M-MLV reverse transcriptase mutants, methods of making and using the same

Abstract

The present application relates to the technical field of biotechnology, in particular to a kind of M-MLV reverse transcriptase mutant and its preparation method and application.The present application provides a kind of M-MLV reverse transcriptase mutant and its preparation method and application.The M-MLV reverse transcriptase mutant fuses the structural characteristics of multiple mutant variants, which has good performance in reverse transcription activity and thermal stability.Especially the M-MLV reverse transcriptase mutant Super RT with amino acid sequence as shown in SEQ ID NO.01, which has higher sustained synthesis capacity, can carry out good reverse transcription reaction on long-chain RNA template;And strong anti-inhibitory capacity can ensure the synthesis of cDNA in complex reaction environment, even in the presence of common inhibitors such as guanidine salt, heparin and salt, full-length cDNA synthesis can be completed in a short time.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an M-MLV reverse transcriptase mutant, its preparation method, and its application. Background Technology

[0002] The discovery of reverse transcriptase demonstrated that genetic information does not flow unidirectionally from DNA to RNA and then to protein; it can also be transferred from RNA to DNA in the reverse direction. The ability to reverse transcribe mature mRNA into cDNA is crucial for acquiring information in various biomedical settings, including diagnosis, prognosis, biotechnology, and forensic biology. Therefore, reverse transcriptase has become a ubiquitous tool in molecular biology.

[0003] Reverse transcriptase, initially discovered in Moloney mouse leukemia virus (MMLV), is an RNA-templated DNA polymerase composed of 671 amino acids. It consists of four subdomains (finger, palm, thumb, and linker domains) and an RNase H active domain, possessing RNase H activity but lacking 3'-5' exonuclease activity. It can be used for reverse transcription to synthesize cDNA. One of the main challenges in reverse transcription of cDNA is interference from RNA secondary structures. While higher reaction temperatures can remove the secondary structures of the template RNA, excessively high temperatures often lead to a sharp decrease in the reverse transcription activity of wild-type (WT) MMLV. Reverse transcriptase activity is also affected by various other factors, such as the presence of inhibitors in the reaction system (e.g., cell lysates and related reagents) and low-volume reaction systems, all of which negatively impact the reverse transcription activity of WT RT.

[0004] Current research demonstrates that E69K, E302R, T306K, W313F, L435G / K, and N454K (Arezi et al (2009) Nucleic Acids Res. 37(2): 473-481, US Pat. No. 7,078,208, and Baranauskas et al 2012 Prot Engineering 25(10): Alterations at sites such as L52P, Y64R, K152M, H204R, M289L, and T306K can improve thermal stability (CN1430670); alterations at sites such as L139P, D200N, T330P, P448A, D449G, L603W, and E607K can enhance full-length reverse transcription capacity, resistance to cell lysate inhibition, and higher thermal stability, while maintaining high reactivity even in reaction systems smaller than 1 nanoliter; furthermore, D52... Alterations at sites such as 4N / A can reduce or eliminate the activity of RNase H (CN110637084A); alterations at sites such as Y64W / R, K152R, Q190F, T197A / E, V223H / L / F, Y133A / H, and F309N / R can improve the fidelity of reverse transcription; while alterations at sites such as Y133A, T197E, and F309N have also been shown to reduce the activity of terminal transferases (CN1430670; US Application No. 60 / 189,454; 09 / 808,124).

[0005] Existing research has primarily employed two methods to obtain reverse transcriptases with enhanced performance: random mutagenesis and site-directed mutagenesis. Random mutagenesis involves randomly mutating amino acids in the M-MLV domain, followed by screening using various methods. This method can identify multiple performance-enhancing MMLV mutants, but it is technically complex, requires a massive mutation library (up to 10⁷), and contains a large number of invalid mutations, making screening extremely difficult. Site-directed mutagenesis is more targeted, primarily altering enzyme activity by mutating amino acids at key active sites such as nucleic acid binding sites and metal ion binding sites. However, this method lacks analysis of the overall enzyme structure and cannot improve enzyme performance from multiple perspectives. Typically, there is a balance between reverse transcriptase activity and stability; mutations at amino acid sites that increase enzyme activity may lead to decreased protein stability, while mutations at amino acid sites that increase protein stability may decrease enzyme activity. Therefore, providing a reverse transcriptase that simultaneously possesses high-temperature stability and high activity is of great significance.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides an M-MLV reverse transcriptase mutant with high reverse transcription efficiency, high temperature resistance, and strong resistance to inhibition, along with its preparation method and applications.

[0008] Specifically, the technical solution of the present invention is as follows:

[0009] In a first aspect, the present invention provides an M-MLV reverse transcriptase mutant, wherein the amino acid sequence of the reverse transcriptase mutant has one or more of the following mutations compared with the amino acid sequence of wild-type M-MLV reverse transcriptase: Y133K, T306H, T330G, L435R.

[0010] Preferably, compared with the amino acid sequence of wild-type M-MLV reverse transcriptase, the amino acid sequence of the reverse transcriptase mutant has one of the following combinations of mutations:

[0011] Mutation combination 2: Y133K, T330G;

[0012] Mutation combination 3: T306H, T330G;

[0013] Mutant combination 6: Y133K, T306H, L435R;

[0014] Mutant combination 8: Y133K, T330G, L435R;

[0015] Mutation combination 10: Y133K, T306H, T330G, L435R;

[0016] Mutant combination 18: Y133K, T306H, T330G.

[0017] Preferably, the amino acid sequence of the wild-type M-MLV reverse transcriptase is shown in SEQ ID NO.02.

[0018] Preferably, the amino acid sequence of the M-MLV reverse transcriptase mutant is shown in SEQ ID NO.01.

[0019] The M-MLV reverse transcriptase mutants provided by this invention (especially the M-MLV reverse transcriptase mutant Super RT with the amino acid sequence shown in SEQ ID NO.01) have the structural features of multiple mutant variants and have the advantages of high temperature resistance, strong anti-inhibition ability, and strong continuous synthesis ability. They overcome the difficulties of reverse transcription caused by the complex secondary structure of RNA and the problem of inhibitors inhibiting reverse transcription, and have broad application prospects and market promotion value.

[0020] Secondly, the present invention provides a coding gene having a nucleotide sequence encoding the M-MLV reverse transcriptase mutant.

[0021] Thirdly, the present invention provides a biological material, which is a recombinant plasmid or a recombinant bacterium, the biological material having the coding gene, and the M-MLV reverse transcriptase mutant can be obtained by expressing the coding gene.

[0022] Fourthly, the present invention provides a method for preparing the M-MLV reverse transcriptase mutant, comprising the following steps: expressing the M-MLV reverse transcriptase mutant using the biological material.

[0023] Fifthly, the present invention provides the application of the M-MLV reverse transcriptase mutant in the preparation of a heat-resistant reagent; the heat-resistant reagent is biologically active at 65°C.

[0024] In a sixth aspect, the present invention provides the application of the M-MLV reverse transcriptase mutant in reverse transcription reactions.

[0025] Preferably, the reverse transcription reaction contains a reverse transcription inhibitor, which is selected from at least one of guanidine salts, heparin, or salts.

[0026] Beneficial effects:

[0027] This invention provides an M-MLV reverse transcriptase mutant, its preparation method, and its applications. The M-MLV reverse transcriptase mutant incorporates structural features of multiple mutant variants, exhibiting good performance in both reverse transcription activity and thermostability. In particular, the M-MLV reverse transcriptase mutant Super RT, with an amino acid sequence as shown in SEQ ID NO. 01, possesses high sustained synthetic capacity, enabling efficient reverse transcription of long RNA templates; it also exhibits strong resistance to inhibition, ensuring cDNA synthesis even in complex reaction environments, and can complete the synthesis of full-length cDNA in a short time even in the presence of common inhibitors such as guanidine salts, heparin, and salts. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0029] Figure 1 This is a schematic diagram of the construction of a reverse transcriptase mutant plasmid.

[0030] Figure 2 The results are from SDA-PAGE analysis of reverse transcriptase mutant protein samples; lanes 1-18 represent the mutant protein samples tested, and M represents the protein molecular weight standard.

[0031] Figure 3Agarose gel electrophoresis image for detecting reverse transcription activity of reverse transcriptase mutants; lanes 1-18 represent PCR detection of reverse transcription products from different reverse transcriptase mutants, and M is the DNA molecular weight standard.

[0032] Figure 4 The results show the thermostability of reverse transcriptase; the top figure shows the electrophoresis results of cDNA obtained by reverse transcription of mutant 10 at different temperatures after PCR, and the bottom figure shows the Maxima control.

[0033] Figure 5 This is a schematic diagram of electrophoresis for detecting the continuous synthetic ability of mutant 10; lanes 1-3 show the detection results of the 3 kb, 6 kb, and l2 kb positions corresponding to mutant 10, and lanes 4-6 show the detection results of the 3 kb, 6 kb, and l2 kb positions corresponding to Maxima. Detailed Implementation

[0034] This invention obtains a reverse transcriptase variant through one or more amino acid mutations, which exhibits one or more changes in activity and has a significant performance improvement.

[0035] The present invention also provides a specific method for obtaining the reverse transcriptase mutant and expressing and purifying it, comprising the following steps:

[0036] (1) Plasmid construction: The wild-type M-MLV reverse transcriptase (WT MMLV) sequence was obtained through gene synthesis based on the gene CCA64130.1. The pET 28b(+) vector and the synthesized WT-MMLV (nucleotide sequence as shown in SEQ ID NO.03) were digested and recovered by restriction endonucleases Nhe I and EcoR I, and then ligated and inserted into the pET 28b(+) plasmid using T4 DNA ligase, so that the expression cassette of WT MMLV was consistent with the histidine purification tag 6xHis purification tag on the vector. The reverse transcriptase mutants were constructed using pET 28b-M-MLV as a template. Primers were designed at the pre-selected mutation sites, and the mutation sites were introduced using the Hieff Mut™ MultiSite-Directed Mutagenesis Kit. The mutant expression vectors were obtained according to the construction method of pET 28b-M-MLV. The mutants were sequenced and confirmed, and a total of 18 mutant plasmids were obtained.

[0037] (2) Construction of recombinant expression strains: The constructed expression plasmids numbered 1-18 and wild-type pET28b-M-MLV (number 19) were mixed with Escherichia coli competent cells DH5α, incubated on ice for 15 min, heat-shocked at 42℃ for 90 s, centrifuged, plated on Kana plates, and cultured overnight at 37℃; single clones were picked and cultured in 4 ml LB (Kana) in a shaker at 30℃~40℃ and 150~220 rpm.

[0038] (3) Mutant screening: The constructed recombinant expression strain was cultured at 30℃~40℃ until the OD value reached 0.4~0.6, and then IPTG was added to a final concentration of 0.2mM~0.8mM. The strain was then cultured at 150rpm~220rpm at 15~17℃ for 10~18 hours (h) to induce expression. The cells were collected by centrifugation at 5000g for 10 minutes (min) at 4℃. The cells were fully resuspended with B-PER bacterial protein extraction reagent, allowed to stand, vortexed and mixed, and then centrifuged at low temperature to obtain the supernatant, which was the crude extract of mutant enzyme. Different crude extracts of mutant enzyme were subjected to SDS-PAGE electrophoresis to detect whether the target protein was expressed. The crude extracts of mutant enzyme with protein expression were screened for reverse transcription activity at different temperatures: using mouse liver total RNA as a template, reverse transcription reaction was performed. The following reaction components were added to the reaction tube containing 1 μg total RNA: 5X RT Buffer 4μL, Thermo Scientific RiboLockRNase Inhibitor (#EO0381). 0.5 μL (20 U), dNTP Mix (10 mM each (#R0191)), 1 μL Random Hexamer (#SO142), and 1 μL of crude extract of mutant enzyme were added to a final volume of 20 μL with Nuclease-free Water and reacted at 37℃~45℃. After the reaction, the reaction was terminated by incubation at 75℃~85℃ for 15s~30s. 2 μL of the reverse transcription product was used as a template for PCR amplification using high-fidelity enzyme Kapa Hifi and specific primers for the β-actin gene. The amplification was then detected by 0.8% agarose gel electrophoresis. If a PCR amplification band was present, the crude extract of mutant enzyme was considered to have reverse transcription activity.

[0039] (4) Protein induction expression: The mutant enzyme cells identified as positive were cultured at a ratio of 1:100 (1 ml of bacterial culture, 100 ml of LB containing kanamycin) at 37℃ and 150 rpm to 220 rpm until the OD060 value was about 0.6 to 0.8. IPTG was added to each bottle of LB medium to a final concentration of 0.2 mM to 0.8 mM and induced at 15℃ to 17℃ for about 10 to 18 h. After induction, the cells were collected by centrifugation at 5000g for 10 min to 20 min at 4℃.

[0040] (5) Protein purification: Resuspend in 5-10 mL Binding / Wash Buffer, add 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, to a final concentration of 1 mM PMSF (protease inhibitor), sonicate, centrifuge at 10000g~12000g for 20-30 min, collect the supernatant at 4℃, filter through a 0.22 μm filter membrane and transfer to a new tube. Purify with nickel affinity resin, add an equal volume of 100% glycerol to the purified solution, mix well and store at 20℃. Ni affinity chromatography buffers include: Equilibration buffer: 10-30 mM Tris-HCl, pH 7.5, 300-500 mM NaCl, 0.05% (v / v) NP-40, 5% glycerol; Wash buffer: 10-30 mM imidazole, 10-30 mM Tris-HCl, pH 7.5, 300-500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol; Gradient elution buffer: 50-200 mM imidazole, 10-30 mM Tris-HCl, pH 7.5, 300-500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol.

[0041] The preferred technical solution of the preparation method of high-performance M-MLV reverse transcriptase described in this invention is as follows: Step (3) Screening of mutants: The constructed recombinant expression strain is cultured at 37℃ and 200rpm until the OD value is 0.6, and then IPTG with a final concentration of 0.4 mM is added to induce expression at 16℃ and 200 rpm; the bacterial cells are collected by centrifugation; the bacterial cells are fully resuspended with B-PER bacterial protein extraction reagent and then allowed to stand at room temperature for 15min, shaken and mixed for 1min, and then the supernatant is collected by centrifugation. The obtained supernatant is the crude extract of mutant enzyme; different crude extracts of mutant enzyme are subjected to SDS-PAGE electrophoresis to detect whether the target protein is expressed.

[0042] The crude extract of the mutant enzyme, which was identified as positive for protein expression, was screened for reverse transcription activity at different temperatures (37℃~70℃): Reverse transcription was performed using mouse liver total RNA as a template. The following reaction components were added to a reaction tube containing 1 μg of total RNA: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mM each (#R0191)), 1 μL of Random Hexamer (#SO142), and 1 μL of the crude extract of the mutant enzyme, using Nuclease-free... Water was added to bring the total volume to 20 μL, and the reaction was carried out at different reaction temperatures from 37℃ to 60℃. After the reaction was completed, the reaction was terminated by incubation at 75℃ to 80℃ for 15 to 30 seconds. 2 μL of the reverse transcription product was used as a template for PCR amplification, and the amplification was detected by 0.8% agarose gel electrophoresis. The observation of PCR amplification bands indicates that the crude extract has reverse transcription activity.

[0043] The preferred technical solution of the preparation method of the high-performance M-MLV reverse transcriptase of the present invention is as follows: In step (3) expression of reverse transcriptase mutants: the mutants with positive screening results are cultured in liquid LB until the OD value is 0.6, IPTG is added to a final concentration of 0.4 mM, and cultured at 16℃ and 200 rpm for 16 h to induce protein expression; the culture medium after IPTG induction is centrifuged at 5000g for 10 min to collect the cells.

[0044] A further preferred embodiment of the method for preparing the high-performance M-MLV reverse transcriptase described in this invention is as follows: In step (4) purification of the reverse transcriptase mutant: the induced bacterial culture is centrifuged at 5000g for 10 min to collect the bacterial cells; the cells are resuspended in 8 mL Binding / Wash Buffer, and 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, and the final concentration is 1 mM PMSF (protease inhibitor). The mixture is sonicated, centrifuged at 10000g for 20 min, and the supernatant is collected at 4℃. After filtration through a 0.22 μm filter membrane, the supernatant is transferred to a new tube. The supernatant is purified using a Ni affinity chromatography column and collected in single tubes stepwise, and then detected by SDS-PAGE electrophoresis.

[0045] The preferred technical solution of the preparation method of the high-performance M-MLV reverse transcriptase of the present invention is as follows: the activity of M-MLV reverse transcriptase is detected by the following method: the activity of reverse transcriptase is determined by isotope method; the system is as follows: 50Mm Tris-HCl, pH 8.0, 20Mm NaCl, 10mM MgCl2, 8mM DTT, 50 uM [3H] dTTP, 1 μM template-primer mixture, the template-primer mixture consists of poly(A) and 16 units of oligo(T), 1 pmol enzyme; water is added to make up to 30 μL and incubated at 37℃ for 10 min, 20 μL of 0.5M EDTA is added to terminate the reaction; then the content of poly(A)-oligo(dT) is determined by acid precipitation method, and the enzyme activity is determined by the content of poly(A)-oligo(dT); under 37℃ conditions, using Poly(A)-oligo(dT) as template / primer, 1 pmol of enzyme is incorporated into the enzyme within 10 min. The amount of enzyme required for nmol[3H]dTTP to enter acid-insoluble substances is defined as one active unit.

[0046] A further preferred embodiment of the method for preparing the high-performance M-MLV reverse transcriptase described in this invention is as follows: The thermostability of the M-MLV reverse transcriptase is tested using the following method: Mouse liver total RNA is used as a template, and reverse transcription is performed at different temperatures. The following reaction components are added sequentially to a reaction tube containing the RNA template: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of ThermoScientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mMeach (#R0191)), 1 μL of Random Hexamer (#SO142), and 200 U of purified reverse transcriptase, using a nuclease-free... Water volume was increased to 20 μL, and the reaction was carried out at different temperatures (37℃, 42℃, 45℃, 50℃, 55℃, and 65℃) for 20 min. After the reaction, the reaction was terminated by incubation at 85℃ for 15 s. Using 2 μL of reverse transcription product as a template, TaqMan real-time PCR was performed using Taq-HSProbe qPCR Premix and a probe targeting the β-Actin gene. The amplification curve was used to determine the reverse transcription and cDNA synthesis. Commercial reverse transcriptase Maxima was used as a control.

[0047] A further preferred embodiment of the method for preparing the high-performance M-MLV reverse transcriptase described in this invention is as follows: The cDNA synthesis length of the M-MLV reverse transcriptase is detected using the following method: Reverse transcription is performed using total RNA extracted from human blood as a template. The following reaction components are added sequentially to a reaction tube containing the RNA template: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of ThermoScientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mMeach (#R0191)), 1 μL of Random Hexamer (#SO142), and 200 U of purified reverse transcriptase. The volume is then increased to 20 μL with Nuclease-free Water, and the mixture is incubated at 85℃ for 10 minutes. The reaction was terminated by s; based on the human HER1 gene sequence, three pairs of specific primers were designed at positions 3 kb, 6 kb, and 12 kb from the 5' end of its cDNA, with the theoretical length of the amplified fragment being 1 kb; using the reverse transcription product as a template, PCR amplification was performed using high-fidelity Kapa HiFi polymerase and the above three pairs of primers, and the agarose gel electrophoresis was performed to detect the amplified fragment length; the commercial reverse transcriptase Maxima was used as a control.

[0048] The transcriptase variants obtained by this invention can screen for highly thermostable M-MLV reverse transcriptases within a defined range, with a heat resistance up to 65℃, which is higher than that of commercially available M-MLV reverse transcriptases reported previously, and has great application value.

[0049] Extensive experimental data from the high-performance M-MLV reverse transcriptase variant of this invention show that as the binding affinity between the reverse transcriptase and its substrate increases, the thermal stability of the reverse transcriptase also improves. This phenomenon provides a theoretical basis for further modifying and enhancing other properties of the M-MLV reverse transcriptase.

[0050] In this invention, through sequence alignment and three-dimensional structure analysis of M-MLV reverse transcriptase, point mutations were designed targeting the reported amino acid regions that directly participate in substrate binding, resulting in the loss or reduction of RNase H binding activity, thus constructing multiple mutant strains. Through identification and screening, a mutant with enhanced thermostability, number 10 (Y133K, T306H, T330G, L435R), was obtained and successfully prepared in large quantities. This study shows that mutant number 10 has a thermostability of up to 65℃ and can synthesize cDNA up to 11 kb in length, demonstrating promising application prospects. (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT)

[0051] The reaction buffer for the reverse transcriptase of this invention not only maintains the optimal pH and ionic strength for the reaction, but also contains additives to improve reverse transcription efficiency. For example, Tris HCl provides a stable buffer environment (pH 6.0-9.0), KCl2 not only creates a high-salt environment but also does not readily react with other bioactive substances, maximizing the protection of reverse transcriptase activity, MgCl2 can simultaneously increase both reverse transcriptase activity and DNA polymerase activity, and DTT is a reducing agent commonly used to provide optimal enzyme activity. The purpose of this invention is to provide a reverse transcriptase mutant with high reverse transcription efficiency, high temperature resistance, and strong continuous synthesis capability.

[0052] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects: (1) The present invention screened a reverse transcriptase mutant that is heat-resistant and has high reverse transcription efficiency. (2) The reverse transcriptase mutant with high reverse transcription efficiency screened by the present invention has a significantly higher amplification efficiency than the wild-type M-MLV enzyme under the same conditions, thus significantly improving the detection efficiency. (3) The present invention screened from multiple mutants and finally screened out a heat-resistant reverse transcriptase mutant that can still maintain a high reverse transcription efficiency at a reverse transcription temperature of 65℃, which has an unexpectedly excellent effect. (4) Under high temperature conditions (65℃), compared with the wild type, the reverse transcriptase mutant of the present invention has an increased reverse transcription efficiency of about 49 times, achieving unexpected technical effects.

[0053] The sequences involved in this invention include:

[0054] Super M-MLV amino acid sequence (SEQ ID NO.01)

[0055] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIILLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPKNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALRRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGHAGFCRLWIPGFAEMAAPLYPLTKGGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVIRAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALRMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLIN

[0056] Wild-type M-MLV amino acid sequence (SEQ ID NO.02)

[0057] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIILLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALRRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALRMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLIN

[0058] Gene-synthesized wild-type M-MLV nucleotide sequence (SEQ ID NO.03)

[0059]

[0060] Mouse β-actin specific primers:

[0061] F:TGTGACGTTGACATCCGTAAAG(SEQ ID NO.04)

[0062] R:TCAGTAACAGTCCGCCTAGAA(SEQ ID NO.05)

[0063] Primer sequences for the HERCl gene (SEQ ID NO. 06~11)

[0064] HERCl-3kb-F:AGCACTGTGGCAGCGGCCAG (SEQ ID NO.06)

[0065] HERCl-3kb-R: GAAGAAATGTAATGGTACCT(SEQ ID NO.07)

[0066] HERCl-6kb-F: CAGCTTCTGCCAGCTGTCCAT(SEQ ID NO.08)

[0067] HERCl-6kb-R: CGCAGCAATGGTTCCTATGT (SEQ ID NO.09)

[0068] HERCl-12kb-F: ATAGCCCTGGCGGTTTGCACT(SEQ ID NO.10)

[0069] HERCl-12kb-R: CTGGTGTAGAAGATGATCAA(SEQ ID NO.11)

[0070] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are all conventional methods; the materials and reagents used are all commercially available.

[0071] Example 1

[0072] This embodiment describes the M-MLV reverse transcriptase mutant and its preparation method, as detailed below:

[0073] 1. Materials and Methods

[0074] 1.1 Experimental Materials

[0075] 1.1.1 Bacterial strains, plasmids and other biological materials

[0076] DH5a and BL21 (DE3) were purchased from Novizan Biotechnology Co., Ltd., and plasmid pET-28b was purchased from Sangon Biotech Co., Ltd. Mouse liver RNA was extracted with Trizol, and total RNA from tomato leaf tissue was obtained by EasyPurePlant RNA Kit from TransGen Biotech Ltd.

[0077] 1.1.2 Reagents: Restriction endonucleases, T4 DNA Ligase, KOD Site-Directed Mutagenesis Kit, Taq-HS Probe qPCR Premix, antibiotics, IPTG, etc., were purchased from Novizan Biotechnology Co., Ltd.; Nuclease-free water, high-fidelity Kapa Hifi polymerase, Maxima reverse transcriptase, and B-PER Reagent were purchased from Thermofisher Scientific; DNA Marker and protein Marker were purchased from Sangon Biotech Co., Ltd.; primer synthesis, probe synthesis, gene synthesis, and sequencing were performed by Sangon Biotech Co., Ltd.

[0078] 1.2 Experimental Methods

[0079] 1.2.1 Bioinformatics Analysis: Homologous sequence searching of the wild-type M-MLV reverse transcriptase gene sequence (GenBank: CCA64130.1) was performed using the BLAST function of the National Center for Biotechnology Information (NCBI). Sequence analysis and alignment were performed using DNAstar software. Three-dimensional structure analysis was performed using PyMOL Molecular Graphics System software.

[0080] 1.2.2 The gene sequence of wild-type M-MLV reverse transcriptase (GenBank: CCA64130.1) was obtained through gene synthesis. The synthesized sequence included an NheI restriction site added to the 5' end, a TAA stop codon added to the 3' end, and an EcoRI restriction site. The pET-28b(+) vector and the synthesized WT-MMLV were digested and recovered using restriction endonucleases NheI and EcoRI, and then ligated into the plasmid pET-28b(+) using T4 DNA ligase. The ligated plasmid was transformed into competent DH5α cells, and after amplification, the recombinant plasmid pET28b-M-MLV was extracted and sequenced to confirm its correctness. The reverse transcriptase produced after induction of expression from this plasmid had a 6xHis purification tag fused to its N-terminus. The reverse transcriptase mutants were constructed using plasmid pET28b-M-MLV as the original template. Specific primers were designed at pre-selected mutation sites, and directional point mutations were introduced using the Hieff Mut™ Multi Site-Directed Mutagenesis Kit. The sequences of all constructed mutant plasmids were confirmed by sequencing.

[0081] 1.2.3 Screening of mutants

[0082] The constructed mutant and wild-type pET28b-M-MLV were cultured at 37℃ until the OD value reached 0.6, then IPTG was added to a final concentration of 0.4 mM, and the mixture was cultured at 16℃ and 200 rpm for 16 h to induce expression. The cells were collected by centrifugation at 5000g for 10 min at 4℃. The cells were resuspended thoroughly with B-PER bacterial protein extraction reagent, allowed to stand, vortexed, and then centrifuged at low temperature to obtain the supernatant, which was the crude extract of the mutant enzyme. Different crude extracts of the mutant enzyme were subjected to SDS-PAGE electrophoresis to observe whether the target protein was expressed. The crude extracts of the mutant enzyme showing protein expression were screened for reverse transcription activity at different temperatures: using mouse liver total RNA as a template, reverse transcription was performed. The following reaction components were added to a reaction tube containing 1 μg of total RNA: 4 μL of 5X RTBuffer, 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), and 10 mM dNTP Mix (each). 1 μL of Random Hexamer (#SO142) and 1 μL of crude extract of mutant enzyme were added to a final volume of 20 μL with Nuclease-free Water and reacted at 42 °C. After the reaction, the reaction was terminated by incubation at 85 °C for 15 s. 2 μL of the reverse transcription product was used as a template for PCR amplification using high-fidelity enzyme Kapa Hifi and specific primers for the β-actin gene (SEQ ID NO. 04~05). The amplification was then detected by 0.8% agarose gel electrophoresis. If a PCR amplification band was present, the crude extract of mutant enzyme was considered to have reverse transcription activity.

[0083] 1.2.4 Protein Induction Expression and Purification

[0084] The identified mutant enzyme cells were cultured at a ratio of 1:100 (1 ml bacterial culture, 100 ml LB medium containing kanamycin) at 37°C and 200 rpm until the OD60 value reached approximately 0.6. IPTG was added to each LB medium bottle to a final concentration of 0.4 mM, and expression was induced at 16°C for 16 h. After induction, the cells were collected by centrifugation at 5000 g for 10 min at 4°C. The cells were resuspended in 5 mL Binding / Wash Buffer, and 0.2 mg / mL lysozyme, 20 μg / mL DNase, 1 mM MgCl2, and a final concentration of 1 mM PMSF (protease inhibitor) were added. The mixture was sonicated and centrifuged at 10000 g–12000 g for 20 min, and the supernatant was collected at 4°C. The supernatant was purified using nickel affinity resin, and the purified solution was mixed with an equal volume of 100% glycerol and stored at -20°C. Ni affinity chromatography buffers include: Equilibration buffer: 10 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.05% (v / v) NP-40, 5% glycerol; Wash buffer: 10 mM imidazole, 10 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol; Gradient elution buffer: 100 mM imidazole, 20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.01% (v / v) NP-40, 5% glycerol.

[0085] 2 Results

[0086] 2.1 Construction of M-MLV mutant clones

[0087] A total of 18 mutants and 1 wild-type M-MLV were obtained through the construction of mutant plasmids. The mutants were screened based on protein expression and whether they had reverse transcriptase activity. The results showed that mutants 2, 3, 6, 8, 10 and 18 successfully expressed reverse transcriptase protein and had reverse transcriptase activity. Their main mutation points were Y133K, T306H, T330G, L435R and their combinations, as detailed in Table 1.

[0088] Table 1. List of reverse transcriptase mutant combinations

[0089]

[0090] The sequence of wild-type M-MLV reverse transcriptase was obtained through gene synthesis and ligated with the vector pET-28b to form a recombinant expression vector. Site mutations in the M-MLV reverse transcriptase mutants were introduced sequentially using specific mutation primers based on the principle of site-directed mutagenesis. The resulting recombinant expression vector (pET28b-M-MLV) produced a fusion protein with a 6xHis affinity purification tag (His Tag) at the N-terminus after induction. A total of 18 reverse transcriptase mutants were constructed.

[0091] 2.2 Screening and washing of M-MLV reverse transcriptase mutants

[0092] Eighteen mutants were screened based on protein expression and reverse transcription activity, with wild-type M-MLV serving as a control. The results showed that six mutants successfully expressed the M-MLV reverse transcriptase protein (…). Figure 2 At 37℃, the reverse transcription products of wild type and mutants 2, 3, 6, 8, 10, and 18 showed specific bands after PCR, indicating reverse transcription activity. Figure 3 ).

[0093] Example 2

[0094] M-MLV reverse transcriptase mutant performance testing

[0095] 1. Detection of reverse transcriptase thermal stability

[0096] Using total RNA from mouse liver as a template, reverse transcription was performed at 37℃–70℃. The following reaction components were added sequentially to the reaction tube containing the RNA template: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), 10 mM dNTP Mix (each (#R0191)), 1 μL of Random Hexamer (#SO142), and 200 U of purified reverse transcriptase. The total volume was brought to 20 μL with nuclease-free water. The reaction was carried out at different temperatures (37℃, 42℃, 45℃, 50℃, 55℃, 60℃, 65℃, 70℃) for 20 minutes. min; after the reaction, incubate at 85℃ for 15s to terminate the reaction; use 2μL of reverse transcription product as a PCR template, and identify the reverse transcriptase variant 10 and PCR targeting the β-Actin gene using PCR, and determine the reverse transcription and cDNA synthesis based on electrophoresis bands; use commercial reverse transcriptase Maxima as a control ( Figure 4 ).

[0097] 2. Detection of reverse transcriptase cDNA synthesis length

[0098] Reverse transcription was performed using total RNA extracted from human blood as a template. The following reaction components were added sequentially to the reaction tube containing the RNA template: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mM each (#R0191)), 1 μL of Random Hexamer (#SO142), and 200 U of purified reverse transcriptase. The total volume was brought to 20 μL with Nuclease-free Water, and the reaction was terminated by incubation at 85℃ for 15 s. Based on the human HER1 gene sequence, three pairs of specific primers (SEQ ID NO. 06~11) were designed at positions 3 kb, 6 kb, and 12 kb from the 5' end of the cDNA. The theoretical length of the amplified fragments was 1 kb. Using the reverse transcription product as a template, PCR amplification was performed using high-fidelity Kapahifi polymerase and the above three pairs of primers, followed by agarose gel electrophoresis to determine the length of the synthesized cDNA. Commercial reverse transcriptase Maxima was used as a control. Figure 5 ).

[0099] 3 Results

[0100] 3.1 Results of reverse transcriptase thermostability test

[0101] Observation of PCR electrophoresis of reverse transcription products at different temperatures showed that the electrophoretic bands of mutant 10 did not change significantly at temperatures ranging from 55℃ to 65℃, indicating that the cDNA content of mutant 10 remained essentially consistent between 55℃ and 65℃. In contrast, the commercial reverse transcriptase Maxima from the control group showed significant differences in electrophoretic bands under the same conditions, with the bands being significantly weaker than those of mutant 10. This result indicates that mutant 10 still possesses high reverse transcription activity at 65℃. Figure 4 ).

[0102] 3.2 Results of reverse transcriptase cDNA synthesis length detection

[0103] The length of the synthesized cDNA was determined by electrophoresis. The results showed that the cDNA obtained by reverse transcription of mutant 10 could reach a length of up to 12 kb, while the control group, synthesized using the commercial reverse transcriptase Maxima, only reached a length of 6-7 kb. This indicates that mutant 10 can synthesize longer cDNA. Figure 5 ).

[0104] Example 3

[0105] Detection of mouse β-actin gene using reverse transcription reaction system

[0106] Using mouse liver total RNA as a template, it was divided into original fractions and 10 fractions. -1 , 10 -3 , 10 -5 , 10 -6 , 10 -7 and 10 -8 Dilute the gradient and then proceed with the subsequent RT-PCR detection steps in this embodiment. Add the following reaction components sequentially to the reaction tube containing the diluted RNA template: 4 μL of 5X RT Buffer (200 mM Tris-HCl (pH 8.3 at 25℃), 350 mM KCl, 12 mM MgCl2, 50 mM DTT), 0.5 μL (20 U) of Thermo Scientific RiboLock RNase Inhibitor (#EO0381), dNTP Mix (10 mM each (#R0191)), 1 μL of Random Hexamer (#SO142), and 200 U of purified reverse transcriptase (No. 10). Make up the total volume to 20 μL with Nuclease-free Water. Incubate at 65℃ for 20 minutes at different reaction temperatures. min; after the reaction, incubate at 85℃ for 15s to terminate the reaction; use 2μL of reverse transcription product as PCR template, PCR is performed with reverse transcriptase variant 10 and primers targeting the β-Actin gene, and the reverse transcription of cDNA is judged based on the electrophoretic bands; commercial reverse transcriptase Maxima is used as a control.

[0107] The results showed that the detection limits of the reverse transcriptase variant 10 in this application and Maxima were 10 and 10, respectively. -7 Dilution gradient with 10 -6 The dilution gradient demonstrates that the reverse transcriptase provided in this invention has better sample detection performance compared to Maxima.

[0108] The embodiments described above are merely illustrative of several implementations of the present invention, designed to facilitate a detailed understanding of the technical solutions of the present invention, but should not be construed as limiting the scope of protection of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. An M-MLV reverse transcriptase mutant, characterized in that, The amino acid sequence of the M-MLV reverse transcriptase mutant is shown in SEQ ID NO.

01.

2. A gene encoding a gene, characterized in that, The encoding gene encodes the nucleotide sequence of the M-MLV reverse transcriptase mutant of claim 1.

3. A biomaterial, characterized in that, The biological material is a recombinant plasmid or a recombinant bacterium, and the biological material has the encoding gene as described in claim 2.

4. The method for preparing the M-MLV reverse transcriptase mutant according to claim 1, characterized in that, The procedure includes the following steps: expressing the M-MLV reverse transcriptase mutant using the biological material described in claim 3.

5. The application of the M-MLV reverse transcriptase mutant of claim 1 in the preparation of a heat-resistant reagent; the heat-resistant reagent is biologically active at 65°C.

6. The application of the M-MLV reverse transcriptase mutant of claim 1 in reverse transcription reaction, wherein the application is for non-disease diagnostic and therapeutic purposes.

Images