical cord-lining mesenchymal cells (CLMCs) were isolated and supplied by CellResearch Corporation Pte Ltd, Singapore. CLECs and CLMCs were thawed and grown in their respective culture media, PTT-e3 and PTT-4. Adult dermal fibroblasts from a healthy 78-year-old Asian male donor were purchased from CellResearch Corporation Pte Ltd and cultured in DMEM / 10% FBS.

[0069] Medium PTT-4 consists of 90% (v / v) CMRL-1066 and 10% (v / v) FBS, and medium PTTe-3 has the following composition: TIFF2026086827000003.tif66140

[0070] Somatic cell reprogramming was performed using the conditions established in Example 1, and furthermore, in a feeder-independent manner. Logarithmic-phase cultures were recovered by dissociation using TrypLE Express (ThermoFisher Scientific), and 720,000 cells were pelleted in a 1.5 ml centrifuge tube. The cell pellet was resuspended in 120 μL of Buffer R (Neon® Transfection System 100 μL Kit, Thermo Fisher Scientific MPK10096). Cocktails containing 1.2 μg each of the episomatic vectors pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL (Addgene plasmid numbers 27077 (SEQ ID NO: 12), 27078 (SEQ ID NO: 13), and 27080 (SEQ ID NO: 14), respectively) were added to the cells and thoroughly mixed (1 × 10⁶ of each vector). 6(A plasmid DNA dose of 1.67 μg was used per cell.) The cell suspension was loaded onto 100 μL of Neon® Tip, and Neon electroporation was performed with the following parameters: Adult dermal fibroblasts - 1,650 V, 10 ms, 3 pulses; CLEC - 1,350 V, 30 ms, 2 pulses; CLMC - 1,600 V, 20 ms, 1 pulse. The cells were immediately transferred to 6 ml of CLEC or CLMC medium containing 1 μM hydrocortisone (StemCell Technologies) and evenly distributed into 3 wells of a Matrigel-coated 6-well plate. After 2 days, the medium was switched to a 1:1 mixture of CLEC or CLMC medium and mTeSR1 supplemented with 1 μM hydrocortisone. On day 4 post-transfection, the medium was changed with the same medium. On day 6 post-transfection, the medium was switched to pure mTeSR1, and hydrocortisone was not added thereafter. Subsequently, the culture medium was changed every two days using mTeSR1. When the iPS colonies reached a diameter of approximately 1-2 mM (around day 20), they were manually picked under a bright-field microscope and each colony was placed in a single well of a 24-well plate (Nunc) coated with Matrigel. When the cells in each well reached approximately 50% concentration, they were detached with dispase (StemCell Technologies) and transferred to wells of a 6-well plate coated with Matrigel. Then, when the cells had almost reached their concentration, they were passaged in a 1:3 ratio by dissociation with 0.5 mM EDTA. The newly passaged cells were cultured overnight in a medium containing 10 μM ROCK inhibitor Y-27632. In addition to mTeSR1, iPS culture was maintained using other commercially available ES / iPS media such as StemMACS® iPS-Brew XF (Miltenyi Biotec) and TeSR-E8 (StemCell Technologies).

[0071] Protocol for creating CLiPS: 1. Actively dividing CLECs or CLMCs cultured in T-75 flasks using their respective maintenance media PTTe-3 and PTT-4 are recovered by dissociation using TrypLE Express (ThermoFisher Scientific). 2. Count the cells and dispense 720,000 cells into microcentrifuge tubes to form a pellet. 3. Resuspend the cell pellet in 120 μL of Buffer R (Neon™ Transfection System 100 μL Kit, Thermo Fisher Scientific MPK10096). Add a cocktail containing 1.2 μg each of pCXLE-hUL, pCXLE-hSK, and pCXLE-hOCT3 / 4-shp53-F and mix thoroughly. 4. Load the cell suspension onto a 100 μL Neon® Tip. Perform electroporation with the following parameters for CLEC: 1350 V, 30 ms, 2 pulses, and for CLMC: 1600 V, 20 ms, 1 pulse. 5. Immediately transfer the cells to 4 ml of CLEC or CLMC medium containing 1 μM hydrocortisone (PTTe-3 and PTT-4, respectively), and then distribute them into 3 wells of a Matrigel-coated 6-well plate. 6. Two days after electroporation, replace the culture medium with a 1:1 (v / v) mixture of CLEC or CLMC medium (PTT-e3 and PTT-4, respectively) and mTeSR1 supplemented with 1 μM hydrocortisone. 7. Four days after electroporation, perform a medium change with the same 1:1 (v / v) medium mixture. 8. Six days after electroporation, replace the culture medium with mTeSR1 only. Do not include hydrocortisone thereafter. 9. Change the culture medium every two days. 10. iPS colonies may begin to appear as early as two weeks after transfection. When the iPS colonies reach a diameter of approximately 0.5 mm to 1 mm (around day 20), they are manually picked under a bright-field microscope and each colony is placed in a single well of a 24-well plate (Nunc) coated with Matrigel. 11. After colony picking, change the culture medium of the isolated colonies daily. 12. Once the cells in each well occupy approximately 50% of the culture surface, detach them with dispase (StemCell Technologies) and transfer them to the wells of a 6-well plate coated with Matrigel. 13. Subsequently, when the cells reach a concentration density of approximately 70% to 80%, the cells are subcultured in a 1:3 ratio by dissociation using 0.5 mM EDTA. The newly subcultured cells are cultured overnight in a medium containing 10 μM ROCK inhibitor Y-27632.

[0072] Following the protocol described above, small clusters of cells that appeared morphologically distinct from the parent cells began to appear around day 10. By day 15, the cell clusters had acquired distinct edges (Figure 3b), and individual embryonic stem cell-like colonies appeared from day 20 onward (Figures 3c and 3d). The colonies were picked when they reached a diameter of 1–2 mm and expanded for characterization and preservation. The expanded CLiPS exhibited cellular morphology indistinguishable from that of adult dermal fibroblast-derived iPS cells or human embryonic stem cells (ES), possessing characteristic large nuclei and thin cytoplasm (Figures 3e and 3f).

[0073] Example 3: Derivation of cGMP-compliant CLiPS (CLMSC-DTHN) To provide proof of concept that CLiPS can be produced under conditions suitable for human therapeutic use, iPS cells were generated from a cGMP-grade CLMC strain called CLMSC-DTHN using the protocol described in WO2018 / 067071 for the production of a mesenchymal stem population in which 99% of the stem cells express markers CD73, CD90, and CD105, but not markers CD34, CD45, and HLA-DR, using cGMP-quality reagents whenever possible. The reprogramming protocol was the same as the one described for CLMC in Example 2, but Matrigel, an extracellular matrix substrate prepared from Angelbreth-Holm-Swarm (EHS)) mouse sarcoma cells, was replaced with recombinant human laminin-511 E8 fragment (iMatrix-511 SILK, ReproCELL), a defined animal-free and xenologous-free substrate for coating cell culture vessels. Furthermore, the mTeSR1 used for reprogramming and subsequent maintenance of the CLiPS clones was replaced with cGMP mTeSR(trademark)1 (StemCell Technologies).

[0074] Under the conditions described herein, CLMSC-DTHN was reprogrammed with kinetics and efficiency equivalent to CLMC (data not shown). Ten days after transfection with the reprogramming vector, small clusters of cells with a compact morphology could be observed (Figure 3n). These clusters grew into isolateable colonies from day 20 onward. The expanded colonies exhibited characteristic cell morphologies of human pluripotent stem cells (Figures 3n-q).

[0075] CLiPS proliferation and cryopreservation Subculturing of CLiPS cells (using a medium suitable for maintaining iPS cells, such as mTeSR1 or TeSR-E8, as before) is performed when the culture reaches approximately 90% concentration. Used medium is aspirated and removed along with any clearly differentiated areas that may be present. Care is taken to avoid prolonged exposure of the cells to air. The culture is rinsed once with preheated (37°C) Dulbecco's phosphate-buffered saline (DPBS). An appropriate amount of reheated (37°C) 0.5 mM EDTA solution is added to the culture according to the culture vessel size - 0.5 ml / well for a 24-well dish, 1 ml / well for a 6-well dish, or 2 ml for a 6 cm dish. The culture is incubated in a 37°C incubator for 5 minutes, after which it is observed under a microscope. The cells should appear round but should not be detached from the surface. The incubation period at 37°C varies depending on the CLiPS strain and can range from approximately 5 to 10 minutes. The incubation period depends primarily on past experience with each strain. After incubation, gently aspirate and remove the EDTA solution, taking care not to remove the cells. Remove the cells by dispensing a medium, such as mTeSR1 or TeSR-E8 containing the ROCK inhibitor Y-27632, directly into the cells using a 1 ml pipette. The amount of medium used depends on the size of the container used: 0.5 ml / well for a 24-well dish, 1 ml / well for a 6-well dish, or 2 ml for a 6 cm dish. Repeat gentle pipetting until most of the cells are removed. Transfer the cell suspension to a 15 ml Falcon tube. Rinse the culture vessel with fresh medium and combine the rinse with the cell suspension in the Falcon tube. Dilute the cells in the tube to a suitable volume for plating into a new Matrigel-coated container. The splitting ratio can range from 1:3 to 1:10, depending on the initial culture density and the growth rate of the individual CLiPS strain.

[0076] For cryopreservation, suspend the cells in mTeSR1 or TeSR-E8 (or any other suitable medium) supplemented with 10% v / v tissue culture-grade dimethyl sulfoxide (DMSO; e.g., Hybri-Max®, Sigma-Aldrich). Dispense this cell suspension into an appropriate number of cryovials. The cell density per aliquot depends on the desired rate at which cell concentration is achieved when the aliquots are thawed and cultured. Transfer the cryovials to a slow-freezing apparatus such as Mr. Frosty® Freezing Container (Thermo Scientific) or CoolCell® Cell Freezing Containers (BioCision LLC) and leave them at -80°C overnight. The following day, transfer the cryovials to liquid nitrogen storage. Leaving CLiPS aliquots at -80°C for more than 24 hours is not recommended. Several commercially available freezing media, such as mFreSR® (StemCell Technologies) and CryoStor® CS10 (Biolife Solutions), are also available for cryopreservation and can be used according to the manufacturer's instructions.

[0077] Example 4: Analysis of CLiPS functionality The functionality of CLiPS was determined by immunofluorescence staining of CLiPS colonies formed after electroporation. This allowed for the analysis of pluripotent embryonic stem cell markers (OCT4, SOX2, KLF4, NANOG, SSEA-4, TRA-1-81). For this purpose, cells were fixed in 4% formaldehyde in phosphate-buffered saline (PBS) for 15 minutes, followed by three washes in PBS for 5 minutes each. For staining of intracellular or nuclear markers (OCT4, SOX2, KLF4, NANOG), cells were permeabilized in 0.1% Triton X-100 in PBS for 10 minutes and blocked in FDB (5% FCS / 1% NGS / 1% BSA) for 1 hour. For staining of surface markers (SSEA-4, TRA-1-81), the permeabilization step was omitted. Cells were incubated overnight at 4°C with a primary antibody appropriately diluted in FDB, followed by incubation at room temperature for 2 hours with a secondary antibody conjugated with an appropriate fluorescent dye. The stained samples were mounted on a DAPI-containing ProLong Diamond Antifade Mountant (ThermoFisher Scientific).

[0078] Furthermore, the number and structure of chromosomes within each CLiPS strain were evaluated by karyotype analysis and G banding analysis, with the G banding analysis performed by Cytogenetics Laboratory, KK Women's and Children's Hospital Pte. Ltd., Singapore.

[0079] Furthermore, RT-PCR analysis was performed to analyze reprogramming and pluripotency gene expression in primary parental cells, parental cells 11 days after vector transfection (D11 transfected cells), and CLiPS cells. For this purpose, total RNA was isolated from the cell pellet using the RNeasy Mini or Plus Mini kit (Qiagen). 2 μg of total RNA was treated with DNase I and used for cDNA synthesis using the RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas, Thermo Fisher Scientific). The PCR reaction was set up as follows: 0.5 μl cDNA, 5 μl 2×MyTaq HS Mix (Bioline), 0.2 μl forward primer (10 μM), 0.2 μl reverse primer (10 μM), and 4.2 μl PCR water. Thermal cycling was performed using the MJ Mini Thermal Cycler (Bio-Rad) under the following conditions: 1 × 95°C for 1 minute, 30 × (95°C for 15 seconds, Tm for 15 seconds, 72°C for 15 seconds), and 72°C for 1 minute. The primer sequences and annealing temperatures (Tm) used are shown in Table 2 below.

[0080] Qualitative expression analysis was performed by agarose gel analysis. Samples were loaded onto 2% agarose gels containing SYBR Safe DNA stain (Thermo Fisher Scientific) in 1×TAE buffer, and electrophoresis was performed at 80 V for 30 minutes. Gel images were captured using the ChemiDoc Imaging System (Bio-Rad).

[0081] (Table 2) Primer sequences TIFF2026086827000004.tif226138TIFF2026086827000005.tif55138

[0082] The results clearly showed that CLiPS exhibited robust expression of human embryonic stem cell (hES) markers KLF4, NANOG, OCT4, SOX2, SSEA4, and TRA-1-60, as demonstrated by antibody staining (Figures 3g-l). G banding analysis showed that CLiPS maintained a normal karyotype from colony picking up to passage 17 (Figure 3m). RT-PCR analysis of gene expression in parental cells, cells at 11 days post-transfection, and expanded iPS clones revealed that activation of endogenous OCT4, SOX2, KLF4, LIN28, and L-MYC genes replaced the role of vector-driven expression of these genes for maintaining pluripotency in fully reprimed CLiPS (Figure 3v). Induction of the endogenous NANOG locus, a gene crucial for somatic cell repriming, was observed at 11 days post-transfection. The absence of detectable levels of EBNA-1 transcript in CLiPS clones suggests that the plasmid vector has been lost from these cells. Further expression of hES-specific genes GDF3, DPPA5, DNMT3, FGF4, and REX-1 in CLiPS further confirms their hES-like molecular phenotype. TERT, which encodes a catalytic reverse transcriptase subunit of telomerase essential for regulating self-renewal and maintaining pluripotency, is expressed in CLiPS at the same levels as in H1 hES.

[0083] Example 5: Expression analysis of pluripotent embryonic stem cell markers in CLiPS-DTHN To analyze the expression of pluripotent embryonic stem cell markers (Oct4, Sox2, Klf4, Nanog), developing CLMSC-DTHN cells were subjected to immunofluorescence staining after electroporation. The immunofluorescence staining protocol was the same as that described for CLiPS in Example 4.

[0084] The results clearly show that CLMSC-DTHN expresses the pluripotent stem cell markers NANOG, OCT4, SOX2, and TRA-1-81 at levels indistinguishable from its corresponding non-GMP cells (Figure 3r-u). Thus, CLMSC-DTHN may offer the same embryonic characteristics as non-GMP-derived CLiPS cells.

[0085] Example 6: Determination of CLiPS pluripotency The pluripotency of CLiPS and aSF-iPS was evaluated using a teratoma formation assay in NOD-SCID mice. For this purpose, 1 × 10⁶ mice were used. 6 Individual CLiPS cells were pelleted and resuspended in 0.1 ml of ice-cold Matrigel. 6-8 week old NOD / MrkBomTac-Prkdc scid The teratomas were injected into the dorsal flanks of the mice. After 3 months, the mice were euthanized, and the teratomas were collected for histological analysis. Paraffin wax sections were then prepared and hematoxylin-eosin staining was performed using standard techniques.

[0086] The results clearly showed that palpable tumors developed in some mice one month after subcutaneous injection of iPS cells into the flank and dorsal region of the mice. Histological analysis of teratomas isolated three months after injection revealed that CLiPS cells spontaneously differentiate into endodermal, mesodermal, and ectodermous tissues (Figures 4a-f).

[0087] Example 7: Differentiation of CLiPS into dopaminergic neurons A crucial prerequisite for the potential future therapeutic applications of CLiPS is the need to demonstrate its ability to differentiate into specific tissue types under defined in vitro conditions. For the differentiation of dopaminergic neurons, the midbrain floor plate induction protocol described in Kriks, S., et al, Nature, 2011. 480(7378): p. 547-51 was used to differentiate iPS cells into dopaminergic neuronal precursors and neurons. Briefly, iPS cells were placed in a 1 cm dish coated with Matrigel (Corning). 2 3.5-4.0 per unit x 10 4Cells were plated at a density of 100 cells and cultured for 5 days in Knock-Out Serum Alternative Medium (KSR) containing Knock-Out DMEM, 15% knock-out serum substitute, 1× GlutaMAX, and 10 mM β-mercaptoethanol. From day 5, KSR medium was gradually transitioned to N2 medium as described in Tomishima, "Midbrain dopamine neurons from hESCs." 2012 Jun 10. In: StemBook. Cambridge (MA): Harvard Stem Cell Institute; 2008-. Available from https: / / www.ncbi.nlm.nih.gov / books / NBK133274 / doi: 10.3824 / stembook.1.70.1. On day 11, the culture medium was changed to NB27 medium, consisting of Neurobasal medium, 2% B27 minus vitamin A, and 1× GlutaMAX, and CHIR (until day 13), BDNF (brain-derived neurotrophic factor, 20 ng / ml; Miltenyi), ascorbic acid (0.2 mM, Sigma), GDNF (glial cell line-derived neurotrophic factor, 20 ng / ml; Miltenyi), TGFβ3 (transforming growth factor β3, 1 ng / ml; R&D), dibutyryl cAMP (0.5 mM; Santa Cruz Biotechnology), and DAPT (10 nM; Tocris) were supplemented for 9 days. On day 20, the cells were dissociated using acutase (Gibco) and placed on a high-cell-density (1 cm) dish pre-coated with poly-L-ornithine (PLO; 15 mg / ml) / laminin (1 μg / ml) / fibronectin (2 μg / ml) in NB27 medium supplemented with 10 μM ROCK inhibitor Y-27632. 2 3-4 x 10 5Replating was performed with individual cells. The cultures were maintained in NB27 medium with medium changes every other day until the desired endpoint was reached. Differentiated cells were analyzed for the expression of cell-specific markers at this stage. For this purpose, frozen sections were prepared by dehydrating slides containing sections by incubation at 37°C for 30 minutes, cooling to room temperature, and washing three times with TBST. Section permeabilization, blocking, antibody staining, and mounting were performed as described in Example 4. Using primary antibodies from the same host species, the first primary antibody was saturated with a fluorochrome conjugated monovalent antibody (Jackson ImmunoResearch) before sequential incubation with a second primary antibody and a conjugated secondary antibody.

[0088] The results clearly demonstrate that dopaminergic neurons were obtained from CLiPS and asF5-iPS using this protocol. Antibody staining revealed that nearly 90% of the cells co-expressed the bottom plate marker FOXA2 and the top plate marker LMX1A (Figure 4k, k', k''), which are definitive features of midbrain DA neuron precursors. Further differentiation yielded abundant mature neurons, as shown by TUJ1 staining, of which approximately 30-50% co-expressed the dopaminergic marker tyrosine hydroxylase (TH) (Figure 4l, l', l''). Electrophysiological analysis of CLiPS-derived neurons at day 45 of differentiation showed that the cells exhibited mature functional characteristics, and injection of hyperpolarizing current demonstrated that the action potential train showed a voltage sag response characteristic of mature midbrain DA neurons (Figure 4m).

[0089] Example 8: Differentiation of CLiPS into hepatocytes A crucial prerequisite for the potential future therapeutic applications of CLiPS is the need to demonstrate its ability to differentiate into desired target cell types or specific tissue types under defined in vitro conditions. For liver differentiation, a protocol originally developed for the differentiation of human embryonic cells (ES) on a mouse feeder layer (Medine, CN, et al., J Vis Exp, 2011(56): p. e2969) was adapted for CLiPS and asF-iPS differentiation on mTeSR1 on Matrigel. The modification involved supplementing the iPS cultures with 2% DMSO and incubating for 24 hours when the culture density reached 20–30%. Final endodermal formation was induced by replacing the mTeSR1 with priming medium (RPMI 1640-B27 supplemented with 100 ng / mL activin A and 50 ng / mL Wnt3a) when the culture density reached approximately 30–60%. The cultures were maintained in priming medium for 3 days, with the medium changed every 24 hours. After 72 hours in priming medium, the medium was switched to SR-DMSO (80% KO-DMEM, 20% KO-SR, 0.5% L-glutamine, 1% non-essential amino acids, 0.1 mM β-mercaptoethanol, and 1% DMSO) for 5 days, with the medium changed every 48 hours. On day 8, the cultures were switched to L-15 maturation maintenance medium supplemented with 10 ng / mL hHGF and 20 ng / mL OSM (Leibovitz L-15 medium, 8.3% tryptose phosphate broth, 8.3% thermoinactivated FBS, 10 μM hydrocortisone 21-hemisuccinate, 1 μM insulin (bovine pancreas), 1% L-glutamine, 0.2% ascorbic acid) for 9 days (with the medium changed every 48 hours). The differentiated cells were again analyzed for the expression of cell-specific markers at this stage. For this purpose, frozen sections were prepared as described in Example 7.

[0090] The results clearly demonstrate that hepatocyte-like cells were obtained from CLiPS and asF5-iPS using this protocol. Antibody staining revealed the expression of hepatocyte markers α-fetoprotein (AFP; Figure 4g, g', g''), cytokeratin 18 (CK18), and human serum albumin (HSA; Figure 4h, h', h'') 17 days after differentiation. The majority of the differentiated cells exhibited the polygonal shape characteristic of hepatocytes. Furthermore, staining with Oil Red O showed the accumulation of abundant intracellular lipid droplets, a characteristic of cultured hepatocytes (Figure 4i, i', i'').

[0091] Example 9: Differentiation of CLiPS into cardiomyocytes A crucial prerequisite for the potential future therapeutic applications of CLiPS is the need to demonstrate its ability to differentiate into specific tissue types under defined in vitro conditions. For cardiomyocyte differentiation, the protocol for iPS-to-cardiomyomyocyte differentiation was adapted from the protocol described in Lian, X., et al., Proc Natl Acad Sci USA, 2012. 109(27), p. E1848-57. iPS cells maintained on Matrigel in mTeSR1 were dissociated into single cells at 37°C for 5 minutes using StemPro accutase (Thermo Fisher Scientific), and then 1 × 10⁶ cells in mTeSR1 supplemented with 5 μM ROCK inhibitor (Y-27632; Stemgent) were placed on a cell culture dish coated with Matrigel. 5 ~2×10 5 cells / cm 2 (5 x 10 per 24 wells) 5Cells were seeded (individual cells) for 24 hours. As a modification, when the cells reached approximately 80% concentration, the medium was switched to mTeSR1 supplemented with 2% DMSO. When the cells reached concentration, they were treated with CHIR99021 in RPMI / B27-insulin for 24 hours. As another modification, at this stage the concentration of CHIR99021 was reduced from the initial 12 μM to 5 μM. The following day, the medium was changed to insulin-free RPMI / 2%B27. Two days later, half of the old medium was combined with an equal volume of fresh medium containing 10 μM IWP2 (Tocris). The remaining medium in the well was discarded, and the mixture was added to the culture. Two days later, the medium was switched to insulin-free RPMI / 2%B27. After 48 hours, the culture was maintained in RPMI / 2%B27 medium, changing the medium every 3 days until the desired endpoint was reached. As described in Example 7, beating cardiomyocytes were fixed and stained for cell-specific markers.

[0092] The results clearly demonstrate that cardiomyocytes were obtained from CLiPS and asF5-iPS using this protocol. Antibody staining revealed that spontaneously contracting cardiomyocytes were observed from day 8 of differentiation. Immunofluorescence antibody staining for the functional cardiomyocyte markers myosin-regulated light chain 2a (MLC2a), cardiac troponin I (cTnI), and α-actinin (αACT) revealed the sarcomere structure within differentiated cardiomyocytes (Figure 4j, j', j''). No significant differences in differentiation efficiency were observed among them.

[0093] Example 10: Differentiation of CLiPS into oligodendrocytes To further demonstrate the ability of the induced pluripotent stem cells of the present invention to differentiate into a given target cell type, CLiPS were differentiated into oligodendrocytes. Oligodendrocyte differentiation of CLiPS and asF-iPS was carried out according to the protocol of Douvaras, P. and V. Fossati, Nat Protoc, 2015. 10(8): p. 1143-54. Furthermore, to analyze the expression of cell-specific markers, frozen sections were prepared as described in Example 7.

[0094] On day 75 of differentiation, clusters of Olig2-positive oligodendrocyte progenitor cells (OPCs; Figure 4n) or O4-positive late-stage OPCs were obtained (Figure 4o).

[0095] Example 11: Immunogenicity analysis To gain insights into the immunogenicity of CLiPS and its neuronal derivatives, the expression of a panel of immunogenicity-related markers by these cells was evaluated by flow cytometry. For this purpose, primary cells and differentiated DA NPCs at day 25 were recovered by dissociation with TrypLE Express, while iPS cultures were recovered by dissociation with 0.5 mM EDTA. Cells were then mixed with 1×Ca containing 0.1% bovine serum albumin (BSA). 2+ Free from and Mg 2+ Cells were resuspended in DPBS to a concentration of 5 million cells / ml. 100 μl of cells were stained with the appropriate conjugate antibody or its isotype control on ice in the dark for 30 minutes. For HLA-E and HLA-G staining, cells were permeabilized with BD Phosflow Perm / Wash Buffer I (BD Biosciences) before staining according to the manufacturer's instructions. After staining, cells were treated with 1×Ca 2+ Free from and Mg 2+ Washed twice in DPBS / 5 mM EDTA, fixed in 1% paraformaldehyde in the dark for 1 hour, then 1×Ca 2+ Free from and Mg 2+ The cells were washed twice in DPBS / 5 mM EDTA. The cells were then sterilized with 0.5 ml of 1×Ca solution. 2+ Free from and Mg 2+ The cells were resuspended in DPBS / 5 mM EDTA and analyzed by flow cytometry. Stained primary cells and iPS cells were analyzed using FACSCalibur, while stained dopaminergic neural progenitor cells (NPCs) were analyzed using FACSCanto II (both from BD Biosciences). Data were analyzed using the FlowJo software package (FlowJo LLC). The antibodies used are listed in Table 3.

[0096] (Table 3) Antibodies used in flow cytometry TIFF2026086827000006.tif117130

[0097] MHC class I HLA-A, HLA-B, and HLA-C molecules, as well as MHC class II HLA-DR molecules, are known to be important in alloimmune responses. The results clearly show that HLA-ABC are expressed in all iPS samples, but significantly reduced levels are observed in EC23-CLiPS (Figure 6a). HLA-DR expression was absent in all iPS samples (Figure 6b), consistent with previous reports that HLA-II expression in iPS cells is negligible (Saljo, K., et al., Sci Rep, 2017. 7(1): p. 13072 and Chen, HF, et al., Cell Transplant, 2015. 24(5): p. 845-64). T cell costimulatory molecules CD40, CD80, and CD86 play important roles in T cell activation during alloimmune responses. Of the three molecules examined, only CD40 was expressed on iPS cells, and it was expressed at the lowest level in asF-iPS and the highest level in MC23-CLiPS compared to the others (Figure 6a). Since it has been reported that tolerogenic HLA-E and HLA-G are expressed in CLMC (Deuse, T., et al., Cell Transplant, 2011. 20(5): p. 655-67) and CLEC (Zhou, Y., et al., Cell Transplant, 2011. 20(11-12): p. 1827-41), the expression of these antigens in CLiPS cells was also investigated. Analysis of permeabilized cells revealed that HLA-E expression was very low in MC23-CLiPS and EC44-CLiPS, and below detectable levels in the other samples. Next, expression profiling of the entire panel of markers in DA differentiation culture at day 25 was repeated. Analysis was performed on neuronal cell populations gated with NCAM-positive staining. The NCAM+ fraction exceeded 97% in all samples, and asF-iPS and EC23-CLiPS showed comparable differentiation efficiencies of 99.5% (Figure 6b). HLA-ABC was expressed in all NPC samples, but at generally lower levels compared to their parental iPS cells (Figure 6c).NPCs derived from EC23-CLiPS expressed the lowest levels of HLA-ABC in the samples, reflecting the trends shown in their parent iPS cells. HLA-ABC expression levels in MC23-CLiPS were reduced upon differentiation into NPCs. CD40 expression was downregulated across all NPC samples, with only EC23-iPS and EC44-iPS-derived NPCs showing slight expression. HLA-E expression was absent in all NPC samples, although slight upregulation of HLA-G was observed in asF-iPS-derived and EC23-iPS-derived NPCs. These results indicate reduced immunogenicity of CLiPS.

[0098] Example 12: Transplantation of CLiPS-derived dopaminergic neurons into a fully immune-qualified mouse model of Parkinson's disease Previous studies have shown that dopaminergic neurons generated from human embryonic stem cells and iPS cells using various protocols have been shown to be effective in treating Parkinson's disease (PD) in rodents (Kriks, S., et al, Nature, 2011. 480(7378): p. 547-51; Hargus, G., et al., Proc Natl Acad Sci USA, 2010. 107(36): p. 15921-6; Doi, D., et al., Stem Cell Reports, 2014. 2(3): p. 337-50; Grealish, S., et al., Cell Stem Cell, 2014. 15(5): p. 653-65; Kirkeby, A., et al., Cell Rep, 2012. 1(6): p. 703-14; Qiu, L., et al., Stem Cells Transl Med, 2017. 6(9): p. 1803-1814; Rhee, YH, et al., J Clin Invest, 2011. 121(6): p. 2326-35; Samata, B., et al., Nat Commun, 2016. 7: p. 13097; Wakeman, DR, et al., Stem Cell Reports, 2017. 9(1): p. 149-161) and non-human primates (Kriks, S., et al, Nature, 2011. 480(7378): p. 547-51; Hargus, G., et al., Proc Natl Acad Sci USA, 2010. 107(36): p. 15921-6; Wakeman, DR, et. (Al., Stem Cell Reports, 2017. 9(1): p. 149-161; Daadi, MM, et al., PLoS One, 2012. 7(7): p. e41120; Kikuchi, T., et al., Nature, 2017. 548(7669): p. 592-596) It has been shown that the model can engraft.In all of these studies, the animals were either immunocompromised or pharmacologically immunosuppressed to prevent graft rejection. The need for immunodeficient or immunosuppressed animals is that transplantation can be autologous (Morizane, A., et al., Stem Cell Reports, 2013. 1(4): p. 283-92; 4. Hallett, PJ, et al., Cell Stem Cell, 2015. 16(3): p. 269-74; Wang, S., et al., Cell Discov, 2015. 1: p. 15012; Emborg, ME, et al Cell Rep, 2013. 3(3): p. 646-50; Sundberg, M., et al., Stem Cells, 2013. 31(8): p. 1548-62) or MHC-matched allogeneic (Morizane, A., et al., 2017. 8(1): p. 385) It was only deemed unnecessary when the procedure was performed using iPS-derived cells.

[0099] To demonstrate the engraftment of CLiPS-derived DA NPCs differentiated using the method of the present invention, NPCs differentiated from asF-iPS, EC23-CLiPS, and MC23-CLiPS at 25 days post-transplantation were transplanted into immunodeficient NOD-SCID mice (n=3). In this regard, it should be noted that all animal experiments were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Neuroscience (NNI) in Singapore.

[0100] To test the immunogenicity of CLiPS-derived DA NPCs, transplantation in a PD model is necessary. For this purpose, a 6-hydroxydopamine (6-OHDA) unilateral lesion mouse model was created. Unilateral 6-OHDA lesions are an established method in rodents, and involve injecting 6-OHDA into the rodent brain to induce motor dysfunction characterized by rotational asymmetry due to angles (Bagga, V., Dunnett, SB and Fricker, RA (2015) Behavioural Brain Research. Elsevier BV, 288, pp. 107-117). In this invention, NOD / MrkBomTac-Prkdc, purchased from InVivos Pte Ltd and maintained under SPF conditions at the Animal Research Facility, NNI, was used. scid 6-OHDA lesions were induced in mice (4 weeks old) and male C57BL / 6NTac mice (6-8 weeks old) purchased from InVivos Pte Ltd. The mice used in this experiment were fully immunocompetent, and no immunosuppression was administered before or after transplantation.

[0101] To create a mouse PD model, 7.5 μg of 6-OHDA (Sigma, Merck-Millipore; dissolved at 2.5 mg / ml in 0.9% NaCl containing 0.2% ascorbic acid) was delivered to the left striatum by stereotactic injection at the following coordinates: anterior-posterior (AP) +0.5 mm; medial-lateral (ML) -1.8 mm from the bregma; dorsal-ventral (DV) -3.0 mm from the skull. After two weeks of acclimatization, three NPC samples (i.e., NPCs derived from asF-iPS, EC23-CLiPS, and MC23-CLiPS) were transplanted by stereotactic injection into the striatum of immunocompetent 6-OHDA-infected C57BL / 6 mice, and the procedure was performed on mouse models that were considered to have successfully induced the lesion.

[0102] To determine a suitable model for transplantation, apomorphine-induced rotation was scored, and mice that rotated more than 6 times per minute were used for transplantation. For transplantation, dopaminergic progenitor cells were collected by dissociation on day 25 and fertilized in HBSS supplemented with 10 ng / mL BDNF and 10 ng / mL GDNF, resulting in approximately 1.25 × 10⁶ cells. 5 The cells were resuspended at 100 cells / μl. 2 μL of the cell suspension was injected into lesional mice at the following coordinates: AP +0.5 mm from the skull; ML -2.0 mm; and DV -2.8 mm. To assess whether the transplanted NPCs could integrate and mediate the functional benefits in the lesioned animals, rotational asymmetry tests were performed at 2-week intervals. 0.05 mg / kg of apomorphine dissolved in 0.9% NaCl containing 0.1% w / v ascorbic acid was intraperitoneally injected into mice, and rotational assays were performed every 2 weeks up to 9 months. Rotation was recorded using a digital camera and manually counted. Animal batches were euthanized under terminal anesthesia at 1 month, 6 months, and 9 months post-transplant.

[0103] Six months after transplantation, striatal dopamine transporter (DAT) activity was evaluated in NPC-transplanted mice, sham-injected mice, and unmanipulated mice using positron emission tomography (PET) with the radioligand (2-[18F]fluoroethyl 8-[(2E)-3-iodoprop-2-en-1-yl]-3-(4-methylphenyl)-8-azabicyclo[3.2.1]octane-2-carboxylate) ([18F]FE-PE2I). Animals were fasted for 3 hours prior to the scanning session. Animals were kept warm during the scan by integrating a warm air channel from the scanning bed. Respiratory rate and temperature were monitored throughout the scan session to ensure an adequate level of anesthesia. Mice were imaged using a nanoScan PET / MRI scanner (Mediso Ltd., Hungary) at the SingHealth Experimental Medicine Centre (SEMC). This scanner features 12 detector modules with axial field of view (FOV) of 94 mm and transaxial FOV of 94 mm or 120 mm in diameter, with 1:3 and 1:5 simultaneity modes, respectively. After intravenous injection of 3.57–10.61 MBq of [18F]FE-PE2I at a maximum volume of 0.1 ml via the tail vein, animals were placed in a lateral recumbent position with their heads up, and 3D dynamic PET scans were performed for 62 minutes with increasing duration frames (i.e., 4 frames at 10 seconds, 4 frames at 20 seconds, 3 frames at 1 minute, 7 frames at 3 minutes, and 6 frames at 6 minutes). [18F]PE-PE2I was synthesized by Singapore Radiopharmaceuticals Pte Ltd. MRI images were used for attenuation correction of the PET scan and as a structural reference of the PET images in data analysis. Thus, T1-weighted MRI images were acquired using the MRI component of the nanoscan PET / MRI scanner. An integrated mouse head coil covers the entire brain during the MRI scan. 3D GRE EXT sequence: A 0.6 mm slice was obtained using a 64 mm square FOV, a 128 × 128 matrix, a 20 ms repetition time (TR), a 2.3 ms echo time (TE), and a 25-degree flip angle.Image and dynamic analysis of [18F]FE-PE2I PET images were all performed using PMOD (version 3.5; PMOD Technologies). All PET images were initially automatically registered to MRI images using the PMOD FUSION tool. The MRI images were then manually registered to a T2-weighted mouse template containing a volume of interest (VOI) template with 20 regions (M. Mirrione, C57BL / 6J mice; Ma, Y., et al., Neuroscience, 2005. 135(4): p. 1203-15; Mirrione, MM, et al., Neuroimage, 2007. 38(1): p. 34-42). The accuracy of manual registration was accessed and validated by two different individuals. Finally, a combined transformation matrix was applied to convert the PET images to the MRI mouse template. The VOIs of the left and right striatum and cerebellum were used for analysis. To reduce errors due to misregistration and misdefinition (He, B. and EC Frey, Phys Med Biol, 2010. 55(12): p. 3535-44), a single-voxel 3D erosion was applied to the obtained VOIs. [18F]FE-PE2I binding was quantified using a non-invasive reference tissue model, as it yielded comparable accuracy to kinetic analysis using an arterial input function (Varrone, A., et al., Nucl Med Biol, 2012. 39(2): p. 295-303). Bind potential (BPnd) values ​​were calculated using a simplified reference tissue model (SRTM) with the cerebellum as the reference (Lammertsma, AA and SP Hume, 1996. 4(3 Pt 1): p. 153-8). Local time-activity curves (TACs) were also extracted from the striatum and cerebellum VOIs. Anesthesia was induced with 5% isoflurane in 100% O2, and maintained with 1.5-2% isoflurane during imaging.

[0104] Mouse brain sections were analyzed for the presence of microglia / macrophages because these cells are known to play a crucial role in allograft and xenograft rejection in the CNS (Hoornaert, CJ, et al., Stem Cells Transl Med, 2017. 6(5): p. 1434-1441). For this purpose, brains were perfused transcardially with 4% PFA and then immunostained for the microglia / macrophage-specific marker Iba1. For this purpose, PFA-perfused brains were fixed overnight in 4% PFA and then equilibrated in 15% and 30% w / v sucrose solutions in PBS until they settled to the bottom of the tube. The brains were embedded in OCT freezing medium, and 18 μm sections were cut using a CM3050 S cryostat (Leica Biosystems) and collected on BOND Plus Slides (Leica Microsystems).

[0105] The results revealed that hNCAM+ / TH+ neurons were present in all three groups one month after transplantation (Figures 7a-c), suggesting that NPCs differentiate into mature neurons and can survive in the host environment. However, no signs of engraftment were observed in the asF-iPS (Figure 7h) or MC23-iPS (data not shown) groups. hNCAM / TH+ fibers may be observed extending from neurons within the transplanted core of the EC23-CLiPS group along the axonal pathways of the corpus callosum (Figures 7d and 7e). Immunostaining for the microglia / macrophage-specific marker Iba1 revealed a richer presence of microglia / macrophages in the injected hemisphere compared to the non-injected hemisphere (Figures 7i and 7j). Microglia / macrophages infiltrating the graft core exhibited an amoeboid morphology characteristic of activated microglia, compared to those around the graft that showed a branched morphology typical of quiescent cells. Furthermore, the infiltrating microglia were stained positively for CD68, a marker of activated microglia. At one month post-transplantation, no microglial accumulation was observed at the injection sites of asF5-iPS and MC23-CLiPS NPC transplanted brains. This is presumed to be because the microglia dispersed and returned to a quiescent state after xenograft clearance. Human TH+ neurons survived up to 9 months in some animals transplanted with EC23-CLiPS NPCs, as confirmed by human nuclear antigen (HuNu) and human NCAM staining (Figure 8a-f). Rotational asymmetry testing revealed that exposure to the dopamine agonist apomorphine resulted in the injured animals exhibiting rotation in the opposite direction due to hypersensitivity of postsynaptic D2 dopamine receptors on the striatum damaged as a result of dopamine depletion. The effectiveness of the interventions performed would manifest as improvement of this rotational asymmetry. Only animals transplanted with EC23-CLiPS NPCs showed improvement in rotational behavior compared to animals transplanted with asF-iPS NPCs or pseudo-transplants (Figure 8h). In these mice, the reduction in rotation became significant (p<0.05) from week 20 post-transplant, decreasing to 18.2 ± 24.7% and 11.1 ± 20.8% at week 20 and week 22, respectively.This model illustrates the latency period for recovery, with post-transplant deterioration being observed first. This is likely due to the inflammatory response caused by stereotactic injection and the time required for the NPC to mature, integrate with host tissue, and innervate. Functional improvement in motor symptoms of Parkinson's disease in EC23-CLiPS NPC-transplanted animals suggests functional recovery of dopaminergic function in the transplanted striatum. To further investigate this, we performed PET imaging using the dopamine transporter (DAT) ligand [18F]FE-PE2I in transplanted mice (Bang, JI, et al., Nucl Med Biol, 2016. 43(2): p. 158-64; Sasaki, T., et al., J Nucl Med, 2012. 53(7): p. 1065-73). DAT is a presynaptic transmembrane protein primarily responsible for the reuptake of dopamine released at synapses, and molecular imaging of DAT is an established tool for studying dopaminergic function. PET imaging six months post-transplant showed that DAT activity in the transplanted damaged hemisphere recovered to approximately 71.4 ± 10.3% (n=3) of the activity in the undamaged hemisphere of EC23-iPS NPC-transplanted mice (Figure 8i). In contrast, recovery was only 16.4 ± 4.0% in asF-iPS-NPC-transplanted mice. These results clearly demonstrate a significant recovery of dopamine reuptake function in EC23-iPS NPC-transplanted mice.

[0106] Example 13: Transplantation of CLiPS-derived dopaminergic neurons into a fully immunocompetent rodent rat model of Parkinson's disease. Our transplantation results indicate that EC23-CLiPS-derived NPC is tolerated when transplanted into the striatum of C56BL / 6 mice. To rule out the possibility of species-specific bias in this phenomenon, the transplantation test was replicated in another species, the Wistar rat. Parkinson's disease was induced in these rats by injecting 6-OHDA into the MFB to damage the nigrostriatal pathway. In this regard, it should be noted that all animal experiments were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Neuroscience (NNI) in Singapore. Additional approval for the rat experiments was provided by the IACUC at the National University of Technology (NTU) in Singapore. MFB lesions are known to cause more complete depletion of the dopaminergic system compared to striatal lesions, and are therefore presumed to be less likely to lead to spontaneous recovery (Torres, EM and SB Dunnett, Animal Models of Movement Disorders: Volume I, EL Lane and SB Dunnett, Editors. 2012, Humana Press: Totowa, NJ. p. 267-279). The rats were fully immunocompetent and no immunosuppression was administered before or after transplantation. For analysis, approximately 8-week-old female Wistar rats were purchased from InVivos Pte Ltd. Unilateral lesions were induced by stereotactic injection of 20 μg of 6-OHDA in 4 μl into the left medial forebrain bundle (MFB) at the following coordinates: AP -4.4 mm from the dura mater; ML -1.2 mm; and DV -8.6 mm. To determine a suitable model for transplantation, apomorphine-induced rotation was scored as described in Example 12. In rats exhibiting more than 6 revolutions / min, approximately 1.25 × 10⁶ of 3 μl of sphincter fluid was administered to the left striatum at the following coordinates relative to bregma. 5Dopaminergic progenitor cells were transplanted at a rate of 25 cells / μl: AP +0.8 mm from the dura mater; ML -2.5 mm; and DV -5 mm. To assess whether the transplanted NPCs could integrate and mediate the functional benefits in the diseased animals, rotational asymmetry tests were performed at 1-month intervals as described in Example 12. Rats were euthanized at 6 months under terminal anesthesia, and their brains were harvested for immunohistochemical analysis after transcardiac perfusion with 4% PFA as described in Example 12. Several animals that did not meet the criteria for lesion formation were similarly transplanted and euthanized at 1 and 3 months post-transplant to assess cell viability and engraftment.

[0107] The results clearly show that unilateral depletion of dopaminergic neurons in the substantia nigra as a result of retrograde transport of 6-OHDA via MFB was confirmed in the model by DAB staining of TH in midbrain sections (Figure 11d). Animals exhibiting at least 5 rotations / min upon apomorphine exposure were transplanted with asF-iPS-derived, EC23-CLiPS-derived, and MC23-CLiPS-derived NPCs. Histological analysis 3 months after transplantation showed the presence of hCyto+ / HuNu+ and hNCAM+ / TH+ cells only in the EC23-CLiPS group. In addition, TH+ neurons in the graft expressed synapsin 1, suggesting integration with host neurons (Figure 11b). Furthermore, only animals transplanted with EC23-CLiPS NPCs showed improvement in rotational behavior of both species, in contrast to asF-iPS NPCs or pseudo-transplant animals (Figure 11e). The rat model also showed a latent period of recovery, with post-transplant deterioration being observed first. This is likely due to the inflammatory response caused by stereotactic injection and the time required for NPCs to mature, integrate with host tissue, and innervate. The results also demonstrate a significant recovery of dopamine reuptake function in CLiPS-derived NPC-transplanted rats.

[0108] It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.

[0109] All patents and publications referenced herein represent the level of skill of those skilled in the art in which the present invention relates. All patents and publications are incorporated herein by reference to the same extent that each individual publication is shown to be incorporated by reference specifically and individually.

[0110] The inventions described exemplary herein can be adequately carried out in the absence of any one or more elements or limitations not specifically disclosed herein. Therefore, terms such as “comprising,” “including,” and “containing” should be interpreted comprehensively and non-restrictively. Furthermore, the terms and expressions used herein are descriptive rather than restrictive, and the use of such terms and expressions is not intended to exclude any equivalent of the exhibited and described features or any part thereof, and it should be recognized that various modifications are possible within the claimed scope of the invention. Thus, while the invention has been specifically disclosed by preferred embodiments and optional features, it should be understood that modifications and alterations of the inventions embodied herein are left to those skilled in the art, and that such modifications and alterations are considered to be within the scope of the invention. The invention is described broadly and generically herein. Each of the narrower species and subgenera groups that fall within the scope of the generic disclosure also forms part of the invention. This includes generic descriptions of the invention using conditional or negative limitations that exclude any subject matter from the group, regardless of whether the excluded subject matter is specifically mentioned herein. In addition, where a feature or aspect of the invention is described in terms of a Markush group, those skilled in the art will recognize that the invention is also described in terms of any individual member or subgroup of any member of that Markush group. Further aspects of the invention will become apparent from the following claims.

[0111] Sequence information SEQUENCE LISTING <110> CELLRESEARCH CORPORATION PTE LTD SINGAPORE HEALTH SERVICES PTE LTD <120> A METHOD OF GENERATING AN INDUCED PLURIPOTENT STEM CELL, AN INDUCED PLURIPOTENT STEM CELL AND METHODS OF USING THE INDUCED PLURIPOTENT STEM CELL <150> US 63 / 054,206 <151> 2020-07-20 <160> 50 <170> PatentIn version 3.5 <210> 1 <211> 741 <212> DNA <213> Homo sapiens <400> 1 ttctttttcc tacagctcct gggcaacgtg ctggttattg tgctgtctca tcattttggc 60 aaagaattcg cccttcacca tggcgggaca cctggcttcg gatttcgcct tctcgccccc 120 tccaggtggt ggaggtgatg ggccaggggg gccggagccg ggctgggttg atcctcggac 180 ctggctaagc ttccaaggcc ctcctggagg gccaggaatc gggccggggg ttgggccagg 240 ctctgaggtg tgggggattc ccccatgccc cccgccgtat gagttctgtg gggggatggc 300 gtactgtggg ccccaggttg gagtggggct agtgccccaa ggcggcttgg agacctctca 360 gcctgaggggc gaagcaggag tcggggtgga gagcaactcc gatggggcct ccccggagcc 420 ctgcaccgtc acccctggtg ccgtgaagct ggagaaggag aagctggagc aaaacccgga 480 ggagtcccag gacatcaaag ctctgcagaa agaactcgag caatttgcca agctcctgaa 540 gcagaagagg atcaccctgg gatatacaca ggccgatgtg gggctcaccc tgggggttct 600 atttgggaag gtattcagcc aaacgaccat ctgccgcttt gaggctctgc agcttagctt 660 caagaacatg tgtaagctgc ggcccttgct gcagaagtgg gtggaggaag ctgacaacaa 720 tgaaaatctt caggagatat g 741 <210> 2 <211> 352 <212> PRT <213> Homo sapiens <400> 2 Met Ala Gly His Leu Ala Ser Asp Phe Ala Phe Ser Pro Pro Pro Gly 1 5 10 15 Gly Gly Asp Gly Ser Ala Gly Leu Glu Pro Gly Trp Val Asp Pro Arg 20 25 30 Thr Trp Leu Ser Phe Gln Gly Pro Pro Gly Gly Pro Gly Ile Gly Pro 35 40 45 Gly Ser Glu Val Leu Gly Ile Ser Pro Cys Pro Pro Ala Tyr Glu Phe 50 55 60 Cys Gly Gly Met Ala Tyr Cys Gly Pro Gln Val Gly Leu Gly Leu Val 65 70 75 80 Pro Gln Val Gly Val Glu Thr Leu Gln Pro Glu Gly Gln Ala Gly Ala 85 90 95 Arg Val Glu Ser Asn Ser Glu Gly Thr Ser Ser Glu Pro Cys Ala Asp 100 105 110 Arg Pro Asn Ala Val Lys Leu Glu Lys Val Glu Pro Thr Pro Glu Glu 115 120 125 Ser Gln Asp Met Lys Ala Leu Gln Lys Glu Leu Glu Gln Phe Ala Lys 130 135 140 Leu Leu Lys Gln Lys Arg Ile Thr Leu Gly Tyr Thr Gln Ala Asp Val 145 150 155 160 Gly Leu Thr Leu Gly Val Leu Phe Gly Lys Val Phe Ser Gln Thr Thr 165 170 175 Ile Cys Arg Phe Glu Ala Leu Gln Leu Ser Leu Lys Asn Met Cys Lys 180 185 190 Leu Arg Pro Leu Leu Glu Lys Trp Val Glu Glu Ala Asp Asn Asn Glu 195 200 205 Asn Leu Gln Glu Ile Cys Lys Ser Glu Thr Leu Val Gln Ala Arg Lys 210 215 220 Arg Lys Arg Thr Ser Ile Glu Asn Arg Val Arg Trp Ser Leu Glu Thr 225 230 235 240 Met Phe Leu Lys Cys Pro Lys Pro Ser Leu Gln Gln Ile Thr His Ile 245 250 255 Ala Asn Gln Leu Gly Leu Glu Lys Asp Val Val Arg Val Trp Phe Cys 260 265 270 Asn Arg Arg Gln Lys Gly Lys Arg Ser Ser Ile Glu Tyr Ser Gln Arg 275 280 285 Glu Glu Tyr Glu Ala Thr Gly Thr Pro Phe Pro Gly Gly Ala Val Ser 290 295 300 Phe Pro Leu Pro Pro Gly Pro His Phe Gly Thr Pro Gly Tyr Gly Ser 305 310 315 320 Pro His Phe Thr Thr Leu Tyr Ser Val Pro Phe Pro Glu Gly Glu Ala 325 330 335 Phe Pro Ser Val Pro Val Thr Ala Leu Gly Ser Pro Met His Ser Asn 340 345 350 <210> 3 <211> 949 <212> DNA <213> Homo sapiens <400> 3 ccgggcgggg cggggccgcc tcgggccggg gagggctcgg gggaggggcg cggcggcccc 60 cggagcgccg gcggctgtcg aggcgcggcg agccgcagcc attgcctttt atggtaatcg 120 tgcgagaggg cgcagggact tcctttgtcc caaatctgtg cggagccgaa atctgggagg 180 cgccgccgca ccccctctag cgggcgcggg gcgaagcggt gcggcgccgg caggaaggaa 240 atgggcgggg agggccttcg tgcgtcgccg cgccgccgtc cccttctccc tctccagcct 300 cggggctgtc cgcgggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc 360 ttctggcgtg tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt 420 ttcctacagc tcctgggcaa cgtgctggtt attgtgctgt ctcatcattt tggcaaagaa 480 ttcgcccttc accatgtaca acatgatgga gacggagctg aagccgccgg gcccgcagca 540 aacttcgggg ggcggcggcg gcaactccac cgcggcggcg gccggcggca accagaaaaa 600 cagcccggac cgcgtcaagc ggcccatgaa tgccttcatg gtgtggtccc gcgggcagcg 660 gcgcaagatg gcccaggaga accccaagat gcacaactcg gagatcagca agcgcctggg 720 cgccgagtgg aaacttttgt cggagacgga gaagcggccg ttcatcgacg aggctaagcg 780 gctgcgagcg ctgcacatga aggagcaccc ggattataaa taccggcccc ggcggaaaac 840 caagacgctc atgaagaagg ataagtacac gctgcccggc gggctgctgg cccccggcgg 900 caatagcatg gcgagcgggg tcggggtggg cgccggcctg ggcgcgggc 949 <210> 4 <211> 317 <212> PRT <213> Homo sapiens <400> 4 Met Tyr Asn Met Met Glu Thr Glu Leu Lys Pro Pro Gly Pro Gln Gln 1 5 10 15 Thr Ser Gly Gly Gly Gly Gly Asn Ser Thr Ala Ala Ala Ala Gly Gly 20 25 30 Asn Gln Lys Asn Ser Pro Asp Arg Val Lys Arg Pro Met Asn Ala Phe 35 40 45 Met Val Trp Ser Arg Gly Gln Arg Arg Lys Met Ala Gln Glu Asn Pro 50 55 60 Lys Met His Asn Ser Glu Ile Ser Lys Arg Leu Gly Ala Glu Trp Lys 65 70 75 80 Leu Leu Ser Glu Thr Glu Lys Arg Pro Phe Ile Asp Glu Ala Lys Arg 85 90 95 Leu Arg Ala Leu His Met Lys Glu His Pro Asp Tyr Lys Tyr Arg Pro 100 105 110 Arg Arg Lys Thr Lys Thr Leu Met Lys Lys Asp Lys Tyr Thr Leu Pro 115 120 125 Gly Gly Leu Leu Ala Pro Gly Gly Asn Ser Met Ala Ser Gly Val Gly 130 135 140 Val Gly Ala Gly Leu Gly Ala Gly Val Asn Gln Arg Met Asp Ser Tyr 145 150 155 160 Ala His Met Asn Gly Trp Ser Asn Gly Ser Tyr Ser Met Met Gln Asp 165 170 175 Gln Leu Gly Tyr Pro Gln His Pro Gly Leu Asn Ala His Gly Ala Ala 180 185 190 Gln Met Gln Pro Met His Arg Tyr Asp Val Ser Ala Leu Gln Tyr Asn 195 200 205 Ser Met Thr Ser Ser Gln Thr Tyr Met Asn Gly Ser Pro Thr Tyr Ser 210 215 220 Met Ser Tyr Ser Gln Gln Gly Thr Pro Gly Met Ala Leu Gly Ser Met 225 230 235 240 Gly Ser Val Val Lys Ser Glu Ala Ser Ser Ser Pro Val Pro Val Val Thr 245 250 255 Ser Ser Ser His Ser Arg Ala Pro Cys Gln Ala Gly Asp Leu Arg Asp 260 265 270 Put Ile Ser Put Tyr Leu Pro Gly Ala Glu Val Pro Glu Pro Ala Ala 275 280 285 Pro Ser Arg Leu His Met Ser Gln His Tyr Gln Ser Gly Pro Val Pro 290 295 300 Gly Thr Ala Ile Asn Gly Thr Leu Pro Leu Ser His Met 305 310 315 <210> 5 <211> 1007 <212> DNA <213> Homo sapiens <400> 5 ccccggcgga aaaccaagac gctcatgaag aaggataagt acacgctgcc cggcgggctg 60 ctggcccccg gcggcaatag catggcgagc ggggtcgggg tgggcgcgg cctgggcgcg 120 ggcgtgaacc agcgcatgga cagttacgcg cacatgaacg gctggagcaa cggcagctac 180 agcatgatgc aggaccagct gggctacccg cagcacccgg gcctcaatgc gcacggcgca 240 gcgcagatgc agcccatgca ccgctacgac gtgagcgccc tgcagtacaa ctccatgacc 300 agctcgcaga cctacatgaa cggctcgccc acctacagca tgtcctactc gcagcagggc 360 acccctggca tggctcttgg ctccatgggt tcggtggtca agtccgaggc cagctccagc 420 ccccctgtgg ttacctcttc ctcccactcc agggcgccct gccaggccgg ggacctccgg 480 gacatgatca gcatgtatct ccccggcgcc gaggtgccgg aacccgccgc ccccagcaga 540 cttcacatgt cccagcacta ccagagcggc ccggtgcccg gcacggccat taacggcaca 600 ctgcccctct cacacatggg ggatctcaaa attgtcgctc ctgtcaaaca aactcttaac 660 tttgatttac tcaaactggc tggggatgta gaaagcaatc caggtccact catgaacaat 720 tcgcccttca ccatggctgt cagtgacgcg ctgctcccat ctttctccac gttcgcgtct 780 ggcccggcgg gaagggagaa gacactgcgt caagcaggtg ccccgaataa ccgctggcgg 840 gaggagctct cccacatgaa gcgacttccc ccagtgcttc ccggccgccc ctatgacctg 900 gcggcggcga ccgtggccac agacctggag agcggcggag ccggtgcggc ttgcggcggt 960 agcaacctgg cgcccctacc tcggagagag accgaggagt tcaacga 1007 <210> 6 <211> 513 <212> PRT <213> Homo sapiens <400> 6 Met Arg Gln Pro Pro Gly Glu Ser Asp Met Ala Val Ser Asp Ala Leu 1 5 10 15 Leu Pro Ser Phe Ser Thr Phe Ala Ser Gly Pro Ala Gly Arg Glu Lys 20 25 30 Thr Leu Arg Gln Ala Gly Ala Pro Asn Asn Arg Trp Arg Glu Glu Leu 35 40 45 Ser His Met Lys Arg Leu Pro Pro Val Leu Pro Gly Arg Pro Tyr Asp 50 55 60 Leu Ala Ala Ala Thr Val Ala Thr Asp Leu Glu Ser Gly Gly Ala Gly 65 70 75 80 Ala Ala Cys Gly Gly Ser Asn Leu Ala Pro Leu Pro Arg Arg Glu Thr 85 90 95 Glu Glu Phe Asn Asp Leu Leu Asp Leu Asp Phe Ile Leu Ser Asn Ser 100 105 110 Leu Thr His Pro Pro Glu Ser Val Ala Ala Thr Val Ser Ser Ser Ala 115 120 125 Ser Ala Ser Ser Ser Ser Ser Pro Ser Ser Ser Gly Pro Ala Ser Ala 130 135 140 Pro Ser Thr Cys Ser Phe Thr Tyr Pro Ile Arg Ala Gly Asn Asp Pro 145 150 155 160 Gly Val Ala Pro Gly Gly Thr Gly Gly Gly Leu Leu Tyr Gly Arg Glu 165 170 175 Ser Ala Pro Pro Pro Thr Ala Pro Phe Asn Leu Ala Asp Ile Asn Asp 180 185 190 Val Ser Pro Ser Gly Gly Phe Val Ala Glu Leu Leu Arg Pro Glu Leu 195 200 205 Asp Pro Val Tyr Ile Pro Pro Gln Gln Pro Gln Pro Pro Gly Gly Gly 210 215 220 Leu Met Gly Lys Phe Val Leu Lys Ala Ser Leu Ser Ala Pro Gly Ser 225 230 235 240 Glu Tyr Gly Ser Pro Ser Val Ile Ser Val Ser Lys Gly Ser Pro Asp 245 250 255 Gly Ser His Pro Val Val Val Ala Pro Tyr Asn Gly Gly Pro Pro Arg 260 265 270 Thr Cys Pro Lys Ile Lys Gln Glu Ala Val Ser Ser Cys Thr His Leu 275 280 285 Gly Ala Gly Pro Pro Leu Ser Asn Gly His Arg Pro Ala Ala His Asp 290 295 300 Phe Pro Leu Gly Arg Gln Leu Pro Ser Arg Thr Thr Pro Thr Leu Gly 305 310 315 320 Leu Glu Glu Val Leu Ser Ser Arg Asp Cys His Pro Ala Leu Pro Leu 325 330 335 Pro Pro Gly Phe His Pro His Pro Gly Pro Asn Tyr Pro Ser Phe Leu 340 345 350 Pro Asp Gln Met Gln Pro Gln Val Pro Pro Leu His Tyr Gln Gly Gln 355 360 365 Ser Arg Gly Phe Val Ala Arg Ala Gly Glu Pro Cys Val Cys Trp Pro 370 375 380 His Phe Gly Thr His Gly Met Met Leu Thr Pro Pro Ser Ser Pro Leu 385 390 395 400 Glu Leu Met Pro Pro Gly Ser Cys Met Pro Glu Glu Pro Lys Pro Lys 405 410 415 Arg Gly Arg Arg Ser Trp Pro Arg Lys Arg Thr Ala Thr His Thr Cys 420 425 430 Asp Tyr Ala Gly Cys Gly Lys Thr Tyr Thr Lys Ser Ser His Leu Lys 435 440 445 Ala His Leu Arg Thr His Thr Gly Glu Lys Pro Tyr His Cys Asp Trp 450 455 460 Asp Gly Cys Gly Trp Lys Phe Ala Arg Ser Asp Glu Leu Thr Arg His 465 470 475 480 Tyr Arg Lys His Thr Gly His Arg Pro Phe Gln Cys Gln Lys Cys Asp 485 490 495 Arg Ala Phe Ser Arg Ser Asp His Leu Ala Leu His Met Lys Arg His 500 505 510 Phe <210> 7 <211> 679 <212> DNA <213> Homo sapiens <400> 7 cttcaccatg gactacgact cgtaccagca ctatttctac gactatgact gcggggagga 60 tttctaccgc tccacggcgc ccagcgagga catctggaag aaattcgagc tggtgccatc 120 gccccccacg tcgccgccct ggggcttggg tcccggcgca ggggacccgg cccccgggat 180 tggtcccccg gagccgtggc ccggagggtg caccggagac gaagcggaat cccggggcca 240 ctcgaaaggc tggggcagga actacgcctc catcatacgc cgtgactgca tgtggagcgg 300 cttctcggcc cgggaacggc tggagagagc tgtgagcgac cggctcgctc ctggcgcgcc 360 ccgggggaac ccgcccaagg cgtccgccgc cccggactgc actcccagcc tcgaagccgg 420 caacccggcg cccgccgcc cctgtccgct gggcgaaccc aagacccagg cctgctccgg 480 gtccgagagc ccaagcgact cggagaatga agaaattgat gttgtgacag tagagaagag 540 gcagtctctg ggtattcgga agccggtcac catcacggtg cgagcagacc ccctggatcc 600 ctgcatgaag catttccaca tctccatcca tcagcaacag cacaactatg ctgcccgttt 660 tcctccagaa agctgctcc 679 <210> 8 <211> 364 <212> PRT <213> Homo sapiens <400> 8 Met Asp Tyr Asp Ser Tyr Gln His Tyr Phe Tyr Asp Tyr Asp Cys Gly 1 5 10 15 Glu Asp Phe Tyr Arg Ser Thr Ala Pro Ser Glu Asp Ile Trp Lys Lys 20 25 30 Phe Glu Leu Val Pro Ser Pro Pro Thr Ser Pro Pro Trp Gly Leu Gly 35 40 45 Pro Gly Ala Gly Asp Pro Ala Pro Gly Ile Gly Pro Pro Glu Pro Trp 50 55 60 Pro Gly Gly Cys Thr Gly Asp Glu Ala Glu Ser Arg Gly His Ser Lys 65 70 75 80 Gly Trp Gly Arg Asn Tyr Ala Ser Ile Ile Arg Arg Asp Cys Met Trp 85 90 95 Ser Gly Phe Ser Ala Arg Glu Arg Leu Glu Arg Ala Val Ser Asp Arg 100 105 110 Leu Ala Pro Gly Ala Pro Arg Gly Asn Pro Pro Lys Ala Ser Ala Ala 115 120 125 Pro Asp Cys Thr Pro Ser Leu Glu Ala Gly Asn Pro Ala Pro Ala Ala 130 135 140 Pro Cys Pro Leu Gly Glu Pro Lys Thr Gln Ala Cys Ser Gly Ser Glu 145 150 155 160 Ser Pro Ser Asp Ser Glu Asn Glu Glu Ile Asp Val Val Thr Val Glu 165 170 175 Lys Arg Gln Ser Leu Gly Ile Arg Lys Pro Val Thr Ile Thr Val Arg 180 185 190 Ala Asp Pro Leu Asp Pro Cys Met Lys His Phe His Ile Ser Ile His 195 200 205 Gln Gln Gln His Asn Tyr Ala Ala Arg Phe Pro Pro Glu Ser Cys Ser 210 215 220 Gln Glu Glu Ala Ser Glu Arg Gly Pro Gln Glu Glu Val Leu Glu Arg 225 230 235 240 Asp Ala Ala Gly Glu Lys Glu Asp Glu Glu Asp Glu Glu Ile Val Ser 245 250 255 Pro Pro Pro Val Glu Ser Glu Ala Ala Gln Ser Cys His Pro Lys Pro 260 265 270 Val Ser Ser Asp Thr Glu Asp Val Thr Lys Arg Lys Asn His Asn Phe 275 280 285 Leu Glu Arg Lys Arg Arg Asn Asp Leu Arg Ser Arg Phe Leu Ala Leu 290 295 300 Arg Asp Gln Val Pro Thr Leu Ala Ser Cys Ser Lys Ala Pro Lys Val 305 310 315 320 Val Ile Leu Ser Lys Ala Leu Glu Tyr Leu Gln Ala Leu Val Gly Ala 325 330 335 Glu Lys Arg Met Ala Thr Glu Lys Arg Gln Leu Arg Cys Arg Gln Gln 340 345 350 Gln Leu Gln Lys Arg Ile Ala Tyr Leu Thr Gly Tyr 355 360 <210> 9 <211> 901 <212> DNA <213> Homo sapiens <400> 9 ccccctggat ccctgcatga agcattcca catctccatc catcagcac agcacacta 60 tgctgcccgt tttcctccag aaagctgctc ccaagagag gcttcagaga ggggtcccca 120 agaagaggtt ctggagagag atgctgcagg ggaaaggaa gatgagggg ctgagagg 180 tgtgagtccc cccacctgtag aaagtgaggc tgcccagtcc tgccacccca aacctgtcag 240 ttctgatact gaggatgtga ccaagaggaa gatcacaac ttcctggagc gcaagaggcg 300 gatgacctg cgttcgcgat tcttggcgct gagggaccag gtgcccaccc tggccagctg 360 ctccaaggcc cccaagtag tgatcctaag caagccttg gatacttgc aagccctggt 420 gggggctgag aagaggatgg ctacagagaa aagacagctc cgatgccggc agcagcagtt 480 gcagaaaaga attgcatacc tcactggcta cggagatctc aaaattgtcg ctcctgtcaa 540 aaactctt aactttgatt tactcaact ggctggggat gtagaagca atccaggtcc 600 actcatgaac aattcgccct tcaccatggg ctccgtgtcc aaccagcagt ttgcaggtgg 660 ctgcgccaag gcggcagaag aggcgcccga ggaggcgcg gaggacgcgg cccgggcggc 720 ggacgagcct cagctgctgc acggtgcggg catctgtaag tggttcaacg tgcgcatggg 780 gttcggcttc ctgtccatga ccgcccgcgc cggggtcgcg ctcgacccc cagtggatgt 840 ctttgtgcac cagagtaagc tgcacatgga agggttccgg agcttgaagg agggtgaggc 900 to 901 <210> 10 <211> 209 <212> PRT <213> Homo sapiens <400> 10 Met Gly Ser Val Ser Asn Gln Gln Phe Ala Gly Gly Cys Ala Lys Ala 1 5 10 15 Ala Glu Glu Ala Pro Glu Glu Ala Pro Glu Asp Ala Ala Arg Ala Ala 20 25 30 Asp Glu Pro Gln Leu Leu His Gly Ala Gly Ile Cys Lys Trp Phe Asn 35 40 45 Val Arg Met Gly Phe Gly Phe Leu Ser Met Thr Ala Arg Ala Gly Val 50 55 60 Ala Leu Asp Pro Pro Val Asp Val Phe Val His Gln Ser Lys Leu His 65 70 75 80 Met Glu Gly Phe Arg Ser Leu Lys Glu Gly Glu Ala Val Glu Phe Thr 85 90 95 Phe Lys Lys Ser Ala Lys Gly Leu Glu Ser Ile Arg Val Thr Gly Pro 100 105 110 Gly Gly Val Phe Cys Ile Gly Ser Glu Arg Arg Pro Lys Gly Lys Ser 115 120 125 Met Gln Lys Arg Arg Ser Lys Gly Asp Arg Cys Tyr Asn Cys Gly Gly 130 135 140 Leu Asp His His Ala Lys Glu Cys Lys Leu Pro Pro Gln Pro Lys Lys 145 150 155 160 Cys His Phe Cys Gln Ser Ile Ser His Met Val Ala Ser Cys Pro Leu 165 170 175 Lys Ala Gln Gln Gly Pro Ser Ala Gln Gly Lys Pro Thr Tyr Phe Arg 180 185 190 Glu Glu Glu Glu Glu Ile His Ser Pro Thr Leu Leu Pro Glu Ala Gln 195 200 205 Asn <210> 11 <400> 11 000 <210> 12 <211> 11681 <212> DNA <213> Homo sapiens <400> 12 gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca 420 tctcccccccc ctccccaccc ccaatttgtgt atttatttat ttttaatta ttttgtgcag 480 cgatgggggc gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc 540 ggggcgggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600 tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660 gggagtcgct gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc 720 gccccggctc tgactgaccg cgttactccc acaggtgagc gggcgggacg gcccttctcc 780 tccgggctgt aattagcgct tggtttaatg acggcttgtt tcttttctgt ggctgcgtga 840 aagccttgag gggctccggg agggcccttt gtgcgggggg agcggctcgg ggggtgcgtg 900 cgtgtgtgtg tgcgtgggga gcgccgcgtg cggctccgcg ctgcccggcg gctgtgagcg 960 ctgcgggcgc ggcgcggggc tttgtgcgct ccgcagtgtg cgcgagggga gcgcggccgg 1020 gggcggtgcc ccgcggtgcg gggggggctg cgaggggaac aaaggctgcg tgcggggtgt 1080 gtgcgtgggg gggtgagcag ggggtgtggg cgcgtcggtc gggctgcaac cccccctgca 1140 cccccctccc cgagttgctg agcacggccc ggcttcgggt gcggggctcc gtacggggcg 1200 tggcgcgggg ctcgccgtgc cgggcggggg gtggcggcag gtgggggtgc cgggcggggc 1260 ggggccgcct cgggccgggg agggctcggg ggaggggcgc ggcggccccc ggagcgccgg 1320 cggctgtcga ggcgcggcga gccgcagcca ttgcctttta tggtaatcgt gcgagagggc 1380 gcagggactt cctttgtccc aaatctgtgc ggagccgaaa tctgggaggc gccgccgcac 1440 cccctctagc gggcgcgggg cgaagcggtg cggcgccggc aggaaggaaa tgggcgggga 1500 gggccttcgt gcgtcgccgc gccgccgtcc ccttctccct ctccagcctc ggggctgtcc 1560 gcggggggac ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt 1620 gaccggcggc tctagagcct ctgctaacca tgttcatgcc ttcttctttt tcctacagct 1680 cctgggcaac gtgctggtta ttgtgctgtc tcatcatttt ggcaaagaat tcgcccttca 1740 ccatggcggg acacctggct tcggatttcg ccttctcgcc ccctccaggt ggtggaggtg 1800 atgggccagg ggggccggag ccgggctggg ttgatcctcg gacctggcta agcttccaag 1860 gccctcctgg agggccagga atcgggccgg gggttgggcc aggctctgag gtgtggggga 1920 ttcccccatg ccccccgccg tatgagttct gtggggggat ggcgtactgt gggccccagg 1980 ttggagtggg gctagtgccc caaggcggct tggagacctc tcagcctgag ggcgaagcag 2040 gagtcggggt ggagagcaac tccgatgggg cctccccgga gccctgcacc gtcacccctg 2100 gtgccgtgaa gctggagaag gagaagctgg agcaaaaccc ggaggagtcc caggacatca 2160 aagctctgca gaaagaactc gagcaatttg ccaagctcct gaagcagaag aggatcaccc 2220 tgggatatac acaggccgat gtggggctca ccctgggggt tctatttggg aaggtattca 2280 gccaaacgac catctgccgc tttgaggctc tgcagcttag cttcaagaac atgtgtaagc 2340 tgcggccctt gctgcagaag tgggtggagg aagctgacaa caatgaaaat cttcaggaga 2400 tatgcaaagc agaaaccctc gtgcaggccc gaaagagaaa gcgaaccagt atcgagaacc 2460 gagtgagagg caacctggag aatttgttcc tgcagtgccc gaaacccaca ctgcagcaga 2520 tcagccacat cgcccagcag cttgggctcg agaaggatgt ggtccgagtg tggttctgta 2580 accggcgcca gaagggcaag cgatcaagca gcgactatgc acaacgagag gattttgagg 2640 ctgctgggtc tcctttctca gggggaccag tgtcctttcc tctggcccca gggccccatt 2700 ttggtacccc aggctatggg agccctcact tcactgcact gtactcctcg gtccctttcc 2760 ctgaggggga agcctttccc cctgtctctg tcaccactct gggctctccc atgcattcaa 2820 actgaggtaa gggcgaattc aagcttcggg gactagtcat atgataatca acctctggat 2880 tacaaaattt gtgaaagatt gactggtatt cttaactatg ttgctccttt tacgctatgt 2940 ggatacgctg ctttaatgcc tttgtatcat gctattgctt cccgtatggc tttcattttc 3000 tcctccttgt ataaatcctg gttgctgtct ctttatgagg agttgtggcc cgttgtcagg 3060 caacgtggcg tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg gggcattgcc 3120 accacctgtc agctcctttc cgggactttc gctttccccc tccctattgc cacggcggaa 3180 ctcatcgccg cctgccttgc ccgctgctgg acaggggctc ggctgttggg cactgacaat 3240 tccgtggtgt tgtcggggaa gctgacgtcc tttccatggc tgctcgcctg tgttgccacc 3300 tggattctgc gcgggacgtc cttctgctac gtcccttcgg ccctcaatcc agcggacctt 3360 ccttcccgcg gcctgctgcc ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag 3420 acgagtcgga tctccctttg ggccgcctcc ccgcatcggt aaattcactc ctcaggtgca 3480 ggctgcctat cagaaggtgg tggctggtgt ggccaatgcc ctggctcaca aataccactg 3540 agatctttt ccctctgcca aaaattatgg ggacatcatg aagccccttg agcatctgac 3600 ttctggctaa taaaggaaat ttattttcat tgcaatagtg tgttggaatt ttttgtgtct 3660 ctcactcgga aggacatatg ggagggcaaa tcatttaaaa catcagaatg agtatttggt 3720 ttagagtttg gcaacatatg cccatatgct ggctgccatg aacaaaggtt ggctataaag 3780 aggtcatcag tatatgaaac agccccctgc tgtccattcc ttattccata gaaaagcctt 3840 gacttgaggt tagatttttt ttatattttg ttttgtgtta tttttttctt taacatccct 3900 aaaattttcc ttacatgttt tactagccag attttcctc ctctcctgac tactcccagt 3960 catagctgtc cctcttctct tatggagatc cctcgacctg cagcccaagc ttggcgtaat 4020 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacacatac 4080 gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 4140 ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag cggatctcaa 4200 ttccgatcat attcaataac ccttaatata acttcgtata atgtatgcta tacgaagtta 4260 ttaggtctga agaggagttt acgtccagcc aagcttagga tcaattctca tgtttgacag 4320 cttatcatcg ataagctgat cctcacaggc cgcacccagc ttttcttccg ttgccccagt 4380 agcatctctg tctggtgacc ttgaagagga agaggagggg tcccgagaat ccccatccct 4440 accgtccagc aaaaaggggg acgaggaatt tgaggcctgg cttgaggctc aggacgcaaa 4500 tcttgaggat gttcagcggg agttttccgg gctgcgagta attggtgatg aggacgagga 4560 tggttcggag gatggggaat tttcagacct ggatctgtct gacagcgacc atgaagggga 4620 tgagggtggg ggggctgttg gagggggcag gagtctgcac tccctgtatt cactgagcgt 4680 cgtctaataa agatgtctat tgatctcttt tagtgtgaat catgtctgac gaggggccag 4740 gtacaggacc tggaaatggc ctaggagaga agggagacac atctggacca gaaggctccg 4800 gcggcagtgg acctcaaaga agagggggtg ataaccatgg acgaggacgg ggaagaggac 4860 gaggacgagg aggcggaaga ccaggagccc cgggcggctc aggatcaggg ccaagacata 4920 gagatggtgt ccggagaccc caaaaacgtc caagttgcat tggctgcaaa gggacccacg 4980 gtggaacagg agcaggagca ggagcgggag gggcaggagc aggaggggca ggagcaggaggag 5040 gagggggcagg agcaggagga ggggcaggag gggcaggagg ggcaggaggg gcaggagcag 5100 gaggagggc aggagcagga ggaggggcag gagggcagg aggggcagga gcaggaggag 5160 gggcaggagc aggaggagggg gcaggagggg caggagcagg aggaggggca ggaggggcag 5220 gagggggcagg agcaggagga ggggcaggag caggaggagg ggcaggaggg gcaggagcag 5280 gaggaggggc aggaggggca ggaggggcag gagcagagagg aggggcagga gcagagggg 5340 caggagggggc aggaggggca ggagcagaggag gggcaggagc aggaggagggg gcagagggg 5400 caggaggggc aggagcagga ggggcaggag caggaggggc aggagcagga ggggcaggag 5460 caggagggggc aggaggggca ggagcaggag gggcaggagg ggcaggaggcaggaggcaggaggcag 5520 gagggggcagg agcaggaga ggggcaggag gggcaggagc aggaggagg gcaggagggg 5580 caggagcagg aggggcagga ggggcaggag caggagggc aggaggggca ggagcaggag 5640 gggcaggagg ggcaggagca ggaggagggg caggagcagg aggggcagga gcaggaggtg 5700 gaggccgggg tcgaggaggc agtggaggcc ggggtcgagg aggtagtgga ggccggggtc 5760 gaggaggtag tggaggccgc cggggtagag gacgtgaaag agccaggggg ggaagtcgtg 5820 aaagagccag ggggagaggt cgtggacgtg gagaaaagag gcccaggagt cccagtagtc 5880 agtcatcatc atccgggtct ccaccgcgca ggccccctcc aggtagaagg ccatttttcc 5940 accctgtagg ggaagccgat tattttgaat accaccaaga aggtggccca gatggtgagc 6000 ctgacgtgcc cccgggagcg atagagcagg gccccgcaga tgacccagga gaaggcccaa 6060 gcactggacc ccggggtcag ggtgatggag gcaggcgcaa aaaaggaggg tggtttggaa 6120 agcatcgtgg tcaaggaggt tccaacccga aatttgagaa cattgcagaa ggtttaagag 6180 ctctcctggc taggagtcac gtagaaagga ctaccgacga aggaacttgg gtcgccggtg 6240 tgttcgtata tggaggtagt aagacctccc tttacaacct aaggcgagga actgcccttg 6300 ctattccaca atgtcgtctt acaccattga gtcgtctccc cttttggaatg gcccctggac 6360 ccggcccaca acctggcccg ctaagggagt ccattgtctg ttatttcatg gtctttttac 6420 aaactcatat atttgctgag gttttgaagg atgcgattaa ggaccttgtt atgacaaagc 6480 ccgctcctac ctgcaatatc agggtgactg tgtgcagctt tgacgatgga gtagatttgc 6540 ctccctggtt tccacctatg gtggaagggg ctgccgcgga gggtgatgac ggagatgacg 6600 gagatgaagg aggtgatgga gatgagggtg aggaagggca ggagtgatgt aacttgttag 6660 gagacgccct caatcgtatt aaaagccgtg tattcccccg cactaaagaa taaatcccca 6720 gtagacatca tgcgtgctgt tggtgtattt ctggccatct gtcttgtcac cattttcgtc 6780 ctcccaacat ggggcaattg ccggaaccct taatataact tcgtataatg tatgctatac 6840 gaagttatta ggtccctcga agaggttcac tagcggatct caattgggca tacccatgtt 6900 gtcacgtcac tcagctccgc gctcaacacc ttctcgcgtt ggaaaacatt agcgacattt 6960 acctggtgag caatcagaca tgcgacggct ttagcctggc ctccttaaat tcacctaaga 7020 atgggagcaa ccagcaggaa aaggacaagc agcgaaaatt cacgccccct tgggaggtgg 7080 cggcatatgc aaaggatagc actcccactc tactactggg tatcatatgc tgactgtata 7140 tgcatgagga tagcatatgc tacccggata cagattagga tagcatatac tacccagata 7200 tagattagga tagcatatgc tacccagata tagattagga tagcctatgc tacccagata 7260 taaattagga tagcatatac tacccagata tagattagga tagcatatgc tacccagata 7320 tagattagga tagcctatgc tacccagata tagattagga tagcatatgc tacccagata 7380 tagattagga tagcatatgc tatccagata tttgggtagt atatgctacc cagatataaa 7440 ttaggatagc atatactacc ctaatctcta ttaggatagc atatgctacc cggatacaga 7500 ttaggatagc atatactacc cagatataga ttaggatagc atatgctacc cagatataga 7560 ttaggatagc ctatgctacc cagatataaa ttaggatagc atatactacc cagatataga 7620 ttaggatagc atatgctacc cagatataga ttaggatagc ctatgctacc cagatataga 7680 ttaggatagc atatgctatc cagatatttg ggtagtatat gctacccatg gcaacattag 7740 cccaccgtgc tctcagcgac ctcgtgaata tgaggaccaa caaccctgtg cttggcgctc 7800 aggcgcaagt gtgtgtaatt tgtcctccag atcgcagcaa tcgcgcccct atcttggccc 7860 gcccacctac ttatgcaggt attccccggg gtgccattag tggttttgtg ggcaagtggt 7920 ttgaccgcag tggttagcgg ggttacaatc agccaagtta ttacaccctt attttacagt 7980 ccaaaaccgc agggcggcgt gtgggggctg acgcgtgccc ccactccaca atttcaaaaa 8040 aaagagtggc cacttgtctt tgtttatggg ccccattggc gtggagcccc gtttaatttt 8100 cgggggtgtt agagacaacc agtggagtcc gctgctgtcg gcgtccactc tctttcccct 8160 tgttacaaat agagtgtaac aacatggttc acctgtcttg gtccctgcct gggacacatc 8220 ttaataaccc cagtatcata ttgcactagg attatgtgtt gcccatagcc ataaattcgt 8280 gtgagatgga catccagtct ttacggcttg tccccacccc atggatttct attgttaaag 8340 atattcagaa tgtttcattc ctacactagt atttattgcc caaggggttt gtgagggtta 8400 tattggtgtc atagcacaat gccaccactg aaccccccgt ccaaatttta ttctgggggc 8460 gtcacctgaa accttgtttt cgagcacctc acatacacct tactgttcac aactcagcag 8520 ttattctatt agctaaacga aggagaatga agaagcaggc gaagattcag gagagttcac tgcccgctcc ttgatcttca gccactgccc ttgtgactaa aatggttcac taccctcgtg 8640. gaatcctgac cccatgtaaa taaaaccgtg acagctcatg gggtggggaga tatcgctgtt ccttaggacc cttttactaa ccctaattcg atagcatatg cttcccgttg ggtaacatat gctattgaat tagggttagt ctggatagta tatactacta cccgggaagc atatgctacc cgtttagggt taacaagggg gccttataaa cactattgct aatgccctct tgagggtccg cttatcggta gctacacagg cccctctgat tgacgttggt gtagcctccc gtagtcttcc 8940 tgggcccctg ggaggtacat gtcccccagc attggtgtaa gagcttcagc caagagttac acataaaggc aatgttgtgt tgcagtccac agactgcaaa gtctgctcca ggatgaaagc 9120. gtcaactaca gtcagagaac 9120. gtcaactaca gtcagagaac ccctttgtgt ttggtccccc cccgtgtcac atgtggaaca gggcccagtt ggcaagttgt 9180. accaaccaac tgaagggatt acatgcactg ccccgcgaag aaggggcaga gatgtcgtag tcaggtttag ttcgtccggg gcggggcatc gatcctctag agtcgacgct agcggatccg 9300 acgccgccat ctctaggccc gcgccggccc cctcgcacag acttgtggga gaagctcggc 9360 tactcccctg ccccggttaa tttgcatata atatttccta gtaactatag aggcttaatg 9420 tgcgataaaa gacagataat ctgttctttt taatactagc tacattttac atgataggct 9480 tggatttcta taagagatac aaatactaaa ttattatttt aaaaaacagc acaaaaggaa 9540 actcacccta actgtaaagt aattgtgtgt tttgagacta taaatatccc ttggagaaaa 9600 gccttgtttg ggccgactcc agtggtaatc tacttcaaga gagtagatta ccactggagt 9660 cttttttgga attcctgcag cccgggggat ccgctgcatt aatgaatcgg ccaacgcgcg 9720 gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc 9780 tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 9840 acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 9900 aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 9960 cacaaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 10020 gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 10080 tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 10140 tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga accccccgtt 10200 cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 10260 gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 10320 ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt 10380 ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 10440 ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 10500 agaaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 10560 aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 10620 atccttttaa attaaaatg aagtttaaa tcaatctaaa gtatatatga gtaaacttgg 10680 tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 10740 tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 10800 tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 10860 gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 10920 tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 10980 ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 11040 gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 11100 aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 11160 tttcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 11220 tgctttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 11280 ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta 11340 aaagtgctca tcattggaaa acgttcttcg gggcgaaac tccaggt cttaccgctg 11400 ttgagatcca gttcgatgta acccactcgt gcaccact gatcttcagc atctttact 11460 ttcaccagcg ttctgggtg agcaaaaaca ggaggcaaa atgccgcaa aaagggaata 11520 agggcgacac ggaaatgttg atactcata ctctctcctttt ttcaatatta ttgaagcatt 11580 tatcaggggtt attgtctcat gagcggatac atatttgaat gtatttagaa aataaaaca 11640 ataggttc cgcgcacatt tccccgaaaa gtgccacctg g 11681 <210> 13 <211> 12693 <212> DNA <213> Homo sapiens <400> 13 gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtagt tcccatagta acgccaatag 180 ggactttcca ttgacgtca tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca 420 tctcccccccc ctccccaccc ccaattttgt attatttat tttttaatta ttttgtgcag 480 cgatggggc gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc 540 ggggcgggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600 tcctttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660 gggagtcgct gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc 720 gccccggctc tgactgaccg cgttactccc acaggtgagc gggcgggacg gcccttctcc 780 tccgggctgt aattagcgct tggtttaatg acggcttgtt tcttttctgt ggctgcgtga 840 aagccttgag gggctccggg agggcccttt gtgcgggggg agcggctcgg ggggtgcgtg 900 cgtgtgtgtg tgcgtgggga gcgccgcgtg cggctccgcg ctgcccggcg gctgtgagcg 960 ctgcgggcgc ggcgcggggc tttgtgcgct ccgcagtgtg cgcgagggga gcgcggccgg 1020 gggcggtgcc ccgcggtgcg gggggggctg cgaggggaac aaaggctgcg tgcggggtgt 1080 gtgcgtgggg gggtgagcag ggggtgtggg cgcgtcggtc gggctgcaac cccccctgca 1140 cccccctccc cgagttgctg agcacggccc ggcttcgggt gcggggctcc gtacggggcg 1200 tggcgcgggg ctcgccgtgc cgggcggggg gtggcggcag gtgggggtgc cgggcggggc 1260 ggggccgcct cgggccgggg agggctcggg ggaggggcgc ggcggccccc ggagcgccgg 1320 cggctgtcga ggcgcggcga gccgcagcca ttgcctttta tggtaatcgt gcgagagggc 1380 gcagggactt cctttgtccc aaatctgtgc ggagccgaaa tctgggaggc gccgccgcac 1440 cccctctagc gggcgcgggg cgaagcggtg cggcgccggc aggaaggaaa tgggcgggga 1500 gggccttcgt gcgtcgccgc gccgccgtcc ccttctccct ctccagcctc ggggctgtcc 1560 gcggggggac ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt 1620 gaccggcggc tctagagcct ctgctaacca tgttcatgcc ttcttctttt tcctacagct 1680 cctgggcaac gtgctggtta ttgtgctgtc tcatcatttt ggcaaagaat tcgcccttca 1740 ccatgtacaa catgatggag acggagctga agccgccggg cccgcagcaa acttcgggg 1800 gcggcggcgg caactccacc gcggcggcgg ccggcggcaa ccagaaaaac agcccggacc 1860 gcgtcaagcg gcccatgaat gccttcatgg tgtggtcccg cgggcagcgg cgcaagatgg 1920 cccaggagaa ccccaagatg cacaactcgg agatcagcaa gcgcctgggc gccgagtgga 1980 aacttttgtc ggagacggag aagcggccgt tcatcgacga ggctaagcgg ctgcgagcgc 2040 tgcacatgaa ggagcacccg gattataaat accggccccg gcggaaaacc aagacgctca 2100 tgaaagga tagtacag ctgcccggcg ggctgctggc ccccggcgg aatagcatgg 2160 cgagcggggt cggggtgggc gccggcctgg gcgcgggcgt gaaccagcgc atggacagtt 2220 acgcgcacat gaacggctgg agcaacggca gctacagcat gatgcaggac cagctggggct 2280 acccgcagca cccgggcctc aatgcgcacg gcgcagcgca gatgcagccc atgcaccgct 2340 acgacgtgag cgccctgcag tacaactcca tgaccagctc gcagacctac atgaacggct 2400 cgcccaccta cagcatgtcc tactcgcagc agggcacccc tggcatggct cttggctcca 2460 tgggttcggt ggtcaagtcc gaggccagct ccagcccccc tgtggttacc tcttcctccc 2520 actccagggc gccctgccag gccggggacc tccgggacat gatcagcatg tatctccccg 2580 gcgccgaggt gccggaaccc gccgccccca gcagacttca catgtcccag cactaccaga 2640 gcggcccggt gcccggcacg gccattaacg gcacactgcc cctctcacac atgggggatc 2700 tcaaaattgt cgctcctgtc aaaacaaactc ttaactttga tttactcaaa ctggctgggg 2760 atgtagaaag caatccaggt ccactcatga acaattcgcc cttcaccatg gctgtcagtg 2820 acgcgctgct cccatctttc tccacgttcg cgtctggccc ggcgggaagg gagaagacac 2880 tgcgtcaagc aggtgccccg aataaccgct ggcgggagga gctctcccac atgaagcgac 2940 ttcccccagt gcttcccggc cgcccctatg acctggcggc ggcgaccgtg gccacagacc 3000 tggagagcgg cggagccggt gcggcttgcg gcggtagcaa cctggcgccc ctacctcgga 3060 gagagaccga ggagttcaac gatctcctgg acctggactt tattctctcc aattcgctga 3120 cccatcctcc ggagtcagtg gccgccaccg tgtcctcgtc agcgtcagcc tcctcttcgt 3180 cgtcgccgtc gagcagcggc cctgccagcg cgccctccac ctgcagcttc acctatccga 3240 tccgggccgg gaacgacccg ggcgtggcgc cgggcggcac gggcggaggc ctcctctatg 3300 gcagggagtc cgctccccct ccgacggctc ccttcaacct ggcggacatc aacgacgtga 3360 gcccctcggg cggcttcgtg gccgagctcc tgcggccaga attggacccg gtgtacattc 3420 cgccgcagca gccgcagccg ccaggtggcg ggctgatggg caagttcgtg ctgaaggcgt 3480 cgctgagcgc ccctggcagc gagtacggca gcccgtcggt catcagcgtc agcaaaggca 3540 gccctgacgg cagccacccg gtggtggtgg cgccctacaa cggcgggccg ccgcgcacgt 3600 gccccaagat caagcaggag gcggtctctt cgtgcaccca cttgggcgct ggaccccctc 3660 tcagcaatgg ccaccggccg gctgcacacg acttccccct ggggcggcag ctccccagca 3720 ggactacccc gaccctgggt cttgaggaag tgctgagcag cagggactgt caccctgccc 3780 tgccgcttcc tcccggcttc catccccacc cggggcccaa ttacccatcc ttcctgcccg 3840 atcagatgca gccgcaagtc ccgccgctcc attaccaaga gctcatgcca cccggttcct 3900 gcatgccaga ggagcccaag ccaaagaggg gaagacgatc gtggccccgg aaaaggaccg 3960 ccacccacac ttgtgattac gcgggctgcg gcaaaaccta cacaaagagt tcccatctca 4020 aggcacacct gcgaacccac acaggtgaga aaccttacca ctgtgactgg gacggctgtg 4080 gatggaaatt cgcccgctca gatgaactga ccaggcacta ccgtaaacac acggggcacc 4140 gcccgttcca gtgccaaaaa tgcgaccgag cattttccag gtcggaccac ctcgccttac 4200 acatgaagag acatttttaa aagggcgaat tgcctgcagg aattcaagct tcggggacta 4260 gtcatatgat aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa 4320 ctatgttgct ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat 4380 tgcttcccgt atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta 4440 tgaggagttg tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc 4500 aacccccact ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt 4560 ccccctccct attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg 4620 ggctcggctg ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc 4680 atggctgctc gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc 4740 ttcggccctc aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct 4800 tccgcgtctt cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgca 4860 tcggtaaatt cactcctcag gtgcaggctg cctatcagaa ggtggtggct ggtgtggcca 4920 atgccctggc tcacaaatac cactgagatc tttttccctc tgccaaaaat tatggggaca 4980 tcatgaagcc ccttgagcat ctgacttctg gctaataaag gaaatttatt ttcattgcaa 5040 tagtgtgttg gaattttttg tgtctctcac tcggaaggac atatgggagg gcaaatcatt 5100 taaaacatca gaatgagtat ttggtttaga gtttggcaac atatgcccat atgctggctg 5160 ccatgaacaa aggttggcta taaagaggtc atcagtatat gaaacagccc cctgctgtcc 5220 attccttatt ccatagaaaa gccttgactt gaggttagat tttttttata ttttgttttg 5280 tgtattttt ttctttaaca tccctaaaat tttccttaca tgttttacta gccagatttt 5340 tcctctctc ctgactactc ccagtcatag ctgtccctct tctcttatg agatccctcg 5400 acctgcagcc caagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat 5460 ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 5520 taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 5580 aacctgtcgt gccagcggat ctcaattccg atcatattca ataaccctta atataacttc 5640 gtataatgta tgctatacga agttattagg tctgaagagg agtttacgtc cagccaagct 5700 taggatcaat tctcatgttt gacagcttat catcgataag ctgatcctca caggccgcac 5760 ccagctttc ttccgttgcc ccagtagcat ctctgtctgg tgaccttgaa gaggaagagg 5820 aggggtcccg agaatcccca tccctaccgt ccagcaaaaa gggggacgag gaatttgagg 5880 cctggcttga ggctcaggac gcaaatcttg agatgttca gcgggagtt tccgggctgc 5940 gagtaattgg tgatgaggac gaggatggtt cggaggatgg ggaattttca gacctggatc 6000 tgtctgacag cgaccatgaa ggggatgagg gtgggggggc tgttggaggg ggcaggagtc 6060 tgcactccct gtattcactg agcgtcgtct aataaagatg tctattgatc tcttttagtg tgaatcatgt ctgacgaggg gccaggtaca ggacctgga atggcctagg agagaaggga gacacatctg gaccagaagg ctccggcggc agtggacctc aaagaagagg gggtgataac catggacgag gacggggag aggacgagg cgaggaggcg gagaccagg agccccggggc 6300 ggctcaggat cagggccaag acatagagat ggtgtccgga gaccccaaaa acgtccaagt tgcattggct gcaaagggac ccacggtgga acaggagcag gagcaggagc gggaggggca gggcaggag gggcaggagc aggagggg gcaggagcag gaggaggggc aggaggggca 6480 ggaggggcag gaggggcagg agcaggagg ggggcaggag caggagg ggcaggagg 6540 gcaggagggg caggagcagg aggaggggca ggagcaggag gaggggcagg 6600 gcaggag gggcaggagg ggcaggaggg gcaggagcag gaggaggggc 6660 ggaggggcag gaggggcagg agcaggag ggggcaggag gggcaggagg ggcaggagca 6720 ggaggagggg caggagcagg aggggcagga ggggcaggag gggcaggagc aggaggggca 6780 ggagcaggag gaggggcagg aggggcagga ggggcaggag caggaggggc aggagcagga 6840 ggggcaggag caggagggggc aggagcagga ggggcaggag gggcaggagc aggagggga 6900 ggaggggcag gagcagagg ggcaggaggg gcaggagcag gaggaggggc aggaggggca 6960 ggagcaggag gaggggcagg aggggcagga gcaggagggg caggaggggc aggagcagga 7020 ggggcaggag gggcaggagc aggaggggca ggaggggcag gagcagagg aggggcagga 7080 gcaggagggg caggagcagg aggtggaggc cggggtcgag gaggcagtgg aggccggggt 7140 cgaggaggta gtggaggccg gggtcgagga ggtagtggag gccgccgggg tagaggcgt 7200 gaaagagcca gggggggaag tcgtgaaaga gccaggggga gaggtcgtgg acgtggagaa 7260 aagaggccca ggagtcccag tagtcagtca tcatcatccg ggtctccacc gcgcaggccc 7320 cctccaggta gaaggccatt tttccaccct gtaggggaag ccgattattt tgaataccac 7380 caagaaggtg gcccagatgg tgagcctgac gtgccccccgg gagcgataga gcagggcccc 7440 gcagatgacc caggagaagg cccaagcact ggaccccggg gtcagggtga tggaggcagg 7500 cgcaaaaaag gagggtggtt tggaaagcat cgtggtcaag gaggttccaa cccgaaattt 7560 gagaacattg cagaaggttt aagagctctc ctggctagga gtcacgtaga aaggactacc 7620 gacgaaggaa cttgggtcgc cggtgtgttc gtatatggag gtagtaagac ctccctttac 7680 aacctaaggc gaggaactgc ccttgctatt ccacaatgtc gtcttacacc attgagtcgt 7740 ctcccctttg gaatggcccc tggacccggc ccacaacctg gcccgctaag ggagtccatt 7800 gtctgttatt tcatggtctt tttacaaact catatatttg ctgaggtttt gaaggatgcg 7860 attaaggacc ttgttatgac aaagcccgct cctacctgca atatcagggt gactgtgtgc 7920 agctttgacg atggagtaga tttgcctccc tggtttccac ctatggtgga aggggctgcc 7980 gcggagggtg atgacggaga tgacggagat gaaggaggtg atggagatga gggtgaggaa 8040 gggcaggagt gatgtaactt gttaggagac gccctcaatc gtattaaaag ccgtgtattc 8100 ccccgcacta aagaataaat ccccagtaga catcatgcgt gctgttggtg tatttctggc 8160 catctgtctt gtcaccattt tcgtcctccc aacatggggc aattgccgga acccttaata 8220 taacttcgta taatgtatgc tatacgaagt tattaggtcc ctcgaagagg ttcactagcg 8280 gatctcaatt gggcataccc atgttgtcac gtcactcagc tccgcgctca acaccttctc 8340 gcgttggaaa acattagcga catttacctg gtgagcaatc agacatgcga cggctttagc 8400 ctggcctcct taaattcacc taagaatggg agcaaccagc aggaaaagga caagcagcga 8460 aaattcacgc ccccttggga ggtggcggca tatgcaaagg atagcactcc cactctacta 8520 ctgggtatca tatgctgact gtatatgcat gaggatagca tatgctaccc ggatacagat 8580 taggatagca tatactaccc agatatagat taggatagca tatgctaccc agatatagat 8640 taggatagcc tatgctaccc agatataaat taggatagca tatactaccc agatatagat 8700 taggatagca tatgctaccc agatatagat taggatagcc tatgctaccc agatatagat 8760 taggatagca tatgctaccc agatatagat taggatagca tatgctatcc agatatttgg 8820 gtagtatatg ctacccagat ataaattagg atagcatata ctaccctaat ctctattagg 8880 atagcatatg ctacccggat acagattagg atagcatata ctacccagat atagattagg 8940 atagcatatg ctacccagat atagattagg atagcctatg ctacccagat ataaattagg 9000 atagcatata ctacccagat atagattagg atagcatatg ctacccagat atagattagg 9060 atagcctatg ctacccagat atagattagg atagcatatg ctatccagat atttgggtag 9120 tatatgctac ccatggcaac attagcccac cgtgctctca gcgacctcgt gaatatgagg 9180 accaacaacc ctgtgcttg cgctcaggcg caagtgtgtg taatttgtcc tccagatcgc 9240 agcaatcgcg ccctatctt ggcccgccca cctacttatg caggtattcc ccggggtgcc 9300 attagtggtt ttgtgggcaa gtggtttgac cgcagtggtt agcggggtta caatcagcca 9360 agttattaca cccttatttt acagtccaaa accgcagggc ggcgtgtggg ggctgacgcg 9420 tgcccccact ccacaatttc aaaaaaaaga gtggccactt gtctttgttt atgggcccca 9480 ttggcgtgga gccccgttta atttcgggg gtgttagaga caaccagtgg agtccgctgc 9540 tgtcggcgtc cactctcttt ccccttgtta caaatagagt gtaacaacat ggttcacctg 9600 tcttggtccc tgcctgggac acatcttaat aaccccagta tcatattgca ctaggattat gtgttgccca tagccataaa ttcgtgtgag atggacatcc agtctttacg gcttgtcccc 9720 accccatgga tttctattgt taaagatatt cagaatgttt cattcctaca ctagtattta ttgcccaagg ggtttgtgag ggttatattg gtgtcatagc acaatgccac cactgaaccc cccgtccaaa ttttattctg ggggcgtcac ctgaacctt gttttcgagc acctcacata caccttactg ttcacaactc agcagttatt ctattagcta aacgaaggag aatgaagaag caggcgaaga ttcaggagag ttcactgccc gctccttgat cttcagccac tgcccttgtg actaaaatgg ttcactaccc tcgtggaatc ctgaccccat gtaaataaaa ccgtgacagc tcatggggtg ggagatatcg ctgttcctta ggaccctttt actaacccta attcgatagc 10140. atatgcttcc cgttgggtaa catatgctat tgaattaggg ttagtctgga tagtatac tactacccgg gaagcatatg ctacccgttt agggttaaca agggggcctt ataaacacta ttgctaatgc cctcttgagg gtccgcttat cggtagctac acaggcccct ctgattgacg 10320 ttggtgtagc ctcccgtagt cttcctgggc ccctggggagg tacatgtccc ccagcattgg 10380 tgtaagagct tcagccaaga gttacacata aaggcaatgt tgtgttgcag tccacagact gcaaagtctg ctccaggatg aaagccactc agtgttggca aatgtgcaca tccatttata aggatgtcaa ctacagtcag agaacccctt tgtgtttggt ccccccccgt gtcacatgtg 10560 10620. gacagggcc cagttggcaa gttgtaccaa ccaactgaag ggattacatg cactgccccg cgaagaaggg gcagagatgt cgtagtcagg tttagttcgt ccggggcggg gcatcgatcc 10680. tctagagtcg acgctagcgg atccgctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attggggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt 10800. tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 10980. aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 11100 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 11160 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 11220 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 11280 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 11340 agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg 11400 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 11460 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 11520 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa 11580 ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt 11640 aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag 11700 ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 11760 agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 11820 cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa 11880 ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 11940 gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 12000 cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 12060 cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 12120 ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 12180 catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 12240 tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 12300 ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 12360 catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 12420 cagttcgatg taaccactc gtgcaccca ctgatcttca gcatcttta ctttcaccag 12480 cgtttctgggg tgagcaaaaa caggaggca aaatgccgca aaaaagggaa taagggcgac 12540 acggaaatgt tgaatactca tactctcct ttcaat tattgagca ttcaggg 12600 ttattgtctc atgagcggat acatatttga atgtatttag aaaataac aaataggggt 12660 tccgcgcaca ttccccgaa aagtgccacc tgg 12693 <210> 14 <211> 12051 <212> DNA <213> Homo sapiens <400> 14 gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtagt tcccatagta acgccaatag 180 ggactttcca ttgacgtca tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca 420 tctcccccccc ctccccaccc ccaattttgt attatttat tttttaatta ttttgtgcag 480 cgatggggc gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc 540 ggggcgggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600 tcctttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660 gggagtcgct gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc 720 gccccggctc tgactgaccg cgttactccc acaggtgagc gggcgggacg gcccttctcc 780 tccgggctgt aattagcgct tggtttaatg acggcttgtt tcttttctgt ggctgcgtga 840 aagccttgag gggctccggg agggcccttt gtgcgggggg agcggctcgg ggggtgcgtg 900 cgtgtgtgtg tgcgtgggga gcgccgcgtg cggctccgcg ctgcccggcg gctgtgagcg 960 ctgcgggcgc ggcgcggggc tttgtgcgct ccgcagtgtg cgcgaggga gcgcggccgg 1020 gggcggtgcc ccgcggtgcg gggggggctg cgaggggaac aaaggctgcg tgcggggtgt 1080 gtgcgtgggg gggtgagcag ggggtgtggg cgcgtcggtc gggctgcaac cccccctgca 1140 cccccctccc cgagttgctg agcacggccc ggcttcgggt gcggggctcc gtacggggcg 1200 tggcgcgggg ctcgccgtgc cgggcggggg gtggcggcag gtgggggtgc cgggcggggc 1260 ggggccgcct cgggccgggg agggctcggg ggaggggcgc ggcggccccc ggagcgccgg 1320 cggctgtcga ggcgcggcga gccgcagcca ttgcctttta tggtaatcgt gcgagagggc 1380 gcagggactt cctttgtccc aaatctgtgc ggagccgaaa tctgggaggc gccgccgcac 1440 cccctctagc gggcgcgggg cgaagcggtg cggcgccggc aggaaggaaa tgggcgggga 1500 gggccttcgt gcgtcgccgc gccgccgtcc ccttctccct ctccagcctc ggggctgtcc 1560 gcggggggac ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt 1620 gaccggcggc tctagagcct ctgctaacca tgttcatgcc ttcttctttt tcctacagct 1680 cctgggcaac gtgctggtta ttgtgctgtc tcatcatttt ggcaaagaat tcgcccttca 1740 ccatggacta cgactcgtac cagcactatt tctacgacta tgactgcggg gaggatttct 1800 accgctccac ggcgcccagc gaggacatct ggaagaaatt cgagctgggtg ccatcgcccc 1860 ccacgtcgcc gccctggggc ttgggtcccg gcgcaggga cccggcccccc gggattggtc 1920 ccccggagcc gtggccccgga gggtgcaccg gagacgaagc ggaatcccgg ggccactcga 1980 aaggctgggg caggaactac gcctccatca tacgccgtga ctgcatgtgg agcggcttct 2040 cggcccggga acgggctggag agagctgtga gcgaccggct cgctcctggc gcgccccggg 2100 ggaacccgcc caaggcgtcc gccgccccgg actgcactcc cagcctcgaa gccggcaacc 2160 cggcgcccgc cgccccctgt ccgctgggcg aacccaagac ccaggcctgc tccgggtccg 2220 agagcccaag cgactcggag aatgaaaa ttgatgttgt gacagtagag aagaggcagt 2280 ctctgggtat tcggaagccg gtcaccatca cggtgcgagc agaccccctg gatccctgca 2340 tgaagcattt ccacatctcc atccatcagc aacagcacaa ctatgctgcc cgttttcctc 2400 cagaaagctg ctcccaagaa gaggcttcag agaggggtcc ccaagaagag gttctggaga 2460 gagatgctgc aggggaaaag gaagatgagg aggatgaaga gattgtgagt cccccacctg 2520 tagaaagtga ggctgcccag tcctgccacc ccaaacctgt cagttctgat actgaggatg 2580 tgaccaagag gaagaatcac aacttcctgg agcgcaagag gcggaatgac ctgcgttcgc 2640 gattcttggc gctgagggac caggtgccca ccctggccag ctgctccaag gcccccaaag 2700 tagtgatcct aagcaaggcc ttggaatact tgcaagccct ggtgggggct gagaagagga 2760 tggctacaga gaaaagacag ctccgatgcc ggcagcagca gttgcagaaa agaattgcat 2820 acctcactgg ctacggagat ctcaaaattg tcgctcctgt caaacaaact cttaactttg 2880 atttactcaa actggctggg gatgtagaaa gcaatccagg tccactcatg aacaattcgc 2940 ccttcaccat gggctccgtg tccaaccagc agtttgcagg tggctgcgcc aaggcggcag 3000 aagaggcgcc cgaggaggcg ccggaggacg cggcccgggc ggcggacgag cctcagctgc 3060 tgcacggtgc gggcatctgt aagtggttca acgtgcgcat ggggttcggc ttcctgtcca 3120 tgaccgcccg cgccggggtc gcgctcgacc ccccagtgga tgtctttgtg caccagagta 3180 agctgcacat ggaagggttc cggagcttga aggagggtga ggcagtggag ttcaccttta 3240 agaagtcagc caagggtctg gaatccatcc gtgtcaccgg acctggtgga gtattctgta 3300 ttgggagtga gaggcggcca aaaggaaaga gcatgcagaa gcgcagatca aaaggagaca 3360 ggtgctacaa ctgtggaggt ctagatcatc atgccaagga atgcaagctg ccaccccagc 3420 ccaagaagtg ccacttctgc cagagcatca gccatatggt agcctcatgt ccgctgaagg 3480 cccagcaggg ccctagtgca cagggaaagc caacctactt tcgagaggaa gaagaagaaa 3540 tccacagccc taccctgctc ccggaggcac agaattgaaa gggcgaattg cctgcaggaa 3600 ttcaagcttc ggggactagt catatgataa tcaacctctg gattacaaaa tttgtgaaag 3660 attgactggt attcttaact atgttgctcc tttacgcta tgtggatacg ctgctttaat 3720 gccttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc 3780 ctggttgctg tctcttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg 3840 cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct 3900 ttccgggact ttcgctttcc ccccctat tgccacggcg gaactcatcg ccgcctgcct 3960 tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg 4020 gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac 4080 gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct 4140 gccggctctg cggcctcttc cgcgtcttg cttcgccct cagacgagtc ggatctccct 4200 ttgggccgcc tccccgcatc ggtaaattca ctcctcaggt gcaggctgcc tatcagaagg 4260 tggtggctgg tgtggccaat gccctggctc acaaatacca ctgagatctt tttccctctg 4320 ccaaaaatta tggggacatc atgaagcccc ttgagcatct gacttctggc tataaagga 4380 aatttatttt cattgcaata gtgtgttgga atttttgtg tctctcactc ggaaggacat 4440 atgggagggc aaatcattta aaacatcaga atgagtattt ggtttagagt ttggcaacat 4500 atgcccatat gctggctgcc atgaacaaag gttggctata aagaggtcat cagtatatga 4560 aacagccccc tgctgtccat tccttattcc atagaaaagc cttgacttga ggttagattt 4620 tttttatatt ttgttttgtg ttattttttt ctttaacatc cctaaaattt tccttacatg 4680 ttttactagc cagatttttc ctcctctcct gactactccc agtcatagct gtccctcttc 4740 tcttatggag atccctcgac ctgcagccca agcttggcgt aatcatggtc atagctgttt 4800 cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg aagcataaag 4860 tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg 4920 cccgctttcc agtcgggaaa cctgtcgtgc cagcggatct caattccgat catattcaat 4980 aacccttaat ataacttcgt ataatgtatg ctatacgaag ttattaggtc tgaagaggag 5040 tttacgtcca gccaagctta ggatcaattc tcatgtttga cagcttatca tcgataagct 5100 gatcctcaca ggccgcaccc agcttttctt ccgttgcccc agtagcatct ctgtctggtg 5160 accttgaaga ggaagaggag gggtcccgag aatccccatc cctaccgtcc agcaaaaagg 5220 gggacgagga atttgaggcc tggcttgagg ctcaggacgc aaatcttgag gatgttcagc 5280 gggagttttc cgggctgcga gtaattggtg atgaggacga ggatggttcg gaggatgggg 5340 aattttcaga cctggatctg tctgacagcg accatgaagg ggatgagggt gggggggctg 5400 ttggaggg caggagtctg cactccctgt attcactgag cgtcgtctaa taaagatgtc 5460 tattgatctc ttttagtgtg aatcatgtct gacgaggggc caggtacagg acctggaaat 5520 ggcctaggag agaagggaga cacatctgga ccagaaggct ccggcggcag tggacctcaa 5580 agaagagggg gtgataacca tggacgagga cgggaagag gacgaggacg aggaggcgga 5640 agaccaggag ccccgggcgg ctcaggatca gggccaagac atagagatgg tgtccggaga 5700 ccccaaaaac gtccaagttg cattggctgc aaagggaccc acggtggaac aggagcagga 5760 gcaggagcgg gagggggcagg agcaggaggg gcaggagcag gaggaggggc aggagcagga 5820 ggaggggcag gaggggcagg aggggcagga ggggcaggag caggaggagg ggcaggagca 5880 ggaggagggg caggagggc aggaggggca ggagcaggag gagggcagg agcaggaga 5940 ggggcaggag gggcaggagc agggaggaggg gcaggagggg caggagggc aggagcagga 6000 ggaggggcag ggagggagg aggggcagga ggggcaggag caggaggagg ggcaggaggg 6060 gcaggagggg caggagcagg aggaggggca ggagcaggag gggcaggagg ggcaggaggg 6120 gcaggagcag gagggcagg agcaggagga ggggcaggag gggcaggagg ggcaggagca 6180 ggaggggcag ggagggagg ggagggagca ggaggggcag ggagggagg ggagggagg 6240 gcaggagcag gagggcagg aggggcagga gcaggagggg caggaggggc aggagcagga 6300 ggaggggcag gagggggcagg agcaggaga ggggcaggag gggcaggagc aggaggggca 6360 ggaggggcag ggagggagg gggaggaggg gcaggagcag gaggggcagg aggggcagga 6420 gcaggaggag gggcaggagc aggaggggca ggagcaggag gtggaggccg gggtcgagga 6480 ggcagtggag gccggggtcg aggaggtagt ggaggccggg gtcgaggagg tagtggaggc 6540 cgccggggta gaggacgtga aagagccagg gggggaagtc gtgaaagagc cagggggaga 6600 ggtcgtggac gtggagaaaa gaggcccagg agtcccagta gtcagtcatc atcatccggg 6660 tctccaccgc gcaggcccccc tccaggtaga aggccatttt tccaccctgt aggggaagcc 6720 gattttttg aataccacca agaaggtggc ccagatggtg agcctgacgt gccccccggga 6780 gcgatagac agggccccgc agatgaccca ggagaaggcc caagcactgg accccgggt 6840 cagggtgatg gaggcaggcg caaaaaagga gggtggtttg gaaagcatcg tggtcaagga 6900 ggttccaacc cgaaatttga gaacattgca gaaggtttaa gagctctcct ggctaggagt 6960 cacgtagaaa ggactaccga cgaaggaact tgggtcgccg gtgtgttcgt atatggaggt 7020 agtaagacct cccttacaa cctaaggcga ggaactgccc ttgctattcc acaatgtcgt 7080 cttacaccat tgagtcgtct cccctttgga atggcccctg gacccggccc acaacctggc 7140 ccgctaaggg agtccattgt ctgttatttc atggtctttt tacaaactca tatatttgct 7200 gaggttttga aggatgcgat taaggacctt gttatgacaa agcccgctcc tacctgcaat 7260 atcagggtga ctgtgtgcag ctttgacgat ggagtagatt tgcctccctg gtttccacct 7320 atggtggaag gggctgccgc ggagggtgat gacggagatg acggagatga aggaggtgat 7380 ggagatgagg gtgaggaagg gcaggagtga tgtaacttgt taggagacgc cctcaatcgt 7440 attaaaagcc gtgtattccc ccgcactaaa gaataaatcc ccagtagaca tcatgcgtgc 7500 tgttggtgta tttctggcca tctgtcttgt caccattttc gtcctcccaa catggggcaa ttgccggaac ccttaatata acttcgtata atgtatgcta tacgaagtta ttaggtccct cgaagaggtt cactagcgga tctcaattgg gcatacccat gttgtcacgt cactcagctc 7740. cgcgctcaac accttctcgc gttggaaac attagcgaca tttacctggt gagcaatcag acatgcgacg gctttagcct ggcctcctta aattcaccta agaatgggag caaccagcag gaaaaggaca agcagcgaaa attcacgccc ccttgggagg tggcggcata tgcaaaggat agcactccca ctctactact gggtatcata tgctgactgt atatgcatga ggatagcata tgctacccgg uncoupled ggatagcata tactacccag uncoupled ggatagcata 7980 tgctacccag father ggatagccta tgctacccag father ggatagcata tactacccag unconnected ggatagcata tgctacccag unconnected ggatagccta 8100 tgctacccag unconnected ggatagcata tgctacccag unconnected ggatagcata 8160 tgctatccag atatttgggt agtatatgct acccagatat aaatttaggat agcatatact 8220. accctaatct ctattaggat agcatatgct acccggatac agattaggat agcatatact 8280 acccagatat agattaggat agcatatgct acccagatat agattaggat agcctatgct 8340 acccagatat aaattaggat agcatatact acccagatat agattaggat agcatatgct 8400 acccagatat agattaggat agcctatgct acccagatat agattaggat agcatatgct 8460 atccagatat ttgggtagta tatgctaccc atggcaacat tagcccaccg tgctctcagc 8520 gacctcgtga atatgaggac caacaaccct gtgcttggcg ctcaggcgca agtgtgtgta 8580 atttgtcctc cagatcgcag caatcgcgcc cctatcttgg cccgcccacc tacttatgca 8640 ggtattcccc ggggtgccat tagtggtttt gtgggcaagt ggtttgaccg cagtggttag 8700 cggggttaca atcagccaag ttattacacc cttattttac agtccaaaac cgcagggcgg 8760 cgtgtggggg ctgacgcgtg cccccactcc acaatttcaa aaaaaagagt ggccacttgt 8820 ctttgtttat gggccccatt ggcgtggagc cccgtttaat tttcgggggt gttagagaca 8880 accagtggag tccgctgctg tcggcgtcca ctctctttcc ccttgttaca aatagagtgt 8940 aacaacatgg ttcacctgtc ttggtccctg cctgggacac atcttaataa ccccagtatc 9000 atattgcact aggattatgt gttgcccata gccataaatt cgtgtgagat ggacatccag 9060 tctttacggc ttgtccccac cccatggatt tctattgtta aagatattca gaatgtttca 9120 ttcctacact agtatttatt gcccaagggg tttgtgaggg ttatattggt gtcatagcac 9180 aatgccacca ctgaaccccc cgtccaaatt ttattctggg ggcgtcacct gaaaccttgt 9240 ttcgagcac ctcacataca ccttactgtt cacaactcag cagttattct attagctaaa 9300 cgaaggagaa tgaagaagca ggcgaagatt caggagagtt cactgcccgc tccttgatct 9360 tcagccactg cccttgtgac taaaatggtt cactaccctc gtggaatcct gaccccatgt 9420 aaataaaacc gtgacagctc atggggtggg agatatcgct gttccttagg acccttttac 9480 taaccctaat tcgatagcat atgcttcccg ttgggtaaca tatgctattg aattagggtt 9540 agtctggata gtatatacta ctacccggga agcatatgct acccgtttag ggttaacaag 9600 ggggccttat aaacactatt gctaatgccc tcttgagggt ccgcttatcg gtagctacac 9660 aggcccctct gattgacgtt ggtgtagcct cccgtagtct tcctgggccc ctgggaggta 9720 catgtcccccc agcattggtg taagagcttc agccaagagt tacacataaa ggcaatgttg 9780 tgttgcagtc cacagactgc aaagtctgct ccaggatgaa agccactcag tgttggcaaa 9840 tgtgcacatc catttataag gatgtcaact acagtcagag aacccctttg tgtttggtcc 9900 ccccccgtgt cacatgtgga acagggccca gttggcaagt tgtaccaacc aactgaaggg 9960 attacatgca ctgccccgcg aagaaggggc agagatgtcg tagtcaggtt tagttcgtcc 10020 ggggcggggc atcgatcctc tagagcgac gctagcggat ccgctgcatt aatgaatcgg 10080 ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 10140 ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 10200 acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 10260 aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 10320 tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 10380 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 10440 gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 10500 acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga 10560 accccccgtt cagcccgacc gctgcgccctt atccggtaac tatcgtcttg agtccaaccc 10620 ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 10680 gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 10740 aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 10800 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 10860 gattacgcgc agaaaaaag gatctcaaga agatcctttg atctttcta cggggtctga 10920 cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 10980 cttcacctag atccttttaa attaaaatg aagtttaaa tcaatctaaa gtatatatga 11040 gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 11100 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 11160 gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 11220 agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 11280 tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 11340 agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 11400 gttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 11460 catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 11520 ggccgcagtg tttcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 11580 atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 11640 tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 11700 cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 11760 cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 11820 atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 11880 aaagggaata agggcgacac ggaaatgttg aatactcata ctcttcctttt ttcaatatta 11940 ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 12000 aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg g 12051 <210> 15 <211> 21 <212> DNA <213> Homo sapiens <400> 15 aaggtcccgg tcaagaaaca g 21 <210> 16 <211> 20 <212> DNA <213> Homo sapiens <400> 16 cttctgcgtc acaccattgc 20 <210> 17 <211> 20 <212> DNA <213> Homo sapiens <400> 17 cccacatgaa gcgacttccc 20 <210> 18 <211> 21 <212> DNA <213> Homo sapiens <400> 18 aggtccagga gatcgttgaa c 21 <210> 19 <211> 20 <212> DNA <213> Homo sapiens <400> 19 tggacagtta cgcgcacatg 20 <210> 20 <211> 21 <212> DNA <213> Homo sapiens <400> 20 gagtaggaca tgctgtaggt g 21 <210> 21 <211> 20 <212> DNA <213> Homo sapiens <400> 21 tgcggccct gctgcagaag 20 <210> 22 <211> 20 <212> DNA <213> Homo sapiens <400> 22 gctgctgggc gatgtggctg 20 <210> 23 <211> 22 <212> DNA <213> Homo sapiens <400> 23 atgcattcaa actgaggtaa gg 22 <210> 24 <211> 22 <212> DNA <213> Homo sapiens <400> 24 tagcgtaaaa ggagcaacat ag <210> 25 <211> 21 <212> DNA <213> Homo sapiens <400> 25 ccatatggta gcctcatgtc c <210> 26 <211> 21 <212> DNA <213> Homo sapiens <400> 26 tcaattctgt gcctccggga g <210> 27 <211> 23 <212> DNA <213> Homo sapiens <400> 27 accacctcgc cttacacatg aag <210> 28 <211> 22 <212> DNA <213> Homo sapiens <400> 28 tagcgtaaaa ggagcaacat ag <210> 29 <211> 21 <212> DNA <213> Homo sapiens <400> 29 ggctgagaag aggatggcta c <210> 30 <211> 21 <212> DNA <213> Homo sapiens <400> 30 agtttgtttg rich c <210> 31 <211> 20 <212> DNA <213> Homo sapiens <400> 31 tcacatgtcc cagcactacc <210> 32 <211> 21 <212> DNA <213> Homo sapiens <400> 32 agtttgtttg rich c <210> 33 <211> 20 <212> DNA <213> Homo sapiens <400> 33 aacccaagac ccaggcctgc <210> 34 <211> 20 <212> DNA <213> Homo sapiens <400> 34 ggtctgctcg caccgtgatg <210> 35 <211> 20 <212> DNA <213> Homo sapiens <400> 35 gaaatggcct aggagagaag <210> 36 <211> 20 <212> DNA <213> Homo sapiens <400> 36 cagccaatgc aacttggacg 20 <210> 37 <211> 24 <212> DNA <213> Homo sapiens <400> 37 cttatgctac gtaaaggagc tggg 24 <210> 38 <211> 24 <212> DNA <213> Homo sapiens <400> 38 ttgtgccaac ccaggtcccg gaag 24 <210> 39 <211> 24 <212> DNA <213> Homo sapiens <400> 39 tatcagatcc taaacagctc gcag 24 <210> 40 <211> 23 <212> DNA <213> Homo sapiens <400> 40 cgtacgcaaa ttaaagtcca gag 23 <210> 41 <211> 23 <212> DNA <213> Homo sapiens <400> 41 actacaacgc ctacgagtcc tac 23 <210> 42 <211> 24 <212> DNA <213> Homo sapiens <400> 42 gttgcaccag aaaagtcaga gttg 24 <210> 43 <211> 24 <212> DNA <213> Homo sapiens <400> 43 atatcccgcc gtgggtgaaa gttc 24 <210> 44 <211> 24 <212> DNA <213> Homo sapiens <400> 44 actcagccat ggactggagc atcc 24 <210> 45 <211> 26 <212> DNA <213> Homo sapiens <400> 45 cctgctcaag ctgactcgac accgtg 26 <210> 46 <211> 25 <212> DNA <213> Homo sapiens <400> 46 ggaaaagctg gccctggggt ggagc 25 <210> 47 <211> 22 <212> DNA <213> Homo sapiens <400> 47 tgctgctcac agggcccgat ac 22 <210> 48 <211> 23 <212> DNA <213> Homo sapiens <400> 48 tcctttcgag ctcagtgcac cac 23 <210> 49 <211> 21 <212> DNA <213> Homo sapiens <400> 49 ctggcgctga gtacgtcgtg g 21 <210> 50 <211> 21 <212> DNA <213> Homo sapiens <400> 50 gcagttggtg gtgcaggagg c 21

Claims

1. In the amniotic membrane stem cells of the umbilical cord, exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, as well as p53-shRNA, are expressed under conditions suitable for reprogramming stem cells, thereby generating induced pluripotent stem cells. A method for producing induced pluripotent stem cells, including [the specified term].

2. The method according to claim 1, wherein the stem cells of the amniotic membrane of the umbilical cord are mesenchymal stem cells of the amniotic membrane of the umbilical cord or epithelial stem cells of the amniotic membrane of the umbilical cord.

3. The method according to claim 1 or 2, wherein the mesenchymal stem of the amniotic membrane of the umbilical cord is a population of mesenchymal stem cells, and at least about 90% or more of the cells in the stem cell population express each of the following markers: CD73, CD90, and CD105.

4. The method according to claim 3, wherein at least about 90% or more of the cells in the mesenchymal stem cell population lack the expression of the following markers: CD34, CD45, and HLA-DR.

5. The method according to claim 3 or 4, wherein at least about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, and about 99% or more of the cells in the mesenchymal stem cell population express CD73, CD90, and CD105 respectively, and lack expression of CD34, CD45, and HLA-DR respectively.

6. The method according to claim 1, wherein exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, and p53-shRNA are provided by one, two, or three vectors, preferably, a first vector encoding proteins OCT3 / 4 and p53-shRNA, a second vector encoding proteins SOX2 and KLF4, and a third vector encoding proteins L-MYC and LIN28.

7. A method according to any one of claims 1 to 6, comprising transfecting stem cells from the amniotic membrane of the umbilical cord to transfer exogenous nucleic acids into the stem cells.

8. The method according to claim 7, comprising subjecting stem cells from the amniotic membrane of the umbilical cord to electroporation to transfer exogenous nucleic acids into the stem cells.

9. The method according to claim 8, wherein mesenchymal stem cells of the amniotic membrane of the umbilical cord are subjected to one pulse of electroporation having a duration of about 15 to 25 ms and a voltage of about 1550 to 1650 V, preferably one pulse of electroporation having a duration of about 20 ms and a voltage of about 1600 V.

10. The ratio of the amount of vector (plasmid) DNA of each vector to the number of amniotic mesenchymal stem cells of the umbilical cord subjected to electroporation is about 1×10 6 about 1.5 μg of plasmid DNA per about 1×10 6 cells of CLMC to about 2.5 μg of DNA per about 1×10 6 cells, such as about 2.5 μg of plasmid DNA : 1×10 6 cells, about 2.25 μg of plasmid DNA : 1×10 6 cells, about 1.8 μg of plasmid DNA : 1×10 6 cells, about 1.7 μg of plasmid DNA : 1×10 6 cells, about 1.6 μg of plasmid DNA : 1×10 6 cells, or preferably about 1.67 : 1×10 6 cells, the method according to claim 9.

11. The method according to claim 8, wherein epithelial stem cells of the amniotic membrane of the umbilical cord are subjected to two pulses of electroporation having a duration of about 25 to 35 ms and a voltage of about 1300 to 1400 V, preferably two pulses of electroporation having a duration of about 30 ms and a voltage of about 1350 V.

12. The ratio of the amount of vector (plasmid) DNA of each vector to the number of epithelial stem cells in the amniotic membrane of umbilical cord cells subjected to electroporation is approximately 1 × 10⁻⁶. 6 Approximately 1.5 μg of DNA per cell is needed for approximately 1 × 10⁻⁶ cells. 6 This ranges from approximately 2.5 μg of DNA per cell, and the ratio is, for example, approximately 1.5 μg of plasmid DNA to 1 × 10⁻¹⁶ 6 One cell, approximately 1.6 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, approximately 1.7 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, approximately 1.8 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, approximately 1.9 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, approximately 2.0 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, approximately 2.5 μg of plasmid DNA: 1 × 10⁻⁶ 6 One cell, preferably about 1.67 μg of plasmid DNA: 1 × 10⁶ 6 The method according to claim 11, wherein the cells are individual cells.

13. The method according to any one of claims 7 to 12, wherein transfected stem cells are cultured in a medium suitable for cell regeneration.

14. The method according to claim 13, wherein the culture medium suitable for cell recovery is a serum-free medium.

15. The method according to claim 13, wherein the culture medium suitable for the restoration of transfected mesenchymal stem cells of the umbilical cord amniotic membrane consists of approximately 85–95% (v / v) of a defined medium and 5–15% (v / v) of fetal bovine serum.

16. The medium according to claim 15, wherein the medium suitable for the restoration of transfected mesenchymal stem cells of the umbilical cord amniotic membrane consists of approximately 90% (v / v) chemically defined medium and approximately 10% (v / v) fetal bovine serum.

17. The culture medium according to claim 14 or 15, comprising approximately 85–95% (v / v) CMRL 1066 and approximately 5–15% (v / v) FBS.

18. The method according to claim 13 or 14, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's modified Eagle medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum).

19. The method according to claim 18, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises mammary epithelial basal medium MCDB 170 at a final concentration of approximately 10–30% (v / v), EpiLife medium at a final concentration of approximately 20–40% (v / v), F12 at a final concentration of approximately 5–15% (v / v), DMEM at a final concentration of approximately 30–45% (v / v), and FBS at a final concentration of approximately 0.1–2% (v / v).

20. The method according to claim 19, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises mammary epithelial basal medium MCDB 170 at a final concentration of approximately 15–25% (v / v), EpiLife medium at a final concentration of approximately 25–35% (v / v), F12 at a final concentration of approximately 7.5–13% (v / v), DMEM at a final concentration of approximately 35–40% (v / v), and FBS at a final concentration of approximately 0.5–1.5% (v / v).

21. The method according to claim 20, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises approximately 20% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 30% (v / v) final concentration of EpiLife medium, approximately 12.5% ​​(v / v) final concentration of F12, approximately 37.5% (v / v) final concentration of DMEM, and approximately 1.0% (v / v) final concentration of FBS.

22. The method according to any one of claims 18 to 21, wherein a culture medium suitable for the restoration of transfected umbilical cord amniotic membrane stem cells is obtained by mixing the following to obtain a final volume of 1000 ml of culture medium: 200 ml of mammary epithelial basal medium MCDB 170, 300 ml of EpiLife medium, 250 ml of DMEM, 250 ml of DMEM / F12, 1% fetal bovine serum.

23. The method according to any one of claims 18 to 22, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises insulin at a final concentration of about 1 to about 7.5 μg / ml.

24. The method according to any one of claims 18 to 24, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises human epidermal growth factor at a final concentration of about 1 to about 15 ng / ml.

25. The method according to any one of claims 18 to 25, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane stem cells further comprises at least one of the following supplements: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3).

26. The method according to claim 25, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises all three: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3).

27. The method according to any one of claims 18 to 26, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells further comprises one or more transforming growth factors (TGFs).

28. The method according to claim 27, wherein the culture medium comprises transforming growth factor β (TGF-β) and / or transforming growth factor α.

29. The method according to any one of claims 18 to 28, wherein the culture medium suitable for the restoration of transfected umbilical cord amniotic stem cells further comprises cholera toxin derived from Vibrio cholerae.

30. The method according to any one of claims 14 to 29, wherein the culture medium suitable for cell recovery contains a compound that suppresses the inflammatory response and enhances cell survival.

31. The method according to claim 30, wherein the compound is a glucocorticoid.

32. The method according to claim 31, wherein the glucocorticoid is selected from the group consisting of prednisolone, methylprednisolone, dexamethasone, betamethasone, corticosterone, and hydrocortisone.

33. The method according to claim 31 or 32, wherein the hydrocortisone concentration is approximately 0.5 μM to approximately 2 μM.

34. The method according to any one of claims 13 to 33, wherein the culture is performed in a coated cell culture vessel, the cell culture vessel is preferably coated with a serum-derived substrate or a serum-free substrate.

35. The method according to any one of claims 9 to 36, wherein the medium suitable for cell recovery is replaced with a mixture of two different cell culture media about 1, 2, or 3 days after transfection, preferably about 2 days after transfection, thereby obtaining induced pluripotent stem cell colonies.

36. The method according to claim 35, wherein two different cell culture media are a medium suitable for cell recovery and a second cell culture medium.

37. The method according to claim 35 or 36, wherein two different cell culture media are mixed in a ratio of about 1:1 (v / v), which is prepared by contacting one volume of a cell recovery-suitable medium with one volume of a second cell culture medium.

38. The method according to claim 36 or 37, wherein the second cell culture medium is a maintenance medium for culturing induced pluripotent stem cells, and the medium is preferably selected from the group consisting of mTeSR1, StemMACS(trademark) iPS-Brew XF, TeSR(trademark)-E8, mTeSR(trademark)Plus, TeSR(trademark)2, mTeSR(trademark)1, Corning(registered trademark) NutriStem(registered trademark) hPSC XF Medium, Essential 8 Medium, StemFlex, StemFit Basic02, and PluriSTEM.

39. The method according to any one of claims 35 to 38, wherein the cell culture medium mixture is replaced with the same cell culture medium mixture within about 3, 4, or 5 days from transfection, preferably within about 4 days from transfection.

40. The method according to any one of claims 35 to 39, wherein the cell culture medium mixture is replaced with a second cell culture medium within about 5, 6, or 7 days from transfection, preferably within about 6 days from transfection.

41. The method according to claim 40, wherein the second cell culture medium is replaced daily, every two days, every three days, preferably every two days.

42. The method according to claim 40 or 41, wherein induced pluripotent stem cell colonies are selected when they reach a size of approximately 0.5 mm to approximately 1.5 mm in diameter, and the selected induced pluripotent stem colonies are transferred to coated cell culture vessels for culture and proliferation.

43. The method according to claim 42, wherein induced pluripotent stem cell colonies are selected under a bright-field microscope.

44. The method according to claim 42 or 43, wherein the cell culture medium is replaced daily or every two days, preferably daily.

45. The method according to claim 43 or 44, wherein the induced pluripotent stem cell colonies are detached from the coated cell culture device when they reach a concentration density of approximately 50%.

46. The method according to claim 45, wherein induced pluripotent stem cell colonies are detached with a reagent selected from the group consisting of a dissociation reagent, a dispase, or an EDTA solution.

47. The method according to claim 45 or 46, wherein the cell population formed from the induced pluripotent stem cell colony is passaged when it reaches a concentration density of approximately 60-90%, preferably 70-80%.

48. The method according to claim 47, wherein a cell population formed from an induced pluripotent stem cell colony is passaged at a ratio of approximately 1:3 (v / v), and the passage at a ratio of approximately 1:3 (v / v) is carried out by dividing approximately 1 volume of dissociated induced pluripotent stem cells into approximately 2 volumes of dissociated induced pluripotent stem cells.

49. The method according to claim 47 or 48, wherein a population of cells formed from an induced pluripotent stem cell colony is dissociated with approximately 0.5 mM EDTA for passage.

50. The method according to claim 48 or 49, wherein a passaged cell population formed from an induced pluripotent stem cell colony is cultured in a culture medium containing a substance that enhances the survival of induced pluripotent stem cells.

51. The method according to claim 50, wherein the substance that enhances the survival of induced pluripotent stem cell colonies is a ROCK inhibitor.

52. A population of induced pluripotent stem cells that can be obtained by the method described in any one of claims 1 to 51.

53. A population of induced pluripotent stem cells obtained by the method described in any one of claims 1 to 51.

54. A pharmaceutical composition comprising induced pluripotent stem cells according to claim 52 or 53.

55. A method for differentiating induced pluripotent stem cells according to claim 52 or 53 into target cells, wherein the induced pluripotent stem cells are differentiated into target cells under conditions suitable for differentiation.

56. The method according to claim 55, wherein the target cells are selected from the group consisting of dopaminergic neurons, oligodendrocytes, hepatocytes, cardiomyocytes, hematopoietic progenitor cells, blood cells, nerve cells, motor neurons, chondrocytes, muscle cells, osteocytes, odontocytes, hair follicle cells, inner ear hair cells, skin cells, melanocytes, immune cells, astrocytes, germ cells, corneal cells, intestinal cells, lung cells, kidney cells, gastric cells, mesenteric cells, and adipocytes.

57. The method according to claim 56, wherein the immune cells are selected from the group consisting of T lymphocytes, B lymphocytes, microglia, and natural killer cells.

58. The method according to claim 56, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into dopaminergic neuronal cells.

59. The method according to claim 56, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into hepatocytes.

60. The method according to claim 56, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into cardiomyocytes.

61. The method according to claim 60, wherein induced pluripotent stem cells are cultured in a medium adapted for the proliferation and differentiation of induced pluripotent stem cells into oligodentrocytes.

62. A pharmaceutical composition comprising differentiated induced pluripotent stem cells obtained by the method described in any one of claims 56 to 61.

63. A pharmaceutical composition according to claim 62, adapted for parenteral administration.

64. A step of administering target cells differentiated from pluripotent stem cells by the method described in any one of claims 56 to 61. A method for treating congenital or acquired degenerative disorders in a subject, including [mention specific method / condition].

65. The method according to claim 64, wherein the disorder is a neurological disorder.

66. The method according to claim 65, wherein the disease is a neurological disorder selected from the group consisting of Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, and Batten's disease.

67. The method according to claim 64, wherein the disorder is liver dysfunction.

68. Extracellular vesicles produced by a population of induced pluripotent stem cells according to claim 52 or 53, or by cells obtained by differentiation of induced pluripotent stem cells according to claim 52 or 53.

69. The extracellular membrane vesicle according to claim 68, wherein the vesicle is an exosome.

70. Use of extracellular membrane vesicles according to claim 68 or 69 as a delivery carrier for therapeutic agents.

71. Cell culture media containing mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbeccoo's modified Eagle medium), F12 (Hamm's F12 medium), and FBS (fetal bovine serum).

72. A cell culture medium according to claim 71, comprising mammary epithelial basal medium MCDB 170 at a final concentration of approximately 10–30% (v / v), EpiLife medium at a final concentration of approximately 20–40% (v / v), F12 at a final concentration of approximately 5–15% (v / v), DMEM at a final concentration of approximately 30–45% (v / v), and FBS at a final concentration of approximately 0.1–2% (v / v).

73. A cell culture medium according to claim 72, comprising mammary epithelial basal medium MCDB 170 at a final concentration of approximately 15–25% (v / v), EpiLife medium at a final concentration of approximately 25–35% (v / v), F12 at a final concentration of approximately 7.5–13% (v / v), DMEM at a final concentration of approximately 35–40% (v / v), and FBS at a final concentration of approximately 0.5–1.5% (v / v).

74. A cell culture medium according to claim 73, comprising approximately 20% (v / v) final concentration of mammary epithelial basal medium MCDB 170, approximately 30% (v / v) final concentration of EpiLife medium, approximately 12.5% ​​(v / v) final concentration of F12, approximately 37.5% (v / v) final concentration of DMEM, and approximately 1.0% (v / v) final concentration of FBS.

75. A cell culture medium according to any one of claims 71 to 74, obtained by mixing the following to obtain a final volume of 1000 ml of culture medium: 200 ml of mammary epithelial basal medium MCDB 170, 300 ml of EpiLife medium, 250 ml of DMEM, 250 ml of DMEM / F12, and 1% fetal bovine serum.

76. A cell culture medium according to any one of claims 71 to 75, comprising insulin at a final concentration of approximately 1 to approximately 7.5 μg / ml.

77. A cell culture medium according to any one of claims 71 to 76, comprising human epidermal growth factor (EGF) at a final concentration of approximately 1 to approximately 15 ng / ml.

78. A cell culture medium according to any one of claims 71 to 77, wherein the medium suitable for the restoration of transfected umbilical cord amniotic membrane epithelial stem cells comprises at least one of the following supplements: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3).

79. The cell culture medium according to claim 78, comprising all three: adenine, hydrocortisone, and 3,3',5-triiodo-L-thyronine sodium salt (T3).

80. A cell culture medium according to claim 79, comprising adenine at a final concentration of approximately 0.05 to approximately 0.1 mM, hydrocortisone at a final concentration of approximately 0.1 to 0.5 μM, and / or 3,3',5-triiodo-L-thyronine sodium salt (T3) at a final concentration of approximately 0.1 to approximately 5 ng / ml.

81. A cell culture medium according to any one of claims 71 to 80, comprising one or more transforming growth factors (TGFs).

82. The cell culture medium according to claim 81, comprising transforming growth factor β1 (TGF-β1) at a final concentration of approximately 0.1 to approximately 5 ng / ml and / or transforming growth factor α (TGF-α) at ​​a final concentration of approximately 1.0 to approximately 10 ng / ml.

83. Approximately 1×10 -11 M ~ approx. 1×10 -10 The culture medium according to any one of claims 71 to 82, comprising a final concentration of M of cholera toxin derived from Vibrio cholerae.

Images