Mutant m-MLV reverse transcriptase
A mutant M-MLV reverse transcriptase with C-helix/loop and C-terminus deletions, along with N-terminal modifications, addresses efficiency and stability issues, improving nucleic acid amplification by enhancing activity and reducing RNase H activity on complex templates.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SEEGENE INC
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-25
AI Technical Summary
Existing reverse transcriptases, such as those derived from Moloney Murine Leukemia Virus (M-MLV) and Avian Myeloblastosis Virus (AMV), suffer from reduced synthesis efficiency for RNA templates with complex structures, storage instability, and are prone to inhibition by nucleic acid extraction inhibitors, necessitating improvements in thermal stability and RNase H activity.
A mutant M-MLV reverse transcriptase is developed with deletions in the C-helix/loop and C-terminus regions, combined with N-terminal deletions and/or a SUMO tag, and specific amino acid substitutions to enhance enzyme activity, stability, and reduce RNase H activity.
The mutant M-MLV reverse transcriptase exhibits increased activity, stability, and solubility, with improved performance on difficult templates and reduced RNase H activity, enhancing the efficiency and reliability of nucleic acid amplification processes.
Smart Images

Figure KR2025021913_25062026_PF_FP_ABST
Abstract
Description
Mutant M-MLV reverse transcriptase
[0001] Cross-reference regarding related applications
[0002] This application claims priority to Korean Patent Application No. 10-2024-0191251, filed with the Korean Intellectual Property Office on December 19, 2024, and Korean Patent Application No. 10-2025-0009934, filed with the Korean Intellectual Property Office on January 23, 2025, the entire disclosure of which is incorporated herein by reference.
[0003] Technology field
[0004] The present disclosure relates to a mutant M-MLV reverse transcriptase with improved enzyme activity.
[0005]
[0006] Molecular diagnostics is currently a rapidly growing field within the in vitro diagnostics market for the early diagnosis of diseases. Among these, nucleic acid-based methods are being effectively used to diagnose causative genetic factors associated with viral and bacterial infections due to their high specificity and sensitivity.
[0007] Most nucleic acid-based diagnostic methods involve a method of amplifying target nucleic acids (e.g., viral or bacterial nucleic acids). As a representative example, the polymerase chain reaction (PCR) involves a repeated cycle of denaturation of double-stranded DNA, annealing of oligonucleotide primers into a DNA template, and primer extension by DNA polymerase (Mullis et al., U.S. Patents No. 4,683,195, 4,683,202 and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).
[0008] Various other methods for amplifying nucleic acids have been proposed, such as LCR (Ligase Chain Reaction), SDA (Strand Displacement Amplification), NASBA (Nucleic Acid Sequence-Based Amplification), TMA (Transcription Mediated Amplification), and RCA (Rolling-Circle Amplification).
[0009] Recently, as Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has become a global epidemic, real-time reverse transcription-polymerase chain reaction (RT-PCR) diagnostic kits for detecting SARS-CoV-2 have been gaining significant attention.
[0010] The reverse transcription-polymerase chain reaction is a method of synthesizing cDNA from RNA by reverse transcription and amplifying DNA fragments using the synthesized cDNA as a template. Reverse transcription is essential for detecting RNA viruses, and details thereof are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Acids Res. 16:10366 (1988).
[0011] The use of reverse transcriptase is essential for reverse transcription reactions, and reverse transcriptase derived from Moloney Murine Leukemia Virus (M-MLV) and Avian Myeloblastosis Virus (AMV) is widely used. AMV-derived reverse transcriptase is useful for templates with complex secondary structures because it is stable at a relatively high reaction temperature (42°C), but it has the disadvantage of reduced synthesis efficiency due to strong RNase H activity. M-MLV-derived reverse transcriptase has relatively low RNase H activity, making it useful for synthesizing long cDNA, but it has the problem of reduced synthesis efficiency for RNA templates with complex structures due to the low reaction temperature (37°C).
[0012] Meanwhile, reverse transcriptase generally has lower storage stability compared to other reagents included in RT-PCR diagnostic kits, raising concerns that it may shorten the shelf life of the real-time RT-PCR kit. Additionally, there is a concern that reverse transcriptase may inhibit the amplification reaction due to its influence from inhibitors derived from the nucleic acid extraction process.
[0013] In order to overcome the aforementioned problems, research is actively being conducted to improve the characteristics of reverse transcriptase (e.g., reduction of RNase H activity, improvement of thermal stability, etc.) by introducing mutations into the reverse transcriptase. U.S. Patents No. 5,017,492, No. 5,244,797, No. 5,405,776, No. 5,668,005 and No. 6,063,608 disclose the introduction of D524G, E562Q, and D583N amino acid substitutions to eliminate RNase H activity. U.S. Patent No. 8,753,845 discloses a method for increasing thermal stability and / or fidelity by introducing mutations to L52, Y64, R116, Y133, K152 Q190, T197, H204, V223, M289, T306 and / or F309 of M-MLV reverse transcriptase.
[0014] Despite these studies, the development of more improved reverse transcriptases is still necessary.
[0015]
[0016] Throughout this specification, numerous cited literature and patent literature are referenced and their citations are indicated. The disclosures of the cited literature and patents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.
[0017]
[0018] The inventors have made diligent research efforts to develop an M-MLV reverse transcriptase with improved reverse transcriptase activity. As a result, it was confirmed that the activity of the reverse transcriptase is improved by deleting the C-helix / loop region and / or the C-terminus of the M-MLV reverse transcriptase. Furthermore, it was confirmed that by including additional mutations along with this deletion, such as N-terminal deletion, insertion of a SUMO tag, and / or one or more amino acid substitutions at positions selected from the group consisting of P51, L52, Y64, K152, H204, N249, M289, T306, D524, E562, K571, D583, and T664, the fidelity and / or thermal stability of the M-MLV reverse transcriptase can be increased, RNase H activity can be reduced (or deleted), and the ability to reverse transcribe for difficult templates can be improved.
[0019]
[0020] Accordingly, the object of the present disclosure is to provide a mutant M-MLV reverse transcriptase having a deletion of the C-helix / loop region and / or the C-terminus.
[0021] Another object of the present disclosure is to provide a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase.
[0022] Another object of the present disclosure is to provide an expression vector comprising a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase and a sequence of a promoter operably linked thereto.
[0023] Another object of the present disclosure is to provide a host cell transformed with an expression vector comprising a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase and a sequence of a promoter operably linked thereto.
[0024] Another object of the present disclosure is to provide a method for reverse transcribing target RNA in a sample into cDNA using the aforementioned mutant M-MLV reverse transcriptase.
[0025]
[0026] Other objects and advantages of the present disclosure will become more apparent from the following detailed description together with the appended claims.
[0027]
[0028] According to one aspect of the present disclosure, a mutant M-MLV reverse transcriptase is provided having an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, a C-helix / loop region deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1, a C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1, or a C-helix / loop region deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1.
[0029]
[0030] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has increased reverse transcriptase activity compared to SEQ ID NO: 1.
[0031] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase additionally comprises at least one amino acid substitution at a position selected from the group consisting of proline 51 (P51), leucine 52 (L52), tyrosine 64 (Y64), lysine 152 (K152), histidine 204 (H204), methionine 289 (M289) and threonine 306 (T306) of SEQ ID NO: 1.
[0032] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has increased fidelity and / or thermostability compared to SEQ ID NO: 1.
[0033] According to one embodiment of the present disclosure, the amino acid substitution is selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, M289L, and T306K.
[0034] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase additionally comprises at least one amino acid substitution at a position selected from the group consisting of aspartic acid 524 (D524), glutamic acid 562 (E562), lysine 571 (K571), aspartic acid 583 (D583) and threonine 664 (T664) of SEQ ID NO: 1.
[0035] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has reduced RNase H activity compared to SEQ ID NO: 1.
[0036] According to one embodiment of the present disclosure, the amino acid substitution is selected from the group consisting of D524G, E562Q, K571R, D583N, and T664N.
[0037] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase additionally comprises an amino acid substitution at the position corresponding to asparagine 249 (N249) of SEQ ID NO: 1.
[0038] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has increased reverse transcription ability for a difficult template compared to SEQ ID NO: 1.
[0039] According to one embodiment of the present disclosure, the amino acid substitution is N249D.
[0040] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase further comprises an N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO: 1.
[0041] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has increased solubility compared to SEQ ID NO: 1.
[0042] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase additionally comprises an N-terminal SUMO tag.
[0043] According to one embodiment of the present disclosure, the N-terminal SUMO tag comprises the amino acid sequence of SEQ ID NO: 13.
[0044] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has increased solubility compared to SEQ ID NO: 1.
[0045] According to another aspect of the present disclosure, a mutant M-MLV reverse transcriptase is provided that comprises an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, and has the following:
[0046] (i) N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO: 1;
[0047] (ii) Deletion of at least 11 consecutive amino acids in the C-helix / loop region corresponding to amino acids 593 to 603 of SEQ ID NO: 1;
[0048] (iii) C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1; and
[0049] (iv) At least three amino acid substitutions at positions selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, N249D, M289L, T306K, D524G, E562Q, K571R, D583N and T664N of SEQ ID NO: 1.
[0050] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase additionally comprises an N-terminal SUMO tag.
[0051] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase has (i) increased reverse transcriptase activity, (ii) increased fidelity and / or thermal stability, (iii) decreased RNase H activity, (iv) increased reverse transcription ability for difficult templates and / or (v) increased solubility compared to SEQ ID NO: 1.
[0052] According to one embodiment of the present disclosure, the mutant M-MLV reverse transcriptase comprises the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11.
[0053]
[0054] The mutant M-MLV reverse transcriptase according to the present disclosure has a deletion of at least 11 consecutive amino acids in the C-helix / loop region corresponding to amino acids 593 to 603 of SEQ ID NO: 1, a deletion of at least 5 consecutive amino acids in the C-terminal region corresponding to amino acids 673 to 677 of SEQ ID NO: 1, or a deletion of at least 11 consecutive amino acids in the C-helix / loop region corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a deletion of at least 5 consecutive amino acids in the C-terminal region corresponding to amino acids 673 to 677 of SEQ ID NO: 1. Such deletion of the C-helix / loop region and / or the C-terminal deletion increases reverse transcriptase activity relative to SEQ ID NO: 1. The mutant M-MLV reverse transcriptase according to the present disclosure may have increased solubility and improved storage stability by further including an N-terminal deletion and / or SUMO tag of SEQ ID NO: 1, and may have improved (i) fidelity and / or thermal stability by further including at least three amino acid substitutions at positions selected from the group consisting of P51, L52, Y64, K152, H204, N249, M289, T306, D524, E562, K571, D583 and T664 of SEQ ID NO: 1, thereby improving (i) fidelity and / or thermal stability, (ii) reducing or deleting RNase H activity, and / or (iii) improving reverse transcription ability for difficult templates.
[0055]
[0056] Figure 1 shows the SDS-PAGE results of Example 1-2.
[0057] Figure 2 shows the SDS-PAGE results of Example 2-2.
[0058] Figures 3a to 3i show the results of fluorescence values (y-axis) versus reaction time (x-axis) according to the reaction between the reference reverse transcriptase and EvaEZ reagent at different concentrations conducted at 50°C in Example 3-1. Figures 3a to 3i are the results for sets 1 to 9, respectively.
[0059] Figures 4a to 4c show the results of fluorescence values (y-axis) versus reaction time (x-axis) according to the reaction between the reference reverse transcriptase and EvaEZ reagent at different concentrations conducted at 60°C in Example 3-1. Figures 4a to 4c are the results for sets 1 to 3, respectively.
[0060] Figure 5 shows the derivative of [time]-[fluorescence value] by primary analysis of one set of Example 3-1 conducted at 50°C.
[0061] Figure 6 shows the derivative of [time]-[fluorescence value] by primary analysis of two sets of Example 3-1 conducted at 50°C.
[0062] Figure 7 shows the derivative of [time]-[fluorescence value] by primary analysis of 3 sets of Example 3-1 conducted at 50°C.
[0063] Figure 8 shows the derivative of [time]-[fluorescence value] by primary analysis of 4 sets of Example 3-1 conducted at 50°C.
[0064] Figure 9 shows the derivative of [time]-[fluorescence value] by primary analysis of 5 sets of Example 3-1 conducted at 50°C.
[0065] Figure 10 shows the derivative of [time]-[fluorescence value] by primary analysis of 6 sets of Example 3-1 conducted at 50°C.
[0066] Figure 11 shows the derivative of [time]-[fluorescence value] by primary analysis of 7 sets of Example 3-1 conducted at 50°C.
[0067] Figure 12 shows the derivative of [time]-[fluorescence value] by primary analysis of 8 sets of Example 3-1 conducted at 50°C.
[0068] Figure 13 shows the derivative of [time]-[fluorescence value] by primary analysis of 9 sets of Example 3-1 conducted at 50°C.
[0069] Figure 14 shows the derivative of [time]-[fluorescence value] by primary analysis of one set of Example 3-1 conducted at 60°C.
[0070] Figure 15 shows the derivative of [time]-[fluorescence value] by primary analysis of two sets of Example 3-1 conducted at 60°C.
[0071] Figure 16 shows the derivative of [time]-[fluorescence value] by primary analysis of 3 sets of Example 3-1 conducted at 60°C.
[0072] Figure 17 shows the derivative of [enzyme concentration]-[time-fluorescence value derivative] by secondary analysis conducted at 50°C in Example 3-1.
[0073] Figure 18 shows the derivative of [enzyme concentration]-[time-fluorescence value derivative] by secondary analysis conducted at 60°C in Example 3-1.
[0074] Figure 19 shows the results of measuring the intrinsic activity of the mutant M-MLV reverse transcriptase (1) of Example 3-2.
[0075] Figure 20 shows the results of measuring the intrinsic activity of the mutant M-MLV reverse transcriptase (2) of Example 3-3.
[0076]
[0077] The inventors have made diligent research efforts to develop an M-MLV reverse transcriptase with improved reverse transcriptase activity. As a result, it was confirmed that the activity of the reverse transcriptase is improved by deleting the C-helix / loop region and / or the C-terminus of the M-MLV reverse transcriptase. Furthermore, it was confirmed that by including additional mutations along with this deletion, such as N-terminal deletion, insertion of a SUMO tag, and / or one or more amino acid substitutions at positions selected from the group consisting of P51, L52, Y64, K152, H204, N249, M289, T306, D524, E562, K571, D583, and T664, the fidelity and / or thermal stability of the M-MLV reverse transcriptase can be increased, RNase H activity can be reduced (or deleted), and the ability to reverse transcribe for difficult templates can be improved.
[0078]
[0079] In one embodiment, the present disclosure provides a mutant M-MLV reverse transcriptase comprising an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, a C-helix / loop region deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1, a C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1, or a C-helix / loop region deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1.
[0080]
[0081] In describing the components of the present disclosure, terms such as first, second, A, B, (a), (b), (i), (ii), etc., may be used. These terms are used merely to distinguish the components from other components, and the nature, order, or sequence of the components is not limited by the terms used.
[0082]
[0083] As used herein, the term “reverse transcriptase (RTase)” refers to a protein, polypeptide, or polypeptide fragment exhibiting reverse transcriptase activity.
[0084] The terms "wild-type" and "mutant" as used herein are terms of the art that can be understood by those skilled in the art. First, "wild-type" may refer to the standard form of a gene or protein that exists in a natural state in an organism; for example, a wild-type enzyme is a form of natural enzyme found in most members of a related species. Meanwhile, "mutant" refers to a modified form of a gene or protein that has characteristics different from the wild-type, including mutations or modifications at the gene or protein level compared to the wild-type.
[0085] In the present invention, the wild-type Moloney murine leukemia virus (M-MLV) reverse transcriptase refers to the reverse transcriptase that exists naturally in M-MLV, and as can be identified in GenBank Accession no. AAC82568.2, it consists of 677 amino acids (Sequence No. 1). Additionally, the nucleotide sequence encoding the 677 amino acid sequence consists of 2,031 nucleotides (Sequence No. 2).
[0086] In the same invention, a mutant M-MLV reverse transcriptase refers to an M-MLV reverse transcriptase comprising one or more mutations relative to the wild-type M-MLV reverse transcriptase (e.g., substitution, insertion, or deletion of amino acid(s)) to improve the function of the wild-type M-MLV reverse transcriptase. In particular, the mutant M-MLV reverse transcriptase according to the present disclosure has a deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1, a deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1, or a deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1.
[0087] As used herein, the term “variation” may refer to a nucleotide variation or an amino acid variation. “Nucleotide variation” may refer to a change in the nucleotide sequence with respect to a reference sequence (e.g., wild-type sequence or first identified sequence, etc.) (e.g., insertion, deletion, inversion, or substitution of one or more nucleotides, e.g., a change in a single nucleotide polymorphism (SNP)), and “amino acid variation” may refer to a change within the amino acid sequence with respect to the reference sequence (e.g., insertion, substitution, or deletion of one or more amino acids, e.g., an internal deletion or an N- or C-terminal cleavage).
[0088] As used in this specification, the term “amino acid substitution” means replacing an amino acid at a specific position in a reference sequence with another amino acid. For example, D524G indicates that the 524th amino acid D in the reference sequence is replaced with G. Additionally, “amino acid deletion” means removing an amino acid at a specific position in the reference sequence, and “amino acid insertion” means adding an amino acid at a specific position in the reference sequence.
[0089] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has a deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1. The mutant M-MLV reverse transcriptase according to the present disclosure may further enhance enzyme properties by combining the deletion of the C-helix / loop region with known mutations to improve enzyme properties. In a specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 3, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 3.
[0090] Eleven consecutive amino acids corresponding to 593 to 603 of wild-type M-MLV reverse transcriptase (i.e., SEQ ID NO: 1) exist within the RNase H domain as a C-helix / loop region (David et al., JOURNAL OF VIROLOGY, Vol 80, No. 17, 8379-8389, 2006). The C-helix contains positively charged amino acids necessary for interaction with nucleic acids and plays an important role in substrate binding and RNase H activity, while the loop region is known to have a flexible structure that increases substrate binding specificity and contributes to interactions with the substrate and surrounding molecules. This flexible structure imparts the property that a specific protein can be easily modified depending on environmental changes or binding conditions, thereby increasing the potential for protein aggregation or modification. Furthermore, this flexible structure can act as a cause for the protein to fail to fold properly or lose its function. Accordingly, the inventors experimentally confirmed that by removing the C-helix and the loop region having a flexible structure, which play an important role in RNase H activity, the RNase H activity can be reduced, and the enzyme stability and consequently enzyme activity (especially activity at high temperatures) can be increased. That is, the deletion of the C-helix / loop region increases reverse transcriptase activity compared to the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1.
[0091] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has a C-terminal deletion of at least five consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1. The mutant M-MLV reverse transcriptase according to the present disclosure may further enhance enzyme properties by combining the C-terminal deletion with known mutations to improve enzyme properties. In a specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 4, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 4.
[0092] The C-terminus of wild-type M-MLV reverse transcriptase possesses a flexible structure that does not contribute to enzyme activity. As previously mentioned, this flexible structure imparts the property that specific proteins can be easily modified depending on environmental changes or binding conditions, thereby increasing the potential for protein aggregation or modification. Furthermore, this flexible structure can cause proteins to fail to fold properly or lose their function. Accordingly, the inventors have experimentally confirmed that by removing the C-terminus, which destabilizes the protein without contributing to enzyme activity, the stability of the enzyme and the resulting enzyme activity can be increased.
[0093] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has a C-helix / loop region deletion of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1. The mutant M-MLV reverse transcriptase according to the present disclosure may further enhance enzyme properties by combining the C-helix / loop region and the C-terminal deletion with known mutations to improve enzyme properties. In a specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 5, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 5.
[0094] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has reverse transcriptase activity increased by 1.1 to 5 times or more than that of the wild-type M-MLV reverse transcriptase. More specifically, the mutant M-MLV reverse transcriptase according to the present disclosure has reverse transcriptase activity increased by 1.1 times or more, 1.2 times or more, 1.3 times or more, 1.4 times or more, 1.5 times or more, 1.6 times or more, 1.7 times or more, 1.8 times or more, 1.9 times or more, 2 times or more, 3 times or more, 4 times or more, or 5 times or more than that of the wild-type M-MLV reverse transcriptase.
[0095] In one embodiment, the activity of the reverse transcriptase can be measured using various known methods. As a representative method, the activity of the reverse transcriptase can be measured by determining how quickly the reverse transcriptase consumes nucleoside triphosphate as a substrate to polymerize nucleic acids, and this can be defined as a unit, which is an intrinsic property of the reverse transcriptase. For example, methods for measuring the enzyme unit based on radioisotopes, methods for measuring the enzyme unit through changes in the fluorescence value of single-stranded proteins (Mark A. Griep, Anal. Biochem., 1995, 232, 180-189.), and methods for measuring the enzyme unit using a fluorescent dye that binds to DNA and emits strong fluorescence (H Tveit, T Kristensen, Anal. Biochem., 2001, 289, 96-98.) can be equally applied to the reverse transcriptase. As another method for measuring reverse transcriptase activity, a method (WO2024-177304) can be applied to evaluate the state of the enzyme (activity and / or purity) by determining the dilution factor at which the specific activity of the polymerase exhibits a substantially constant value.
[0096] According to the aforementioned literature, “specific activity” refers to the ability of reverse transcriptase to synthesize cDNA from template RNA per unit mass. This is expressed as the amount of dNTPs consumed per minute in μmols per mg of enzyme. Specific activity can be used to measure the quality and performance of reverse transcriptase. For example, higher specific activity means that a large amount of cDNA can be accurately synthesized with a small amount of enzyme.
[0097] According to experiments by the inventors, it was experimentally confirmed that the presence or absence of deletion in the C-helix / loop region and / or deletion in the C-terminus can reduce RNase H activity and, consequently, increase enzyme stability and enzyme activity (particularly activity at high temperatures). Specifically, at 50°C, the intrinsic reverse transcriptase activity of the enzyme with a deleted C-terminus increased by 1.31 times compared to the enzyme without deletion, and the intrinsic reverse transcriptase activity of the enzyme with deletion in both the C-helix / loop region and the C-terminus increased by 1.48 times compared to the enzyme without deletion (see Example 3).
[0098] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise a mutation that increases solubility. For example, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise an N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO: 1, together with a C-helix / loop region and / or a C-terminal deletion.
[0099] The N-terminus of wild-type M-MLV reverse transcriptase has a disordered structure. Proteins with such disordered structures may exist in a state prone to non-specific binding to other molecules or aggregation, which can negatively affect the stability or solubility of the protein. Therefore, removing the disordered N-terminus can increase the solubility of the protein (DEBANU DAS et al., Protein Science, 10:1936-1941, 2001).
[0100] In a specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 6, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 6. In another specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 7, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 7. In another specific embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure comprises the amino acid sequence of SEQ ID NO: 8, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with respect to SEQ ID NO: 8.
[0101] As used herein, the term "identity" means an exact correspondence of amino acid to amino acid or nucleotide to nucleotide between two polypeptide sequences or two nucleotide sequences. The identity between two sequences may be determined by algorithms widely known in the art. For example, the comparison of two sequences may generally be performed by comparing the sequences after optimal alignment with respect to a segment or window of comparison to identify local regions of the sequences. Optimal alignment for comparison can be performed by a local homology algorithm (Smith and Waterman, 1981, Ads App. Math. 2, 482), a similarity search algorithm (Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444), or a computer program using the said algorithm (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group), or by visual observation.
[0102] The percentage of identity between the two sequences can be determined using the BLASTN algorithm (Altschul et al. (1977) Nucl. Acids Res.25:3389~3402) or the BLASTP algorithm (Altschul et al. (1990) J.Mol.Biol.215:403~410) available on the National Center for Biotechnology Information (NCBI) website. For example, the expression “having at least 95% identity with respect to amino acids 24 through 672 of SEQ ID NO: 1” means that the mutant M-MLV reverse transcriptase according to the present disclosure has at least 95% identity based on a total of 649 amino acid sequences from the 24th amino acid to the 672nd amino acid of SEQ ID NO: 1.
[0103] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure may have a SUMO (Small ubiquitin-like modifier) tag inserted at its N-terminus. Since the SUMO tag possesses both hydrophobic and hydrophilic properties, the protein with the added SUMO tag folds more stably in a hydrophilic environment and can prevent non-specific aggregation. In particular, the SUMO tag can play a role in inducing the protein to be highly soluble in water because it facilitates the interaction between polar groups and hydrophobic regions on the protein surface (Butt et al., Protein Expression and Purification, 43(1):1-9, 2005). Therefore, the mutant M-MLV reverse transcriptase according to the present disclosure may have increased solubility by additionally including an N-terminal SUMO tag. In one embodiment, the SUMO tag comprises the amino acid sequence of SEQ ID NO: 13.
[0104] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has solubility 1.1 to 10 times higher than that of the wild-type M-MLV reverse transcriptase. Specifically, the mutant M-MLV reverse transcriptase according to the present disclosure has solubility 1.1 times or more, 1.2 times or more, 1.3 times or more, 1.4 times or more, 1.5 times or more, 1.6 times or more, 1.7 times or more, 1.8 times or more, 1.9 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, or 10 times or more higher than that of the wild-type M-MLV reverse transcriptase.
[0105] As described above, the mutant M-MLV reverse transcriptase according to the present disclosure may have further enhanced enzyme properties by including a combination of known mutations to improve enzyme properties, such as a C-helix / loop region and / or a C-terminal deletion. Accordingly, the mutant M-MLV reverse transcriptase according to the present disclosure may comprise an amino acid sequence having at least 90% identity with respect to amino acids 24 to 672 of the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1. Specifically, the mutant M-MLV reverse transcriptase comprises an amino acid sequence having at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to amino acids 24 to 672 of the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1.
[0106] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise a variation that increases fidelity and / or thermal stability. For example, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise one or more amino acid substitutions at a position selected from the group consisting of P51, L52, Y64, K152, H204, M289, and T306 of the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1. Specifically, said amino acid substitutions may be selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, M289L, and T306K.
[0107] The term “fidelity” as used herein refers to the ability of a reverse transcriptase to accurately replicate a desired template RNA, that is, the ability of a reverse transcriptase to accurately perform cDNA synthesis in a reverse transcription reaction. The fidelity of a reverse transcriptase can be evaluated by determining the frequency of incorporation of incorrect nucleotides into the synthesized cDNA molecule, which can be referred to as the enzyme’s error rate. A reverse transcriptase with high fidelity has a very low frequency of incorporation of incorrect nucleotides, and the resulting cDNA has high complementarity with the template RNA. Consequently, the error rate of the reverse transcriptase is low during the synthesis process. There is no difference between the terms “fidelity” and “accuracy,” and these terms may be used interchangeably.
[0108] The term “thermal stability” as used herein refers to the ability of an enzyme to maintain its activity at a temperature at which its activity can be measured after exposure to high temperatures (e.g., 37°C for wild-type M-MLV reverse transcriptase). Thermal stability means the ability to withstand exposure to high temperatures, but does not necessarily mean that it will be active at high temperatures.
[0109] In one embodiment, the thermal stability of the reverse transcriptase may be determined by its half-life. As used herein, the term “half-life” refers to the time it takes for an enzyme to lose 50% of its activity under specific conditions. Since a longer half-life allows the enzyme to maintain activity for a longer period under those conditions, the half-life is an important factor in ensuring the stability and reliability of the enzyme.
[0110] In one embodiment, the thermal stability of the reverse transcriptase can be determined by the residual activity after heat treatment.
[0111] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has residual activity that is 1.1 times or more, 1.2 times or more, 1.3 times or more, 1.4 times or more, 1.5 times or more, 1.6 times or more, 1.7 times or more, 1.8 times or more, 1.9 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, or 6 times or more higher than that of the wild-type M-MLV reverse transcriptase.
[0112] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise a mutation that reduces (or deletes) RNase H activity. For example, the mutant M-MLV reverse transcriptase according to the present disclosure may further comprise one or more amino acid substitutions at a position selected from the group consisting of D524, E562, K571, D583, and T664 of the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1. Specifically, said amino acid substitutions may be selected from the group consisting of D524G, E562Q, K571R, D583N, and T664N.
[0113] As used herein, the term “RNase H activity” refers to the enzymatic activity of hydrolyzing RNA in RNA / DNA hybrids. Most (wild-type) reverse transcriptases possess RNase H activity, and this RNase H activity can be reduced or inactivated by introducing mutations (e.g., deletions or substitutions).
[0114] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has RNase H activity deleted or has reduced RNase H activity compared to the wild-type M-MLV reverse transcriptase.
[0115] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has RNase H activity reduced by at least 1.1 times, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, or at least 6 times compared to the wild-type M-MLV reverse transcriptase.
[0116] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure may further include a mutation that increases the reverse transcription ability for a difficult template. For example, the mutant M-MLV reverse transcriptase according to the present disclosure may further include an amino acid substitution at a position corresponding to N249 of the wild-type M-MLV reverse transcriptase of SEQ ID NO: 1. Specifically, the amino acid substitution may be N249D.
[0117] The term “difficult template” as used herein refers to a DNA or RNA sequence that is difficult to amplify and / or sequence, and includes, for example, a GC-rich template (a GC ratio of 60 to 65% or more of the template), a template containing a repeat sequence, or a template having a complex structure such as a hairpin structure.
[0118] In one embodiment, the difficult template is a sequence having a high GC content (e.g., 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, etc.). Sequences with high GC content form stronger hydrogen bonds, making them difficult to denature, which makes it difficult for the enzyme to access them. In another embodiment, the difficult template is a repetitive sequence. Repetitive sequences can make it difficult for the polymerase to replicate accurately. In yet another embodiment, the difficult template is a sequence having a secondary structure. If the template forms a secondary structure such as a hairpin, the polymerase may not be able to operate efficiently. In yet another embodiment, the difficult template is a degraded or contaminated sequence. Such sequences reduce amplification efficiency.
[0119] In one embodiment, the mutant M-MLV reverse transcriptase according to the present disclosure has a reverse transcription ability for difficult templates that is 1.1 to 10 times higher than that of the wild-type M-MLV reverse transcriptase. Specifically, the mutant M-MLV reverse transcriptase according to the present disclosure has a reverse transcription ability for difficult templates that is 1.1 times or more, 1.2 times or more, 1.3 times or more, 1.4 times or more, 1.5 times or more, 1.6 times or more, 1.7 times or more, 1.8 times or more, 1.9 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, or 10 times or more higher than that of the wild-type M-MLV reverse transcriptase.
[0120]
[0121] In another embodiment, the present disclosure provides a mutant M-MLV reverse transcriptase comprising an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, and having the following:
[0122] (i) N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO: 1;
[0123] (ii) Deletion of at least 11 consecutive amino acids in the C-helix / loop region corresponding to amino acids 593 to 603 of SEQ ID NO: 1;
[0124] (iii) C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1; and
[0125] (iv) At least three amino acid substitutions at positions selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, N249D, M289L, T306K, D524G, E562Q, K571R, D583N and T664N of SEQ ID NO: 1.
[0126]
[0127] Since the foregoing details are described in detail elsewhere in this specification, common details among them are omitted to avoid excessive duplication that would cause complexity to this specification.
[0128]
[0129] In one embodiment, the mutant M-MLV reverse transcriptase comprises the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11.
[0130] In one embodiment, the mutant M-MLV reverse transcriptase additionally includes an N-terminal SUMO tag.
[0131] In one embodiment, the mutant M-MLV reverse transcriptase has (i) increased reverse transcriptase activity, (ii) increased fidelity and / or thermal stability, (iii) decreased RNase H activity, (iv) increased reverse transcription ability for difficult templates and / or (v) increased solubility compared to SEQ ID NO: 1.
[0132]
[0133] In another aspect, the present disclosure provides a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase. Specifically, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase is codon-optimized for E. coli.
[0134] In this invention, "codon optimization" refers to the process of modifying the codons of a heterologous protein to match the codon usage bias of the host organism being transformed in order to increase the expression of the heterologous protein. For example, when E. coli is used as the host being transformed in this invention, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase according to the present disclosure may be codon optimized by modifying its codons to match the codon usage bias of E. coli. The codon-optimized nucleotide sequence is different from the nucleotide sequence prior to codon optimization, but their amino acid sequences are identical. The codon optimization may be carried out by methods commonly used in the art.
[0135] As used herein, the term "expression" refers to the process in which a polypeptide is produced based on the nucleic acid sequence of a gene. The process may refer to any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0136] In a specific embodiment, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises SEQ ID NO: 10 or a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity therewith. For example, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises or consists of the sequence represented by SEQ ID NO: 10. As another example, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises or consists of a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity with respect to SEQ ID NO: 10.
[0137] In a specific embodiment, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises SEQ ID NO: 12 or a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity therewith. For example, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises or consists of the sequence represented by SEQ ID NO: 12. As another example, the nucleotide sequence encoding the mutant M-MLV reverse transcriptase comprises or consists of a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity with respect to SEQ ID NO: 12.
[0138]
[0139] In another aspect, the present disclosure provides an expression vector comprising a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase and a sequence of a promoter operably linked thereto.
[0140] As used herein, the term "expression vector" refers to a carrier designed for the expression of a protein in a cell. In this invention, an expression vector comprises an expression cassette, which is the basic unit for expression, and may also include various other components.
[0141] As the expression vector mentioned above, a vector capable of independent replication in a host cell or a vector capable of being incorporated into a host chromosome may be used. Examples of expression vectors may include any one of various expression vectors known in the art, such as plasmid vectors, phage vectors, and viral vectors, but are not limited thereto.
[0142] As used herein, the term "expression cassette" refers to a polynucleotide structure containing all the elements necessary for self-expression. An expression cassette may typically include a promoter, a transcription terminator, a ribosome binding site, and a translation terminator operably linked to a transgenic gene. An expression cassette may be in the form of a self-replicating expression vector.
[0143] In one embodiment, the expression cassette herein comprises (i) a nucleotide sequence encoding a mutant M-MLV reverse transcriptase, and (ii) a sequence of a promoter operably linked thereto.
[0144] In this document, the term "promoter" refers to a nucleic acid sequence encoding an amino acid that contains a binding site for RNA polymerase and has transcription initiation activity into the mRNA of a downstream gene.
[0145] As used herein, the term "operably linked" indicates that the fragment is arranged so that transcription is initiated at the promoter and proceeds through the amino acid coding sequence to the termination code.
[0146] In one embodiment, the promoter may be selected depending on the host. For example, when E. coli (e.g., HB101, BL21, DH5α, etc.) is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol., 158:1018-1024 (1984)) and the left-leaning promoter of phage λ (pL λ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14:399-445 (1980)) may be used as the promoter. As another example, when Bacillus is used as a host cell, the promoter of the toxin protein gene of Bacillus churingensis (Appl. Environ. Microbiol. 64:3932-3938(1998); Mol. Gen. Genet. 250:734-741(1996)) or any promoter that can be expressed in Bacillus can be used as a promoter.
[0147] The expression cassette according to the present disclosure may include, in addition to a nucleotide sequence encoding a mutant M-MLV reverse transcriptase and a promoter operably linked thereto, various elements known to be involved in assisting the expression / secretion of M-MLV reverse transcriptase.
[0148] In one embodiment, the expression cassette according to the present disclosure may further include a nucleotide sequence encoding a histidine tag at the end of the nucleotide sequence encoding the mutant M-MLV reverse transcriptase. The histidine tag is used to facilitate the purification of the protein using affinity chromatography. When histidine is added to the end of the protein of interest, the metal ion affinity of the protein is significantly increased, making purification easy. When a protein having a histidine tag is brought into contact with a column immobilized with metal ions such as nickel under conditions of pH 8.0 or higher, the histidine tag chelates the metal ions and binds to the column, thereby allowing the target protein to be recovered with high purity.
[0149] The nucleotide sequence encoding the above histidine tag may be connected to the C-terminus or N-terminus of the nucleotide sequence encoding the above mutant M-MLV reverse transcriptase.
[0150] The above histidine tag may consist of at least six histids. The number of histids constituting the above histidine tag can be easily adjusted by a person skilled in the art.
[0151] In one embodiment, the expression vector may be an expression vector in which a phage-derived promoter and an RNA polymerase gene are combined. As a representative example, the pET vector comprises an expression cassette in which a T7 promoter derived from a T7 phage and a T7 RNA polymerase gene are combined. The T7 promoter can induce potent gene expression and is highly effective in efficiently regulating the expression of foreign genes inserted into host cells such as E. coli.
[0152] In one embodiment, the expression vector further includes an origin of replication.
[0153] In one embodiment, the expression vector further includes a selection marker. For example, the selection marker may include a nucleotide sequence encoding a drug resistance gene.
[0154]
[0155] In another aspect, the present disclosure provides a host cell transformed with an expression vector comprising a nucleotide sequence encoding the aforementioned mutant M-MLV reverse transcriptase and a sequence of a promoter operably linked thereto.
[0156] As used herein, the term "transformation" means the introduction of DNA into a host, resulting in homologous recombination of the DNA with the host chromosome.
[0157] The above transformation may be carried out using various methods known in the art. For example, the transformation may be carried out by electroporation, protoplasmic fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring with silicon carbide fibers, Agrobacterium-mediated transformation, PEG (polyethylene glycol), dextran sulfate, lipofectamine, or particle bombardment, but is not limited thereto.
[0158] The host may be various hosts known in the art, such as bacteria (E. coli, Bacillus subtilis, etc.), yeast, filamentous fungi, insect cells, eukaryotic cells, animal cells (including mammalian cells such as human cells), but are not limited thereto.
[0159] When using prokaryotic cells as host cells, for example, bacteria belonging to the genus Escherichia (e.g., Escherichia coli), the genus Bacillus (e.g., Bacillus subtilis), the genus Pseudomonas (e.g., Pseudomonas putida), and the genus Rhizobium (e.g., Rhizobium meliloti) can be used as host cells. E. coli strains suitable for the production of xenoproteins are well known to those skilled in the art, and many are also commercially available (e.g., Escherichia coli BL21T1R, Escherichia coli BL21, E. coli XL1-Blue, E. coli XL2-Blue, E. coli DH1, E. coli JM109, E. coli HB101, etc.). In addition, bacteria of the genus Bacillus, such as Bacillus subtilis MI114 and B. subtilis 207-21, and bacteria of the genus Brevibacillus, such as Brevibacillus choshinensis, are known as hosts for the production of heterologous proteins. These host cells can be combined with a suitable expression vector and used to produce the mutant M-MLV reverse transcriptase of the present disclosure.
[0160] The mutant M-MLV reverse transcriptase according to the present disclosure can be obtained by culturing the transformed host cells and lysing and purifying the culture.
[0161] Culture of transformed host cells can be carried out using media commonly used in the art. For example, if the transformed host cells are prokaryotic cells (e.g., E. coli), they can be cultured using LB (Luria-Bertani) medium. Various methods of culturing transformed host cells are well known to those skilled in the art and are disclosed in Sambrook et al., *Molecular Cloning*, *A Laboratory Manual*, *Cold Spring Harbor Laboratory Press* (2001), which is incorporated herein by reference.
[0162] Cultured host cells can be disrupted by various methods known in the art, specifically, sonication or disruption methods using glass beads, but are not limited thereto.
[0163] The purification process may utilize methods for purifying proteins known in the art, for example, filtration using a silica gel or Celite gel column, size-exclusion chromatography using liquid column chromatography, ion-exchange chromatography, partition chromatography, affinity chromatography, or a combination of these chromatographs.
[0164]
[0165] In another aspect, the present disclosure provides a method for reverse transcribing target RNA in a sample into cDNA using the aforementioned mutant M-MLV reverse transcriptase.
[0166] The mutant M-MLV reverse transcriptase according to the present disclosure has improved thermal reactivity (or heat resistance) along with thermal stability compared to the wild-type M-MLV reverse transcriptase, so it can be used for reverse transcription reactions at high temperatures.
[0167] In one embodiment, the reverse transcription reaction may be carried out at 37°C to 60°C. Reverse transcription at such high temperatures can facilitate cDNA synthesis for a template that is difficult to destroy because it can destroy the higher-order structure of mRNA.
[0168] In one embodiment, the reverse transcription reaction may require additional components other than the reverse transcriptase. Examples include primers, dNTPs, buffers, divalent metal salts, and UDG (Uracil DNA Glycosylase).
[0169] There are three main types of primers used in reverse transcription reactions: (i) oligo dT primers that anneal to the poly A tail of mRNA and synthesize cDNA starting from the 3'-terminus, (ii) random primers made of random nucleotides of size 6 to 9 nt that start synthesis in all regions of RNA, and (iii) target-specific primers that synthesize only target cDNA.
[0170] dNTPs used in reverse transcription reactions refer to nucleoside triphosphates that make up nucleic acids and can consist of dATP, dGTP, dCTP, dUTP, and dTTP.
[0171] The buffer used in the reverse transcription reaction may be a mixture of a weak acid and its conjugate base or a weak base and its conjugate acid known in the art. Examples include Tris buffer and HEPES buffer, but are not limited thereto. The buffer components and their concentrations suitable for the reverse transcriptase are known in the art.
[0172] In the case of reverse transcription or nucleic acid amplification reactions, carry-over contamination can occur, where the product of a previous reaction (e.g., cDNA or amplification product) contaminates the newly performed reaction through various pathways. That is, the carry-over contaminant acts as a template in the newly performed reaction, being reverse transcribed or amplified, which can lead to a problem of false positive results, appearing positive even though the result is actually negative. This carry-over contamination can be prevented by using uracil DNA glycosylase (UDG).
[0173] As an example of a suitable UDG, a heat-labile UDG may be used. The heat-labile UDG may include, but is not limited to, UDGs derived from cold-tolerant organisms, such as psychrophilic bacteria or Atlantic cod. These enzymes are characterized by being rapidly and irreversibly inactivated when exposed to temperatures of 50°C or 55°C, respectively. Therefore, the heat-labile UDG is inactivated before the reverse transcription reaction begins, so that only carryover contaminants can be removed without affecting the cDNA generation process by the reverse transcription reaction at all.
[0174] The divalent metal ions constituting the divalent metal salts used in reverse transcription reactions include, but are not limited to, manganese ions, magnesium ions, and cobalt ions. Divalent metal ions suitable for reverse transcriptase and their concentrations are known in the art. Divalent metal ions can be supplied in the form of salts such as chlorides, sulfates, or acetates.
[0175] In one embodiment, cDNA obtained from the reverse transcription method can be further amplified using the cDNA as a template. This can be carried out using any one of the aforementioned nucleic acid amplification methods, including the PCR method.
[0176]
[0177] Since the foregoing details are described in detail elsewhere in this specification, common details among them are omitted to avoid excessive duplication that would cause complexity to this specification.
[0178]
[0179] The present invention will be described in detail below with reference to examples. The following examples are merely illustrative of one embodiment of the present invention and do not limit the scope of the present invention.
[0180]
[0181] Examples
[0182]
[0183] Example 1: Preparation of mutant M-MLV reverse transcriptase (1)
[0184] (1-1) Cloning
[0185] A nucleotide sequence (Sequence No. 10) encoding the amino acid sequence of Sequence No. 9, comprising the following mutations (i) and (ii) in addition to a C-terminal deletion of five consecutive amino acids corresponding to amino acids 673 to 677 of Sequence No. 1, was synthesized from IDT (Integrated DNA Technologies, USA):
[0186] (i) N-terminal deletion of 23 consecutive amino acids
[0187] (ii) P51L, L52P, Y64R, K152M, H204R, N249D, M289L, T306K, D524G, E562Q, K571R, D583N and T664N.
[0188] The nucleotide sequence (Sequence No. 10) encoding the amino acid sequence of Sequence No. 9 above was obtained by performing codon optimization for E. coli host cells using the GenScript Rare Codon Analysis (GenScript) program.
[0189] Next, to amplify the nucleotide sequence of SEQ ID NO: 10, a PCR reaction mixture was prepared as follows. Specifically, 100 pg of template (SEQ ID NO: 10), 10 μmol of forward primer (SEQ ID NO: 14), 10 μmol of reverse primer (SEQ ID NO: 15), 0.2 μl of Q5 Polymerase (New England Biolabs), 4 μl of 5X Q5 buffer (New England Biolabs), and 12.3 μl of Nuclease-Free water (Seegene) were added to prepare a final reaction mixture of 20 μL.
[0190] Forward primer (Sequence No.: 14):
[0191] 5'-GCCATCATCATCATCATCACACCTGGTTGTCAGATTTT-3'
[0192] Reverse primer (Sequence No.: 15):
[0193] 5'-GCTGTCCACCAGTCATGCTATTAGATCAGCAGGGTAGAC-3'
[0194] The reaction mixture prepared above was denatured in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) at 98°C for 30 seconds, and 20 cycles were performed at 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 60 seconds. Finally, a final extension was performed at 72°C for 2 minutes.
[0195] The above PCR product was purified using a purification kit (QIAGEN, QIAquick PCR Purification Kit). Subsequently, the purified PCR product was used in a Gibson Assembly ® A recombinant vector was constructed by cloning into a pET28a(+) expression plasmid using the Cloning Kit (NEB).
[0196]
[0197] (1-2) Transformation and Expression
[0198] The above recombinant vector was transformed into E. coli BL21 cells.
[0199] To this end, 1 μl of the recombinant vector was placed into a tube containing 50 μl of E. coli BL21 and incubated on ice for 30 minutes. The tube was transferred to a water bath preheated to 42°C and subjected to heat shock for 30 seconds, followed by incubation on ice for 2 minutes. Subsequently, 1 ml of liquid LB medium was added and cultured at 37°C and 200 rpm for 1 hour.
[0200] 100 μl of the above culture solution was spread onto a selective medium containing the antibiotic kanamycin, and then incubated at 37°C for 16 hours to obtain transformed colonies.
[0201] The above-mentioned transformed colonies (i.e., transformants) were inoculated into LB medium (BD Difco, LB broth miller) containing the antibiotic kanamycin (0.05 mg / ml) and incubated with aeration at 37°C for 16 hours. 500 ml of sterile LB medium containing the same concentration of kanamycin was prepared in a 2 L Erlenmeyer flask, 5 ml of the above culture solution was added, and then the absorbance (OD) at 600 nm 600The culture was incubated at 37°C for 2 hours and 30 minutes until the value at ) reached 0.6. Subsequently, 500 μl of 1 M IPTG was added to induce reverse transcriptase expression, followed by aeration incubation at 20°C for 20 hours. Then, OD 600 The value was measured, and a cell pellet was obtained by centrifuging at 4,000 rpm for 20 minutes. The cell pellet was suspended in 10 ml of lysis / binding buffer (40 mM pH 7.5 Tris-HCl, 300 mM NaCl, 10 mM Imidazole), and the cells were lysed using a cell disruptor (QSONICA, Q700) under conditions of on: 6 sec, off: 9 sec, on time: 3 min, Amp: 26%. 10 μl of the lysate was transferred to a separate tube, and the remaining lysate was centrifuged at 13,000 rpm for 10 minutes to obtain only the aqueous supernatant excluding the pellet.
[0202] To confirm the expression of reverse transcriptase, 10 μl of lysate and 10 μl of aqueous supernatant, respectively, were suspended in 3X SDS-PAGE loading dye and loaded onto a 10% SDS-PAGE gel (BIO-RAD, 10% Mini-PROTEIN TGX Protein Gels). The gel was operated using an electrophoresis device (BIO-RAD, PowerPac™ Basic Power Supply) at 100 V for 15 minutes and at 200 V for 30 minutes, followed by staining with a gel staining reagent (BIOMAX, DirectBlue™ Gel Staining Solution) for 3 hours, after which the reverse transcriptase band was observed.
[0203] The results of the SDS-PAGE loading above are shown in Fig. 1. As shown in Fig. 1, a thick band was observed at the 75 kDa position in both lanes loaded with the lysate and the aqueous supernatant, indicating that the mutant M-MLV reverse transcriptase according to the present disclosure was appropriately expressed.
[0204]
[0205] (1-3) Refining
[0206] The reverse transcriptase contained in the above aqueous supernatant contains six histidine tags derived from a pET28a(+) expression vector at its N-terminus. Purification was performed as follows using the above histidine tags.
[0207] A 5 ml Ni column (Cytiva Life Sciences, Ni Sepharose™ 6Fast Flow) prepared in a chromatography tube was washed with 25 ml of triple purified water, and then the column was equilibrated with 25 ml of lysis / binding buffer (40 mM pH 7.5 Tris-HCl, 300 mM NaCl, 10 mM Imidazole). The aqueous supernatant obtained in Examples 1-2 above was loaded onto the equilibrated column. Subsequently, the column was washed with 25 ml of wash buffer (40 mM pH 7.5 Tris-HCl, 300 mM NaCl, 25 mM Imidazole), and then the reverse transcriptase was eluted with 5 ml of elution buffer (40 mM pH 7.5 Tris-HCl, 300 mM NaCl, 300 mM Imidazole).
[0208] The eluent containing the purified reverse transcriptase was placed in an Amicon centrifuge tube (Merck, Amicon® Ultra Centrifugal Filter 10 kDa), and then the buffer was replaced five times with 15 ml of 2X reverse transcriptase storage buffer (40 mM pH 7.5 Tris-HCl, 200 mM NaCl, 0.2 mM EDTA, 2 mM DTT). Subsequently, the concentration of the buffer-replaced protein was measured using a NanoDrop One™ UV-Vis Spectrophotometer (Thermo Fisher Scientific, NanoDrop One™ UV-Vis Spectrophotometer), and the final concentration was confirmed to be 4.0 mg / ml.
[0209]
[0210] Example 2: Preparation of mutant M-MLV reverse transcriptase (2)
[0211] (2-1) Cloning
[0212] A nucleotide sequence (Sequence No. 12) encoding the amino acid sequence of Sequence No. 11 was synthesized from IDT (Integrated DNA Technologies, USA), comprising: a deletion of the C-helix / loop region of 11 consecutive amino acids corresponding to amino acids 593 to 603 of Sequence No. 1 and a deletion of 5 consecutive amino acid C-terminals corresponding to amino acids 673 to 677 of Sequence No. 1, further comprising the following mutations (i) and (ii):
[0213] (i) N-terminal deletion of 23 consecutive amino acids; and
[0214] (ii) P51L, L52P, Y64R, K152M, H204R, N249D, M289L, T306K, D524G, E562Q, K571R, D583N and T664N.
[0215] The nucleotide sequence (Sequence No. 12) encoding the amino acid sequence of Sequence No. 11 above was obtained by performing codon optimization for E. coli host cells using the GenScript Rare Codon Analysis (GenScript) program.
[0216] Next, to amplify the nucleotide sequence of SEQ ID NO: 12, a PCR reaction mixture was prepared as follows. Specifically, 100 pg of template (SEQ ID NO: 12), 10 μmol of forward primer (SEQ ID NO: 16), 10 μmol of reverse primer (SEQ ID NO: 17), 0.2 μl of Q5 Polymerase (New England Biolabs), 4 μl of 5X Q5 buffer (New England Biolabs), and 12.3 μl of Nuclease-Free water (Seegene) were added to prepare a final reaction mixture of 20 μL.
[0217] Forward primer (Sequence No.: 16):
[0218] 5'- ATGCGTTTGCTACCGCCCATCTGACGTCGGAAGGCAAA - 3'
[0219] Reverse primer (Sequence No.: 17):
[0220] 5'- TCTTTGCCTTCCGACGTCAGATGGGCGGTAGCAAACG - 3'
[0221] The reaction mixture prepared above was denatured in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) at 98°C for 30 seconds, and 20 cycles were performed at 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 60 seconds. Finally, a final extension was performed at 72°C for 2 minutes.
[0222] The above PCR product was purified using the aforementioned purification kits (QIAGEN, QIAquick PCR Purification Kit). Subsequently, the purified PCR product was used in the Gibson Assembly ® A recombinant vector was constructed by cloning into a pET28a(+) expression plasmid using the Cloning Kit (NEB).
[0223]
[0224] (2-2) Transformation and Expression
[0225] The recombinant vector of Example 2-1 was transformed into E. coli BL21 under the same conditions as Example 1-2, and protein expression was induced.
[0226] The expression status was confirmed by performing SDS-PAGE in the same manner as in Examples 1-2, and as shown in Figure 2, a strong band at the approximately 75 kDa position was observed in both the lysate and the aqueous supernatant. This indicates that the mutant M-MLV reverse transcriptase (2) of this example was properly expressed.
[0227]
[0228] (2-3) Refining
[0229] The reverse transcriptase contained in the aqueous supernatant of Example 2-2 was purified using the same method as in Example 1-3. Subsequently, buffer exchange using an Amicon centrifuge tube was also performed in the same manner as in Example 1-3. As a result, the final concentration was confirmed to be 4.0 mg / mL.
[0230] Meanwhile, as a control group for comparing the performance of the mutant M-MLV reverse transcriptase (1) and the mutant M-MLV reverse transcriptase (2) according to the present embodiment, a control group M-MLV reverse transcriptase having all the same conditions except for the C-terminal deletion compared to the mutant M-MLV reverse transcriptase (1) was also prepared in the same way as in Example 1.
[0231]
[0232] Example 3: Evaluation of Mutant M-MLV Reverse Transcription Enzyme
[0233] To measure the activity of the mutant M-MLV reverse transcriptase according to the present disclosure, the method disclosed in WO2024-177304 was used. According to the said document, a reference reverse transcriptase (reference or standard product) with known activity and purity is selected, its intrinsic activity is measured, and then the intrinsic activity of the reverse transcriptase of interest is measured relative to the intrinsic activity of the reference reverse transcriptase.
[0234] The intrinsic activity of reverse transcriptase is Biotium’s Fluorometric Polymerase Activity Kit, the EvaEZ™ product (EvaGreen ®The consumption of nucleotide dNTPs as substrates during the extension of primers bound to a template was evaluated and measured using a solution containing dye, a primed template, dNTPs, MgCl2, and Tris buffer. The EvaEZ™ product mentioned above is EvaGreen, which increases the fluorescence signal upon binding to dsDNA. ® It is based on the characteristics of the dye. The fluorescence signal increases in proportion to the amount of dsDNA produced, which allows for real-time verification of how effectively the enzyme produces dsDNA. Therefore, M-MMLV reverse transcriptase activity can be evaluated by detecting the newly produced double-stranded DNA (dsDNA) that consumes dNTPs.
[0235] (3-1) Measurement of dNTP consumption (pmole / U) by reference reverse transcriptase
[0236] First, Invitrogen’s SuperScript™ III was selected as the reference reverse transcriptase. The method for measuring the dNTP consumption of Invitrogen’s SuperScript™ III is as follows:
[0237] SuperScript™ III with an initial concentration of 200 U / μl 10X Thermopol ® Using reaction buffer (New England Biolabs) and ultrapure water, the solution was diluted to a total of five concentrations: 10,000 mU / ul, 1,000 mU / ul, 500 mU / ul, 250 mU / ul, and 125 mU / ul. Subsequently, the reagent was prepared by mixing EvaEZ reagent:reverse transcriptase:ultrapure water in a volume ratio of 10:1:9.
[0238] Specifically, 207 μl of 2X EvaEZ™ reagent (New England Biolabs) and 186.3 μl of ultrapure water were mixed, and then 62.7 μl was dispensed into six tubes. 3.3 μl of the enzyme diluted to the five concentrations was added to five of the six tubes, while 1X Thermopol was added to the remaining tube as a negative control reaction instead of the enzyme. ® 3.3 μl of reaction buffer was added and pipetting was performed. All these procedures were carried out under ice-cold conditions.
[0239] 66 μl of the mixture prepared in the above 6 tubes was dispensed in sets of 3, each containing 20 μl, into 8-strip PCR tubes (BIORAD) and reacted for 60 minutes using Bio-Rad's CFX96-DR instrument while tracking changes in fluorescence at 30-second intervals at 50°C and 60°C, respectively.
[0240] The same process was carried out in a total of 9 sets for the 50℃ reaction and 3 sets for the 60℃ reaction, and the results were analyzed as follows.
[0241]
[0242] Primary Analysis: Derivative of [Time]-[Fluorescence Value]
[0243] Graphs of FIGS. 3a to 3i (x-axis time, y-axis fluorescence value) were obtained through the above 50°C reaction, and graphs of FIGS. 4a to 4c (x-axis time, y-axis fluorescence value) were obtained through the above 60°C reaction.
[0244] As shown in Figs. 3a to 3i and Figs. 4a to 4c, it was confirmed that the fluorescence value (y-axis) increases as time (x-axis) elapses, that is, as dsDNA is synthesized. This indicates that EvaGreen ®This is because the dye generates a fluorescent signal as it binds to dsDNA. In other words, since the above measurement value is a fluorescence value that increases with the time it takes to synthesize DNA, it has a direct correlation with the consumption of dNTPs.
[0245] Next, in the graphs of Figures 3a to 3i and 4a to 4c, the slope (derivative of [time]–[fluorescence value]) of the portion where the graph of fluorescence values over time is a linear function within the first 10 minutes for each enzyme concentration was measured. For each dilution factor, a scatter plot was plotted with time on the x-axis and fluorescence value on the y-axis; then, the linear function R of three repetitions, including the corresponding slope trend lines in order from the earliest time, was measured. 2 The point where the maximum value was selected among values greater than or equal to 0.99 (Tables 1 and 2).
[0246] As a result, as shown in Figures 5 to 13, it was confirmed that the derivative of [time]-[fluorescence value] was a linear function in all 9 sets of 50°C reactions. Similarly, as shown in Figures 14 to 16, it was confirmed that the derivative of [time]-[fluorescence value] was a linear function in all 3 sets of 60°C reactions.
[0247]
[0248] 50℃ Set 1 hour (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2Slope (a) standard deviation (SE)2.5100001948.40.992081.50.992128.70.992052.954.051000472.10.99371.71.00452.20.99432.030.75500227.81.00210.71.00225.31.00221.35.35250100.21.00107.41.00101.91.00103.22.21012552.70.9949.40.9951.60.9951.21.0 Total 0(NC) 0.20.49 - 0.50.76 0.40.73 0.00.350℃ Set 2 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2 Slope (a) standard deviation (SE)2100001668.80.991585.10.991633.40.991629.124.35.51000278.10.99280.81.00240.01.00266.313.26500111.21.00132.11.00122.60.99121.96.0625043.30.9836.71.0043.10.9941.02.21312522.70.9920.70.9920.80.9821.40.7 Total 0(NC) 1.00.96 - 0.80.87 - 0.20.45 0.00.550℃ Set 3 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2 Slope (a) standard deviation (SE)2100001991.40.991990.01.002073.40.992018.327.63.51000334.91.00317.31.00314.21.00322.16.43.5500154.61.00165.21.00149.21.00156.34.7925079.60.9996.90.9964.41.0080.39.411.512521.70.9935.20.9819.20.9825.45.0 Total 0(NC) -0.10.192.00.77 -1.90.70 -0.01.150℃ Set 4 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average slope (a) R 2Slope(a)R 2 Slope(a)R 2 Slope(a) Standard Deviation (SE) 2 1 0 0 0 2 0 7 3.5 1.00 19 8 1.4 1.00 19 4 7.4 1.00 2 0 0 0.8 3 7.7 2 1 0 0 2 7 0.5 1.00 3 2 0.5 1.00 3 2 3.2 1.00 3 0 4.7 1 7.1 7 5 0 0 1 6 3.4 0.99 1 5 8.90 1 5 2.8 0.99 1 5 8.4 3.1 7 2 5 0 5 4.10 99 5 5.8 0.99 6 6.4 0.99 5 8.7 3.9 2 5 1 2 5 2 7.4 0.98 3 1.90 98 2 3.2 0.98 2 7.5 2.5 Total 0(NC) 0.1 0.1 1 -0.00.1 1 -0.00.09 -0.00.05 0 ℃ Set 5 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2 Slope(a) Standard Deviation (SE) 2 1 0 0 0 2 7 3.1 0.99 2 0 6 5.1 0.99 2 0 4 9.3 0.99 2 1 2 9.2 7 2.1 3 1 0 0 3 0 5.9 1.00 3 1 5.01 0.00 2 9 1.6 1.00 3 0 4.1 6.8 3 5 0 0 1 4 2.2 1.00 1 4 1.4 1.00 1 4 7.2 1.00 1 4 3.6 1.8 7.5 2 5 0 8 3.6 0.99 8 9.2 0.99 7 5.5 1.00 8 2.8 4.0 8 1 2 5 3 9.4 0.99 5 3.7 0.99 4 9.2 0.98 4 7.4 4.2 Total 0 (NC) 1.1 0.95 -0.2 0.49 -0.9 0.89 -0.0 0.6 5 0 ℃ Set 6 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2Slope (a) standard deviation (SE)2100001921.01.001977.71.002067.81.001988.842.74.51000354.41.00342.81.00381.61.00359.611.56500182.20.99181.61.00177.70.99180.51.46.5250103.41.0090.60.9964.70.9886.311.410.512546.50.9854.70.9849.30.9950.22.4 Total 0(NC)-1.10.882.20.92-1.10.950.01.150℃ Set 7 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average slope (a) R 2 Slope(a)R 2 Slope(a)R 2 Slope (a) standard deviation (SE)1.5100002400.01.002115.61.002089.51.002201.799.431000296.61.00322.01.00275.31.00298.013.53500147.01.00135.51.00143.91.00142.13.4525089.40.9990.01.0078.71.0086.03.71012536.90.9951.70.9843.10.9843.94.3 Total 0(NC)1.60.89-0.70.87-0.90.870.00.850℃ Set 8 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average slope (a) R 2 Slope(a)R 2 Slope(a)R 2Slope(a) Standard Deviation (SE) 2100002391.71.002202.81.002368.101.002320.8759.4321000358.50.99457.11.00415.201.00410.2828.583.5500207.51.00223.40.99203.580.992 11.48 6.07 3.5 2508 9.40.991 03.40.998 4.8 10.9992 57 5.608 5125 44.20.9968.50.945 3.62 0.9955 447.07 Total 0(NC) 1.4 0.98 - 0.4 0.77 - 1.0 10.9 20.00 0.7 450℃ Set 9 hours(min) Concentration(mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope(a)R 2 Slope(a)R 2 Slope(a)R 2 Slope (a) standard deviation (SE)1.5100002389.21.002651.31.002350.21.002463.694.51.51000397.51.00332.21.00325.91.00351.922.91.5500184.71.00206.10.99159.10.96183.313.61.5250101.61.0074.30.9935.41.0070.419.21312516.40.9915.70.9928.80.9820.34.3 Total 0(NC)3.10.87-0.90.84-2.20.680.01.6
[0249]
[0250] 60℃ Set 1 hour (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2Slope(a) Standard Deviation (SE) 2 min 100001412.401.001650.100.991430.901.001497.8076.34 2.5 min 10003271.00315.111.00269.801.00304.0817.50 2.5 min 500182.460.98155.680.98185.020.9 9 174.39 9.38 5 min 250 80.8 20.99 75.37 0.99 64.28 1.00 73.49 4.8 78 min 125 38.8 40.98 30.4 11.00 44.5 10.98 37.9 24.10 Total 0(NC) -0.5 20.8 1 -0.08 0.20 0.6 10.79 -0.00 0.33 60℃ Set 2 hours (min) Concentration (mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope (a) R 2 Slope(a)R 2 Slope(a)R 2 Slope(a) Standard Deviation (SE) 1.5 min 100001526.50 1.001489.60 1.001408.60 1.00147 4.903 4.821.5 min 1000372 1.00372.75 1.00279.96 1.0034 1.6130.83 2 min 500165.700.99166.960.99185.000. 99172.556.23 2 min 25098.020.9994.871.0095.951.0096.280.93 3 min 12558.260.8655.530.9066.940.9160.24 3.44 Total 0(NC) 0.18 0.20 - 1.18 0.751.000.89 0.000.63 60℃ Set 3 hours(min) Concentration(mU) Dispense 1 Dispense 2 Dispenses 3 Average Slope(a)R 2 Slope(a)R 2 Slope(a)R 2Slope (a) Standard Deviation (SE) 1.5 min 100001795.301.001745.601.001526.201.001689.0382.67 1.5 min 10003341.00287.851.00316.541.00312.9313.56 5 min 500151.370.98131.490.98152.320 .99145.066.797 min25075.690.9965.750.9976.160.9972.533.405 min12515.270.6915.730.5520.930.6617.311.81 Total0(NC)2.200.90-0.850.91-1.340.700.001.11
[0251]
[0252] Secondary analysis: Derivative of [enzyme concentration]–[time–fluorescence derivative]
[0253] It was confirmed that the above [differential of time-fluorescence value] is a linear function, and a secondary analysis was performed. In the secondary analysis, the derivative of the primary analysis was applied to calculate the dNTP consumption according to enzyme concentration.
[0254] First, the previously used enzyme concentrations (10,000, 1,000, 500, 250, 125 mU) are applied to the x-axis of the secondary analysis. Then, the [differential of time-fluorescence value] obtained from the primary analysis, that is, the value obtained by multiplying the average slope by 10, is denoted as the y1 value (Equation 1).
[0255] The above y1 value was divided by the maximum fluorescence value and multiplied by 270 (pmole) to denote y2 (pmole) (Equation 2). Here, 270 pmole is the maximum amount of dNTP used in the EvaEZ™ reagent and is used in the formula to calculate the maximum dNTP pmole used at the maximum fluorescence value. This means that the fluorescence value will reach its maximum when all the dNTPs added as substrates to the reaction solution are consumed.
[0256]
[0257] [Equation 1]
[0258] y1 = [Time - Derivative of Fluorescence Value] X 10
[0259] [Equation 2]
[0260] y2 = y1 X (270 / maximum fluorescence value)
[0261]
[0262] As a result, the results shown in Tables 3 and 4 were obtained.
[0263]
[0264] 50℃ Set 1 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10) y2(pmole) Standard Deviation 1 0000 205 2.9 5 4.0 205 28.7 50 4.7 13.3 1 000 43 2.0 30.7 43 19.6 10 6.2 7.5 500 22 1.3 5.3 22 12.9 5 4.4 1.3 25 0 10 3.2 2.2 10 31.5 25.4 0.5 125 5 1.2 1.0 5 12.3 12.6 0.2 0 0.0 0.3 0.0 0.0 0.1 50℃ Set 2 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 10000 1629.124.3 16291.05 39.18.0 1000 266.31 3.2 2663.28 8.14.4 500 121.96.0 1219.4 40.42.0 250 41.02.2 410.41 3.6 0.7 125 21.40.7 213.8 7.10.2 00.00.5 0.00.00.250℃ Set 3 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 100002018.327.620182.7496.36.81000322.16.43221.279.21.6500156.34.71563.438.41.225080.39.4803.119.72.312525.45.0253.76.21.200.01.10.00.00.350℃ Set 4 Concentration(mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 1000020000.837.720007.7477.79.01000304.717.13047.472.84.1500158.43.11583.737.80.725058.73.9587.314.00.912527.52.5275.16.60.600.00.00.00.00.050℃ Set 5 Concentration(mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10)y 2 (pmole) Standard Deviation 10000 21 29.27 2.1 21 29 1.75 32.1 18.0 1000 30 4.16.8 30 41.37 6.01.75 00 143.6 1.8 143 5.9 35.9 0.5 250 82.8 4.08 27.6 20.7 1.0 125 47.4 4.2 47 4.31 1.9 1.1 00.00.6 0.00.00.250℃ Set 6 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10) y2(pmole) Standard Deviation 10000 1988.84 2.71 9888.35 49.11 1.81 000 359.61 1.53 595.89 9.33.25 00 180.51.41 805.34 9.80.42 5086.31 1.48 62.62 3.83.11 25 50.22.45 01.91 3.90.70 0.01 10.00.00.350℃ Set 7 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 100002201.799.422017.0584.626.41000298.013.52979.879.13.6500142.13.41421.337.70.925086.03.7860.222.81.012543.94.3438.911.71.100.00.80.00.00.250℃ Set 8 Concentration(mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 10000 2320.9 59.4 23208.7 497.3 12.7 1000 410.3 28.6 410 2.8 87.9 6.1 500 211.5 6.1 2114.8 45.3 1.3 250 92.6 5.6 925.7 19.8 1.2 125 55.4 7.1 55 4.4 11.9 1.5 00.00.7 0.00.00.2 50℃ Set 9 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10)y 2 (pmole) Standard Deviation 10000 246 3.69 4.5 246 35.75 8 1.42 2.31 000 35 1.92 2.93 518.58 3.05.45 00 18 3.31 3.61 832.74 3.33.2 250 70.41 9.27 4.21 6.64.51 252 0.34.3 203.14.8 1.000 0.01.60.00.00.4.
[0265]
[0266] 60℃ Set 1 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10) y2(pmole) Standard Deviation 10000 149 7.8 76.31 49 78.0 55 6.8 85.11 000 30 4.1 17.5 30 40.8 11 3.0 19.5 500 17 4.4 9.4 17 43.9 64.8 10.5 250 73.5 4.9 73 4.9 27.3 5.4 125 37.9 4.1 37 9.2 14.1 4.6 00.00.3 0.00.00.4 60℃ Set 2 Concentration (mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x10)y2(pmole)Standard Deviation 100001474.934.814749.0521.136.91000341.630.83416.1120.732.7500172.66.21725.561.06.625096.30.9962.834.01.012560.23.4602.421.33.600.00.60.00.00.760℃ Set 3 Concentration(mU) Primary Analysis Mean Slope Standard Deviation y1(Mean Slope x 10)y 2 (pmole) Standard Deviation 10000 168 9.08 2.71 689 0.35 70.98 3.8 1000 312.9 13.6 3129.31 05.8 13.8 500 145.16.8 145 0.6 49.06 92 50 72.5 3.6 725.32 4.5 3.6 125 17.31 8 173.15.9 1.8 00.01.1 0.00.01.1
[0267]
[0268] The inventors calculated the dNTP consumption for each enzyme concentration based on the time at which the fluorescence value reaches its maximum fastest among the five concentrations, i.e., 10 minutes (in the case of 10,000 mU reverse transcriptase). To this end, the y2 value calculated through the [time-fluorescence derivative] of the first analysis was applied to the y-axis of the second analysis, and the enzyme concentration was applied to the x-axis. As shown in Figures 17 and 18, a linear function was plotted through the x-axis and y-axis, and the final slope value was determined. Since the determined slope is pmole / mU, the dNTP consumption of the reference reverse transcriptase in the 50°C and 60°C reactions can be calculated by multiplying the slope value by 1000 to convert the units. Therefore, in the second analysis, the dNTP consumption of the enzyme (pmole / U) was calculated using the final slope value obtained through the second derivative through the x-axis and y-axis.
[0269]
[0270] 50℃ Set Reference Reverse Transcription Enzyme dNTP Consumption (pmole / U) 1106.4284.8378.4472.3575.7699.3779.2888.1982.4
[0271]
[0272] 60℃ Set Reference Reverse Transcription Enzyme dNTP Consumption (pmole / U) 11 16 21 22.2 31 0 3.3
[0273]
[0274] As a result, it was confirmed that 1 Unit of reverse transcriptase of SuperScript™ III (a level consuming 1 nmole of dNTPs for 10 minutes at 37°C) is equivalent to a level consuming 85.2 ± 7.3 pmole (95% confidence interval) of dNTPs for 10 minutes at 50°C (Table 5 and Fig. 17), and equivalent to a level consuming 113.8 ± 10.8 pmole (95% confidence interval) of dNTPs for 10 minutes at 60°C (Table 6 and Fig. 18). Through this, the unit of reverse transcriptase can be defined as the amount of dNTPs consumed per unit time at a unit temperature. In particular, the value 85.2 pmole / U is a figure established through 9 sets of experiments (3 minutes per set / a total of 27 times) with SuperScript™ III at 50°C, and is a value that converts the amount of dNTP consumed into a unit value. Similarly, the value of 113.8 pmole / U was established through 3 sets of experiments (3 abscissions per set / a total of 9 times) using SuperScript™ III at 60°C, and is a value that converts dNTP consumption into a unit value. Through the same experiment, the researchers confirmed that a consistent value was obtained every time, even when changing the instrument, experimenter, or reagent used, thereby securing the reliability of the measurement method for reference reverse transcriptase.
[0275] The dNTP consumption (pmole / U) of the reference reverse transcriptase calculated using the above EvaEZ™ reagent product was used to measure the intrinsic activity (U / ug) of the mutant M-MLV reverse transcriptase (1) and mutant M-MLV reverse transcriptase (2) of Example 4 below.
[0276]
[0277] (3-2) Measurement of intrinsic activity of mutant M-MLV reverse transcriptase (1)
[0278] 4.0 mg / ml of mutant M-MLV reverse transcriptase (1) prepared in Example 1 was 10X Thermopol ®The reaction buffer (New England Biolabs) and ultrapure water were used to dilute the sample to a total of four concentrations: 200 µg / µl, 100 µg / µl, 50 µg / µl, and 25 µg / µl. Meanwhile, the control M-MLV reverse transcriptase was also prepared at the same concentrations.
[0279] Next, the intrinsic activity of mutant M-MLV reverse transcriptase and control reverse transcriptase at different concentrations was measured at 50°C in the same manner as in Example 2-1. As a result, it was confirmed that the mutant M-MLV reverse transcriptase (1) containing a C-terminal deletion consumed 1,329 pmole of dNTPs in 10 minutes. On the other hand, it was confirmed that the control M-MLV reverse transcriptase without a C-terminal deletion consumed 1,010 pmole of dNTPs in 10 minutes at 50°C.
[0280] Using the above dNTP consumption, intrinsic activity was measured using the following mathematical formula 3.
[0281]
[0282] [Equation 3]
[0283] Intrinsic activity of mutant M-MLV reverse transcriptase (U / ug) = [dNTP consumption of mutant M-MLV reverse transcriptase (pmole / ug) / [dNTP consumption of reference reverse transcriptase (pmole / U)]
[0284]
[0285] As a result, as shown in Fig. 19, the control M-MLV reverse transcriptase without C-terminal deletion showed low activity with an intrinsic activity of 11.8 U / ug at 50°C. On the other hand, the mutant M-MLV reverse transcriptase (1) with C-terminal deletion showed an intrinsic activity of 15.55 U / ug at 50°C, which is about 1.3 times higher than the control. Through this, it was confirmed that C-terminal deletion can contribute to improving the intrinsic activity of reverse transcriptase.
[0286]
[0287] In addition, to determine the amount of enzyme with activity (U / ul) among the total enzymes based on the above dNTP consumption (pmole / ug) value, it was calculated using the following mathematical formula 4.
[0288]
[0289] [Equation 4]
[0290] [Amount of enzyme with activity (U / ul) out of total enzymes (U / ul)] = [Total protein mass (ug / ul)] X [Intrinsic activity of mutant M-MLV reverse transcriptase (U / ug)]
[0291]
[0292] As a result, it was confirmed that at 50°C, the amount of the mutant M-MLV reverse transcriptase (1) with activity among the total enzymes was 20.1 U / ul, while the amount of the control M-MLV reverse transcriptase was 12.4 U / ul.
[0293] As described above, through this embodiment, the amount of enzyme with activity among the total enzymes could finally be calculated using the intrinsic activity value of the mutant M-MLV reverse transcriptase (1) obtained above and the given total amount of protein. Through these results, it was confirmed that the intrinsic activity value (15.55 U / ug) of the mutant M-MLV reverse transcriptase (1) having a C-terminal deletion at 50°C was higher than the intrinsic activity value (11.8 U / ug) of the control M-MLV reverse transcriptase without a C-terminal deletion. In other words, it was confirmed that the deletion of the C-terminus can contribute to increasing the activity of the enzyme.
[0294]
[0295] In addition, the intrinsic activity of mutant M-MLV reverse transcriptase (1) was further measured at 60°C, and it was confirmed that mutant M-MLV reverse transcriptase (1) consumed 1275 pmole of dNTPs for 10 minutes at 60°C and showed an intrinsic activity of 11.2 U / µg. It was confirmed that the amount of mutant M-MLV reverse transcriptase (1) with activity among the total enzymes at 60°C was 12.32 U / µg.
[0296]
[0297] (3-3) Measurement of intrinsic activity of mutant M-MLV reverse transcriptase (2)
[0298] 4.0 mg / ml of mutant M-MLV reverse transcriptase (2) prepared in Example 2 was 10X Thermopol ® The reaction buffer (New England Biolabs) and ultrapure water were used to dilute the mixture to a total of four concentrations: 200 ug / ul, 100 ug / ul, 50 ug / ul, and 25 ug / ul.
[0299] Next, the intrinsic activity of mutant M-MLV reverse transcriptase (2) at different concentrations was measured at 50°C and 60°C, respectively, in the same manner as in Example 2-1. As a result of the reaction at 50°C, it was confirmed that the mutant M-MLV reverse transcriptase (2), which includes both deletions in the C-helix / loop region and the C-terminal deletion, consumed 1,497 pmole of dNTPs in 10 minutes. As a result of the reaction at 60°C, it was confirmed that the mutant M-MLV reverse transcriptase (2) consumed 1,911 pmole of dNTPs in 10 minutes.
[0300] Using the above dNTP consumption, intrinsic activity was measured using the following mathematical formula 3.
[0301]
[0302] [Equation 3]
[0303] Intrinsic activity of mutant M-MLV reverse transcriptase (U / ug) = [dNTP consumption of mutant M-MLV reverse transcriptase (pmole / ug) / [dNTP consumption of reference reverse transcriptase (pmole / U)]
[0304]
[0305] As a result, as shown in FIG. 20, the mutant M-MLV reverse transcriptase (2) exhibited intrinsic activity of 17.57 U / ug and 16.8 U / ug at 50°C and 60°C, respectively. It was confirmed that the intrinsic activity of the mutant M-MLV reverse transcriptase (2) was about 1.1 times higher at 50°C and about 1.5 times higher at 60°C compared to the intrinsic activity of the mutant M-MLV reverse transcriptase (1) having only a C-terminal deletion (15.55 U / ug at 50°C and 11.2 U / ug at 60°C). Through this, it was confirmed that the deletion of the C-helix / loop region can contribute to improving the intrinsic activity of the reverse transcriptase, particularly at high temperatures such as 60°C.
[0306]
[0307] In addition, to determine the amount of enzyme with activity (U / ul) among the total enzymes based on the above dNTP consumption (pmole / ug) value, it was calculated using the following mathematical formula 4.
[0308]
[0309] [Equation 4]
[0310] [Amount of enzyme with activity (U / ul) out of total enzymes (U / ul)] = [Total protein mass (ug / ul)] X [Intrinsic activity of mutant M-MLV reverse transcriptase (U / ug)]
[0311]
[0312] As a result, it was confirmed that the amount of active mutant M-MLV reverse transcriptase (2) among the total enzymes at 50°C was 43.9 U / ul, and the amount of active mutant M-MLV reverse transcriptase (2) among the total enzymes at 60°C was 35.4 U / ul.
[0313]
[0314] As described above, through this embodiment, the amount of enzyme with activity among the total enzymes could finally be calculated using the intrinsic activity value of the mutant M-MLV reverse transcriptase (2) obtained above and the given total amount of protein. Through these results, it was confirmed that the intrinsic activity value (17.57 U / ug) of the mutant M-MLV reverse transcriptase (2) containing both deletion of the C-helix / loop region and the C-terminal deletion at 50°C was 1.48 times higher than the intrinsic activity value (11.8 U / ug) of the control M-MLV reverse transcriptase, and furthermore, had an activity 1.13 times higher than the intrinsic activity value (15.55 U / ug) of the mutant M-MLV reverse transcriptase (1) having only the C-terminal deletion. In particular, it was confirmed that the intrinsic activity value (16.8 U / ug) of the mutant M-MLV reverse transcriptase (2) at 60℃ was 1.5 times higher than the intrinsic activity value (11.2 U / ug) of the mutant M-MLV reverse transcriptase (1), and it was confirmed that the deletion of the C-helix / loop region can contribute to increasing the activity of the enzyme, especially at high temperatures.
[0315]
[0316] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
1. A mutant M-MLV reverse transcriptase comprising an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, a deletion of the C-helix / loop region of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1, a deletion of the C-terminal region of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1, or a deletion of the C-helix / loop region of at least 11 consecutive amino acids corresponding to amino acids 593 to 603 of SEQ ID NO: 1 and a deletion of the C-terminal region of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO:
1.
2. The mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase has increased reverse transcriptase activity compared to SEQ ID NO:
1.
3. The mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase additionally comprises at least one amino acid substitution at a position selected from the group consisting of proline 51 (P51), leucine 52 (L52), tyrosine 64 (Y64), lysine 152 (K152), histidine 204 (H204), methionine 289 (M289) and threonine 306 (T306) of SEQ ID NO:
1.
4. The mutant M-MLV reverse transcriptase according to claim 3, characterized in that the mutant M-MLV reverse transcriptase has increased fidelity and / or thermostability compared to SEQ ID NO:
1.
5. A mutant M-MLV reverse transcriptase according to claim 3, characterized in that the amino acid substitution is selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, M289L, and T306K.
6. The mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase additionally comprises at least one amino acid substitution at a position selected from the group consisting of aspartic acid 524 (D524), glutamic acid 562 (E562), lysine 571 (K571), aspartic acid 583 (D583) and threonine 664 (T664) of SEQ ID NO:
1.
7. The mutant M-MLV reverse transcriptase according to claim 6, characterized in that the mutant M-MLV reverse transcriptase has reduced RNase H activity compared to SEQ ID NO:
1.
8. A mutant M-MLV reverse transcriptase according to claim 6, characterized in that the amino acid substitution is selected from the group consisting of D524G, E562Q, K571R, D583N and T664N.
9. The mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase additionally comprises an amino acid substitution at the position corresponding to asparagine 249 (N249) of SEQ ID NO:
1.
10. The mutant M-MLV reverse transcriptase according to claim 9, characterized in that the mutant M-MLV reverse transcriptase has increased reverse transcription ability for a difficult template compared to SEQ ID NO:
1.
11. A mutant M-MLV reverse transcriptase according to claim 9, characterized in that the amino acid substitution is N249D.
12. The mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase additionally comprises an N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO:
1.
13. The mutant M-MLV reverse transcriptase according to claim 12, characterized in that the mutant M-MLV reverse transcriptase has increased solubility compared to SEQ ID NO:
1.
14. A mutant M-MLV reverse transcriptase according to claim 1, characterized in that the mutant M-MLV reverse transcriptase additionally comprises an N-terminal SUMO tag.
15. A mutant M-MLV reverse transcriptase according to claim 14, characterized in that the N-terminal SUMO tag comprises the amino acid sequence of SEQ ID NO:
13.
16. A mutant M-MLV reverse transcriptase according to claim 14, characterized in that the mutant M-MLV reverse transcriptase has increased solubility compared to SEQ ID NO:
1.
17. A mutant M-MLV reverse transcriptase comprising an amino acid sequence having at least 95% identity with respect to amino acids 24 to 672 of SEQ ID NO: 1, and having the following: (i) N-terminal deletion of at least 23 consecutive amino acids corresponding to amino acids 1 to 23 of SEQ ID NO: 1; (ii) Deletion of at least 11 consecutive amino acids in the C-helix / loop region corresponding to amino acids 593 to 603 of SEQ ID NO: 1; (iii) C-terminal deletion of at least 5 consecutive amino acids corresponding to amino acids 673 to 677 of SEQ ID NO: 1; and (iv) At least three amino acid substitutions at positions selected from the group consisting of P51L, L52P, Y64R, K152M, H204R, N249D, M289L, T306K, D524G, E562Q, K571R, D583N and T664N of SEQ ID NO:
1.
18. A mutant M-MLV reverse transcriptase according to claim 17, characterized in that the mutant M-MLV reverse transcriptase additionally comprises an N-terminal SUMO tag.
19. The mutant M-MLV reverse transcriptase according to claim 17, characterized in that the mutant M-MLV reverse transcriptase has (i) increased reverse transcriptase activity, (ii) increased fidelity and / or thermal stability, (iii) decreased RNase H activity, (iv) increased reverse transcription ability for difficult templates and / or (v) increased solubility compared to SEQ ID NO:
1.
20. The mutant M-MLV reverse transcriptase according to claim 17, characterized in that the mutant M-MLV reverse transcriptase comprises the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11.