Prime editing guide RNA, prime editing system, and use thereof

Repositioning RTT-PBS to stem loop 2 in pegRNA and optimizing linkers enhances prime editing efficiency and stability, addressing degradation issues and improving editing accuracy and cost-effectiveness.

WO2026092426A1PCT designated stage Publication Date: 2026-05-07WESTLAKE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/130453
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-29
Filing Date
2025-10-28
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current prime editing systems face challenges with low efficiency and stability of pegRNA due to degradation of the RTT-PBS region, leading to reduced editing accuracy and increased complexity and cost, while existing solutions like tevopreQ1 integration and circular RNA approaches have limited success.

Method used

Repositioning the RTT-PBS to an internal stem-loop structure in the pegRNA scaffold, specifically at stem loop 2, and optimizing linker sequences to enhance stability and efficiency without additional components, resulting in a new prime editing guide RNA (npegRNA).

Benefits of technology

The npegRNA significantly improves editing efficiency and stability, reducing degradation and maintaining functional binding to Cas9, thus enhancing the precision and effectiveness of prime editing, especially with RNA or RNP delivery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025130453-FTAPPB-I100001
    Figure PCTCN2025130453-FTAPPB-I100001
  • Figure PCTCN2025130453-FTAPPB-I100002
    Figure PCTCN2025130453-FTAPPB-I100002
  • Figure PCTCN2025130453-FTAPPB-I100003
    Figure PCTCN2025130453-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a prime editing guide RNA (pegRNA), aprime editing (PE) system, and use thereof, pertaining to the technical field of prime editing. The prime editing guide RNA provided herein positions the reverse transcriptase template and primer binding site (RTT-PBS) at the stem loop 2 region of the sgRNA scaffold based on the canonical pegRNA design. This configuration not only effectively mitigates degradation of the RTT-PBS but also increases its binding capability to Cas9. Consequently, this design preserves the efficiency of prime editing without interference.
Need to check novelty before this filing date? Find Prior Art

Description

Prime Editing Guide RNA, Prime Editing System, and Use ThereofTechnical Field

[0001] The invention pertains to the technical field of gene editing, particularly to prime editing. It relates to a prime editing guide RNA, a prime editing system, uses thereof, and a method for gene editing.Background

[0002] In clinical medicine, more than 70,000 disease-associated gene mutations have been identified. Traditional therapeutic means are largely ineffective against the vast majority of genetic diseases. In the face of such significant challenges in the field of human diseases, the demand for precise gene editing technologies has become extremely urgent. Developing highly efficient, precise, multi-functional, and sequence-specific gene editing tools has been a long-standing technical goal in the life sciences field.

[0003] The emergence of CRISPR technology has offered hope for achieving this goal. With the aid of the CRISPR-Cas system, scientists can manipulate the genome. For instance, Cas9 or Cas12 generate DNA double-strand breaks (DSBs) at target sequences specified by small guide RNAs (sgRNAs) , thereby guiding editing of the target DNA [1] . The broken DNA triggers intracellular repair mechanisms, such as non-homologous end joining (NHEJ) or microhomology-mediated end joining (MMEJ) . During the repair process, a spectrum of insertions and deletions (indels) occurs. Most of these indels result in frameshift mutations within the coding sequence target, thereby disrupting the target gene. To achieve specific directional DNA editing, Cas proteins can be used in combination with artificially provided DNA templates. The DNA templates can be introduced into the broken DNA sites through homology-directed repair (HDR) [2] or homology-independent targeted integration (HITI) [3] . However, HDR mainly functions in mitotically active cells, and its occurrence probability is much lower than that of NHEJ. This results in the generation of a large number of indel by-products with incorrect editing, thereby reducing the purity of the precisely corrected editing results. Moreover, HITI cannot control the direction and quantity of the inserted sequences, and undesired indel outcomes often outnumber the precise intended edits. These drawbacks severely limit the application of HDR and HITI in the field of precise gene editing. In addition, DSBs generated by Cas nucleases can also lead to DNA fragment loss, chromosomal translocation, chromatin fragmentation, and activation of p53 in cells. These effects may have irreversible consequences for cells, even leading to cellular carcinogenesis [4-6] . In summary, given the challenges and adverse consequences of Cas nucleases during gene editing, there is a need to develop tools for precise gene editing without generating DSBs.

[0004] In 2016, David R. Liu’s lab made a significant advance by developing a base editing system. This system achieves both transitions and transversions of a single base without generating DSBs and without needing extra DNA as a donor [7, 8] . The base editor works by fusing a deaminase enzyme to a catalytically impaired Cas protein. During the editing, sgRNA targets the base editor to the target sequence in the genomic DNA, forms an R-loop structure with the Cas protein domain in the base editor at the target DNA site and displaces single-stranded DNA, thereby triggering deamination catalyzed by ssDNA (single-stranded DNA) -specific deaminase. Compared with Cas nucleases, base editors have significantly improved efficiency, produce fewer indels, and more importantly, do not significantly cause adverse consequences caused by DSBs [9] . However, because base editors perform deamination within a small window of 4-5 nucleotides, identical bases near the target base may also be unintentionally edited, leading to so-called “bystander editing”

[0010] . In addition, base editors may also produce off-target effects in DNA and RNA [11, 12] . Also, base editors can only achieve the transitions and transversions of a single base, and cannot achieve many other types of DNA editing (such as insertion, deletion, etc. ) . Base editing may still not be a relatively perfect solution.

[0005] Prime editing

[0013] system operates using a fusion of a S. pyogenes (Sp) Cas9 nickase (Cas9n) and a reverse transcriptase (RT) , guided by pegRNA-an extended sgRNA with a 3'extension of the reverse transcriptase template and primer binding site (RTT-PBS) –to direct genomic edits. Prime editing, which works by directly rewriting target DNA, confers superior advantages over base editing and homology-directed repair (HDR) in terms of editing product accuracy, DNA targeting specificity, and flexibility

[0014] . However, early prime editing systems had low and inconsistent efficiency

[0013] . To solve this, researchers have pursued numerous strategies to enhance PE efficiency, with a primary focus on engineering the Cas9n and RT proteins. These efforts include improving their expression levels and ability to enter the cell nucleus, enhancing their binding affinity to the target DNA, and continuously optimizing RT's reverse transcription capability. Some improved versions include PEmax

[0015] , hyPE2

[0016] , ePPE

[0017] , and PE6

[0018] . However, optimizations of Cas9n and RT have so far yielded limited gains in editing efficiency and appear to have reached a bottleneck.

[0006] During prime editing, pegRNA definitely plays a very important role. Reverse transcription template (RTT) is the key part-it carries the blueprint of editing and directly determines what the editing product of DNA. Primer binding site (PBS) is a navigator for prime editing, which pairs with the cutted DNA fragment and precisely locates it to the starting point of reverse transcription. The integrity of the RTT and PBS is essential for the accuracy and efficiency of the prime editing process. However, pegRNA is recognized as a foreign entity by the cell and is particularly vulnerable to degradation by endogenous exonucleases, which severely compromises its intracellular stability and longevity

[0019] . Moreover, the Cas9 enzyme fails to effectively shield the 3’ terminal RTT and PBS regions of the pegRNA, so these parts are easily damaged (Figure 1a)

[0020] . When pegRNA is truncated by endogenous nucleases, the remaining portion containing the complete sgRNA scaffold can no longer function as pegRNA, but still has the ability to bind to Cas9 and the target DNA. These truncated pegRNAs compete with intact pegRNAs for binding to Cas9 and target DNA, thereby reducing the editing efficiency of prime editing (Figure 8)

[0020] .

[0007] Therefore, degradation of the 3’ end of canonical pegRNA is a major factor limiting prime editing. To improve the stability of pegRNA and prevent its degradation, existing technologies primarily involve integrating sequences like tevopreQ1 and xrRNA into the end of pegRNA

[0021] . The most common version is epegRNA with tevopreQ1 integrated into the 3’ end of the pegRNA. These sequences form hairpin structures or tertiary structures that act as protective barriers against exonuclease-mediated degradation at the 3'end of pegRNA. However, the incorporation of these additional parts increases the complexity of the prime editing system, reduce pegRNA’s ability to bind Cas9

[0019] , poses a potential challenge to itsnormal function in cells, and also increases the cost to produce pegRNA by industry. Some researchers have tried separating RTT and PBS from the sgRNA scaffold and putting them in circular RNA to avoid degradation. Unfortunately, this approach has not achieved significant results in improving editing efficiency

[0022] .

[0008] Delivering PE as ribonucleoproteins (RNPs) is considered efficient and safe for genome editing in living organisms because the editing activity is temporary. However, in practice, RNP delivery does not work as well as DNA or mRNA methods in many types of cells. This low efficiency makes it hard to use PE for treating genetic diseases, especially in cell therapy. To solve this problem, there is an urgent need to design a prime editing guide RNA that prevent the degradation of RTT-PBS and greatly improves prime editing efficiency, without adding additional parts or affecting the pegRNA’s function.Summary of the Invention

[0009] In view of one or more of the problems existing in the prior art, afirst aspect of the invention provides a prime editing guide RNA, designated as npegRNA, which comprises or consists of a nucleotide sequence structure represented by the following formula (I) :

[0010] spacer-scaffold1-linker1-RTT-PBS-linker2-scaffold2 (I)

[0011] wherein, in formula (I) :

[0012] spacer represents the target sequence for gene editing;

[0013] scaffold1 comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 6;

[0014] linker1 comprises or consists of GCCAUGNNNN (SEQ ID NO: 10) , wherein NNNN represents a 4-bp sequence extended from the 5'-end of the RTT on the target genomic sequence;

[0015] RTT represents a reverse transcription RNA template sequence;

[0016] PBS represents a primer binding site for DNA binding in prime editing;

[0017] linker2 comprises or consists of NNNNCAUGGC (SEQ ID NO: 11) , wherein NNNN represents a 4-bp sequence extended from the 3'-end of the PBS on the target genomic sequence;

[0018] scaffold2 comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 7.

[0019] In some embodiments, the prime editing guide RNA further comprises a polyU sequence linked to the 3'-end of scaffold2; optionally, the polyU sequence is UUUUUU.

[0020] In a second aspect, the invention provides a prime editor comprising a fusion of a partially inactivated endonuclease Cas9 and a reverse transcriptase, as well as the npegRNA provided in the first aspect of the invention.

[0021] In some embodiments, the endonuclease Cas9 includes but is not limited to H840A, and the reverse transcriptase includes but is not limited to MMLV-RT.

[0022] In a third aspect, the invention further provides a DNA prime editing system comprising a gene encoding the npegRNA provided in the first aspect of the invention, and a gene encoding the fusion mentioned in the second aspect of the invention.

[0023] In a fourth aspect, the invention provides a nucleic acid construct encoding the npegRNA provided in the first aspect of the invention, and optionally further encoding the fusion mentioned in the second aspect of the invention.

[0024] In a fifth aspect, the invention further provides a vector comprising the nucleic acid construct provided in the fourth aspect of the invention.

[0025] In a sixth aspect, the invention further provides a host cell comprising the npegRNA provided in the first aspect of the invention, or the prime editor provided in the second aspect of the invention, or the DNA prime editing system provided in the third aspect of the invention, or the nucleic acid construct provided in the fourth aspect of the invention, or the vector provided in the fifth aspect of the invention.

[0026] In a seventh aspect, the invention provides use of the npegRNA, the prime editor, the DNA prime editing system, the nucleic acid construct, the vector, or the host cell according to the first to sixth aspects of the invention for at least one of the following:

[0027] 1) for editing a genomic sequence of an organism or a biological cell;

[0028] 2) for the preparation of a product for editing a genomic sequence in an organism or a biological cell;

[0029] 3) for improving the efficiency of editing a genomic sequence in an organism or a biological cell;

[0030] 4) for the preparation of a product for improving the efficiency of editing a genomic sequence in an organism or a biological cell.

[0031] In an eighth aspect, the invention provides a method for gene editing, comprising introducing the npegRNA, and / or the prime editor, and / or the DNA prime editing system, and / or the nucleic acid construct, and / or the vector, and / or the host cell according to the first to sixth aspects of the invention into a material to be edited to achieve editing of a target gene.

[0032] Advantages of the Invention

[0033] In canonical pegRNA, the RTT-PBS is located at the tail (3’ end) . This structure makes the RTT-PBS sequence more susceptible to degradation. Furthermore, the resulting “truncated” pegRNA after degradation competes with the intact pegRNA for Cas9n-RT and target DNA, substantially limiting the efficiency of prime editing. In contrast, in the npegRNA provided by the invention, the RTT-PBS is repositioned to the stem-loop2 region. This not only effectively prevents the degradation of RTT-PBS, but also ensures that even if degradation occurs, the degraded npegRNA will no longer have a complete sgRNA structure or the ability to bind to Cas9, thereby avoiding any adverse impact on prime editing efficiency (as shown in Figure 8) . The protective effect of npegRNA on RTT-PBS enhances its function in prime editing and significantly improves the efficiency of prime editing, especially when delivered using RNA or RNP.

[0034] The currently widely used improved epegRNA incorporates tevopreQ1 at the 3'-end of canonical pegRNA, resulting in a more complex structure and increased RNA length. This not only impairs the function of the pegRNA and reduces its binding ability to Cas9, but also increases the synthesis cost of pegRNA. In contrast, the npegRNA provided by the invention enhances the efficiency of prime editing without compromising pegRNA function and its binding ability to Cas9. Moreover, it exhibits a shorter length compared with epegRNA (as shown in Table 1 below) .

[0035] Table1: The length of canonical pegRNA (canonical) 、epegRNA and npegRNA (Taking enhanced green fluorescent protein (EGFR) site as an example)

[0036] Description of the Drawings

[0037] Figure 1. Design of npegRNAs with repositioned RTT-PBS.

[0038] a. Cryo-EM structure of the SpCas9-pegRNA-DNA complex at the initiation stage of prime editing.

[0039] b. Base composition diagram of canonical pegRNA, with red borders indicating the positions of tetraloop and stem loop 2.

[0040] c. Three pegRNAs with different RTT-PBS positions: canonical pegRNA (RTT-PBS at the 3'-extension) , non-canonical npegRNA-1 (RTT-PBS in tetraloop) , and non-canonical npegRNA-2 (RTT-PBS in stem loop 2) .

[0041] d. Schematic diagrams of prime editing (PE) mediated by the three pegRNAs.

[0042] Figure 2. Design variants and editing efficiency comparison of npegRNA-1 and npegRNA-2.

[0043] a. Design diagrams of npegRNA-1 and npegRNA-2, with red boxes indicating the original sgRNA scaffold sequences to be replaced.

[0044] b. Sequences and design diagrams of different versions.

[0045] c. Fluorescence and bright-field images corresponding to d.

[0046] d. Results of editing efficiency comparison using the EGFP 5bp-deletion reporter system for different versions of npegRNA-1 and npegRNA-2, where npegRNA-1.7 and npegRNA-2.7 are optimal for subsequent assays.

[0047] Figure 3. Comparison of editing efficiencies for optimized npegRNAs using diverse GFP reporter systems.

[0048] a. Flow chart of editing using the EGFP reporter system.

[0049] b. Schematic diagrams of EGFP reporter systems with different lengths.

[0050] c. Editing results of EGFP reporter systems with different lengths using canonical pegRNA, npegRNA-1.7, and npegRNA-2.7.

[0051] d. Editing efficiency comparison of pegRNA structures and various prime editing systems using the EGFP 5bp-deletion reporter system.

[0052] e. Editing efficiency comparison of pegRNA structures and various prime editing systems using the EGFP 50bp-replacement reporter system.

[0053] Figure 4. Assessment of npegRNA PE Efficiency at different DNA sites and in various cell lines using plasmid transfection.

[0054] a-b. Editing efficiency comparison between canonical pegRNA and npegRNA-2 at endogenous sites in 293T cells (a) and N2a cells (b) .

[0055] c. Comparison of flag insertion efficiency between canonical pegRNA and npegRNA-2 at SITE1 and FANCF sites in 293T cells.

[0056] d. Editing efficiency comparison between canonical pegRNA and npegRNA-2 at SITE1 and FANCF sites across multiple cell lines.

[0057] e. Off-target efficiency comparison between canonical pegRNA and npegRNA-2 at known off-target sites of SITE1 and FANCF in 293T cells.

[0058] f. Precision editing efficiency comparison among canonical pegRNA, epegRNA, and npegRNA-2.

[0059] Figure 5. Structural prediction of canonical pegRNA and npegRNAs combining with Cas9n-RT and target DNA using AlphaFold3.

[0060] a. canonical pegRNA.

[0061] b. npegRNA-2.

[0062] c. npegRNA-1.

[0063] Figure 6. RIP assay workflow and results analysis for canonical pegRNA and npegRNA-2.

[0064] a. Flow chart of RIP-Seq for canonical pegRNA and npegRNA using Cas9n-RT.

[0065] b. Nucleotide percentage detected by RIP-Seq for canonical pegRNA and npegRNA.

[0066] c. Read statistics from PE2 RIP-Seq for canonical pegRNA and npegRNA.

[0067] d-e. Editing results (e) of the EGFP 5bp-deletion reporter system using Cas9n-RT and in vitro transcribed npegRNA with deleted or extra sequences (d) .

[0068] Figure 7. Enhanced DNA targeting efficiency of Cas9 / npegRNA complex in live cells.

[0069] a. Amodel depicting dCas9-pegRNA RNP binding to Cy5-labeled target DNA, using the canonical pegRNA as an example.

[0070] b. EMSA for DNA binding by dCas9-pegRNA RNP complexes.

[0071] c. Schematic diagram of the telomere fluorescence labeling process.

[0072] d. Representative images of telomere fluorescence labeling using sgRNA and different pegRNA structures.

[0073] e-f. Statistical results of labeling: e. number of fluorescent foci per nucleus; f. total fluorescence intensity of all fluorescent foci per nucleus.

[0074] Figure 8. Illustration of DNA binding during prime editing mediated by canonical pegRNA and npegRNA, wherein npegRNA=npegRNA-2.

[0075] Figure 9. Comparison of canonical pegRNA and npegRNA in correcting the Fah mutation and rescueing the liver disease phenotype in a mouse model of tyrosinemia.

[0076] a. Schematic of mouse injection: hydrodynamic tail vein injection of all-in-one plasmids (Cas9n-RT, nicking sgRNA, and canonical pegRNA / npegRNA) into 6-8-week-old HT1 mice (Fah mutant) , followed by immediate NTBC withdrawal and subsequent liver tissue collection at day 36 post-injection for HTS, RT-PCR, and IHC analysis.

[0077] b. Body weight changes after NTBC withdrawal, normalized to day 0.

[0078] c. Schematic of Fah mutant alternative splicing patterns and RT-PCR results, verified by Sanger sequencing, shown in green (normal) and black (mutant) boxes.

[0079] d. Precise editing sequencing analysis of liver genomic DNA (two mice per group with three liver samples each) .

[0080] e. H&E and FAH IHC staining of mouse liver.

[0081] f. Percentage plot of FAH IHC-positive regions.

[0082] g. Representative editing results of canonical pegRNA and npegRNA.

[0083] Figure 10. npegRNA outperforms canonical pegRNA and epegRNA in PE efficiency with in vitro transcribed pegRNAs.

[0084] a. Experimental flow chart.

[0085] b-c. Editing efficiency of the EGFP 5bp-deletion (b) and EGFP 50bp-replacement (c) reporter system at 72 h post-transfection with different doses.

[0086] d. Editing efficiency of TRAC+5 G to A by pegRNAs at 48h and 72 h post-transfection.

[0087] e. Editing efficiency of FANCF+2 GAT insertion by pegRNAs at 72 h post-transfection.

[0088] Figure 11. npegRNA outperforms canonical pegRNA and epegRNA in PE efficiency with RNA or RNP delivery.

[0089] a. Experimental flow chart.

[0090] b. Schematic of the BFP-EGFP reporter system.

[0091] c. Editing results of the BFP-EGFP system via plasmid / RNA / RNP electroporation, comparing the performance of canonical pegRNA, epegRNA, and npegRNA.

[0092] d. Editing results of the BFP-EGFP system via PEmaxΔRH and PE7 RNP electroporation, comparing the performance of canonical pegRNA, epegRNA, and npegRNA.

[0093] Figure 12. PE RNP-mediated endogenous gene tagging

[0094] a. PE RNP-mediated endogenous gene tagging using the split-GFP system in HEK293T cells stably expressing GFP1-10. This system includes a short GFP11 fragment and a larger GFP1-10 fragment. PE RNP mediates the insertion of GFP11 at the N-terminal end of an endogenous gene’s CDS sequence. Successful GFP11 insertion switches the GFP-off to GFP-on, enabling endogenous protein labeling. b. Efficiency of GFP positive cells through PE-mediated H2BC21 GFP11 (57-bp) insertion with varying doses of pegRNAs, nicking sgRNA, and PE6d RNP, 96 h post-electroporation in HEK293T GFP1-10 cells.

[0095] c. FACS gating examples of GFP positive cells for H2BC21 GFP11 (57-bp) insertion in HEK293T cells stably expressing GFP1-10.

[0096] d. Efficiency of GFP positive cells from PE-mediated LMNB1 GFP11 (60-bp) insertion using PEmaxΔRH, PE6d, and PE7 RNP in HEK293T GFP1-10 cells, 96 h post-electroporation.

[0097] e. Representative fluorescence images from (b and d) . Scale bars, 5μm.

[0098] Figure 13. npegRNA RNP-mediated PE at endogenous sites.

[0099] a-b. PE6d-mediated precise editing and indels at FANCF+2 GAT insertion in HEK293T cells at 48h (a) and 72h (b) post-electroporation with varying RNP dosages.

[0100] Figure 14. npegRNA-mediated PE RNP enhances editing efficiency of efficient editing of disease-relevant loci across various cell types.

[0101] a. Installation of Fanconi Anemia-causing FANCF+2 GAT insertion in HEK293T cells using PE6d and PE7 RNP.

[0102] b. Installation of mutation in T cell receptorαlocus (TRAC+5 G to A) in HEK293T cells using PE6d and PE7 RNP.

[0103] c. Installation of pathogenic A79V mutation (PSEN1+6 G to A) in HEK293T cells using PE6d RNP.

[0104] d. Installation of pathogenic Q29H mutation (RNF2+1 C to G) in HEK293T cells using PE6d RNP.

[0105] e. Installation of mutation in a gene editing hotspot (AAVS1+6 G to C) in HEK293T cells using PE6d RNP.

[0106] f. Installation of Fanconi Anemia-causing FANCF+2 GAT insertion in iPSCs using PE6d RNP.

[0107] g. Installation of mutation in T cell receptorαlocus (TRAC+5 G to A) in Jurkat T cells using PE6d RNP.

[0108] h. Installation of CCR532-bp deletion for enhanced HIV resistance in Jurkat T cells using PE6d RNP.

[0109] Figure 15. In vitro expression and purification of PE6d protein, PE6d mRNA and pegRNAs, and FACS analysis.

[0110] a. Illustration of expression cassettes for PEmaxΔRH, PE6d, and PE7.

[0111] b. PE protein purification yield from E. coli.

[0112] c. SDS-PAGE analysis of PE proteins after purification.

[0113] d. Agarose gel electrophoresis of in vitro transcribed PE6d-mRNA.

[0114] e. Agarose gel electrophoresis of in vitro transcribed sgRNA, canonical pegRNA, epegRNA, npegRNA-1, and npegRNA-2.

[0115] f. Flow cytometry analysis for GFP-positive cell selection.Detailed Description of Embodiments

[0116] The invention aims to provide a prime editing guide RNA (also referred to herein as npegRNA) capable of preventing the degradation of RTT-PBS and significantly improving the efficiency of prime editing, without introducing additional elements or impairing the function of pegRNA. Based on this npegRNA, the invention also provides a prime editing system and a gene editing method. The technical idea of the invention is to optimize the position of RTT-PBS on the sgRNA scaffold, by positioning RTT-PBS on an internal stem-loop that is less susceptible to degradation. Through continuous optimization, the structure achieves optimal efficiency, and its effectiveness is validated using endogenous gene sites and in live gene therapy experiments.

[0117] To make the objectives, technical solutions, and benefits of the embodiments of the invention clearer, the technical solutions in the embodiments of the invention will be described clearly and completely hereinafter. Apparently, the described embodiments are only a part of the embodiments of the invention, rather than all of them. Any other embodiments obtained by those ordinary skilled in the art based on the embodiments of the invention without making creative efforts, shall fall within the protection scope of the invention. Unless stated otherwise, the term "comprise" or variations such as “include” or “contain” throughout the description and claims shall be understood to means the inclusion of the stated elements or components, without excluding other elements or other components.

[0118] In addition, to better illustrate the invention, numerous specific details are provided in the detailed description of embodiments below. Those skilled in the art should understand that the invention can be implemented even without certain specific details. In some embodiments, raw materials, components, methods, and means well-known to those skilled in the art are not described in detail, so as to highlight the main purpose of the invention.

[0119] The methods used in the following examples are conventional methods, unless stated otherwise. Specific steps can be found in "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor) .

[0120] The sources of biological materials described in the examples are provided only to illustrate the way to obtain in the experiment for the purpose of the disclosure and shall not be construed as limiting the sources of biological materials of the invention. Actually, the sources of the biological materials used are extensive, any biological materials that can be obtained without violating laws and and moral ethics can be replaced and used according to the instructions in the examples.

[0121] Some synthetic biological materials involved in the following examples, such as primers and sequences that require artificial synthesis, can be synthesized by existing techniques.

[0122] Tables 2 and 3 list the main experimental instruments, and main reagents, and chemicals used in the following examples. Unless otherwise specified, the reagents or chemicals used in the examples are commercially available.

[0123] Table 2: Main Experimental Instruments

[0124] Table 3: Reagents and Chemicals

[0125] Example 1. Repositioning of RTT-PBS in Prime Editing Guide RNA.

[0126] Through analysis of the existing SpCas9-pegRNA-DNA complex structure

[0020] , two additional unoccupied sites were identified on the sgRNA scaffold (the nucleotide sequence is shown in SEQ ID NO: 1) of canonical pegRNA (comprising spacer, scaffold (i.e., sgRNA scaffold) , RTT, and PBS sequences, with RTT and PBS sequences at the 3'-extension) . These two sites in the scaffold of canonical pegRNA, namely the tetraloop and the stem loop 2 as shown in Figures 1a and 1b, are spatially exposed on the outside of Cas9 and do not interact with the amino acids of Cas9. These sites may serve as ideal candidate sites for RTT-PBS function. Figure 1c illustrates schematics of RTT-PBS placed at the tetraloop and stem loop 2 positions on the scaffold, and Figure 1d shows diagrams of prime editing (PE) mediated by pegRNAs with different structures. The functions of pegRNAs with these various structures were validated in the following examples.

[0127] Example 2. Optimization of Flanking Linkers for Repositioned RTT-PBS in Prime Editing Guide RNA.

[0128] 2.1 Experimental Materials

[0129] 1) Cell line: 293T cells (purchased from the American Type Culture Collection (ATCC) .

[0130] 2) Linker designs:

[0131] - Extended linker (4 bp) : sequences extended from both ends of RTT-PBS on the target genome with a length of 4 bp;

[0132] - Unpaired linker (4 bp) : ACAC~ACAC;

[0133] - Paired linker (6 bp) : GCCAUG~CAUGGC.

[0134] Specifically, in this example, the nucleotide sequence of the extended linker is UGAC~CAGC, and the nucleotide sequence of the RTT-PBS is as shown in SEQ ID NO: 2. The connection order of these linkers and RTT-PBS is: paired linker (GCCAUG) +unpaired linker (ACAC) +extended linker (UGAC) -RTT-PBS-extended linker (CAGC) +unpaired linker (ACAC) + paired linker (CAUGGC) , abbreviated as linker1-RTT-PBS-linker2. For example, Figure 2b exemplarily shows specific combinations of different versions (version. 1 to version. 8) . When linker1-RTT-PBS-linker2 was placed at the tetraloop and stem loop 2 positions on the scaffold of the pegRNA, two groups of pegRNAs were obtained, named npegRNA-1 and npegRNA-2, with the following connection orders:

[0135] npegRNA-1: spacer (SEQ ID NO: 3) -scaffold1 (SEQ ID NO: 4) -linker1-RTT-PBS-linker2-scaffold2 (SEQ ID NO: 5) -polyU (UUUUUU) (the polyU serves as the termination sequence for the hU6 promoter during intracellular expression) ;

[0136] npegRNA-2: spacer (SEQ ID NO: 3) -scaffold1 (SEQ ID NO: 6) -linker1-RTT-PBS-linker2-scaffold2 (SEQ ID NO: 7) -polyU (UUUUUU) .

[0137] 3) Linker combinations: For linker1-RTT-PBS-linker2 in npegRNA-1 and npegRNA-2, linker1 and linker2 simultaneously used one of the following combinations: 0+0+0, 0+4+0, 4+0+0, 4+4+0, 0+0+6, 0+4+6, 4+0+6, and 4+4+6. For example, for the 4+0+6 combination, when it serves as linker1, it indicates the sequential connection of a 4-bp extended linker, a 0-bp unpaired linker (i.e., no unpaired linker) , and a 6-bp paired linker (GCCATG) at the RTT end of RTT-PBS; when it serves as linker2, it indicates the sequential connection of a 4-bp extended linker, a0-bp unpaired linker (i.e., no unpaired linker) , and a 6-bp paired linker (CATGGC) at the PBS end of RTT-PBS. The npegRNA-1 with the 4+0+6 combination was named npegRNA-1.7, and the npegRNA-2 with the 4+0+6 combination was named npegRNA-2.7. Similarly, the numbers and their order in other linker combinations represent the same meaning. The npegRNA-1 and npegRNA-2 with different linker combinations were named accordingly. Thus, the pegRNAs serving as experimental groups in this example specifically included:

[0138] npegRNA-1 (npegRNA-1.1: 0+0+0, npegRNA-1.2: 0+4+0, npegRNA-1.3: 4+0+0, npegRNA-1.4: 4+4+0, npegRNA-1.5: 0+0+6, npegRNA-1.6: 0+4+6, npegRNA-1.7: 4+0+6, or npegRNA-1.8: 4+4+6) , npegRNA-2 (npegRNA-2.1: 0+0+0, npegRNA-2.2: 0+4+0, npegRNA-2.3: 4+0+0, npegRNA-2.4: 4+4+0, npegRNA-2.5: 0+0+6, npegRNA-2.6: 0+4+6, npegRNA-2.7: 4+0+6, or npegRNA-2.8: 4+4+6) .

[0139] 4) Control: canonical pegRNA, which has the RTT-PBS located at its tail, and its nucleotide sequence is shown in SEQ ID NO: 8.

[0140] 5) Target: An EGFP reporter system with an insertion of “tagcc” near the editing site (as shown in Figure 2c) . The reporter system was named EGFP 5bp-deletion reporter system. The objective of this example was to delete this insertion through gene editing to enable cells to express green fluorescent protein.

[0141] 2.2 Experimental Methods and Results

[0142] We constructed pegRNA plasmids by individually cloning pegRNAs with different structures and nicking sgRNA (SEQ ID NO: 9) into expression plasmids (Addgene, #41824) downstream of the hU6 promoter. The Cas9n-RT plasmid was constructed by cloning the Cas9n-RT (afusion of partially inactivated endonuclease Cas9 (e.g., H840A) and a reverse transcriptase (e.g., MMLV-RT) ) into an expression plasmid (Addgene, #132775) downstream of the CMV promoter. In 293T cells, experimental or control pegRNA plasmids, EGFP reporter system plasmids (EGFP 5bp deletion reporter system plasmids) , Cas9n-RT plasmids, and nicking sgRNA plasmids were co-transfected with PEI at a DNA: PEI ratio of 1: 2.5. Cells of each well of a 48-well plate were transfected with 375 ng Cas9n-RT plasmid, 150 ng EGFP reporter system plasmid, 125 ng pegRNA plasmid, and 100 ng nicking sgRNA plasmid. After 72 hours, the proportion of GFP-positive cells in the experimental and control groups was compared by FACS to screen for high-efficiency combinations for further analysis.

[0143] Results are shown in Figures 2c and 2d. Figure 2d shows the statistical results of the proportion of GFP-positive cells in the experimental and control groups, and Figure 2c shows the corresponding fluorescence images and bright-field images of GFP-positive cells in the experimental and control groups in Figure 2d. As shown in the results of Figures 2c and 2d, the average proportion of GFP-positive cells for the canonical pegRNA was approximately 35%. Among the npegRNA-1-based experimental groups, npegRNA-1.7 with the 4+0+6 linker combination had the highest average proportion of GFP-positive cells, approximately 37%. Among the npegRNA-2-based experimental groups, npegRNA-2.7 with the 4+0+6 combination had the highest average proportion of GFP-positive cells, approximately 49%. It can be seen that the 4+0+6 linker combination resulted in a higher average proportion of GFP-positive cells in both npegRNA-1-based and npegRNA-2-based experimental groups. However, npegRNA-2.7 achieved an average proportion of GFP-positive cells of approximately 49%, which was significantly higher than that of the control group and the npegRNA-1.7-based experimental group. These results preliminarily confirm that placing RTT-PBS at the stem loop 2 position of the sgRNA scaffold and using the 4+0+6 linker combination enhances the gene editing efficiency of the resulting prime editing guide RNA (i.e. npegRNA-2.7) .

[0144] Example 3. Further Screening of Repositioned RTT-PBS in Prime Editing Guide RNA.

[0145] 3.1 Experimental Materials

[0146] 1) Cell line: 293T cells.

[0147] 2) Experimental groups: npegRNA-1.7 (hereinafter abbreviated as npegRNA-1) , npegRNA-2.7 (hereinafter abbreviated as npegRNA-2) .

[0148] 3) Control: canonical pegRNA (SEQ ID NO: 8) .

[0149] 4) Targets: EGFP reporter systems, with termination sequences of different lengths (1bp, 2bp, 5bp, 8bp, 12bp, 16bp, 20bp, 50bp) deleted or inserted near the editing site (as shown in Figures 3b and 3e) . The EGFP reporter systems shown in Figure 3b were named EGFP 1bp-insertion, EGFP 2bp-deletion, EGFP 5bp-deletion, EGFP 8bp-deletion, EGFP 12bp-deletion, EGFP 16bp-deletion, and EGFP 20bp-deletion reporter systems according to the length of the deleted or inserted termination sequence. The EGFP reporter system shown in Figure 3e was named EGFP 50bp-replacement reporter system plasmid.

[0150] 3.2 Experimental Methods and Results

[0151] 1) As shown in the experimental flow chart of Figure 3a, in 293T cells, experimental or control pegRNA plasmids, EGFP 5bp-deletion reporter system plasmids, different prime editor plasmids (PE2 (Addgene, #132775) , PEmax (Addgene, #174820) , and PE6d (Addgene, #207854) ) , and nicking sgRNA plasmids were co-transfected with PEI at a DNA: PEI ratio of 1: 2.5. Cells of each well of a 48-well plate were transfected with 375 ng PE3, PEmax, or PE6d plasmid, 150 ng EGFP reporter system plasmid, 125 ng pegRNA plasmid, and 100 ng nicking sgRNA plasmid. After 72 hours, the proportion of GFP-positive cells in the experimental and control groups was compared by FACS.

[0152] The results are shown in Figure 3d. It can be observed that in the EGFP 5bp-deletion reporter system, npegRNA-2 exhibited significantly higher proportions of GFP-positive cells than npegRNA-1 and the control group when used with PE3, PEmax, and PE6d.

[0153] 2) Following the procedure in (1) , the only difference was that the experimental group used npegRNA-2, and the EGFP 5bp-deletion reporter system plasmid was replaced with the EGFP 50bp-replacement reporter system plasmid. After 72 hours of co-transfection, the proportion of GFP-positive cells in the experimental and control groups was compared by FACS.

[0154] The results are shown in Figure 3e. It can be observed that in the EGFP 50bp-replacement reporter system, npegRNA-2 exhibited significantly higher proportions of GFP-positive cells than the control group when used with PE3, PEmax, and PE6d.

[0155] 3) In 293T cells, experimental or control pegRNA plasmids, each EGFP reporter system plasmid shown in Figure 3b, Cas9n-RT plasmids, and nicking sgRNA plasmids (constructed in Example 2) were co-transfected with PEI at a DNA: PEI ratio of 1: 2.5. Cells of each well of a 48-well plate were transfected with 375 ng Cas9n-RT plasmid, 150 ng EGFP reporter system plasmid, 125 ng pegRNA plasmid, and 100 ng nicking sgRNA plasmid. After 72 hours, the proportion of GFP-positive cells in each experimental group and the control group were compared by FACS.

[0156] The results are shown in Figure 3c. It can be observed that in EGFP reporter systems with different lengths, the proportion of GFP-positive cells in the npegRNA-2 group was higher than that in the control canonical pegRNA group, while the npegRNA-1 group showed lower proportions of GFP-positive cells than the control group.

[0157] In summary, these results confirm that npegRNA-2 significantly improves gene editing efficiency. It can be defined as a non-canonical prime editing guide RNA (npegRNA) improved by reverse transcription template repositioning, which is constructed by placing RTT-PBS at the stem loop 2 position of the sgRNA scaffold and using the 4+0+6 linker combination. Therefore, its structure is represented by the following formula (I) :

[0158] spacer-scaffold1-linker1-RTT-PBS-linker2-scaffold2 (I)

[0159] Wherein in formula (I) :

[0160] spacer is generally 20 nt in length, and is determined by the specific editing site, referring to the guide sequence on pegRNA (i.e., the target sequence for gene editing) .

[0161] scaffold1 may comprise or consist of the nucleotide sequence set forth in SEQ ID NO: 6.

[0162] linker1 may have the sequence of GCCAUGNNNN (SEQ ID NO: 10) , where NNNN represents a 4-bp extended linker, which is a 4-bp sequence extended from the 5'-end of the RTT on the target genomic sequence, and N may be selected from A, G, C, or U.

[0163] RTT-PBS refers to the reverse transcription RNA template (RTT) and the primer binding site (PBS) for DNA binding on the pegRNA, both of which are determined by the specific editing site. The RTT sequence determines the sequence of the edited product; the PBS sequence serves as the primer for reverse transcription and is homologous to the spacer.

[0164] linker2 may have the sequence of NNNNCAUGGC (SEQ ID NO: 11) , wherein NNNN represents a 4-bp extended linker, which is a 4-bp sequence extended from the 3'-end of PBS on the target genomic sequence, and N may be selected from A, G, C, or U.

[0165] scaffold2 may comprise or consist of the nucleotide sequence set forth in SEQ ID NO: 7.

[0166] For convenience, apolyU sequence (UUUUUU) may be linked to the 3'-terminus of the npegRNA represented by formula (I) , serving as the termination sequence for the hU6 promoter during endogenous expression.

[0167] Example 4. Comparison of npegRNA-2, canonical pegRNA, and epegRNA at Endogenous Loci.

[0168] 4.1 Experimental Materials

[0169] 1) Cell lines: 293T, N2a, Hela, K562, RPE, and U2OS cells (all purchased from ATCC) .

[0170] 2) Experimental group: npegRNA-2.

[0171] 3) Controls: canonical pegRNA, epegRNA.

[0172] 4) Target sites: RNP+6 G to T, SITE1+5 G to A, TRAC+5 G to A, FANCF+2 CCTGG to TCACA, FANCF+2 GAT insertion, Pcsk9+1 CTC to GAG, Ctnnb1+4 GGA deletion, FANCF+1 flag insertion, SITE1+1 flag insertion.

[0173] Specifically, the nucleotide sequences of pegRNA and nicking sgRNA used in the experimental and control groups for different targets in this example are listed in Table 4 below.

[0174] Table 4

[0175] 4.2 Experimental Methods and Results

[0176] In 293T cells, experimental or control pegRNA plasmids, Cas9n-RT plasmids (constructed in Example 2) , and nicking sgRNA plasmids were co-transfected with PEI at a DNA: PEI ratio of 1: 2.5. Cells of each well of a 48-well plate were transfected with 375 ng Cas9n-RT plasmid, 125 ng pegRNA plasmid, and 100 ng nicking sgRNA plasmid. After 72 hours, editing efficiency was analyzed by high-throughput sequencing (HTS) .

[0177] Editing efficiency was detected in the following cell lines:

[0178] 293T cells: PRNP+6 G to T, SITE1+5 G to A, TRAC+5 G to A, FANCF+2 CCTGG to TCACA, FANCF+2 GAT insertion, FANCF+1 flag insertion, SITE1+1 flag insertion.

[0179] N2a cells: Pcsk9+1 CTC to GAG, Ctnnb1+4 GGA deletion.

[0180] Hela, K562, RPE, U2OS cells: SITE1+5 G to A, FANCF+2 GAT insertion.

[0181] Off-target sites in 293T cells: Known off-targets of SITE1+5 G to A and FANCF+2 GAT insertion. Genomic DNA was extracted after 72 hours. The target sites were amplified through two rounds of PCR (the first round amplified the target sequence, and the second round added adaptors for HTS) followed by HTS. Editing efficiency was calculated based on sequencing results.

[0182] The results are shown in Figure 4, npegRNA-2 demonstrated higher editing efficiency than pegRNA across different loci and different cell lines (as shown in Figure 4a-d) . The analysis of off-target editing efficiency at SITE1 and FANCF loci revealed that npegRNA-2 did not exhibit more off-target effects than canonical pegRNA (as shown in Figure 4e) . Compared with epegRNA, npegRNA-2 showed similar editing efficiency at the FANCF+2 GAT insertion locus, but higher editing efficiency at the FANCF+1 flag insertion locus (as shown in Figure 4f) .

[0183] Example 5. Structural prediction of Cas9n-RT, various pegRNAs, and DNA.

[0184] 1) Site Selection: EGFP reporter systems with a “tagcc” insertion near the editing site, i.e. the EGFP 5bp-deletion reporter system.

[0185] 2) various pegRNAs for prediction: canonical pegRNA, npegRNA-1, and npegRNA-2.

[0186] 3) Prediction software: AlphaFold3 (https:  / / alphafoldserver. com / ) .

[0187] The DNA was divided into three single strands (DNA1, DNA2, and DNA3, wherein DNA1 is the Target strand, and DNA2 and DNA3 are Non-target strands) . During structure prediction, the three DNA strands and the amino acid sequence of Cas9n-RT were submitted to the alphafold3 structural prediction website with canonical pegRNA, npegRNA-1, and npegRNA-2, respectively. The prediction structures with high credibility feedback from the website were used for analysis.

[0188] Specifically, the three DNA strands used in this example include DNA1 (Target strand, SEQ ID NO: 41) , DNA2 (Non-target strand 1, SEQ ID NO: 42) , and DNA3 (Non-target strand 2, SEQ ID NO: 43) . The nucleotide sequences of canonical pegRNA, npegRNA-1, and npegRNA-2 are as shown in SEQ ID NO: 44 to SEQ ID NO: 46, respectively.

[0189] The prediction results are shown in Figure 5. Similar to canonical pegRNA (Figure 5a) , npegRNA-2 (Figure 5b) can be recognized by Cas9n-RT and bind to the target DNA. The spacer sequence on npegRNA-2 binds to the target strand, and the PBS can accurately bind to the non-target strand and combine with RT to prepare for the subsequent reverse transcription process. In contrast, for npegRNA-1 (Figure 5c) , the binding of its PBS to the non-target strand conflicts with the stability of the double-stranded DNA, which may reduce the efficiency of base editing.

[0190] Example 6. Comparison of Protection Ability of Cas9n-RT to canonical pegRNA and npegRNA-2

[0191] 6.1 Experimental Materials

[0192] 1) Cell line: 293T cells.

[0193] 2) Experimental groups: canonical pegRNA (SEQ ID NO: 24) , npegRNA-2 (SEQ ID NO: 26) .

[0194] 3) Target: FANCF+2 GAT insertion.

[0195] 6.2 Experimental Methods and Results

[0196] Based on the Cas9n-RT plasmid constructed in Example 2, an HA tag was added to the N-terminus of Cas9n-RT, and the resulting plasmid was designated as the HA-Cas9n-RT plasmid. Each 10-cm dish of 293T cells was transfected with 10μg of the HA-Cas9n-RT plasmid and 5μg of an individual pegRNA plasmid selected from the various pegRNAs. After 30 hours, RNPs (CRISPR / protein complexes (Ribonucleoprotein complexes, RNPs) bound to different pegRNAs were enriched by anti-HA antibody-conjugated magnetic beads. RNA was then purified, and adaptors for high-throughput sequencing were connected to both ends of the RNA, followed by reverse transcription, PCR amplification and high-throughput sequencing. The integrity of different pegRNAs was analyzed by comparing the sequencing results. The experimental process is shown in Figure 6a.

[0197] The results demonstrated that npegRNA-2 bound to Cas9n-RT exhibited higher integrity, whereas the RTT-PBS region in canonical pegRNA showed significant degradation (Figure 6b, c) . In addition, it was found that a part of npegRNA-2 bound to Cas9n-RT lacked three nucleotides. In order to evaluate the impact of this deletion on function, aGFP editing experiment was carried out using an in vitro transcribed variant of npegRNA-2 (Figure 6d) ; the results showed that npegRNA-2 with three nucleotides deleted still retained its function and did not significantly reduce the editing efficiency (Figure 6e) . This finding confirms the reliability of our RIP (RNA Binding Protein Immunoprecipitation) experiment and further highlights that npegRNA-2 has more robust structure and function compared with canonical pegRNA.

[0198] Example 7. Comparison of Target DNA Binding Ability of Cas9n-RT with canonical pegRNA, epegRNA, and npegRNA-2

[0199] 7.1 Experimental Materials

[0200] Experimental groups: canonical pegRNA (SEQ ID NO: 24) , epegRNA (SEQ ID NO: 25) , npegRNA-2 (SEQ ID NO: 26) (abbreviated as npegRNA in this example, i.e., npegRNA=npegRNA-2) .

[0201] 7.2 Experimental Methods and Results

[0202] We performed electrophoretic mobility shift assay (EMSA) experiments by incubating a Cy5-labeled dsDNA (synthesized by Youkang Biotech) substrate with pre-incubated RNP complexes of dCas9 and either canonical pegRNA, npegRNA, or epegRNA (Figure 7a and 7b) . The dCas9 protein was purified internally following established protocols. Cy5-labeled DNAs were dissolved in duplex buffer (IDT, 11-01-02-02) and annealed by heating to 95℃for 5 minutes, followed by a gradual cooldown to 25℃ at a rate of 0.1℃ / s. RNPs were formed by mixing dCas9 with a 10-fold molar excess of in vitro transcribed canonical pegRNA, epegRNA, or npegRNA in duplex buffer at room temperature for 10 minutes. DNA was then added to achieve a final concentration of 20 nM, and the mixture was incubated at 37℃ for 45 minutes. The binding results were analyzed using 1%agarose gel electrophoresis in TBE buffer with 5 mM MgCl2.

[0203] The dCas9-npegRNA complex, wherein the npegRNA integrates RTT-PBS into stem loop 2 of sgRNA, demonstrated a binding capability to dsDNA comparable to that of dCas9-canonical pegRNA (Figure 7b) . In contrast, in line with a previous report

[0012] , dCas9-epegRNA displayed a lower binding ability to the dsDNA substrate.

[0204] Example 8. Comparison of Telomere Imaging Capability of npegRNA and pegRNA with Other Structures.

[0205] 8.1 Experimental Materials

[0206] 1) Cell line: U2OS cells.

[0207] 2) Experimental groups: canonical pegRNA (SEQ ID NO: 47) , epegRNA (SEQ ID NO: 48) , npegRNA-1 (SEQ ID NO: 49) , npegRNA-2 (SEQ ID NO: 50) (abbreviated as npegRNA in this example, i.e., npegRNA=npegRNA-2) .

[0208] 3) Control: sgRNA (SEQ ID NO: 51) .

[0209] 4) Target: Telomere (>100 copies) .

[0210] 8.2 Experimental Methods and Results

[0211] U2OS cells were co-transfected with plasmids of experimental group pegRNA or the control group sgRNA, along with the dCas9-mCherry plasmid (addgene, #108570) , using PEI at a DNA: PEI ratio of 1: 2.5. Cells of each well of a 24-well plate were transfected with 500 ng dCas9-mCherry plasmid and 300 ng experimental group pegRNA or control group sgRNA plasmid. After 16 hours, the nuclei were imaged by confocal microscope, and the number of telomeric foci and the fluorescence intensity per nucleus were counted. The experimental process is shown in Figure 7c.

[0212] Through imaging and statistical analysis, atrend was identified: compared with the sgRNA alone, the addition of RTT-PBS to sgRNA resulted in a reduction in both the number of fluorescently labeled telomeric foci and the overall fluorescence intensity per nucleus. However, among these pegRNAs, the reduction in fluorescently labeled telomeric foci and overall fluorescence intensity observed in the npegRNA-2 group was the smallest (as shown in Figure 7d-f) . This observation indicates that the structural design of npegRNA-2 reduces the negative impact of introducing RTT-PBS on the targeting ability of canonical pegRNA.

[0213] Example 9. Comparison of Gene Editing Efficiency Between canonical pegRNA and npegRNA-2 (Abbreviated as npegRNA in This Example, i.e., npegRNA=npegRNA-2) in In Vivo Therapy.

[0214] 9.1 Experimental Materials

[0215] 1) Mouse Strain: Fah- / -mice

[0023] . Mice were housed at the Experimental Animal Center of Westlake University. All experiments strictly followed the"Guidelines for the Care and Use of Laboratory Animals"of Westlake University and were approved by the Institutional Animal Care and Use Committee (IACUC) of Westlake University.

[0216] The Fah gene encodes fumarylacetoacetate hydrolase, akey enzyme in tyrosine metabolism. Mutations in Fah gene cause hereditary tyrosinemia type I (HT1) , altering mRNA splicing patterns (Figure 9c) , leading to functional deficiency of the enzyme, impaired tyrosine metabolism, and accumulation of toxic byproducts. Ultimately, this metabolic defect manifests at the organismal level as hepatomegaly, hepatocyte necrosis, liver fibrosis, cirrhosis, and even hepatocellular carcinoma. While a low-tyrosine diet combined with NTBC inhibitor therapy can partially alleviate symptoms, it reduces patients’ quality of life and increases cancer risk. Fortunately, hepatocytes possess a unique regenerative capacity. In theory, repairing even a small portion of hepatocytes could potentially cure the disease, providing a strong rationale for gene therapy.

[0217] 2) Experimental Groups:

[0218] canonical pegRNA (SEQ ID NO: 52) .

[0219] npegRNA (SEQ ID NO: 53) .

[0220] 3) Target: Point mutation in the Fah gene.

[0221] 9.2 Experimental Methods and Results

[0222] 1) Plasmid Construction: First, canonical pegRNA or npegRNA, along with nicking sgRNA (SEQ ID NO: 54) were cloned into the Cas9n-RT expression plasmid (constructed in Example 2) . The resulting plasmids were named PE3 (canonical pegRNA+nicking sgRNA +Cas9n-RT) and nPE3 (npegRNA+nicking sgRNA+Cas9n-RT) .

[0223] 2) In Vivo Delivery: These plasmids (50μg / mouse) were delivered to mouse livers via hydrodynamic tail vein injection (Figure 9a) . NTBC was withdrawn immediately after injection, and mouse body weight was monitored continuously.

[0224] 3) Analysis: After 36 days, when a significant recovery in mouse body weight was observed, liver tissues were collected for DNA / RNA extraction. High-throughput sequencing was performed on the target region to assess editing efficiency, and reverse transcription PCR was performed on mRNA to detect the alternative splicing patterns (primers: TTCTACTCTTCTCGGCAGCA (SEQ ID NO: 55) and CGGGGAGATTGTGGTTCCAA (SEQ ID NO: 56) ) . Additionally, liver tissues were subjected to histological analysis (H&E and FAH-IHC staining) .

[0225] The results showed that mice in the npegRNA treatment group (nPE3) exhibited faster body weight recovery (Figure 9b) . Analysis of targeted sequencing and reverse transcription PCR revealed that compared with the mice in the canonical pegRNA group, mice in the npegRNA group had a higher repair rate of the Fah gene (Figure 9d and 9g; up to 9.78%for canonical pegRNA vs. 16.09%for npegRNA) and significantly increased levels of correctly spliced mRNA (Figure 9c) . Furthermore, the results of H&E and FAH-IHC also showed that the liver repair effect of the mice in the npegRNA group (nPE3) was better (Figure 9e and 9f) . In summary, our gene therapy approach using npegRNA has demonstrated encouraging results, offering a potential breakthrough for the treatment of hereditary tyrosinemia type I.

[0226] Example 10. Comparison of RNA-Delivered canonical pegRNA and npegRNA-2 (Abbreviated as npegRNA in this example)

[0227] 10.1 Experimental Materials

[0228] 1) Cell Line: 293T reporter cells for EGFP reporter experiments.

[0229] To generate 293T reporter cells for EGFP reporter experiments, two individual lentiviruses were produced, each carrying genes for a disrupted EGFP reporter with either a 5-bp deletion or a 50-bp replacement. 293T cells were then infected separately with these lentiviruses and selected with Puromycin to obtain the stable cell lines expressing the respective reporters.

[0230] 2) Experimental Groups:

[0231] For the EGFP 5-bp deletion reporter system, canonical pegRNA (SEQ ID NO: 57) , epegRNA (SEQ ID NO: 58) and npegRNA (SEQ ID NO: 59) were used; For the EGFP 50-bp replacement reporter system, canonical pegRNA (SEQ ID NO: 90) , epegRNA (SEQ ID NO: 91) and npegRNA (SEQ ID NO: 92) were used;

[0232] For the TRAC+5 G to A and FANCF+2 GAT insertion sites, the nucleotide sequences of canonical pegRNAs, epegRNAs and npegRNAs were as described in Table 4) .

[0233] 3) Targets:

[0234] EGFP reporter systems (5bp-deletion and 50bp-replacement) .

[0235] Endogenous loci: TRAC+5 G to A, FANCF+2 GAT insertion.

[0236] 10.2 Experimental Methods and Results

[0237] The required canonical pegRNA, epegRNA npegRNA, and nicking sgRNA plasmids were obtained according to the aforementioned Examples 2-4. In RNA comparison experiments, we first transfected 293T reporter cells (with a 5-bp deletion, or with a 50-bp replacement) with the 375 ng of Cas9n-RT plasmid using PEI (Step 1) . Twelve hours later, canonical pegRNA / epegRNA / npegRNA plasmids and nicking sgRNA plasmids were transfected using Lipofectamine 3000 (Step2) . The respective amounts of plasmids transfected per well of a 48-well plate were as follows: 35 ng, 100 ng, 350 ng, 1000 ng of canonical pegRNA / epegRNA / npegRNA; 10 ng, 30 ng, 100 ng, 300 ng of nicking sgRNA (Figures 10a) . Editing efficiency was assessed by FACS (GFP+) and HTS at 24-, 48-, and 72-hours post RNA transfection.

[0238] Analysis of GFP-positive cell proportions and high-throughput sequencing results across different groups (Figures 10b-e) revealed that npegRNA significantly enhanced prime editing efficiency over both canonical pegRNA and epegRNA. These findings indicate that npegRNA-mediated prime editing holds greater application value in low-dose or transient editing scenarios.

[0239] Example 11. Comparison of canonical pegRNA, epegRNA, and npegRNA Delivered via RNP.

[0240] 11.1 Experimental Materials

[0241] 1) Cell Lines: 293T reporter cells, iPSCs, Jurkat T cells (purchased from ATCC) .

[0242] The generation of stable 293T cell lines (293T reporter cells) expressing either the BFP or GFP1-10 reporter was performed using respective lentiviruses, following a procedure analogous to that in Example 10.

[0243] 2) Experimental Groups: canonical pegRNA, epegRNA, npegRNA-2 (abbreviated as npegRNA in this example) .

[0244] Targets: EGFP reporter systems (BFP-EGFP, EGFP 5bp-deletion reporter system and EGFP 50bp-replacement reporter system) . H2BC21-57 bp insertion, LMNB1-60 bp insertion, CCR532 bp deletion, FANCF+5 G to T, PRNP+6 G to T, PSEN1+6 G to A, RNF2+1 C to G, AAVS1+6 G to C.

[0245] Specifically, the nucleotide sequences of canonical pegRNA, epegRNA, npegRNA and nicking sgRNA used in the experimental groups for different targets in this example are listed in Table 5 below (Note: Since RNA was used throughout this example rather than plasmids, the RNA sequences are provided) .

[0246] Table 5

[0247] 11.2 Experimental Methods and Results

[0248] First, stable cell lines were constructed by lentiviral infection, including the BFP-GFP system (Figure 11 b) , EGFP 5bp-deletion reporter system, EGFP 50bp-replacement reporter system, and GFP1-10 system

[0024] . The required pegRNAs, nicking sgRNA, and PE6d-mRNA were obtained using an in vitro transcription kit (Figure 15d, e) , and a PCR step was first performed to append a T7 promoter sequence (CTAATACGACTCACTATAGG) upstream of the spacer sequence and a terminal-TTTT sequence downstream of all pegRNAs. PEmaxΔRH, PE6d, and PE7 proteins were obtained by prokaryotic expression in E. coli (strain BL21) and purification via a Ni column (Figure 15c) . For electroporation experiments, 50, 000 cells were transfected using the NeonTM Transfection System 10μL kit (ThermoFisher, MPK5000S) according to the manufacturer's instructions (Figure 11a) . For plasmid transfection, acombination of 375 ng PE6d plasmid, 125 ng pegRNA plasmid, and 100 ng nicking sgRNA plasmid was used (plasmids were obtained according to Examples 2 and 3) . For RNA transfection, 1μg PE6d mRNA, 60 pmol pegRNA, and 10 pmol nicking sgRNA were used. For RNP transfection, 30 pmol PE6d protein was mixed with 60 pmol pegRNA and 10 pmol nicking sgRNA in Buffer R, incubated at room temperature for 10 minutes, and then transfected. Electroporation conditions were as follows: 1, 150 V for 20 ms with 2 pulses for 293T cells; 1, 100 V for 20 ms with 2 pulses for iPSCs; and 1, 700 V for 20 ms with 1 pulse for Jurkat T cells. After electroporation, cells were cultured in preheated 48-well or 96-well plates and incubated for 72 hours before editing efficiency was detected by FACS or high-throughput sequencing.

[0249] The results showed that for the BFP-GFP reporter system, there was no difference in the editing efficiency when using plasmids to deliver canonical pegRNA, epegRNA, and npegRNA. When using RNA and RNP delivery, the editing efficiency of canonical pegRNA and epegRNA decreased significantly, while the editing efficiency of the npegRNA group increased significantly (Figure 11c) . Similar results were observed with PEmaxΔRH and PE7 RNP (Figure. 11d) . npegRNA also perform high editing efficiency than canonical pegRNA and epegRNA with EGFP 5bp-deletion reporter system, EGFP 50bp-replacement reporter system (Figure 11e, f) .

[0250] For the H2BC21 gene (encoding a nuclear localization protein) and the LMNB1 gene (encoding a nucleolar localization protein) , we used the 293T-GFP1-10 stable cell line and used RNP to deliver canonical pegRNA, epegRNA, and npegRNA to insert GFP11 into these two genes (neither GFP11 nor GFP1-10 emits fluorescence signals alone, but their fusion produces a fluorescence signal) . After 72 hours, FACS was performed to count the number of GFP-positive cells, and the GFP-positive cells were isolated, and photographed using a confocal microscope (Figure 12a) . The results showed that compared with canonical pegRNA and epegRNA, npegRNA had a higher endogenous protein labeling efficiency, as shown in Figure 12b-e.

[0251] In addition, we also performed RNP delivery of pegRNA editing on 293T cells, iPSCs, and Jurkat T cells. The results are shown in Figure 13 and 14, indicating that npegRNA delivered by RNP has higher editing efficiency than canonical pegRNA and epegRNA in 293T cells, iPSCs, and Jurkat T cells. These results suggest that npegRNA-mediated prime editing has more application value in low-dose or transient editing scenarios.

[0252] Finally, it should be noted that the above are only the preferred embodiments of the invention and are not intended to limit the invention. Although the invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the invention shall be included in the protection scope of the invention.

[0253] References:

[0254] 1. Pickar-Oliver, A. and C.A. Gersbach, The next generation of CRISPR-Cas technologies and applications. Nat Rev Mol Cell Biol, 2019. 20 (8) : p. 490-507.

[0255] 2. Heyer, W.D., K.T. Ehmsen, and J. Liu, Regulation of homologous recombination in eukaryotes. Annu Rev Genet, 2010. 44: p. 113-39.

[0256] 3. Suzuki, K., et al., In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 2016. 540 (7631) : p. 144-149.

[0257] 4. Enache, O.M., et al., Cas9 activates the p53 pathway and selects for p53-inactivating mutations. Nat Genet, 2020. 52 (7) : p. 662-668.

[0258] 5. Leibowitz, M.L., et al., Chromothripsis as an on-target consequence of CRISPR-Cas9 genome editing. Nat Genet, 2021. 53 (6) : p. 895-905.

[0259] 6. Cullot, G., et al., CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations. Nat Commun, 2019. 10 (1) : p. 1136.

[0260] 7. Gaudelli, N.M., et al., Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature, 2017. 551 (7681) : p. 464-471.

[0261] 8. Komor, A.C., et al., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature, 2016. 533 (7603) : p. 420-4.

[0262] 9. Song, Y., et al., Large-Fragment Deletions Induced by Cas9 Cleavage while Not in the BEs System. Mol Ther Nucleic Acids, 2020. 21: p. 523-526.

[0263] 10. Rees, H.A. and D.R. Liu, Base editing: precision chemistry on the genome and transcriptome ofliving cells. Nat Rev Genet, 2018. 19 (12) : p. 770-788.

[0264] 11. Jin, S. et al. Cytosine, but Not Adenine, Base Editors Induce Genome-Wide off-Target Mutations in Rice. Science vol. 364 https:  / / www. science. org (2019) .

[0265] 12. Grunewald, J., et al., Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Nature, 2019. 569 (7756) : p. 433-437.

[0266] 13. Anzalone, A.V., et al., Search-and-replace genome editing without double-strand breaks or donor DNA. Nature, 2019. 576 (7785) : p. 149-157.

[0267] 14. Chen, P.J. and D.R. Liu, Prime editing for precise and highly versatile genome manipulation. Nat Rev Genet, 2023. 24 (3) : p. 161-177.

[0268] 15. Chen, P.J., et al., Enhanced prime editing systems by manipulating cellular determinants of editing outcomes. Cell, 2021. 184 (22) : p. 5635-5652 e29.

[0269] 16. Song, M., et al., Generation of a more efficient prime editor 2 by addition of the Rad51 DNA-binding domain. Nat Commun, 2021. 12 (1) : p. 5617.

[0270] 17. Zong, Y., et al., An engineered prime editor with enhanced editing efficiency in plants. Nat Biotechnol, 2022. 40 (9) : p. 1394-1402.

[0271] 18. Doman, J.L., et al., Phage-assisted evolution and protein engineering yield compact, efficient prime editors. Cell, 2023. 186 (18) : p. 3983-4002 e26.

[0272] 19. Nelson, J.W., et al., Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol, 2022. 40 (3) : p. 402-410.

[0273] 20. Shuto, Y., et al., Structural basis for pegRNA-guided reverse transcription by a prime editor. Nature, 2024. 631 (8019) : p. 224-231.

[0274] 21. Zhang, G., et al., Enhancement of prime editing via xrRNA motif-joined pegRNA. Nat Commun, 2022. 13 (1) : p. 1856.

[0275] 22. Liu, B., et al., A split prime editor with untethered reverse transcriptase and circular RNA template. Nat Biotechnol, 2022. 40 (9) : p. 1388-1393.

[0276] 23. Paulk, N.K., et al., Adeno-associated virus gene repair corrects a mouse model of hereditary tyrosinemia in vivo. Hepatology, 2010. 51 (4) : p. 1200-8.

[0277] 24. Xu, H., et al., TriTag: an integrative tool to correlate chromatin dynamics and gene expression in living cells. Nucleic Acids Res, 2020. 48 (22) : p. 13013-13014.

Claims

1.A prime editing guide RNA (npegRNA) , wherein said npegRNA comprises or consists of a nucleotide sequence structure represented by the following formula (I) :spacer-scaffold1-linker1-RTT-PBS-linker2-scaffold2 (I)wherein in formula (I) :spacer represents a target sequence for gene editing;scaffold1 comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 6;linker1 comprises or consists of GCCAUGNNNN (SEQ ID NO: 10) , wherein NNNN represents a 4-bp sequence extended from the 5'-end of the reverse transcriptase template (RTT) on the target genomic sequence;RTT represents a reverse transcription RNA template sequence;PBS represents a primer binding site for binding DNA;linker2 comprises or consists of NNNNCAUGGC (SEQ ID NO: 11) , wherein NNNN represents a 4-bp sequence extended from the 3'-end of the PBS on the target genomic sequence;scaffold2 comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 7.2.The npegRNA according to claim 1, further comprising a polyU sequence linked to the 3'-end of scaffold2; optionally, said polyU sequence is UUUUUU.3.A prime editor, comprising a fusion of a partially inactivated endonuclease Cas9 and a reverse transcriptase, and the npegRNA according to claim 1 or 2.4.The prime editor according to claim 3, wherein said endonuclease Cas9 includes H840A, and said reverse transcriptase includes MMLV-RT.5.A DNA prime editing system, comprising a gene encoding the npegRNA according to claim 1 or 2, and a gene encoding the fusion according to claim 3 or 4.6.A nucleic acid construct, encoding the npegRNA according to claim 1 or 2, and optionally further encoding the fusion according to claim 3 or 4.7.A vector, comprising the nucleic acid construct according to claim 6.8.A host cell, comprising the npegRNA according to claim 1 or 2, the prime editor according to claim 3 or 4, the DNA prime editing system according to claim 5, the nucleic acid construct according to claim 6, or the vector according to claim 7.9.Use of the npegRNA according to claim 1 or 2, the prime editor according to claim 3 or 4, the DNA prime editing system according to claim 5, the nucleic acid construct according to claim 6, the vector according to claim 7, or the host cell according to claim 8, for at least one of the following:1) for editing a genomic sequence of an organism or a biological cell;2) for the preparation of a product for editing a genomic sequence in an organism or a biological cell;3) for improving the efficiency of editing a genomic sequence in an organism or a biological cell;4) for the preparation of a product for improving the efficiency of editing a genomic sequence in an organism or a biological cell.10.A method for gene editing, comprising introducing the npegRNA according to claim 1 or 2, the prime editor according to claim 3 or 4, the DNA prime editing system according to claim 5, the nucleic acid construct according to claim 6, the vector according to claim 7, and / or the host cell according to claim 8 into a material to be edited to achieve editing of a target gene.