Use of TERT gene in detection of residual ipscs

By using the TERT gene as a detection marker, combined with transcriptomics and proteomics methods, and utilizing RNA-seq and qPCR technologies, the challenge of detecting residual iPSCs was solved, enabling efficient screening of undifferentiated pluripotent stem cells.

WO2026092716A1PCT designated stage Publication Date: 2026-05-07SHENZHEN GENOCURY BIOTECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/131958
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-31
Filing Date
2025-10-31
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively detecting the presence of induced pluripotent stem cells (iPSCs) in differentiated cells, especially methods that detect iPSC cell residues in functional cells derived from iPSC differentiation.

Method used

Using the TERT gene as a detection marker, transcriptomics and proteomics methods were employed, along with techniques such as RNA-seq and qPCR, to detect the expression level of the TERT gene. Specific primer combinations were then used for screening to ensure the detection of undifferentiated pluripotent stem cells.

Benefits of technology

It significantly improves the accuracy of iPSC residual detection. The expression difference of the TERT gene in iPSC is significantly greater than that of other pluripotency genes. It can serve as an effective target in iNK cells, enabling efficient screening of residual undifferentiated pluripotent stem cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025131958_07052026_PF_FP_ABST
    Figure CN2025131958_07052026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed in the present invention is the use of a TERT gene in the detection of residual iPSCs, which can effectively detect the presence of residual iPSCs in differentiated cells derived from hiPSCs, such as iNK cells.
Need to check novelty before this filing date? Find Prior Art

Description

Application of TERT gene in the detection of iPSC residues Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the TERT gene in the detection of iPSC residues. Background Technology

[0002] Induced pluripotent stem cells (iPSCs) are a type of pluripotent cell with self-renewal and self-replication capabilities. They can differentiate into all cell types in the body and have broad clinical application prospects. iPSCs possess unlimited proliferative capacity and can form teratomas in vivo; therefore, to apply iPSC technology to regenerative medicine and provide patients with transplantable cells or tissues, we must ensure the safety of iPSC-derived cells or organs, that is, we must ensure that undifferentiated iPSC cells are excluded from differentiated cells. Therefore, detecting residual iPSC cells in functional cells derived from iPSC differentiation has become paramount in the clinical use of iPSCs. Currently, the following methods are used to detect residual iPSCs: 1) immunofluorescence staining; 2) flow cytometry; 3) culture method; 4) RT-qPCR detection method. Summary of the Invention

[0003] In view of this, one aspect of the present invention provides a method for screening residual undifferentiated pluripotent stem cells in a cell population derived from pluripotent stem cells (PSCs), comprising detecting the expression of a marker in the cell population, said marker being TERT (Telomerase reverse transcriptase).

[0004] This invention does not impose any particular restrictions on the TERT gene sequence; any sequence derived from the TERT gene can be used. Preferably, the TERT gene is derived from pluripotent stem cells.

[0005] In some embodiments of the present invention, the TERT gene comprises at least one of the following DNA fragments:

[0006] The nucleotide sequence is shown in SEQ ID NO:1.

[0007] In some embodiments of the present invention, the pluripotent stem cells are human iPSCs.

[0008] In some embodiments of the present invention, the cell population comprises differentiated cells derived from human iPSCs.

[0009] In some embodiments of the present invention, the differentiated cells are NK cells (iNK cells).

[0010] In some embodiments of the present invention, the detection is selected from one or more of transcriptomics detection methods and proteomics detection methods.

[0011] In some embodiments of the present invention, the transcriptomics detection method is selected from one or more of RNA sequencing (RNA-seq), quantitative PCR (qPCR), and microarray.

[0012] In some embodiments of the present invention, the proteomics detection method is selected from one or more of mass spectrometry (MS), protein microarray, enzyme-linked immunosorbent assay (ELISA), and Western blotting.

[0013] In some embodiments of the present invention, quantitative PCR (qPCR) is used to detect the expression of the marker TERT in the cell population.

[0014] In some embodiments of the present invention, the qPCR is selected from one or more of RT-qPCR and dd-qPCR.

[0015] This invention also provides the use of a substance for detecting the expression level of a biomarker in any of the following:

[0016] A1. Application in the preparation of products for the detection of undifferentiated pluripotent stem cells;

[0017] A2. Application in constructing a model of the differentiation process of pluripotent stem cells;

[0018] The marker is TERT.

[0019] The present invention also provides a set of primer combinations for detecting TERT, the nucleotide sequence of the forward primer is shown in SEQ ID NO:2: TCACGGAGACCACGTTTCAAA;

[0020] The nucleotide sequence of the reverse primer is shown in SEQ ID NO:3: TTCAAGTGCTGTCTGATTCCAAT.

[0021] In some embodiments of the present invention, the kit comprises the primer combination described above. Beneficial effects

[0022] The inventors of this invention have discovered that, compared to the pluripotency genes OCT4, SOX2, and NANOG, the expression of the TERT gene in hiPSCs differs significantly from its expression in iNK cells, and can serve as an effective target for detecting hiPSC remnants in iNK cells.

[0023] In this article:

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise stated, conventional methods of chemistry, biochemistry, biophysics, molecular biology, cell biology, genetics, immunology, and pharmacology known to those skilled in the art are employed in the practice of this invention.

[0025] Unless otherwise stated, the use of any and all instances or exemplary wording provided herein (e.g., “such”) is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention. Nothing in the specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0026] Throughout this application, the terms "method" and "scheme" are used interchangeably when referring to cell differentiation processes. As used herein, "an," "a," or "the" may mean one or more. Unless otherwise stated in this specification, terms presented in the singular also include plural cases. As used herein, "and / or" means and covers any and all possible combinations of one or more of the associated listed items, and when interpreted in an alternative manner ("or"), it means the absence of a combination. Furthermore, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted.

[0027] Generally, unless otherwise stated, "Day 0" refers to the start of a protocol, which is carried out by, for example but not limited to, plating or transferring stem cells to an incubator, or by contacting stem cells with compounds in their current cell culture medium prior to transfer. Typically, a protocol is started by transferring undifferentiated stem cells to a different cell culture medium and / or container, for example but not limited to plating or incubation, and / or by initially contacting undifferentiated stem cells with compounds that affect undifferentiated stem cells in a manner that initiates the differentiation process.

[0028] The method of the present invention is described in more detail below by way of non-limiting embodiments and examples. A method for screening cell populations of PSCs or PSC-like cells is provided.

[0029] Pluripotent stem cells (PSCs) should be understood as undifferentiated cells that possess differentiation potential and proliferative capacity (especially self-renewal capacity) but retain differentiation potential. Based on differentiation potential, stem cells include subpopulations such as PSCs, multipotent stem cells, and unipotent stem cells. PSCs are stem cells capable of being cultured in vitro and possessing the potential to differentiate into any cell lineage belonging to the three germ layers (ectoderm, mesoderm, and endoderm). Multipotent stem cells are stem cells with the potential to differentiate into multiple types of tissues or cells (but not all types). Unipotent stem cells are stem cells with the potential to differentiate into a specific tissue or cell. PSCs can be induced from fertilized eggs, cloned embryos, germ cells, stem cells in tissues, somatic cells, etc. Examples of PSCs include embryonic stem cells (ES cells), EG cells (embryonic germ cells), induced pluripotent stem cells (iPSCs), etc. Muse cells (multi-lineage differentiated continuous stress cells) obtained from mesenchymal stem cells (MSCs) and GS cells derived from germ cells (e.g., testes) are also included in PSCs. iPSCs are a type of PSC that can be generated directly from adult cells. Adult cells can be converted into PSCs by introducing the product of a specific set of pluripotency-related genes. Embryonic stem cells can be generated by culturing cells from blastomeres or the inner cell mass of the blastocyst. These cells can be obtained without destroying the embryo. Embryonic stem cells can be obtained from given tissue institutions or commercially available.

[0030] As used herein, the term “cell population” refers to a defined group of cells, which may be in vitro or in vivo.

[0031] Typically, the group of cells is isolated into a container in vitro. In a preferred embodiment, the method according to the invention is performed in vitro. In one embodiment, the in vitro container is a suitable substrate, such as a micropore.

[0032] As used in this article, the term “contaminated residual undifferentiated stem cells” refers to a subset of PSCs in a cell population that has undergone a differentiation protocol designed to differentiate the cell population into differentiated cells that do not possess pluripotent characteristics.

[0033] As used herein, the term "screening" refers to the act of examining a cell population for the presence of one or more cells with a specific genotype or phenotype, such as pluripotency. Genotypes and phenotypes can be determined based on the expression of biomarkers.

[0034] As used herein, the term "marker" refers to a naturally occurring, identifiable expression by a cell that can be associated with certain characteristics of that cell. In a preferred embodiment, the marker is genetic expression or proteomic expression that can be detected and associated with the cell's identity. These markers can be identified by genes. This can be readily translated into the expression of the corresponding mRNA and protein.

[0035] As used herein, the term "expression" in relation to a biomarker refers to the presence or absence of a detectable molecule in a cell. In one embodiment, the expressed molecule is mRNA or protein. Thus, in one embodiment, PSCs are detected and optionally identified at the transcriptomic and / or proteomic levels. In one embodiment, the biomarker is the genetic expression of a gene that may be associated with the pluripotency of stem cells. Biomarker expression can be detected at any suitable level, such as at the mRNA or protein level. Those skilled in the art will readily understand that a cell can be defined by the positive or negative expression of a biomarker, i.e., the characteristics and state of a cell can be equally associated with the expression and absence of a certain biomarker. When referring to a specific biomarker, the presence or absence of expression can be indicated by a + (plus) or - (minus) sign, respectively.

[0036] As used herein, the term "detection" in relation to expression refers to measuring a signal to determine the presence of contaminated residual undifferentiated stem cells (PSCs) in a cell population. "Detection" according to this method does not necessarily imply a positive signal; a positive signal will not be obtained if the cell population does not contain any contaminated residual undifferentiated stem cells. The presence of PSCs can be determined using any suitable signal, such as by emitting light from, for example, a fluorescent molecule. Many techniques are readily available for detecting and optionally identifying biomarkers in a cell population. In one embodiment, a multi-omics (bulk) RNA-seq (RNA sequencing) analysis is used to screen the cell population. As used herein, when referring to screening, the term "multi-omics (bulk)" refers to analyzing the expression of biomarkers in a cell population rather than in individual cells.

[0037] In the implementation plan, this multi-omics analysis was performed using RNA-seq analysis.

[0038] In one embodiment, the cell population comprises differentiated cells derived from PSCs. As used herein, the term "differentiated cell" in relation to stem cells refers to a PSC that has undergone a process of progression from an undifferentiated state to a specific differentiation state, i.e., from an immature state to a less immature state or a mature state. Changes in cell interactions and cell maturation occur when cells lose markers of undifferentiated cells or acquire markers of differentiated cells. The loss or acquisition of a single marker can indicate that a cell has matured or fully differentiated. Therefore, a "differentiated cell" is considered a cell that was previously classified as a PSC but is allowed to differentiate into a certain germ layer cell type.

[0039] Therefore, in one embodiment, the method includes an initial step of differentiating PSCs into a cell population of differentiated cells derived from PSCs. Those skilled in the art will readily understand that, as used herein, the term "differentiation" refers to a method of subjecting PSCs to a process that allows the cells to progress from an undifferentiated state to a differentiated state. Typically, the steps of differentiating PSCs include culturing the cells under specific conditions and / or exposing the cells to certain factors.

[0040] In one embodiment, the PSC is a human PSC. In a further embodiment, the PSC is a human iPSC (hiPSC).

[0041] In one embodiment, the differentiated cells are NK cells.

[0042] In one embodiment, the cell population is in vitro. Most commonly, the cell population used for screening will be in one embodiment where the method includes the step of identifying residual PSCs or PSC-like cells in the cell population.

[0043] As used herein, the term "PSC-like cell" refers to a cell that has lost its pluripotency but still shares some characteristics with PSCs, such as gene expression, proliferative capacity, or any other features similar to those of PSCs. The term "identification" refers to establishing or indicating a strong association between the expression of certain markers detected in a cell population and a specific cell within that cell population. In one embodiment, residual PSCs or PSC-like cells are detected and optionally identified by single-cell sequencing. In one embodiment, the cell population is screened using fluorescence-activated cell sorting (FACS).

[0044] On the other hand, a cell population comprising differentiated cells derived from PSCs is provided, wherein the cell population lacks cells expressing the marker TERT.

[0045] In one embodiment, the detected expression level of the marker TERT in the cell population is lower than that in the spike-in reference cell population by 0.1%, 0.01%, or 0.001% compared to the hiPSCs mixed in differentiated cells. In another embodiment, the detected expression level of the marker TERT in the cell population is lower than that in the hPSCs mixed in differentiated cells by 0.1%, 0.01%, or 0.001% compared to the spike-in reference cell population.

[0046] As used herein, “sequence identity” generally refers to the exact correspondence between nucleotides or amino acids of two polynucleotide or polypeptide sequences. Typically, techniques for determining sequence identity involve identifying the nucleotide sequence of a polynucleotide and / or the amino acid sequence it encodes, and comparing these sequences to a second nucleotide or amino acid sequence. Two or more sequences (polynucleotides or amino acids) can be compared by determining their “percentage of identity.” Whether it’s a nucleic acid or amino acid sequence, the percentage of identity between two sequences is the number of exact matches between the two aligned sequences divided by the length of the shorter sequence, and then multiplied by 100. For example, the Advanced BLAST computer program, available from the National Institutes of Health, can also be used to compare sequence information to determine the percentage of identity. The BLAST procedure is based on the following alignment methods: Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87: 2264-2268 (1990) and discussed in Altschul et al., J. Mol. Biol. 215: 403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-5877 (1993); and Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). In short, the BLAST procedure defines identity as the number of identical alignment symbols (usually nucleotides or amino acids) divided by the total number of shorter symbols in both sequences. The procedure can be used to determine the percentage of identity over the entire length of the compared protein.

[0047] As used herein, the term "lack" is defined as a negative detection of the expression marker of TERT. In one embodiment, the detection method is according to Example 1.

[0048] All publications, documents, and patents mentioned herein are hereby incorporated in their entirety by reference, as are each publication, document, or patent not specifically and individually indicated to be incorporated herein by reference in its entirety. In case of conflict, this application (including any definitions herein) shall prevail. However, any references, articles, publications, patents, patent publications, and patent applications cited herein are not and should not be construed as an admission or recommendation of any kind.

[0049] The section headings used in this document are for organizational purposes only and are not intended to limit the topics described. Type the technical issue description paragraph here. Attached Figure Description

[0050] Figure 1: Figures 1A, 1B, 1C and 1D show the expression results of TERT, OCT4, SOX2 and NANOG in hiPSC and iNK cells, respectively, using RNA-seq sequencing.

[0051] Figure 2: A bar chart showing the expression levels of TERT, OCT4, SOX2 and NANOG genes in hiPSC, iNK cell 1 and iNK cell 2 in Example 1;

[0052] Figure 3: Correlation analysis between TERT gene expression and iPSC content. Detailed Implementation

[0053] The present invention and its technical effects will be clearly and completely described below with reference to embodiments, so as to fully understand the technical solution, the technical problem solved, and the beneficial effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments; other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0054] Experimental methods not specifically described in the following examples were performed according to conventional methods and conditions known in the art, or as selected according to the product instructions. Reagents and raw materials not specifically described in this invention are all commercially available. Example

[0055] 1. RNA-seq sequencing to screen biomarkers in hiPSCs and iNK cells

[0056] RNA-seq sequencing analysis of hiPSCs and their differentiated iNK cells (the differentiation method is based on the method for differentiating iNK cells from hiPSCs disclosed in Chinese Invention Patent Publication No. CN112608895A) revealed that, similar to the expression patterns of pluripotency genes OCT4, SOX2, and NANOG in hiPSCs and iNK cells, the TRET gene was highly expressed in hiPSCs but almost not expressed in iNK cells, making it a potential target for detecting residual iPSCs. The expression results of TERT, OCT4, SOX2, and NANOG in hiPSCs and iNK cells detected by RNA-seq sequencing are shown in Figures 1A, 1B, 1C, and 1D, respectively.

[0057] 2. qPCR was used to verify the expression of TERT, OCT4, SOX2, and NANOG in hiPSCs and iNK cells.

[0058] In traditional qRT-PCR (or simply qPCR), fluorescence appears after sequence amplification during the PCR reaction (Higuchi et al., Biotechnology (NY). (1992); 10(4): 413-7. doi: 10.1038 / nbt0492-413). qPCR is usually performed to quantify the absolute amount of target sequences or compare the relative amount of target sequences between samples. This technique monitors target amplification in real time by emitting target-specific fluorescence signals during the amplification process. The expression levels of TERT, OCT4, SOX2, and NANOG were compared in hiPSC and its derived iNK cells using qPCR analysis; the primer pairs for amplifying each gene are shown in Table 1 below.

[0059] Table 1: Primer pairs used for qPCR.

[0060]

[0061] The specific testing method is as follows:

[0062] First, total mRNA was extracted from cell samples of hiPSC, iNK cells 1, and iNK cells 2 using the Tiangen RNA Extraction Kit (RNAprepPureCell / BacteriaKit, #DP430). The mRNA was then reverse transcribed into cDNA using the Vazyme RNA Reverse Transcription Kit (HiScriptⅡQRTSuperMixforQprc, #R223-01) at a rate of 2 μg. Finally, the expression of TERT, OCT4, SOX2, and NANOG genes in hiPSC, iNK cells 1, and iNK cells 2 was detected by RT-qPCR using the chamQSYBRqPCR MasterMix Kit (Novizan, #Q311-02). All products were used in accordance with the manufacturer's instructions and general knowledge known to those skilled in the art.

[0063] In qPCR, the threshold line is the point at which the detection level or reaction reaches a fluorescence intensity higher than the background level. Ct (cycle threshold) is the intersection point between the amplification curve and the threshold line (Bustin et al., ClinChem. April 2009; 55(4):611-22. doi:10.1373 / clinchem.2008.112797). Using the ddCt (delat-deltaCt) method and with the expression of the GAPDH gene (internal reference gene / housekeeping gene) as an endogenous control, the fold changes in the expression of TERT, OCT4, SOX2, and NANOG genes relative to hiPSCs in iNK cells 1 and iNK cells 2 were calculated. The amplification results were analyzed using the relative quantification method 2-ΔΔCt, and the results are shown in Figure 2.

[0064] As shown in Figure 2, compared with hiPSC in iNK cells 1 and iNK cells 2, the expression difference of TERT was significantly greater than that of pluripotency genes OCT4, SOX2 and NANOG; the TERT gene has great potential as a potential target for detecting hiPSC residues in iNK cells.

[0065] Example 2

[0066] Use qPCR to verify the correlation between TERT gene expression and ipsc:

[0067] iPSCs and iNK cells were mixed at concentrations of 10%, 1%, 0.1%, 0.01%, and 0.001% for qPCR detection. GAPDH gene expression (internal reference / housekeeping gene) was used as the source control. The fold change in TERT gene expression relative to iPSCs in the iNK cell population was calculated. The amplification results were analyzed using a relative quantification method. -△△CtThe analysis was performed using the method shown in Figure 3.

[0068] As shown in Figure 3, compared with iNK cells, the expression level of TERT is linearly positively correlated with the proportion of iPSCs in the cell population. This indicates that using TERT as a marker gene and detecting its expression level can be used to detect and screen for residual undifferentiated pluripotent stem cells in cell populations derived from pluripotent stem cells.

Claims

1. A method for screening residual undifferentiated pluripotent stem cells in a cell population derived from pluripotent stem cells, characterized in that, This includes detecting the expression of a certain marker in the cell population, said marker being TERT.

2. The method according to claim 1, characterized in that, The pluripotent stem cells mentioned are human iPSCs.

3. The method according to claim 2, characterized in that, The cell population comprises differentiated cells derived from human iPSCs.

4. The method according to claim 3, characterized in that, The differentiated cells are NK cells.

5. The method according to any one of claims 1-4, characterized in that, The detection method is selected from one or more of transcriptomics detection methods and proteomics detection methods.

6. The method according to claim 5, characterized in that, The transcriptomics detection method is selected from one or more of RNA sequencing, quantitative PCR, and microarray chips.

7. The method according to claim 5, characterized in that, The proteomics detection method is selected from one or more of mass spectrometry, protein microarray, enzyme-linked immunosorbent assay (ELISA), and Western blotting.

8. The method according to any one of claims 1-6, characterized in that, The expression of TERT in the cell population was detected using quantitative PCR.

9. The method according to claim 8, characterized in that, The qPCR is selected from RT-qPCR and dd-qPCR.

10. The method according to claim 8, characterized in that, The TERT gene includes at least one of the following: a. The nucleotide sequence is shown in SEQ ID NO:1; b. A nucleic acid sequence derived from humans that encodes telomerase reverse transcriptase and has more than 80% sequence similarity to SEQ ID NO:

1.

11. The application of substances used to detect biomarker expression levels in any of the following: A1. Application in the preparation of products for the detection of undifferentiated pluripotent stem cells; A2. Application in constructing a model of the differentiation process of pluripotent stem cells; The marker is TERT.

12. A primer combination for detecting TERT, characterized in that, The nucleotide sequence of the forward primer is shown in SEQ ID NO:2: TCACGGAGACCACGTTTCAAA; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:3: TTCAAGTGCTGTCTGATTCCAAT.

13. A reagent kit, characterized in that, The kit contains the primer combination as described in claim 11.

Citation Information

Patent Citations

  • Multipotent / pluripotent cells and methods

    CN102317448A

  • Transgenic insect cell line for high-yield baculovirus, and preparation method and application thereof

    CN102807969A

  • iPSC residue detection method using ESRG gene as universal marker gene

    CN111996241A

  • IPSC residue detection method based on single cell sequencing data analysis

    CN113355433A

  • Immortalized porcine macrophage cell strain as well as construction method and application thereof

    CN113528453A