Nano-graphene oxide–based composition having therapeutic effects on post-transplant complications and applications thereof
Nano-graphene oxide and NGO-treated macrophages address the limitations of current GVHD treatments by modulating macrophage polarization and promoting immune tolerance, effectively reducing GVHD severity and inflammation.
Patent Information
- Application Number
- PCT/KR2025/017658
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-30
- Filing Date
- 2025-10-30
- Publication Date
- 2026-05-07
AI Technical Summary
Current treatments for graft-versus-host disease (GVHD) after allogeneic hematopoietic stem cell transplantation are inadequate, with existing immunosuppressive therapies showing limited efficacy and macrophage-based therapies facing challenges due to phenotypic instability and plasticity, leading to potential exacerbation of inflammation.
Nano-graphene oxide (NGO) and macrophages treated with NGO are used to modulate macrophage polarization, targeting the IFN-γ-STAT1 axis to inhibit M1 macrophage activation and promote an M2-like phenotype, thereby reducing inflammation and promoting Treg induction, with NGO-Mac providing a safer cell-based therapy.
NGO and NGO-Mac effectively alleviate GVHD by stabilizing macrophage polarization and enhancing immune tolerance, reducing inflammation and GVHD severity without impairing essential immune functions, offering a promising alternative to conventional therapies.
Smart Images

Figure KR2025017658_07052026_PF_FP_ABST
Abstract
Description
Nano-graphene oxide-based composition having therapeutic effect on post-transplant complications and its application
[0001] The present application claims priority to Korean Patent Application No. 10-2024-0151541 filed on October 30, 2024, and the entire specification is a reference to the present application.
[0002]
[0003] The present invention relates to nano-graphene oxide having a therapeutic effect on post-transplant complications such as graft-versus-host disease, nano-graphene oxide with a surface modified with a zwitter ionic polymer, macrophages treated with said nano-graphene oxide, and applications thereof.
[0004]
[0005] The present invention was completed with the support of the research project No. 500-20230269 (500-20240247) and the project title “Development of a side-effect-free cell therapy for graft-versus-host disease and a coronavirus treatment using nanographene oxide (Elucidation of the inflammation-regulating mechanism of nanographene oxide for graft-versus-host disease and development of a treatment for porcine epidemic diarrhea virus)” and the support of INBCT.
[0006] In addition, the present invention was completed with the support of the National Research Foundation of Korea by project numbers 2022R1C1C1009606 (1711185211, 1711155979) and 00218476 (2710081848, 2710001655, 1711197758).
[0007]
[0008] Allogeneic hematopoietic stem cell transplantation (HSCT) is a widely used treatment for various malignant and non-malignant hematological and immune diseases. However, the infusion of donor-derived immune cells carries significant risks as they may recognize the recipient's tissue as a foreign substance. This reaction is primarily caused by human leukocyte antigen mismatches and minority histocompatibility antigen (HSA) differences, ultimately leading to graft-versus-host disease (GVHD). Despite advancements in immunosuppressive therapy for GVHD prevention, acute GVHD (aGVHD) still occurs in 40–50% of transplant patients and remains a major cause of death after allogeneic HSCT, excluding recurrence. The standard first-line treatment for severe acute GVHD is systemic steroid therapy, but it does not respond in 35–60% of patients. Although ruxolitinib has been approved as a treatment for steroid-refractory GVHD, the disease still has a high mortality rate, and a universally effective second-line treatment has not been established.
[0009] The pathogenesis of acute GVHD consists of a three-step chain process. First, tissue damage caused by pretreatment, such as whole-body radiation or chemotherapy, activates the recipient's antigen-presenting cells (APCs). Subsequently, donor-derived alloreactive T cells are stimulated to initiate the afferent phase of the immune response. Finally, target organs are damaged by the secretion of inflammatory cytokines and the release of cytotoxic granules. Activated donor T cells differentiate into Th1 and Th17 helper T cell subtypes, causing host tissue damage. In contrast, regulatory T cells (Tregs) perform immunomodulatory functions that suppress GVHD through contact-dependent and contact-independent mechanisms.
[0010] In addition to T cells, macrophages are emerging as important regulators in the pathogenesis of aGVHD. Macrophages possess remarkable heterogeneity and plasticity, playing a crucial role in both innate and adaptive immunity. They are classified into inflammatory M1 and anti-inflammatory M2 subtypes based on their activation state. M1 macrophages are activated by IFN-γ and TLR ligands and secrete inflammatory cytokines such as TNF-α and IL-12 through the IFN-γ / STAT1 and LPS / TLR4 / MyD88 signaling pathways. M1 macrophage infiltration serves as a biomarker of disease progression, and it has been reported that higher M1 / M2 ratios are associated with increased severity (grades II-IV) of aGVHD. Conversely, mesenchymal stem cell-derived extracellular vesicles (EVs) induce macrophage polarization toward M2, thereby mitigating aGVHD, while donor-derived M2 macrophages have also been shown to suppress GVHD in mouse models. These results suggest that macrophages are potential therapeutic targets, but it has not been clearly revealed how the IFN-γ / STAT1 axis is involved in M1 macrophage-mediated inflammation.
[0011] Against this backdrop, therapeutic approaches involving the direct injection of M2 macrophages or the repolarization of M1 macrophages into M2 macrophages within the body are being attempted. However, macrophage-based therapies face an inherent limitation due to the plasticity of macrophages, which change their phenotypes depending on the surrounding environment. Even M2 macrophages administered for therapeutic purposes can revert to an inflammatory phenotype similar to M1 macrophages if exposed to a strong inflammatory microenvironment (e.g., IFN-γ, DAMPs, etc.). This phenotypic instability can nullify therapeutic effects or even exacerbate inflammation, leaving the technology to maintain a stable anti-inflammatory phenotype as a key challenge in the development of macrophage therapies.
[0012] Nano-sized graphene oxide (NGO) is a carbon-based nanoparticle that is attracting attention as a potential therapeutic candidate for various inflammatory diseases, such as inflammatory bowel disease and liver injury, due to its excellent biocompatibility and context-dependent immune-modulating properties. NGOs possess superior reactive oxygen species (ROS) scavenging capabilities resulting from their electron-deficient ring structure, thereby alleviating oxidative stress and cellular inflammation. Furthermore, NGOs have been reported to induce macrophage polarity in the M2b subtype, increasing Treg populations and suppressing Th1 and Th17 responses. Recent studies have suggested that NGOs possess antiviral activity in addition to their immune-modulating capabilities, which may allow them to regulate inflammatory responses in hematopoietic stem cells and progenitor cells. Consequently, there is a possibility that NGOs could alleviate abnormal immune activity and hematopoietic dysfunction in patients vulnerable to infection after transplantation.
[0013] PMPC (Poly 2-methacryloyloxyethyl phosphorylcholine) is one of the zwitter ionic polymers and is an FDA-approved material. It is an artificial phospholipid-like polymer with excellent biocompatibility, and is known to be a substance that minimizes protein adsorption in the body and does not cause an immune response by mimicking the phospholipid structure of the cell membrane.
[0014]
[0015] [Prior Art Literature]
[0016] [Patent Literature]
[0017] (Patent Document 1) Korean Published Patent Application No. 10-2019-0060491 (2019-06-03)
[0018]
[0019] In the present invention, as a result of diligent efforts to evaluate the therapeutic potential of nanographene oxide for post-transplant complications, it was confirmed that nanographene oxide, nanographene oxide with a surface modified with an amphoteric ionic polymer, or macrophages treated with said nanographene oxide effectively alleviate acute graft-versus-host disease, and the present invention was completed.
[0020] Accordingly, the object of the present invention is to provide nanographene oxide having a therapeutic effect on post-transplant complications such as graft-versus-host disease, nanographene oxide with a surface modified with an amphoteric ionic polymer, macrophages treated with said nanographene oxide, and applications thereof.
[0021]
[0022] The present invention provides a pharmaceutical composition for preventing or treating complications after transplantation, comprising nano-graphene oxide.
[0023] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
[0024] According to a preferred embodiment of the present invention, the post-transplant complications are one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0025] In addition, the present invention provides a pharmaceutical composition for preventing or treating complications after transplantation, comprising nano-graphene oxide whose surface is modified with a zwitter ionic polymer.
[0026] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer is a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0027] According to a preferred embodiment of the present invention, the amphoteric ionic polymer is one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)).
[0028] In addition, the present invention provides a pharmaceutical composition for preventing or treating post-transplant complications comprising macrophages treated with nanographene oxide.
[0029] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
[0030] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide is modified with a zwitter ionic polymer.
[0031] In addition, the present invention provides a cell therapy agent for treating post-transplant complications comprising macrophages treated with nanographene oxide.
[0032] In addition, the present invention comprises: i) a step of producing immature macrophages by culturing monocytes with growth factors for 4 to 8 days; and
[0033] ii) a step of treating the above immature macrophages with 15–25 μg / mL nanographene oxide for 16–20 hours;
[0034] A method for producing macrophages treated with nano-graphene oxide for the prevention or treatment of complications after transplantation is provided.
[0035] According to a preferred embodiment of the present invention, the monocytes are obtained from one or more selected from the group consisting of peripheral blood, spleen, and bone marrow.
[0036] According to a preferred embodiment of the present invention, the growth factor is a macrophage-colony stimulating factor.
[0037] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
[0038] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide is modified with an amphoteric ionic polymer.
[0039] In addition, the present invention provides a method for treating post-transplant complications comprising the step of administering nano-graphene oxide to an individual in need.
[0040] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
[0041] According to a preferred embodiment of the present invention, the post-transplant complications are one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0042] In addition, the present invention provides a method for treating post-transplant complications comprising the step of administering nano-graphene oxide, whose surface is modified with a zwitter ionic polymer, to an individual in need.
[0043] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer is a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0044] According to a preferred embodiment of the present invention, the amphoteric ionic polymer is one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)).
[0045] In addition, the present invention provides a method for treating post-transplant complications comprising the step of administering macrophages treated with nano-graphene oxide to an individual in need.
[0046] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
[0047] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide is modified with a zwitter ionic polymer.
[0048]
[0049] The present invention will be described in more detail below.
[0050]
[0051] The term 'post-transplant complication' of the present invention may refer to an overall immunological, infectious, metabolic, organ functional abnormality or pathological condition that may occur in the recipient's body after various transplant procedures, such as organ transplantation, hematopoietic stem cell transplantation (bone marrow cell transplantation), tissue transplantation, or cell therapy transplantation.
[0052] The term 'prevention' of the present invention may refer to any act that causes graft-versus-host disease or related diseases to be suppressed or their onset to be delayed due to the nano-graphene oxide of the present invention or macrophages treated with nano-graphene oxide.
[0053] The term 'improvement' or 'treatment' of the present invention may refer to any act that causes parameters related to graft-versus-host disease or related diseases, such as the severity of symptoms, to be improved or benefited by the nano-graphene oxide of the present invention or macrophages treated with nano-graphene oxide.
[0054] The ‘cell therapy’ of the present invention may be a pharmaceutical product intended to promote the regeneration of damaged tissue, regulate immune responses, or treat or prevent diseases by administering living cells cultured, manipulated, or processed in vitro to an individual. Such cell therapy may utilize various cells, such as stem cells and immune cells, and unlike drugs, may exhibit therapeutic effects by having the cells themselves perform physiological functions.
[0055]
[0056] In this invention, a heterologous mouse model for graft-versus-host disease (GVHD) was developed to confirm the therapeutic potential of graphene nanooxide (NGO). It was confirmed that NGO can contribute to the treatment of GVHD by inhibiting the activation, including proliferation and differentiation, of human immune cells in both in vitro and in vivo environments. Furthermore, sequence analysis revealed that aGVHD (acute GVHD) is associated with a distinct immune signature. NGO treatment selectively reduced upregulated gene expression in aGVHD PBMCs, whereas this effect was not observed in non-GVHD PBMCs. These changes in gene expression were concentrated particularly in innate immune system-related pathways, a result that further emphasizes the immunomodulatory effects of NGO.
[0057] The key finding of the present invention is the ability of NGOs to regulate macrophage polarization. Transcriptome analysis revealed that NGO treatment downregulated genes associated with M1 macrophage activation, including IFN-γR2, STAT1, and downstream inflammatory cytokines such as CXCL9 and IL-1β. This suggests the inhibition of the IFN-γ-STAT1 signaling axis, a critical pathway in M1 macrophage-mediated inflammation. To investigate whether other signaling pathways contribute to these effects, typical innate immune signaling molecules involved in the TLR-MyD88, MAPK, and NF-κB pathways were also examined. NGO treatment did not alter the expression or phosphorylation of MyD88, pERK1 / 2, pp38, or pIκBα, suggesting that these pathways are not involved in NGO-mediated macrophage polarization. Furthermore, the present invention investigated whether the inhibition of STAT1 by NGOs is attributed to their known ROS scavenging properties. In this regard, treatment with the ROS inhibitor NAC did not affect STAT1 phosphorylation, which supports the conclusion that NGOs act not through ROS inhibition but directly inhibit the IFN-γ-STAT1 axis (Fig. 5H). The inhibition of M1 polarization was further supported by phenotypic and functional evaluations, which showed that the expression of M1 markers (CD80, CD86) decreased and the expression of M2 markers (CD163, CD206) increased in NGO-treated macrophages. In particular, NGOs selectively reprogram M0 (non-polarized) macrophages into an M2-like phenotype and tend to maintain this bias even upon subsequent M1 polarization stimulation (Figs. 5A, E). This suggests that NGOs may contribute to maintaining macrophage polarization in an inflammatory environment.
[0058] The ability of NGOs to modulate T cell responses highlights their therapeutic potential in graft-versus-host disease (GVHD). In vitro, NGOs directly inhibited T cell proliferation and reduced Th1 differentiation (IFN-γ-producing CD4+ (Manifested as a decrease in T cells) and promoted Treg expansion, a key mechanism for attenuating GVHD. Furthermore, this invention suggests that NGO exerts indirect immunomodulatory effects by regulating macrophage polarization. NGO treatment inhibited M1 macrophage differentiation and promoted an M2-like phenotype, contributing to increased Treg induction. Moreover, NGO-Mac increased IL-10 levels, which further supports this indirect pathway. IL-10 blockade caused NGO-Mac to lose its ability to induce Treg and suppress Th1 responses, suggesting that NGO-Mac relies on an IL-10-dependent mechanism to maintain regulatory function even under inflammatory conditions. This highlights the dual mechanism by which NGO alleviates GVHD. NGO acted directly on T cells to suppress inflammatory responses and reprogrammed macrophages into an anti-inflammatory phenotype that promotes IL-10-dependent Treg induction. This integrated regulatory network was further validated in in vivo studies, and both NGO and NGO-Mac treatments increased Treg expression frequency and reduced M1 macrophage infiltration in organs infected with GVHD.
[0059] Considering safety considerations and the potential difficulties in obtaining regulatory approval for direct administration of NGOs, the present invention explored an alternative cell-based therapy using NGO-promoted macrophages (NGO-Mac). The present invention demonstrated that NGO-Mac effectively inhibits Th1 differentiation and promotes Treg cell proliferation by maintaining immunosuppressive properties while exhibiting an M2-like phenotype. Developing NGO-Mac as a cell therapy utilizes macrophage-mediated delivery to provide a safer and clinically applicable approach, while simultaneously reducing concerns associated with direct nanoparticle exposure.
[0060] In conclusion, the present invention confirmed that NGOs and NGO-Mac effectively alleviate aGVHD by modulating macrophage polarization and T cell responses. A key advantage of NGO-based therapies is their biocompatibility and clinical convertibility. Unlike conventional immunosuppressive therapies that broadly suppress immune function, NGOs exhibit selective immunomodulatory effects by altering macrophage polarization and promoting immune tolerance. NGOs targeting the IFN-γ-STAT1 axis suppress M1-mediated inflammation while simultaneously enhancing Treg induction and reducing the severity of GVHD without impairing essential immune functions. Furthermore, the development of NGO-Mac as a cell-based therapy provides a promising alternative to direct NGO administration, enabling the utilization of macrophages as targeted immunomodulators while addressing safety and conversion challenges.
[0061]
[0062] Accordingly, the present invention can provide a pharmaceutical composition for preventing or treating post-implantation complications comprising nano-graphene oxide.
[0063] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0064] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0065] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0066] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0067] The pharmaceutical composition of the present invention may be in various oral or parenteral formulations. When formulating the composition, it may be prepared using one or more buffers (e.g., saline solution or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.
[0068] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing at least one excipient with one or more compounds, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, or gelatin, etc. For example, tablets or sugar-coated tablets can be obtained by combining an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and processing it into a granular mixture.
[0069] In addition, lubricants such as magnesium stearate and talc are also used in addition to simple excipients. Liquid formulations for oral administration include suspensions, liquid formulations, emulsions, or syrups, and may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents like water and liquid paraffin. Additionally, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and may additionally include anticoagulants, flavorings, emulsifiers, solubilizers, dispersants, flavorings, antioxidants, packaging agents, pigments, and preservatives.
[0070] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, or suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. Witepsol, macrogol, Tween 61, cocoa paste, laurin paste, glycerol, gelatin, etc. may be used as bases for suppositories.
[0071] The composition of the present invention may be administered orally or parenterally, and when administered parenterally, it may be formulated in the form of an injectable administered intraperitoneally, rectum, vein, muscle, or subcutaneously according to methods known in the art.
[0072] The above-mentioned injectable must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Suitable carriers for the injectable may include, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils, as solvents or dispersion media. More preferably, suitable carriers may include Hanks' solution, Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injectable from microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. Additionally, the injectable may, in most cases, further include isotonic agents such as sugars or sodium chloride.
[0073] The composition of the present invention is administered in a pharmaceutically effective amount. A pharmaceutically effective amount refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. That is, the total effective amount of the composition of the present invention may be administered to the patient as a single dose, or administered via a fractionated treatment protocol involving long-term administration of multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all the aforementioned factors, and this can be easily determined by a person skilled in the art.
[0074] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's weight, age, gender, health condition, diet, time of administration, method of administration, excretion rate, and severity of the disease.
[0075] The composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
[0076]
[0077] In addition, the present invention provides a pharmaceutical composition for preventing or treating post-implantation complications comprising nano-graphene oxide whose surface is modified with a zwitter ionic polymer.
[0078] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0079] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0080] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0081] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0082] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0083] Since the above pharmaceutical composition is identical in concept to the pharmaceutical composition for the prevention or treatment of post-transplant complications containing the above-mentioned graphene oxide, the description is replaced by the description thereof.
[0084]
[0085] In addition, the present invention may provide a pharmaceutical composition for preventing or treating post-transplant complications comprising macrophages treated with nanographene oxide.
[0086] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0087] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0088] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide may be modified with an amphoteric ionic polymer.
[0089] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0090] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0091] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0092] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0093] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0094] Since the above pharmaceutical composition is identical in concept to the pharmaceutical composition for the prevention or treatment of post-transplant complications containing the above-mentioned graphene oxide, the description is replaced by the description thereof.
[0095]
[0096] In addition, the present invention may provide a cell therapy agent for treating post-transplant complications comprising macrophages treated with nanographene oxide.
[0097] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0098] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0099] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide may be modified with an amphoteric ionic polymer.
[0100] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0101] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0102] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0103] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0104] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0105]
[0106] In addition, the present invention comprises: i) a step of producing immature macrophages by culturing monocytes with growth factors for 4 to 8 days; and
[0107] ii) a step of treating the above immature macrophages with 15–25 μg / mL nanographene oxide for 16–20 hours;
[0108] A method for producing macrophages treated with nano-graphene oxide for the prevention or treatment of complications after transplantation, including
[0109] Preferably, the present invention comprises the steps of: i) producing immature macrophages by culturing monocytes with a growth factor for 5 to 7 days; and
[0110] ii) a step of treating the above immature macrophages with 17–23 μg / mL nanographene oxide for 17–19 hours;
[0111] A method for producing macrophages treated with nano-graphene oxide for the prevention or treatment of complications after transplantation, including
[0112] According to a preferred embodiment of the present invention, the monocytes may be obtained from one or more selected from the group consisting of peripheral blood, spleen, and bone marrow. Preferably, the monocytes may be obtained from peripheral blood.
[0113] According to a preferred embodiment of the present invention, the growth factor may be a macrophage-colony stimulating factor.
[0114] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0115] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0116] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide may be modified with an amphoteric ionic polymer.
[0117] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0118] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0119] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0120] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0121] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0122]
[0123] In addition, the present invention can provide a method for treating post-transplant complications comprising the step of administering nano-graphene oxide to an individual in need.
[0124] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0125] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0126] The above-mentioned individuals may include individuals who have undergone or will undergo various transplant procedures, such as organ transplantation, hematopoietic stem cell transplantation (bone marrow cell transplantation), tissue transplantation, or cell therapy transplantation, and who have already developed or are likely to develop immunological, infectious, metabolic, organ functional abnormalities, or pathological complications in vivo after transplantation. The above-mentioned individuals may refer to all mammals, including humans, dogs, cattle, horses, rabbits, mice, rats, or chickens, but are not limited thereto.
[0127] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0128] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0129]
[0130] In addition, the present invention can provide a method for treating post-transplant complications comprising the step of administering nano-graphene oxide, whose surface is modified with a zwitter ionic polymer, to an individual in need.
[0131] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0132] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0133] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0134] The above-mentioned individuals may include individuals who have undergone or will undergo various transplant procedures, such as organ transplantation, hematopoietic stem cell transplantation (bone marrow cell transplantation), tissue transplantation, or cell therapy transplantation, and who have already developed or are likely to develop immunological, infectious, metabolic, organ functional abnormalities, or pathological complications in vivo after transplantation. The above-mentioned individuals may refer to all mammals, including humans, dogs, cattle, horses, rabbits, mice, rats, or chickens, but are not limited thereto.
[0135] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0136] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0137]
[0138] In addition, the present invention can provide a method for treating post-transplant complications comprising the step of administering macrophages treated with nano-graphene oxide to an individual in need.
[0139] According to a preferred embodiment of the present invention, the average diameter of the nano-graphene oxide may be 1 to 100 nm and the thickness may be 0.3 to 3 nm. Preferably, the average diameter of the nano-graphene oxide may be 1 to 50 nm and the thickness may be 0.3 to 2 nm.
[0140] The above-mentioned nano-graphene oxide may be plate-shaped particles formed by stimulating graphene oxide, which is oxidized graphene, to have an average diameter of 1 to 100 nm and composed of three or fewer layers of graphene (thickness of 2 nm or less). Additionally, it may have excellent colloidal stability due to abundant oxygen-containing functional groups (C=O, OH, CO, etc.) and a high negative charge (around 50 mV), as well as the potential for water dispersion.
[0141] According to a preferred embodiment of the present invention, the surface of the nano-graphene oxide may be modified with an amphoteric ionic polymer.
[0142] According to a preferred embodiment of the present invention, the nano-graphene oxide modified with the amphoteric ionic polymer may be a nano-graphene oxide variant in which the nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.0.
[0143] Specifically, the nano-graphene oxide modified with the above-mentioned amphoteric polymer may be a graphene oxide variant in which an amphoteric polymer is bonded to functional groups such as carboxyl groups and hydroxyl groups on the surface of the nano-graphene oxide in a ratio of 1.0:0.01 to 1.0:100.0. In this case, the average diameter of the particles of the graphene oxide variant may increase from 1 nm to 10 μm.
[0144] According to a preferred embodiment of the present invention, the amphoteric ionic polymer may be one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)). Preferably, the amphoteric ionic polymer may be PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)).
[0145] The above-mentioned individuals may include individuals who have undergone or will undergo various transplant procedures, such as organ transplantation, hematopoietic stem cell transplantation (bone marrow cell transplantation), tissue transplantation, or cell therapy transplantation, and who have already developed or are likely to develop immunological, infectious, metabolic, organ functional abnormalities, or pathological complications in vivo after transplantation. The above-mentioned individuals may refer to all mammals, including humans, dogs, cattle, horses, rabbits, mice, rats, or chickens, but are not limited thereto.
[0146] According to a preferred embodiment of the present invention, the post-transplant complications may be one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
[0147] The above graft rejection may include solid organ transplant rejection, including acute graft rejection and chronic graft rejection. The above autoimmune disease may include rheumatoid arthritis, inflammatory bowel disease, and multiple sclerosis.
[0148]
[0149] The present invention confirmed that the administration of graphene nanooxide (NGO), NGO modified with amphoteric ionic polymers, or macrophages treated with said NGO improved survival rates and effectively reduced tissue damage and inflammation in an animal model of acute graft-versus-host disease (GVHD) occurring after transplantation. NGOs regulated the activation and differentiation direction of immune cells, particularly macrophages, thereby reducing inflammation-inducing (M1-type) macrophages and increasing the induction of immunomodulatory (M2-type) macrophages and regulatory T cells (Treg), and also provided an effect of restoring immune balance in patient-derived immune cells. Therefore, the present invention can be effectively utilized in the treatment of immune diseases caused by post-transplant complications, such as graft-versus-host disease.
[0150]
[0151] Figures 1a–1l show the time- and dose-dependent effects of graphene nanooxide (NGO) in a xenograft graft-versus-host disease (GVHD) mouse model. In NOD-scid IL2RγNULL (NSG) mice irradiated at a near-lethal dose (2.4 Gy), 1 × 10⁶ on day 0 6Canine human peripheral blood mononuclear cells (PBMCs) were injected. NGOs were administered intraperitoneally (IP) at 150, 300, or 600 μg on day 4 (n = 7, 9, and 7, respectively), or at 300 μg on day 7 (n = 9). Ruxolitinib was administered orally daily starting on day 4 (n = 6) or day 7 (n = 7). The control group received either PBS (n = 4) or PBMCs only (n = 10). Figure 1a shows the experimental design for the induction and treatment of heterogeneous GVHD. 1 × 10⁶ were injected into 8-week-old NSG mice on day 0. 6 Human PBMCs were irradiated with a sublethal dose of 2.4 Gy one day prior to intraperitoneal injection. Non-lethal saline (NCO) was administered intraperitoneally on day 4 or 7, and ruxolitinib was administered orally daily starting on day 4 or 7. All surviving mice were sacrificed on day 20, and peripheral blood (PB), bone marrow (BM), spleen, and organs were collected for analysis. Figure 1b shows the rate of change in body weight, and Figure 1c shows the survival rate of mice in each group. Figure 1d shows the GVHD scores for each group. GVHD severity was assessed based on body weight loss, coat texture, posture, and viability, and scores were assigned three times a week. Statistical comparisons between groups were based on the GVHD scores measured on day 18, indicated by the arrows. Figures 1e and 1f show representative H&E stained sections (e) of the skin, liver, and intestine of each group and the corresponding histological GVHD severity scores (f). Grades 0–2 indicate mild GVHD, and grades 3–4 indicate severe GVHD. Figure 1g shows CD3 in peripheral blood on day 20. +The results of T cell flow cytometry analysis are presented. T cell subtypes were classified into naive (TN), central memory (TCM), effector memory (TEM), and effector (TE) populations based on CCR7 and CD45RA expression. Figure 1h shows human PBMCs (hPBMC, 1 × 10⁶) in NSG mice irradiated with a small amount of radiation (2.4 Gy). 6 This shows the experimental plan for inducing GVHD in mice by administering either PBMC alone (n = 14) or 300 μg of NGO (NGO, n = 15) and administering NGO. 9-week-old NOD-scid IL2RγNULL (NSG) mice were irradiated with 2.4 Gy of radiation one day prior to hPBMC injection. hPBMC was administered intraperitoneally on day 0, and 300 μg of NGO dissolved in PBS was administered on day 4. Peripheral blood (PB) samples were collected on days 11 and 27. On day 29, all surviving mice were sacrificed, and PB, bone marrow (BM), spleen, and tissues were harvested. Figure 1i shows the percentage change in body weight for each group, and Figure 1j shows the survival rate for each group. Figure 1k shows the results of evaluating the presence of human grafts in PB by flow cytometry of hCD45-positive cells (hCD45% = hCD45 / (hCD45+mCD45)). Figure 1l shows representative H&E stained images of the skin (50×), liver (100×), and intestine (100×) of each group, along with the histological grades of GVHD severity. Grades 0–2 indicate mild GVHD, while grades 3–4 indicate severe GVHD. n = 3 mice per group. Results are expressed as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).
[0152] Figures 2a through 2e show that nanographene oxide (NGO) regulates the activation of human immune cells. Figure 2a shows the proliferation rate of human peripheral blood mononuclear cells (PBMCs) labeled with CFSE (carboxyfluorescein succinimidyl ester) after 5 days of co-culture with anti-CD3 / CD28 beads, IL-2, and various concentrations of NGO (20, 40 μg / mL). Figure 2b shows the relative mRNA expression levels of inflammatory factors measured by qRT-PCR. It shows the results of culturing human peripheral blood mononuclear cells (hPBMCs) stimulated with anti-CD3 / CD28 Dynabeads and IL-2 with NGO for 48 hours. Figures 2c and 2d show the results of culturing CD4+ T cells with various concentrations of NGO in the presence of anti-CD3 / CD28 beads and IL-2 for 5 days. Figure 2c shows the percentages of Th1 (CD4+IFN-γ+) cells and D) Treg (CD4+CD25+FOXP3+) cells analyzed and quantified by flow cytometry. Figure 2e shows the results of culturing peripheral blood mononuclear cells (PBMCs) from patients with graft-versus-host disease (GVHD) (n = 4) for 4 days with or without anti-CD3 / CD28 Dynabeads and NGOs. The experimental plan and the proportions of CD4+ T cell subpopulations, including pure T cells (TN), central memory T cells (TCM), effector memory T cells (TEM), and effector T cells (TE), are presented. Results are expressed as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).
[0153] Figures 3a–3c show transcriptome analysis results indicating that graphene nanooxide (NGO) rebalances the immune response in peripheral blood mononuclear cells (PBMCs) of patients with acute graft-versus-host disease (GVHD). Figure 3a A) RNA sequencing scheme for PBMCs of patients with acute graft-versus-host disease (aGVHD) and allogeneic hematopoietic stem cell transplant (HSCT) recipients without aGVHD (non-GVHD). After isolating PBMCs from aGVHD and non-GVHD patients, they were stimulated with 20 μg / mL of NGO for 48 hours in the presence of anti-CD3 / CD28 Dynabeads and IL-2. Gene expression was analyzed (n = 5). Figure 3a B) Heatmap showing DEG between the aGVHD NGO administration group and the aGVHD group. Figure 3a, c) Heatmap showing immune response-related genes in the aGVHD and aGVHD NGO-treated groups. Figures 3b and 3c show the results of gene ontology (GO) enrichment analysis for biological processes (BP) (b) and molecular functions (MF) (c) related to downregulated genes in NGO-treated aGVHD PBMCs and untreated aGVHD PBMCs.
[0154] Figure 4 shows that the RNA expression profile indicates that nanographene oxide (NGO) downregulates M1 macrophage-associated genes. Gene expression was analyzed after treating healthy normal peripheral blood mononuclear cells (PBMCs) with 20 μg / mL of NGO for 48 hours in the presence of activated anti-CD3 / CD28 Dynabeads and IL-2. A) Multidimensional Scale (MDS) plot showing the separation of PBMC and NGO-treated samples. B) Heatmap showing changes in M1 macrophage-associated gene expression for differentially expressed genes in all PBMC and NGO-treated samples. Decreased expression is indicated in blue, and increased expression is indicated in red.
[0155] Figures 5a through 5j indicate the downregulation of M1 macrophage polarization through the pathway. Figures 5a and 5b show the results of treating peripheral blood mononuclear cell (PBMC)-derived macrophages with NGO for 48 hours in the presence of LPS + IFN-γ (M1 cytokine). M1 macrophage marker (CD80 + , CD86 + , left) and M2 macrophage marker (CD163 + , CD206 + Figures 5b and 5d show the relative expression levels of IFN-γR2 and STAT1 (b), inflammatory chemokines (c), and inflammatory cytokines (d) in M1 macrophages or NGO-treated M1 macrophages. Figures 5e and 5f show the results of repolarizing PBMC-derived macrophages from M1 to M2 (e) or M2 to M1 (f) and administering 20 μg / mL of NGO under M1 stimulation. The expression of CD80, CD86, CD163, and CD206 in PBMC-derived macrophages was analyzed using a flow cytometer. Figure 5g shows the expression of NGO, the STAT1 inhibitor (fludarabine, 25 × 10⁻⁶). -6 M) or STAT1 enhancer(2-NP, 45 × 10 -6Figure 5h shows the results of Western blot evaluation of STAT1 and p-STAT1 expression in PBMC-derived macrophages after exposure to LPS + IFN-γ in the presence of M for 2 hours. Figure 5h shows the results of Western blot evaluation of STAT1 and phosphorylated STAT1 (p-STAT1) expression in PBMC-derived macrophages after stimulation with LPS + IFN-γ for 30 minutes in the presence of NGO or 10 mM NAC. Figure 5i shows the results of Western blot evaluation of MyD88, phosphorylated ERK1 / 2, p38, and phosphorylated IκBα expression in PBMC-derived macrophages after stimulation with LPS + IFN-γ for 30 minutes regardless of NGO treatment. Figure 5j indicates that NGO exposure modulates macrophage polarization and immunomodulatory functions in vitro: (A) Representative image showing the morphology of M1 macrophages after 24 hours of culture and M1 macrophages treated with NGO. (B) CD4 +T cells were cultured for 5 days with anti-CD3 / CD28 beads and IL-2 at an effector-to-target (E:T) ratio of 1:4, along with untreated or NGO-treated macrophages and 50 ng / mL IL-2, 25 ng / mL IFN-γ, and 25 ng / mL IL-12. (C) Intracellular ROS levels in PBMC-derived macrophages treated with LPS + IFNγ for 6 hours in the presence of 20 μg / mL NGO or 10 mM NAC. Cells were cultured with 10 μM DCFDA in serum-free medium for 30 minutes prior to flow cytometry analysis. (D) Expression of STAT1 and phosphorylated STAT1 (p-STAT1) in PBMC-derived macrophages was evaluated by Western blot after 1, 4, and 6 hours of exposure to LPS + IFNγ, regardless of NGO treatment. (E) Expression of STAT1 and phosphorylated STAT1 (p-STAT1) in PBMC-derived macrophages was evaluated by Western blot after birepolarization from M1 to M2 macrophages with 20 μg / mL NGO under M1 stimulation. (F) Proliferation results of CFSE-labeled human PBMCs after co-culture for 5 days with untreated or NGO-treated macrophages at a 1:4 E:T ratio in the presence of anti-CD3 / CD28 beads and IL-2. Results are expressed as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).
[0156] Figures 6a through 6h show that nano-graphene oxide (NGO) Mac modulates T cells in vitro in combination with IL-10. Figure 6a shows the experimental design for inducing NGO-Mac. Macrophages (Mac) were generated by treating peripheral blood mononuclear cell (PBMC)-derived monocytes with 50 ng / mL of macrophage colony-stimulating factor (M-CSF) for 6 days, and then NGO-Mac were generated by treating them with 20 μg / mL of NGO for various durations. Figure 6b shows the relative mRNA expression levels of inflammatory chemokines after inducing NGO-Mac in macrophages by treating them with NGO for 6, 18, or 24 hours. Figure 6c shows the proliferation rate of human PBMCs labeled with CFSE (carboxyfluorescein succinimidyl ester) after co-culturing each cell population for 5 days in the presence of anti-CD3 / CD28 beads and IL-2 at an effector-target (ET) ratio of 1:4. Figures 6d and 6f show CD4+ T cells cultured for 5 days in the presence of anti-CD3 / CD28 beads at a 1:2 ET ratio (d) without lineage-driving cytokines, or with IFN-γ and IL-12 at a 1:4 ET ratio (e). CD4 + IFN-γ + Th1 cells and CD4 + CD25 + FOXP3 + The percentage of Treg cells was analyzed and quantified using a flow cytometer. Figure 6f shows the quantification results of IL-10 in the supernatant of Mac and NGO-Mac collected after 24–48 hours of culture, measured by ELISA. Figures 6g and 6h show the results of culturing CD4+ T cells for 5 days in the presence of anti-CD3 / CD28 beads at a 1:2 ET ratio (G) without lineage-driven cytokines or at a 1:4 ET ratio (H) with IFN-γ and IL-12. CD4 + IFN-γ + Th1 cells and CD4 + CD25 + FOXP3+ The percentage of Treg cells was analyzed and quantified using a flow cytometer. Figures 6g and 6h show CD4 + T cells were cultured under the same conditions as in Figures 6d and 6e, but with the addition of anti-IL-10 neutralizing antibodies. Cells were co-cultured without lineage-driven cytokines at an E:T ratio of 1:2 (g) or with IFN-γ and IL-12 at a ratio of 1:4 (h). Th1 and Treg subsets were quantified by flow cytometry as described above. Results are expressed as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).
[0157] Figures 7a through 7h show that nanographene oxide (NGO) Mac alleviates acute graft-versus-host disease (GVHD) in a xenograft mouse model. Figure 7a shows the experimental plan for inducing GVHD in mice and administering Mac and NGO-Mac. NSG mice (11–13 weeks old) were irradiated with 2.4 Gy one day prior to human peripheral blood mononuclear cells (hPBMC) injection, and the hPBMCs were administered intraperitoneally (IP) on day 0. On day 7, 8 × 10⁶ donor-matched mice were... 5 Canine Mac or NGO-Mac cells were intravenously administered. Figure 7b shows the rate of change in body weight monitored during the observation period. The n for the saline, PBMC, Mac, and NGO-Mac groups were 8, 11, 5, and 6, respectively. Figure 7c shows the GVHD scores for each group. GVHD severity was assessed based on body weight loss, coat texture, posture, and viability, and scoring was performed three times a week. Figure 7d shows CD80 among hepatic infiltrators + CD86 + It shows the proportion of human macrophages. Figure 7e shows the CD4 of the spleen. + CD25 + FOXP3 among cell populations +This indicates the proportion of cells. Figures 7F through 7h show representative H&E and immunohistochemistry (IHC) staining of CD3 in skin (F), liver (G), and intestine (H) tissues of each mouse group. Histological grades 0–2 indicate mild GVHD, and 3–4 indicate severe GVHD. There were 3 mice per group. CD3 positivity was analyzed using ImageScope software with the Positive Pixel Count v9 algorithm. Results are expressed as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).
[0158] Figure 8 shows the effect of increasing the M2 phenotype of nano-graphene oxide-treated macrophages (NGO-Mac).
[0159] Figure 9 shows that nano-graphene oxide-treated macrophages (NGO-Mac) controlled the plasticity of macrophages even when treated with inflammatory cytokines.
[0160] Figure 10 shows that nano-graphene oxide (NGO-NXM) with a surface modified with PMPC has higher cell viability and lower cytotoxicity compared to NGO.
[0161] Figure 11 shows that nano-graphene oxide (NGO-NXM) with a surface modified with PMPC significantly reduces early and late apoptosis and necrosis compared to NGO, and maintains the survival rate of cells, thereby showing an effect of inhibiting apoptosis.
[0162] Figure 12 shows that nano-graphene oxide (NGO-NXM) with a surface modified with PMPC has the effect of regulating the polarity of macrophages by suppressing the inflammatory phenotype of M1 macrophages and inducing a transition to the M2 anti-inflammatory phenotype.
[0163] Figure 13 shows that nano-graphene oxide (NGO-NXM) with a surface modified with PMPC has the effect of reducing inflammatory signaling by inhibiting the STAT1 pathway activity of M1 macrophages.
[0164] Figure 14 confirms that the nano-graphene oxide of the present invention is in the form of a thin sheet at the nano level as a result of transmission electron microscopy (TEM) analysis.
[0165] Figures 15a and 15b show the results of measuring the nano-graphene oxide of the present invention using an atomic force microscope (AFM). The average thickness was found to be about 1 to 2 nm, confirming that it has a single-layer to few-layer structure.
[0166] Figure 16 shows the results of confirming the electronic properties of nano-graphene oxide through ultraviolet-visible spectroscopy (UV-Vis).
[0167] Figure 17 shows the results of measuring particle surface charge using Malvern Zetasizer Nano ZS. It was confirmed that the colloidal dispersion stability is excellent due to the electrostatic repulsion between particles.
[0168] Figures 18a and 18b confirmed the presence of numerous oxygen-containing functional groups (e.g., carbonyl group (C=O), hydroxyl group (-OH), epoxy group (COC), etc.) on the surface of nano-graphene oxide through Fourier Transistor (FTIR) analysis. Figure 18a shows the amide bonds formed after the coupling reaction between NGO and propargylamine and EDC, and Figure 18b shows the modified NXM (NGO-PMPC).
[0169] Figure 19 shows the results of measuring the particle size distribution of nano-graphene oxide variants (NXM; NGO-PMPC) using Dynamic Light Scattering (DLS).
[0170]
[0171] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it is obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.
[0172]
[0173] <Experimental Method>
[0174] 1. Preparation of nanographene oxide and variants
[0175] The nano-sized graphene oxide (NGO) used in the present invention may be provided by INBCT Co., Ltd (Hwaseong, Korea) or manufactured through chemical oxidation and exfoliation processes using natural graphite as a starting material as follows.
[0176] (1) Oxidation step
[0177] Graphite powder was dispersed in a mixed acid of sulfuric acid (H2SO4) and phosphoric acid (H3PO4) (e.g., volume ratio 9:1), and then potassium permanganate (KMnO4), an oxidizing agent, was added to react. The reaction was generally carried out with stirring at 40 to 50 °C for 8 to 12 hours, and during this process, oxygen-containing functional groups (hydroxyl groups, epoxy groups, carbonyl groups, etc.) were introduced between the layers of graphite to form a graphene oxide precursor.
[0178] (2) Termination and washing step
[0179] After the oxidation reaction, the reaction mixture was cooled and a hydrogen peroxide (H2O2) solution was added to decompose the residual oxidizing agent. Subsequently, the mixture was washed sequentially using distilled water, hydrochloric acid (HCl), ethanol, etc., and the centrifugation process was repeated to remove impurities (metal ions, acid residues).
[0180] (3) Exfoliation and dispersion step
[0181] Individual graphene oxide nanosheets were obtained by ultrasonically treating cleaned graphite oxide (e.g., 10–50 kHz, 1–3 hours). At this time, ultrasonic energy separated interlayer bonds to form nanosized graphene oxide with a single-layer to few-layer structure. The obtained suspension was subjected to filtration and concentration processes to finally produce a stable aqueous graphene oxide dispersion.
[0182] (4) Drying and storage
[0183] Solid-state graphene oxide can be recovered by performing freeze-drying or vacuum drying as needed, and this material could subsequently be redispersed in water or physiological saline.
[0184] This manufacturing process is based on the Taylor method or the modified Taylor method, and the oxygen content, number of layers, particle size, and surface charge could be controlled by adjusting reaction conditions (acid ratio, oxidant concentration, reaction temperature, and time, etc.). Accordingly, the nano-graphene oxide produced in the present invention has a nano-sized plate-like structure with an average diameter of about 1 to 20 nm and a thickness of about 0.3 to 3 nm, and can exhibit high hydrophilicity and biocompatibility by including a number of oxygen-containing functional groups on the surface.
[0185] In addition, since the nano-graphene oxide according to the present invention does not include a metal catalyst or a high-temperature heat treatment step during the manufacturing process, it can provide a high-purity material with minimized metal impurities. This may have the advantage of reducing concerns regarding toxicity in in vivo applications (e.g., regulation of immune cells, inhibition of inflammation, etc.).
[0186] (5) Modifying the surface of nano-graphene oxide with an amphoteric ionic polymer
[0187] In the present invention, to modify the surface of nano-graphene oxide (NGO) into a polyzwitterion with excellent biocompatibility, a polymer PMPC (poly(2-methacryloyloxyethyl phosphorylcholine)) containing phosphate choline groups was synthesized using the RAFT polymerization method. First, a RAFT initiator having an azide group (-N3) at the end was prepared using 3-azidopropanol and 4-cyano-4-(phenylcarbonothioylthio)pentanoic acid, thereby obtaining a PMPC-N3 polymer with a uniform molecular weight distribution. This polymer possesses the amphoteric characteristics of hydrophilic phosphate choline groups and is designed to be suitable for selective binding with the graphene oxide surface in the future.
[0188] Subsequently, an alkyne group (-C≡CH) was introduced by amide coupling of propargylamine to the carboxyl group (-COOH) on the surface of graphene oxide, and then PMPC-N3 was covalently bonded via a copper-catalyzed click reaction (CuAAC). FT-IR analysis confirmed the presence of a triazole peak, confirming that the bonding was successful. The NGO-PMPC composite synthesized through this process features a graphene oxide surface uniformly modified with an amphoteric polymer, thereby simultaneously securing high hydrophilicity, biocompatibility, and surface stability.
[0189]
[0190] 2. Isolation of human peripheral blood mononuclear cells
[0191] Peripheral blood (PB) from a healthy donor was collected from the Korean Red Cross Blood Bank in Seoul with the approval of the Institutional Review Board (IRB) of Seoul National University (IRB No. E2309 / 002-00). The patient's PB was provided by Asan Medical Center (Seoul, Korea) under IRB No. 2023-0700. Blood samples were collected from the patient 14 days after hematopoietic stem cell transplantation (HSCT). Acute graft-versus-host disease (GVHD) was diagnosed and staged according to established criteria, and detailed clinical information for each patient used in transcriptome analysis is presented in [Table 1] below (Transplant type: PBSC; GVHD prophylaxis: CSA, MTX, ATG; Sample collection time: 2 weeks post-transplant; UPN, unique patient number; HLA, human leukocyte antigen; GVHD, graft-versus-host disease; HSCT, hematopoietic stem cell transplantation; M, male; F, female; AML, acute myeloid leukemia; AmixL, acute mixed lineage leukemia; Bu, busulfan; d, day; Flu, fludarabine; PBSC, peripheral blood stem cells; CSA, cyclosporine; MTX, methotrexate; ATG, anti-thymocyte globulin; GI, gastro-intestinal; * Staging and grade assessment of acute GVHD was performed according to MAGIC criteria). Human PB mononuclear cells (hPBMCs) were isolated via density gradient centrifugation as previously described. CD4 + T cells and CD14 + Monocytes are human CD4 according to the manufacturer's instructions + or CD14 +It was enriched in hPBMCs via self-activating cell sorting using a micro bead kit (Miltenyi Biotec, Bergisch Gladbach, Germany).
[0192]
[0193]
[0194] 3. Preparation of macrophages
[0195] Macrophages are freshly isolated hCD14 + Monocytes were generated by culturing for 6 days in RPMI1640 medium supplemented with 10% FBS and 50 ng / mL of granulocyte / macrophage-colony stimulating factor (GM-CSF; PeproTech EC, Margravine Road, London) or macrophage-colony stimulating factor (M-CSF; BioLegend, San Diego, USA). Immature macrophages were subsequently cultured for 1–2 days with GM-CSF (50 ng / mL), IFN-γ (20 ng / mL, BioLegend), and LPS (1 μg / mL, Sigma-Aldrich, St. Louis, MO, USA) or M-CSF (50 ng / mL), IL-4 (20 ng / mL, BioLegend), and IL-13 (20 ng / mL, BioLegend) to induce differentiation into M1 or M2 macrophages, respectively. To elucidate the mechanism by which NGOs regulate macrophage polarization, GM-CSF-stimulated immature macrophages were cultured with fludarabine (25 × 10⁶). -6 M; STAT1 inhibitor, MedChemExpress, Monmouth Junction, NJ, USA) or 2-NP(45 × 10 6M; STAT1 enhancer, MedChemExpress), IFN-γ (20 ng / mL), and LPS (1 μg / mL) were treated for 2 hours. To generate NGO macrophages (NGO-Mac), PB-derived CD14 + After culturing monocytes with M-CSF for 6 days, 20 μg / mL of NGO was treated for 18 hours.
[0196]
[0197] 4. Xenograft Graft-Version-Host Disease Mouse Model
[0198] All animal experiments were conducted with the approval (SNU-220607-2-1) of the Institutional Animal Care and Use Committee of Seoul National University. This invention complied with the ARRIVE guidelines. NOD-scid IL2RγNULL (NSG) mice were reared in a specific pathogen-free facility. To induce xGVHD (xenogeneic graft-versus-host disease), mice (8–13 weeks of age) were irradiated with 2.4 Gy, and after 24 hours, 1 × 10 human peripheral blood mononuclear cells (hPBMCs) suspended in 200 μL of sterile physiological saline were... 6Dogs were administered intraperitoneally (IP). For efficacy evaluation, 8-week-old NSG mice were intraperitoneally injected with 150, 300, or 600 μg of NGO (200 μL saline) on day 4 of PBMC infusion, or 300 μg on day 7. Separately, ruxolitinib (MedChemExpress or Tocris Bioscience, Bristol, UK), a JAK inhibitor currently approved for steroid-refractory GVHD, was administered orally at a dose of 30 mg / kg / day starting on day 4 or 7. Ruxolitinib was dissolved in DMSO and diluted with a 0.5% methylcellulose (MC) solution. Treatment was continued until the time of sacrifice. Control mice were administered only saline or the solvent (MC). To verify the optimal NGO dosage, in an independent experiment using 9-week-old NSG mice, only the PBMC monotherapy group and the 4-day NGO 300 μg group were compared under identical xGVHD induction. To evaluate the therapeutic efficacy of macrophage-based cell therapy, xGVHD was induced in 11–13-week-old NSG mice using the same protocol, and 8 x 10 per mouse 5 Canine macrophages (Mac) or NGO-treated macrophages (NGO-Mac) were suspended in 200 μL of physiological saline and administered intravenously. Control mice were injected with only physiological saline. Graft-versus-host disease severity was assessed using a scoring system that included four clinical indicators: body weight loss, posture (slouching), motility, and anemia. Each indicator was scored from 0 (minimum) to 3 (maximum). Mice were evaluated for GVHD scores three times a week and monitored daily. Mice reaching a GVHD score of 6 / 8 were sacrificed in accordance with the recommendations of the Ethics Committee. The final scores of animals that died after reaching ethical limits were retained in the dataset for subsequent reference (last observation retained).
[0199]
[0200] 5. Flow cytometry
[0201] Peripheral blood (PB), spleen, and bone marrow (BM) were collected during the autopsy and subjected to flow cytometry. Red blood cells were removed from the PB using erythrocyte lysis buffer (eBioscience, San Diego, CA). Spleen cells were obtained by lysis, and bone marrow cells were recovered by flushing from the femur and tibia. Liver infiltrators were obtained by dissecting the organs and incubating them for 1 hour in HBSS containing deoxyribonuclease I (DNase I, 50 μg / mL, Roche, Basel, Switzerland) and collagenase A (1 mg / mL, Roche). Digestion was stopped by washing twice with PBS. All tissue-derived cells were washed twice with PBS containing 2% fetal bovine serum (FBS). The human-specific antibodies used were as follows: CD45-APC H7, CD3-BV510, CD4-FITC, CD8-BV421, CCR7-PE, CD45RA-APC, CD163-BV421, CD11b-PE, CD80-PECy7, CD206-APC, CD14-APC Cy7, CD4-APC H7, CD25-APC, FOXP3-PE, IFN-γ-APC (all from BD Biosciences, San Jose, CA, USA). The mouse-specific antibody anti-CD45-PECy7 (BD Biosciences) was also used.
[0202]
[0203] 6. T-cell proliferation analysis
[0204] For the T-cell proliferation assay, PBMC is 2 × 10 6Labeled with M 5,6-carboxyfluorescein succinimidyl ester (CFSE; Thermo Fisher Scientific, Waltham, MA, USA), and 2.5 × 10 5 Macrophages and 1 × 10⁶ 5 PBMCs were added to each well along with anti-CD3 / CD28 Dynabiz (Gibco) and recombinant human IL-2 (30 U / mL; PeproTech). After 5 days, cells were stained with fluorescently labeled human monoclonal antibodies against CD45-APC-H7, CD3-BV510, CD4-APC, and CD8-BV421 (BD Biosciences). T cell proliferation was analyzed using a flow cytometer (Attune Nxt, Thermo Fisher Scientific) via the CFSE dilution method. Viable lymphocytes were gated to 7AAD-negative cells.
[0205]
[0206] 7. CD4+ T cell differentiation
[0207] CD4 + T cells were stimulated with anti-CD3 / CD28 micro beads and treated with specific cytokines to induce differentiation into specific T helper (Th) cell subpopulations. For Th1 differentiation, cells were cultured with IL-2 (50 ng / mL), IFN-γ (25 ng / mL), and IL-12 (25 ng / mL), while Treg cell differentiation was induced with TGF-β (25 ng / mL) and retinoic acid (10 × 10⁶). -9 Induced using M). CD4 T cells treated with cytokines (5 × 10⁶ per well) 5Cells were cultured for 5 days with 0, 20, or 40 μg / mL of NGO. For intracellular cytokine staining, cells were stimulated for 5 hours in RPMI medium supplemented with 10% FBS with the addition of PMA / ionomycin and the protein transport inhibitor GolgiPlug (BD Biosciences). Th1 cells and Treg cells were stained with CD4-FITC and IFN-γ-APC or CD4-FITC, FOXP3-PE, and CD25-APC, respectively. Intracellular staining for FOXP3 and IFN-γ was performed using the Foxp3 / Transcription Factor Staining Buffer Set (eBioscience) according to the manufacturer's instructions. Stained cells were analyzed using a flow cytometer.
[0208]
[0209] 8. Co-culture of CD4 T-cells and macrophages
[0210] A 0.4 μm Transwell (Transwell, Transwell Costa, Corning, NY, USA) system was used for the co-culture of CD4 T cells and macrophages. CD4 T cells were seeded in the lower chamber with anti-CD3 / CD28 dynabeads and cultured for 5 days in the presence or absence of IL-2 (50 ng / mL), IFN-γ (25 ng / mL), and IL-12 (25 ng / mL). Macs were placed in the upper chamber and treated with or without interleukin-10 (IL-10) neutralizing antibody (20 μg / mL). In experiments without cytokines, macrophages (Mac) or NGO-treated macrophages (NGO-Mac) were co-cultured with T cells at a 1:2 ratio. After 5 days of co-culture, T cells were stained with CD4-FITC, FOXP3-PE, and CD25-APC and analyzed by flow cytometry. In experiments involving Th1 cytokines, Mac or NGO-Mac were co-cultured with T cells at a 1:4 ratio, and after 5 days, the T cells were stained with CD4-FITC and IFN-γ-APC or CD4-FITC, FOXP3-PE, and CD25-APC and analyzed.
[0211]
[0212] 9. Measurement of intracellular reactive oxygen species
[0213] To evaluate intracellular reactive oxygen species (ROS) levels, PBMC-derived macrophages were cultured in 12-well plates and stimulated with granulocyte / macrophage-colony stimulating factor (GM-CSF, 50 ng / mL), IFN-γ (20 ng / mL), and lipopolysaccharide (LPS, 1 μg / mL). They were also stimulated with NGO (20 μg / mL) or N-acetylcysteine (NAC, 10 × 10⁶). -3Incubated for 6 hours with or without treatment with M). After stimulation, the medium was removed and 2′,7′-dichlorofluorescin diacetate (DCFDA, 10 × 10⁻⁶) was added to serum-free RPMI. -6 Added M (Sigma-Aldrich) and incubated at 37°C for 30 minutes. Average DCFDA fluorescence was immediately analyzed by flow cytometry.
[0214]
[0215] 10. Western blot
[0216] Cells were lysed in RIPA buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitors. Equal protein amounts (40 μg per sample) were applied to SDS-PAGE and analyzed with the following primary antibodies: STAT1 (#9172, Cell Signaling Technology, Danvers, MA, USA), phospho-STAT1 (Tyr701) (58D6) (#9167, Cell Signaling Technology), MyD88 (#4283, Cell Signaling Technology), p44 / 42 MAPK (Erk1 / 2) (#4696, Cell Signaling Technology), phospho-p44 / 42 MAPK (Erk1 / 2) (#4370, Cell Signaling Technology), p38 MAPK (#9212, Cell Signaling Technology), phospho-p38 MAPK (#9211, Cell Signaling Technology), phospho-IκB (#9246, Cell Signaling Technology) and GAPDH (clone 0411, sc-47724, Santa Cruz Biotechnology, Dallas, TX, USA). Bands were detected by Enhanced Chemiluminescence (Thermo Fisher Scientific) and ChemiDoc XRS + Imaging was performed using a system (BioRad, Hercules, CA, USA). Band intensity was quantified using ImageJ software (National Institutes of Health).
[0217]
[0218] 11. Real-time Quantitative PCR
[0219] Total RNA was extracted using Trizol solution (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA), and 2 μg of RNA was converted to cDNA using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Real-time PCR was performed using TOPreal SYBR Green qPCR PreMIX (Enzynomics, Daejeon, Korea) and analyzed on a CFX96 Real-Time PCR system (Bio-Rad, Contra Costa County, CA, USA). GAPDH was used for normalization. Primer sequences are listed in [Table 2].
[0220] Forward primer (5' - 3') Reverse primer (5' - 3') IL-1βCCACAGACCTTCCAGGAGAATG(SEQ No. 1) GTGCAGTTCAGTGATCGTACAGG(SEQ No. 2) TNF-αCAGAGGGAAGAGTTCCCCAG(SEQ No. 3) CCTTGGTCTGGTAGGAGACG(SEQ No. 4) CXCL9AAGCAGCCAAGTCGGTTAGT(SEQ No. 5) CAGCAGTGTGAGCAGTGATTC(SEQ No. 6) CXCL10GTCCACGTGTTGAGATCATTGCT(SEQ No. 7) TCGATTTTGCTCCCCTCTGGT(SEQ No. 8) IFNγR2CTCCATTCTGCCTGGGTGACAA(SEQ No. 9) CGTGGAGGTATCAGCGATGTCA(SEQ No. 10) STAT1TCCAGGCCAAAGGAAGCACC(SEQ No. 11)GAAGGGTGAACTTCAGACACAGA(Sequence No. 12)IL-12BGACATTCTGCGTTCAGGTCCAG(Sequence No. 13)CATTTTTGCGGCAGATGACCGTG(Sequence No. 14)GAPDHGACAGTCAGCCGCATCTTCT(Sequence No. 15)GCGCCCAATACGACCAAATC(Sequence No. 16)
[0221]
[0222] 12. RNA sequencing
[0223] RNA sequencing (RNA-seq) was performed using Illumina technology at Macrogen Inc. (Seoul, South Korea). hPBMCs were stimulated with CD3 / CD28 Dynabiz (Gibco; Thermo Fisher Scientific, Inc.) and Interleukin-2 (IL-2, 30 U) and treated for 48 hours in the presence or absence of NGO (20 μg / mL). Total RNA was extracted and purified from hPBMCs using Trizol reagent (Invitrogen). For RNA sequencing of patient-derived PBMCs, libraries were constructed using the SMARTer Stranded RNA-Seq Kit (Takara Bio USA, Mountain View, CA, USA) and sequenced on the Illumina NovaSeq X platform in a 2 × 150 bp paired-end configuration. Libraries for normal PBMC sequencing were constructed using the Illumina TruSeq Stranded mRNA Sample Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on the HiSeq X Ten platform with the same settings. All library construction followed the manufacturer's protocols. After adapter removal and filtering of low-quality reads (using an in-house script), the filtered reads were aligned to hg38 using HISAT2. Aligned reads were counted using featureCounts. For differential expression analysis, gene expression in each sample group was quantified using the edgeR R package. For patient-derived PBMC samples (n = 5 per group), differentially expressed genes (DEGs) were selected based on a false discovery rate (FDR) < 0.05. However, for the volcano plots comparing aGVHD and non-GVHD, the nominal p-value (p < 0.05) was used as the criterion. For in vitro NGO-treated hPBMCs, absolute log2-fold change ≥ 1 and p-value < 0.DEGs were selected based on 05. All heatmaps were generated using an in-house script, and clustering analysis was performed using the hierarchical clustering method.
[0224]
[0225] 13. Gene Ontology Analysis and Gene Set Expression Analysis
[0226] The gene set was classified into two categories, biological process (BP) and molecular function (MF), based on gene ontology (GO). The significance of the gene set was calculated using GSEA (gene set enrichment analysis v3.0, https: / www.gsea-msigdb.org / gsea / index.jsp). GO-based trend analysis was performed using Fisher's exact test.
[0227]
[0228] 14. Bioinformatics Analysis
[0229] The truncated DEG (log2-fold change > 2.4, p value < 0.05) was used for path analysis using Qiahen's Ingenuity Pathway Analysis (IPA, Qiagen Redwood City, www.qiagen.com / ingenuity).
[0230]
[0231] 15. Statistical Analysis
[0232] All experiments were repeated at least three times. Data were presented as mean ± standard error of the mean (SEM). An unpaired two-tailed Student's t-test was used for comparisons between two groups. For comparisons involving three or more groups, a one-way ANOVA was performed followed by Tukey's multiple comparisons test. For analyses involving two independent variables (e.g., treatment and time), a two-way ANOVA was used, followed by a Tukey's multiple comparisons test. Statistical analysis was performed using GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA).
[0233]
[0234] [Example 1]
[0235] In vivo safety assessment by NGOs
[0236] To evaluate the in vivo safety of graphene nanooxide (NGO), C57BL / 6 mice were intraperitoneally injected with 150, 300, or 600 μg of NGO and monitored for 4 weeks. Body weight monitoring revealed a transient decrease in the 300 μg and 600 μg groups on Day 1, but these values subsequently returned to baseline. No sustained difference in body weight was observed compared to the saline administration group. Serum biochemical tests, including ALT, AST, BUN, and creatinine, remained within the normal range for all groups and time points, indicating no evidence of hepatotoxicity or nephrotoxicity.
[0237] CBC analysis was performed to further evaluate potential hematological toxicity. On Day 1, platelet counts decreased in both the 300 μg and 600 μg administration groups. At Week 1, the 600 μg administration group showed a significant decrease in white blood cells (WBC), mean erythrocyte volume (MCV), and mean erythrocyte hemoglobin concentration (MCHC). A transient decrease in lymphocyte count was also observed in the 600 μg administration group at Week 1. However, all indicators returned to normal levels by Week 2, suggesting that the observed hematological changes were reversible. Taken together, these results suggest that while a high dose of NGO (600 μg) may temporarily affect hematological indicators in the initial stages, no sustained systemic toxicity was observed during the 4-week evaluation period.
[0238]
[0239] [Example 2]
[0240] NGOs alleviating acute GVHD severity in heterologous mouse models
[0241] An xGVHD mouse model was used to evaluate the therapeutic effects of graphene nanooxide (NGO) in vivo. Immunodeficient NOD-scid IL2RγNULL (NSG) mice irradiated with sublethal doses of hPBMC were injected. NGO was administered intraperitoneally at doses of 150, 300, and 600 μg on day 4, or 300 μg on day 7. As a control group, ruxolitinib was administered orally daily starting on day 4 or day 7 (Fig. 1A). Body weight monitoring showed that when 300 μg of NGO was administered on day 7, absolute body weight was significantly maintained compared to the PBMC group, but no significant difference in the rate of change of body weight was observed (Fig. 1B). Mice administered NGO (150 or 300 μg on day 4, 300 μg on day 7) or ruxolitinib starting from day 4 showed improved survival compared to the PBMC group (Fig. 1C). Consistently, GVHD clinical scores evaluated at day 18 were significantly lower in the NGO150 (day 4), NGO300 (day 4), and NGO300 (day 7) groups (Fig. 1D). Flow cytometry analysis of PB at day 20 revealed a significant decrease in activated T cells (effector memory T cells [TEM] + effector T cells [TE] subgroups) in the NGO300 (day 4), NGO600 (day 4), and NGO300 (day 7) groups (Fig. 1G). Histopathological evaluation revealed that mice treated with NGO300 on day 4 showed reduced lymphocyte infiltration and tissue damage in the skin, liver, and intestines, and had significantly lower GVHD pathological scores in all three organs compared to the PBMC group (Fig. 1E, F). Collectively, these results demonstrated that NGO effectively alleviates GVHD severity in vivo. Among the tested treatment conditions, a single IP administration of 300 μg NGO on day 4 after hPBMC infusion showed the most consistent and potent therapeutic effect, as evidenced by improvements in body weight maintenance, survival, GVHD scores, T-cell activation, and histopathology.
[0242] To verify the reproducibility and therapeutic validity of optimal conditions, an independent xGVHD experiment was performed using only the NGO300 (Day 4) group (Fig. 1H). As with previous results, NGO-treated mice showed improved survival (Fig. 1I) and improved body weight maintenance (Fig. 1J) compared to the PBMC group. Flow cytometry results showed that human CD45 in PB at Day 27 + It was confirmed that leukocyte engraftment was significantly reduced (Fig. 1K). Histological analysis showed reduced lymphocyte infiltration and tissue damage in the skin, liver, and intestines, and GVHD pathological scores were significantly lower in all three organs (Fig. 1F, Fig. 1L). Taken together, these results indicate that a single dose of 300 μg of NGO on day 4 can effectively alleviate GVHD severity and improve survival rates in the xGVHD mouse model.
[0243]
[0244] [Example 3]
[0245] Immunomodulatory effects of NGOs on human immune cell activation
[0246] To elucidate the mechanism by which NGOs alleviate GVHD, the effects of NGOs on human immune cell activation were evaluated in vitro. NGO treatment dose-dependently inhibited lymphocyte proliferation (Fig. 2A) and significantly reduced the expression of inflammatory cytokines (IL-1β, TNFα) and chemokines (CXCL9, CXCL10) in activated hPBMCs (Fig. 2B). To further evaluate the effects of NGOs on T cell differentiation, CD4 using lineage-specific cytokines + T cells were differentiated into Th1 cells and Treg cells. NGO treatment produced IFN-γ in Th1 cells (IFN-γ + CD4 + Although it significantly reduced ) (Fig. 2C), FOXP3 + CD25 + CD4 +It increased the induction of Treg cells (Fig. 2D). In addition, when peripheral blood cell membranes (PBMCs) derived from aGVHD patients were cultured with NGO and CD3 / CD28 dynavid, the proportion of uncontacted T cells increased, while the number of effector memory T cells decreased (Fig. 2E). These results suggested that NGO not only inhibits the activation and proliferation of T cells but also promotes immune regulatory mechanisms, thereby contributing to a protective effect against GVHD.
[0247]
[0248] [Example 4]
[0249] Transcriptome analysis of PBMC in aGVHD patients administered NGO
[0250] To investigate the effects of graphene nanooxide (NGO) on immune cells in aGVHD patients, PBMCs were obtained from patients who developed aGVHD after HSCT or those without GVHD (nonGVHD). PBMCs were cultured for 2 days with or without NGO, after which RNA sequencing was performed (Figure 3a, A). Gene expression profiles showed distinct clustering depending on both aGVHD status and NGO treatment. In the comparison between aGVHD and nonGVHD, no DEGs showed significant expression levels based on FDR correction. However, through volcano plot visualization using nominal p-values (p < 0.05), several immune-related genes upregulated in aGVHD were identified, including S100A8, FCER1G, PLA2G4A, and NLRC4. Among these, S100A8 and NLRC4 are known to be involved in the pathogenesis of GVHD, while FCER1G and PLA2G4A are known to be involved in innate immune activation and inflammatory signaling. Subsequent analysis comparing aGVHD PBMCs in the NGO-treated and untreated groups identified 779 DEGs (adjusted p < 0.05), and significant downregulation of these immune-related genes was observed (Fig. 3a, B). These results suggested that NGO treatment reduces the expression of inflammation-inducing genes in PBMCs of aGVHD patients while simultaneously reconfiguring immune pathways. Furthermore, NGO treatment reduced the expression of several genes associated with immune activation and antigen presentation, such as IFNGR2, CD86, FCGR3A, TLR8, NLRP3, and LYZ (Fig. 3a, C).GO analysis of genes downregulated by NGOs in aGVHD PBMCs revealed an increase in immune-related processes, including "negative regulation of IL-10 production" and "myeloid cell activation involved in immune response" (Fig. 3b). Additionally, "RAGE receptor binding," a molecular function that amplifies inflammation through innate immune signaling, was also increased (Fig. 3c).
[0251] To evaluate whether these immunomodulatory effects were consistent in nonGVHD samples, peripheral blood proteins (PBMCs) of nonGVHD patients treated with NGOs were also analyzed. Among the four major immune-related genes identified above, S100A8, FCER1G, and PLA2G4A were significantly downregulated in nonGVHD cases as well. Heatmap analysis confirmed that the expression of additional immune-related genes, including CXCL11, JAK2, TLR8, B2M, STAT1, and LYZ, decreased after NGO treatment. These results demonstrate that NGOs suppress major pro-inflammatory gene signatures in PBMCs of both aGVHD and nonGVHD patients, supporting the broad immunomodulatory potential of NGOs across diverse donor backgrounds.
[0252]
[0253] [Example 5]
[0254] NGO that downregulates M1 macrophage-related genes in mRNA transcriptome analysis
[0255] To mitigate statistical bias caused by the small number of patient samples, additional transcriptome analysis was performed using in vitro activated PBMCs from healthy donors. RNA sequencing of control and NGO-treated hPBMCs revealed distinct clustering between the two groups (Figure 4A). In particular, genes associated with M1 macrophage polarization and the IFN-γ signaling pathway were downregulated by NGO exposure (Figure 4B). Furthermore, GSEA confirmed a decrease in the expression of the COATES_MACROPHAGE_M1_VS_M2_UP gene set after NGO exposure. This gene set consisted of genes that are upregulated in M1 macrophages compared to M2 macrophages. Additionally, Intrinsic Pathway Analysis (IPA) predicted that the IFN-γ and STAT1 signaling pathways, which play a crucial role in the polarization of macrophages toward the inflammatory M1 phenotype, were downregulated upon NGO treatment (Table 3).
[0256] Disease and Function Predicted Activation Group Number of Target Molecules Predicted Activation Status Activation Z-Score P-Value of Overlap Migration of antigen-presenting cells NGO 20 treatment (vs. non-NGO treatment) 197 Inhibition -0.9284 E-16 Systemic autoimmune syndrome NGO 20 treatment (vs. non-NGO treatment) 276 Inhibition -1.16 3.83 E-33 Activation of leukocytes NGO 20 treatment (vs. non-NGO treatment) 158 Inhibition -0.46 4.59 E-21 Immune-mediated inflammatory disease NGO 20 treatment (vs. non-NGO treatment) 287 Inhibition -0.56 7.94 E-29
[0257]
[0258] [Example 6]
[0259] NGO that inhibits M1 macrophage polarization by selectively inhibiting STAT1 signaling
[0260] Considering the transcriptomic results, the role of NGO in M1 macrophage polarization was investigated in more detail in this invention. Human monocyte-derived macrophages were differentiated into M1 macrophages using LPS and IFN-γ and then treated with NGO. Flow cytometry analysis revealed that NGO decreased the expression of M1 surface markers CD80 and CD86 while simultaneously increasing the expression of M2 markers CD163 and CD206 in a time-dependent manner (Fig. 5A). Morphologically, M1 macrophages treated with NGO exhibited a spindle shape similar to M2, whereas untreated M1 macrophages maintained a round shape (Fig. 5J). Additionally, transcriptomic data showed differences in the expression of IFN-γ / -STAT1 signaling pathway genes (Fig. 4B). RT-PCR analysis confirmed that NGO not only reduced the expression of IFN-γR2 and STAT1 (Fig. 5B) under LPS and IFN-γ stimulation, but also reduced the expression of M1-related inflammatory chemokines (CXCL9, CXCL10) (Fig. 5C) and cytokines (IL-1β, IL-12B) (Fig. 5D). Furthermore, when M2-inducing cytokines were administered after M1 stimulation and NGO treatment, M1 markers decreased and M2 polarization was promoted (Fig. 5E).
[0261] CD4 M1 macrophages +As a result of evaluating functional outcomes through co-culture with T cells, it was found that IFN-γ production was significantly reduced upon NGO treatment (Fig. 5J). Furthermore, when NGO was treated after M1 stimulation, M2 polarization increased and M1 differentiation was inhibited (Fig. 5F). Since STAT1 phosphorylation is a key process in IFN-γ / STAT1 signaling, the effects of NGO on the regulation of STAT1 phosphorylation were analyzed in this invention. Western blot analysis revealed that total STAT1 and phosphorylated STAT1 (p-STAT1) decreased in M1 macrophages treated with NGO (Fig. 5J). Similarly, p-STAT1 levels decreased when NGO was treated after M1 stimulation (Fig. 5J). In particular, NGO inhibited STAT1 phosphorylation more effectively than fludarabine, a STAT1 inhibitor, and reversed the increase in STAT1 phosphorylation induced by 2-NP (Fig. 5G).
[0262] To determine whether ROS scavenging contributes to these effects, intracellular ROS levels were measured 6 hours after LPS and IFN-γ stimulation. Although NGO significantly reduced ROS, the antioxidant N-acetylcysteine (NAC) exhibited a more potent ROS inhibitory effect (Fig. 5J). Nevertheless, NAC did not reduce p-STAT1 levels 30 minutes after stimulation, but p-STAT1 levels were significantly reduced when NGO was administered alone or in combination with NAC (Fig. 5H). Therefore, these results suggested that NGO inhibits STAT1 activation through a mechanism independent of ROS reduction.
[0263] The present invention subsequently investigated whether NGOs regulate the TLR4-MyD88-NF-κB / MAPK axis, another key pathway of M1 polarization. Western blot analysis of NGO-treated macrophages revealed no changes in MyD88, ERK1 / 2, or p38 expression, phosphorylation of ERK1 / 2 or p38, or IκBα degradation (Fig. 5I). These results suggest that NGOs do not interfere with LPS-MyD88 signaling. Collectively, these results suggest that NGOs selectively inhibit polarization from M0 (non-polarized) macrophages to M1 macrophages by targeting the IFN-γ / STAT1 pathway, independent of ROS scavenging or TLR4-MyD88-NF-κB / MAPK signaling. This pathway specificity appears to support the relative stability of NGO-induced reprogramming rather than transient attenuation of cytokine responses.
[0264]
[0265] [Example 7]
[0266] NGO-Mac that regulates T cell responses through IL-10 signaling
[0267] Given the high biocompatibility of nanographene oxide (NGO), the immunosuppressive effect requires further evaluation for potential therapeutic applications. To evaluate the immunomodulatory effect, CD14 + NGO-Mac was generated by differentiating monocytes into macrophages and treating them with NGO (Fig. 6A). RT-PCR analysis showed that the levels of CXCL9 and CXCL10, which are primarily secreted by M1 macrophages, began to decrease 18 hours after NGO treatment (Fig. 6B). Furthermore, when CFSE-labeled peripheral blood protein proteins (PBMCs) were cultured with CD3 / CD28 and IL-2, it was found that NGO-Mac inhibited T cell proliferation more effectively than NGO or untreated macrophages (Mac) (Figs. 6C, 5J). CD4 +To evaluate the effects on T cells, CD4 T cells and CD14 in peripheral blood mononuclear cells (PBMCs) + Monocytes were isolated, and NGO-Mac was generated from CD14 monocytes and co-cultured using a Transwell system. NGO-Mac significantly increased the proportion of regulatory T cells (Treg) compared to the control group without macrophage co-culture (Fig. 6D). Additionally, under inflammatory conditions where helper T cells were induced to adopt a Th1 phenotype by administering IFN-γ and IL-12, NGO-Mac co-culture reduced the Th1 cell population while increasing Tregs (Fig. 6E).
[0268] Consistent with these immunomodulatory effects, NGO-Mac secreted significantly higher levels of IL-10 than Mac, as confirmed by ELISA (Fig. 6F). To determine if IL-10 mediates these effects, neutralizing antibodies against IL-10 were added to the Transwell co-culture medium. IL-10 blockade blocked NGO-Mac-mediated Treg induction (Fig. 6G). Furthermore, under inflammatory conditions, IL-10 neutralization reversed the inhibition of Th1 differentiation and reduced Treg expansion (Fig. 6H). Overall, these results demonstrate that NGO-Mac regulates T cell proliferation and differentiation through an IL-10-dependent mechanism, supporting its potential as a macrophage-based immunomodulatory cell therapy for GVHD.
[0269]
[0270] [Example 8]
[0271] aGVHD weakening of NGO-Mac in the xGVHD mouse model
[0272] To evaluate the therapeutic potential of NGO-Mac in vivo, CD14 isolated from the same donor peripheral blood mononuclear cells (PBMCs) used in the xGVHD model +Mac and NGO-Mac were generated using monocytes and administered to xGVHD mice (Fig. 7A). Mice administered only hPBMC showed significant body weight loss, whereas mice treated with NGO-Mac maintained stable body weight (Fig. 7B). Three mice died in the PBMC group and one in the Mac group, but no mortality was observed in the NGO-Mac group. Furthermore, GVHD scores decreased in mice treated with either Mac or NGO-Mac compared to the PBMC-alone group (Fig. 7C). Flow cytometry analysis of liver-infiltrating immune cells further showed a decrease in the proportion of M1 macrophages in the NGO-Mac group compared to the PBMC group (Fig. 7D). Moreover, Treg frequency increased in the spleen of mice treated with NGO-Mac compared to the PBMC group (Fig. 7E). Histopathological examination of skin (Fig. 7F), liver (Fig. 7G), and intestine (Fig. 7H) tissues further supported the protective effect of NGO-Mac. Additionally, CD3 + H&E staining and immunohistochemistry (IHC) results for T cells showed that the GVHD pathological scores were significantly lower in the Mac and NGO-Mac groups compared to the PBMC group, and in the NGO-Mac group, CD3 + T cell infiltration was also reduced. Similarly, in the intestines, GVHD pathological scores were lower in the NGO-Mac group, and CD3 in the Mac group and NGO-Mac group + T cell infiltration decreased.
[0273]
[0274] [Example 9]
[0275] Additional Analysis by NGO-Mac
[0276] <9-1> Increase in M2 Phenotype of NGO-Mac
[0277] The ratio of anti-inflammatory M2 macrophages was compared between macrophages differentiated from human peripheral blood-derived mononuclear cells by treating them with M-CSF at a concentration of 50 ng / mL for 6 days and macrophages differentiated by treating them with NGO at a concentration of 20 μg / mL for 18 hours and the NGO-treated macrophages (NGO-Mac).
[0278] As a result, as shown in [Figure 8], it was confirmed that the proportion of anti-inflammatory M2 macrophages in NGO-treated macrophages increased.
[0279]
[0280] <9-2> Plasticity Control of NGO-Mac
[0281] After producing NGO-Mac in human peripheral blood-derived mononuclear cells, an inflammatory condition was induced by treating with inflammatory cytokines (20 ng / mL IFN, 1 ug / ml LPS) for 48 hours, an anti-inflammatory condition was induced by treating with anti-inflammatory cytokines (20 ng / mL IL-4, 20 ng / mL IL-13), and the M2 macrophage ratio was confirmed.
[0282] As a result, as shown in [Figure 9], when NGO-Mac was exposed to an anti-inflammatory condition, there was no significant difference compared to when there was no stimulation; however, it was confirmed that the proportion of M2 macrophages increased significantly only when exposed to an inflammatory condition. This could be interpreted as regulating the plasticity of macrophages, which is a limitation of macrophages that changes easily according to the external environment.
[0283]
[0284] [Example 10]
[0285] The efficacy of NGO-NXM
[0286] <10-1> Cytotoxicity of NGO-NXM
[0287] Cytotoxicity was confirmed using a CCK-8 assay after treating RAW264.7 cell lines with NGO and PMPC surface-modified NGO (NGO-NXM, NGO-PMPC) at different concentrations for 24 hours. In addition, macrophages differentiated from human peripheral blood-derived mononuclear cells were treated with NGO or NGO-NXM at concentrations of 10 and 20 µg / ml, and after 24 hours, an apoptosis assay was performed by staining with Annexin V, 7-AAD and analyzing the results by flow cytometry.
[0288] As a result, as shown in [Figure 10], it was confirmed that the toxicity of NGO-NXM was significantly lower compared to NGO. Similarly, as shown in [Figure 11], the proportion of live cells was no different or increased compared to the untreated group for NGO 10 ug / ml and NGO-NXM 10 and 20 ug / ml, but decreased only in the NGO 20 ug / ml treatment group. In addition, the rates of late apoptosis and necrosis increased in the NGO 20 ug / ml treatment group, whereas they all decreased significantly in the NGO-NXM treatment groups compared to the untreated group. Taken together, it was determined that the cytotoxicity of NGO-NXM is significantly lower than that of NGO.
[0289]
[0290] <10-2> Effects of NGO-NXM on Macrophages
[0291] Macrophages differentiated from human peripheral blood-derived mononuclear cells were treated with inflammatory cytokines (20 ng / mL IFN, 1 ug / ml LPS) that differentiate them into M1 macrophages, and NGO and NGO-NXM were treated at concentrations of 10 and 20 ug / ml for 48 hours, and the ratio of M1 and M2 macrophages was confirmed by flow cytometry. In addition, macrophages differentiated from human peripheral blood-derived mononuclear cells were treated with inflammatory cytokines (20 ng / mL IFN, 1 µg / ml LPS) to induce differentiation into M1 macrophages, and NGO and NGO-NXM were treated at concentrations of 10 and 20 µg / ml for 30 minutes. Proteins were collected and the expression levels of STAT1 and phospho-STAT1 were confirmed by western blot.
[0292] As a result, as shown in [Figure 12], when comparing the groups treated with NGO and NGO-NXM at the same concentration, the proportion of M2 macrophages increased more in NGO-NXM, and the proportion of M1 macrophages decreased more when NGO-NXM was treated at 20 ug / ml compared to the NGO 20 ug / ml group. In addition, both NGO and NGO-NXM significantly inhibited the phosphorylation of STAT1 compared to M1 macrophages (Figure 13).
[0293]
[0294] [Example 11]
[0295] Analysis of the Characteristics of NGOs and NXM (NGO-PMPC)
[0296] Scanning electron microscope (SEM) and transmission electron microscope (TEM) analysis revealed that nano-graphene oxide exhibits a wrinkled, thin plate-like structure with an average diameter (1–20 nm) at the nanometer (nm) level (Fig. 14a). To more accurately measure the actual particle size distribution of the nano-graphene oxide particles, additional analysis was performed using a DISC centrifuge (DISC Centrifuge, CPS Instruments Inc., USA). As a result, it was confirmed that approximately 99% of the total particles of the nano-sized graphene oxide of the present invention have a size of 50 nm or less, while some particles are distributed up to approximately 100 nm. Additionally, atomic force microscope (AFM) analysis confirmed a thickness of approximately 1–2 nm, indicating the formation of a single- to few-layer structure (Figs. 15a, Fig. 15b). Such nano-structures provide high specific surface area and reactivity, which is advantageous for in vivo interactions.
[0297] UV-Vis spectroscopy results confirmed a π-π* transition (carbon-carbon double bond, C=C) at around 230 nm and an n-π* transition (carbonyl group, C=O) at around 300 nm, indicating the electronic structure and oxygen substitution state of nano-graphene oxide (Fig. 16).
[0298] In addition, zeta potential measurements showed that nano-graphene oxide exhibited a negative charge of approximately 50 mV or less, confirming that it maintains excellent stability in a colloidal dispersion state (Fig. 17). This suppresses aggregation through electrostatic repulsion between particles and maintains a homogeneous dispersion state, enabling stable operation even in a biological environment.
[0299] According to Fourier Transistor (FTIR) analysis, numerous oxygen-containing functional groups (e.g., carbonyl groups (C=O), hydroxyl groups (-OH), epoxy groups (COC), etc.) exist on the surface of nano-graphene oxide (Fig. 18a; gray lines). These functional groups enhance hydrophilicity in aqueous solutions and enable hydrogen bonding and electrostatic interactions with various biomolecules. Furthermore, these oxygenated functional groups confer redox-regulating capabilities, thereby increasing biocompatibility by contributing to the balance of reactive oxygen species (ROS) and antioxidant activity.
[0300] In addition, the first synthesis verification for modification into an amphoteric polymer was performed via IR analysis. The amide bonds formed after the coupling reaction of NGO with propargylamine and EDC were confirmed by FT-IR (Fig. 18a; blue line, 1069 cm⁻¹). -1 Subsequently, the characteristics of the modified NXM (NGO-PMPC) were confirmed by IR analysis (Fig. 18b).
[0301] The particle size distribution of nano-graphene oxide (NGO-PMPC) modified with amphoteric ionic polymers was measured using Dynamic Light Scattering (DLS) (Fig. 19). These results confirm the trends in particle size changes according to two different media (DW and DMEM). The particle size distribution was measured three times and presented as the average value and maximum-minimum error range. The top of Fig. 19 shows the results in cell culture medium (DMEM), and the bottom shows the results in triple-distilled water (DW). When measured in triple-distilled water (DW), a multiple-peak distribution was observed spanning from tens of nanometers (nm) to hundreds of nanometers, with the main particle size located around 100–500 nm. In contrast, when measured in cell culture medium (DMEM), peaks in the tens of nanometer (nm) range were predominantly observed for NGO-PMPC, and the overall particle size distribution showed a tendency to concentrate in a relatively small region.
[0302]
[0303] The present invention confirmed that the administration of graphene nanooxide (NGO), NGO modified with amphoteric ionic polymers, or macrophages treated with said NGO improved survival rates and effectively reduced tissue damage and inflammation in an animal model of acute graft-versus-host disease (GVHD) occurring after transplantation. NGOs regulated the activation and differentiation direction of immune cells, particularly macrophages, thereby reducing inflammation-inducing (M1-type) macrophages and increasing the induction of immunomodulatory (M2-type) macrophages and regulatory T cells (Treg), and also provided an effect of restoring immune balance in patient-derived immune cells. Therefore, the present invention has industrial applicability as it can be effectively utilized in the treatment of immune diseases caused by post-transplant complications such as graft-versus-host disease.
[0304]
[0305] Sequence No. 1 corresponds to the forward primer sequence of IL-1β.
[0306] Sequence No. 2 corresponds to the reverse primer sequence of IL-1β.
[0307] Sequence No. 3 corresponds to the forward primer sequence of TNF-α.
[0308] Sequence No. 4 corresponds to the reverse primer sequence of TNF-α.
[0309] Sequence No. 5 corresponds to the forward primer sequence of CXCL9.
[0310] Sequence No. 6 corresponds to the reverse primer sequence of CXCL9.
[0311] Sequence No. 7 corresponds to the forward primer sequence of CXCL10.
[0312] Sequence No. 8 corresponds to the reverse primer sequence of CXCL10.
[0313] Sequence No. 9 corresponds to the forward primer sequence of IFNγR2.
[0314] Sequence No. 10 corresponds to the reverse primer sequence of IFNγR2.
[0315] Sequence No. 11 corresponds to the forward primer sequence of STAT1.
[0316] Sequence No. 12 corresponds to the reverse primer sequence of STAT1.
[0317] Sequence No. 13 corresponds to the forward primer sequence of IL-12B.
[0318] Sequence No. 14 corresponds to the reverse primer sequence of IL-12B.
[0319] Sequence No. 15 corresponds to the forward primer sequence of GAPDH.
[0320] Sequence No. 16 corresponds to the reverse primer sequence of GAPDH.
Claims
1. A pharmaceutical composition for preventing or treating post-transplant complications comprising nanographene oxide.
2. A composition according to claim 1, characterized in that the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
3. A composition according to claim 1, characterized in that the post-transplant complication is one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
4. A pharmaceutical composition for preventing or treating post-implantation complications comprising nano-graphene oxide with a surface modified with a zwitter ionic polymer.
5. A composition according to claim 4, wherein the nano-graphene oxide modified with the amphoteric ionic polymer is a nano-graphene oxide variant in which nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.
0.
6. A composition according to claim 4, wherein the amphoteric ionic polymer is one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)), and PEI (Poly(ethylene imine)).
7. A pharmaceutical composition for preventing or treating post-transplant complications comprising macrophages treated with nanographene oxide.
8. A composition according to claim 7, characterized in that the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
9. A composition according to claim 7, wherein the surface of the nano-graphene oxide is modified with a zwitter ionic polymer.
10. A cell therapy agent for treating post-transplant complications comprising macrophages treated with nanographene oxide. 11.i) A step of producing immature macrophages by culturing monocytes with growth factors for 4 to 8 days; and ii) a step of treating the above immature macrophages with 15–25 μg / mL nanographene oxide for 16–20 hours; A method for preparing macrophages treated with nanographene oxide for the prevention or treatment of post-transplant complications, comprising 12. A method of preparation according to claim 11, characterized in that the monocytes are obtained from one or more selected from the group consisting of peripheral blood, spleen, and bone marrow.
13. A method of preparation according to claim 11, characterized in that the growth factor is a macrophage-colony stimulating factor.
14. A manufacturing method according to the 11th, characterized in that the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
15. A method of manufacturing according to claim 11, characterized in that the surface of the nano-graphene oxide is modified with a zwitter ionic polymer.
16. A method for treating post-transplant complications comprising the step of administering nano-graphene oxide to an individual in need.
17. A treatment method according to claim 16, characterized in that the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
18. A treatment method according to claim 16, wherein the above-mentioned post-transplant complications are one or more selected from the group consisting of graft-versus-host disease, graft rejection, autoimmune disease, posttransplant lymphoproliferative disorder, anemia, hyperglycemia, veno-occlusive disease, and pulmonary fibrosis.
19. A method for treating post-transplant complications comprising the step of administering nano-graphene oxide, whose surface is modified with a zwitter ionic polymer, to a subject in need.
20. A treatment method according to claim 19, wherein the nano-graphene oxide modified with the amphoteric ionic polymer is a nano-graphene oxide variant in which nano-graphene oxide and the amphoteric ionic polymer are combined in a ratio of 1.0:0.01 to 1.0:100.
0.
21. A treatment method according to claim 19, wherein the amphoteric ionic polymer is one or more selected from the group consisting of PMPC (Poly(2-methacryloyloxyethyl phosphorylcholine)), PVA (Polyvinyl alcohol), PAMPS (Poly(acrylamidomethylpropane sulfonic acid)), PDMAEMA (Poly(N,N-dimethylaminoethyl methacrylate)), PEGMA (Poly(ethylene glycol) methyl ether methacrylate), PHEMA (Poly(2-hydroxyethyl methacrylate)) and PEI (Poly(ethylene imine)).
22. A method for treating post-transplant complications comprising the step of administering macrophages treated with nanographene oxide to a subject in need.
23. A treatment method according to claim 22, characterized in that the average diameter of the nano-graphene oxide is 1 to 100 nm and the thickness is 0.3 to 3 nm.
24. A treatment method according to claim 22, characterized in that the surface of the nano-graphene oxide is modified with a zwitter ionic polymer.