Sirna delivery with biological vectors

By attaching an siRNA sequence to the EV or VLP membrane via a fusion protein with an RNA-binding domain, the method addresses inefficiencies in siRNA delivery, ensuring high loading and functional release for effective gene silencing.

WO2026095803A1PCT designated stage Publication Date: 2026-05-07UMC UTRECHT HLDG BV
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/NL2025/050565
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-04
Filing Date
2025-11-04
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current strategies for delivering siRNA using extracellular vesicles (EVs) and viral particles (VLPs) face challenges such as inefficient encapsulation, poor loading efficiency, and limited target versatility, with existing methods often compromising the functionality and stability of siRNA.

Method used

The use of a fusion protein comprising an RNA-binding domain attached to the EV or VLP membrane, which incorporates an RNA molecule with a stemloop and siRNA sequence, allowing efficient loading and release of siRNA into target cells via cellular enzymes.

Benefits of technology

This approach achieves high loading efficiency of siRNA into EVs and VLPs without compromising RNA functionality, enabling effective silencing of target genes and reducing cellular toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000017_0001
    Figure IMGF000017_0001
  • Figure IMGF000041_0001_TABLE
    Figure IMGF000041_0001_TABLE
Patent Text Reader

Abstract

The invention relates to an extracellular vesicle (EV), viral particle or virus like particle (VLP) comprising an RNA molecule attached to the internal surface of the EV membrane, to the viral particle or to the VLP membrane via a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain, wherein the RNA molecule comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by the RNA-binding domain, and wherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain, to encoding nucleic acid molecules and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Title: siRNA delivery with biological vectors

[0002] Field of the invention

[0003] The invention relates to the field of siRNA delivery, in particular to extracellular vesicles, viral particles and virus-like particles comprising siRNA as drug delivery vehicles.

[0004] Background of the invention

[0005] Nucleic acid-based therapies are rapidly revolutionizing the medical landscape due to their ability to specifically regulate expression of any gene of interest, including therapeutic target genes. Many classes of thepeutic nucleic acids exist, including mRNAs, short oligonucleotides, guide RNAs for gene editing purposes and siRNAs.

[0006] siRNAs are short, double stranded RNA molecules that specifically inhibit translation of targeted mRNAs. Unmodified siRNAs are rapidly degraded in the circulation and are negatively charged, preventing diffusion into the cell's cytoplasm, where siRNA exerts its function.

[0007] Advances in RNA chemistry have yielded chemically modified siRNAs conjugated to targeting ligands (e.g. GalNAc) which overcome some of these hurdles, but these conjugates lack delivery efficiency and target versatility.

[0008] Alternatively, siRNAs can be encapsulated in synthetic vectors to avoid their clearance and degradation in the bloodstream and to enable entry into the cell. Synthetic vectors, including lipid nanoparticles and polymers, can encapsulate high quantities of siRNA, but their delivery efficiency is typically low. In addition, doselimiting toxicities and predominant accumulation in the liver after intravenous administration limits their versatility. Biological vectors, such as extracellular vesicles (EVs), viruses and virus-like particles (VLPs) typically show higher cargo delivery efficiencies and organ-targeting versatility, but are currently ill-suited for the delivery of siRNA, for two reasons: (1) siRNA needs to be efficiently encapsulated in the vector, which has proven problematic, and (2) if efficient siRNA encapsulation is achieved, it needs to be released from the vector at the appropriate site in the recipient cell. RNA aptamers have previously been used to load longer nucleic acids, including mRNA and components of the CRISPR / Cas system (guide RNAs), in biological vectors. There, the aptamers were inserted in non-funcional domains of the RNAs of interest (i.e. untranslated regions of mRNAs and RNA loops protruding from Cas nucleases for guide RNAs). This yielded effective loading of the nucleic acids into the vectors, but their functionality upon delivery to recipient cells was severely restricted by the ability to be released from the vector (e.g. Hung et al, J. Extracellular Vesicles, 2016). This was addressed by introduction of conditional release domains in fusion proteins and vector proteins, such as photocleavable domains (Han et al, Sci Transl Med, 2024) or chemical dimerization domains (Ilahibaks et al, J Extracell Biol, 2023 and WO 2019 / 092145 Al).

[0009] Prior efforts to load siRNA in EVs were focused on simple overexpression of shRNAs in EV-producing cells or transfection of synthetic siRNAs in those cells (e.g. Ohno et al, Mol Ther, 2013; Liu et al, Sci Rep, 2015; Zhang et al, Biomaterials, 2014). These strategies rely on the passive secretion of high intracellular concentrations of siRNAs in EVs, resulting in EVs with only low and variable / poorly predictable amounts of siRNA. Alternatively, physical methods have been explored to load EVs after their isolation, for example using electroporation (e.g. Alvarez-Erviti et al, Nat Biotechnol, 2011; Kamerkaer et al, Nature 2017), sonication (Haney et al, J Controlled Release, 2015), lipid transfection (Wahlgren et al, Nucleic Acids Res, 2012) or by conjugating siRNAs to lipid tails (O'Loughlin et al, Mol. Ther, 2017). These strategies have major disadvantages, such as perturbation of the structure of EVs, causing EV aggregation and loss of function (Kooijmans et al, J Controlled Release, 2013), poor loading efficiencies, or siRNA located on the outside of the EV membrane, exposing siRNAs to serum nucleases and inhbiting functional delivery.

[0010] Hence, there remains a need in the art for strategies for efficient delivery of siRNA.

[0011] Summary of the invention

[0012] It is an object of the present invention to provide strategies for siRNA delivery that overcome one or more of the disadvantages of current EV-based and other strategies. The invention therefore provides an extracellular vesicle (EV), viral particle or virus like particle (VLP) comprising an RNA molecule attached to the internal surface of the EV membrane, to the viral particle or to the VLP membrane via a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain, wherein the RNA molecule comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by the RNA-binding domain, and wherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain

[0013] In a further aspect, the invention provides a nucleic acid molecule comprising an oligonucleotide comprising the linear sequence of an RNA molecule comprising at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain.

[0014] In a further aspect, the invention provides a pharmaceutical composition comprising the EV, viral particle or VLP or nucleic acid molecule according to the invention and a pharmaceutically acceptable carrier.

[0015] In a further aspect, the invention provides a method for producing extracellular vesicles (EVs) according to according to the invention comprising: - introducing a nucleic acid molecule according to according to the invention into a mammalian host cell;

[0016] - optionally introducing a nucleic acid molecule comprising an oligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain;

[0017] - allowing the host cell to produce EVs; and

[0018] - isolating the produced EVs.

[0019] In a further aspect, the invention provides a mammalian host cell provided with a nucleic acid molecule according to according to the invention and optionally a nucleic acid molecule comprising an oligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain.

[0020] In a further aspect, the invention provides an EV, viral particle VLP, nucleic acid molecule, or pharmaceutical composition according to according to the invention for use as a medicament, or for use in treatment, prevention or diagnosis of disease. In a further aspect, the invention provides a method of treatment or prevention of a disease in an individual in need thereof, comprising administering an EV, viral particle VLP, nucleic acid molecule, or pharmaceutical composition according to the invention to the individual.

[0021] In a further aspect, the invention provides a use of an EV, viral particle VLP, nucleic acid molecule, or pharmaceutical composition according to the invention for the preparation of a medicament, in particular for treatment of a disease.

[0022] Detailed description

[0023] As used herein, "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of’ meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.

[0024] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0025] The word “approximately” or “about” when used in association with a numerical value (e.g. approximately 10, about 10) preferably means that the value may be the given value (e.g. 10), plus or minus 5% of the value (e.g. 10, plus or minus 5%), preferably plus or minus 1% of the value.

[0026] The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.

[0027] As used herein, the term “prevention” refers to precluding or delaying the onset of a disease or condition and / or the appearance of clinical symptoms of the disease or condition in a subject that does not yet experience clinical symptoms of the disease.

[0028] The term “treatment” refers to inhibiting the disease or disorder, i.e., halting or reducing its development or at least one clinical symptom of the disease or disorder, and / or to relieving symptoms of the disease or condition. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.

[0029] As used herein, the term “subject” encompasses humans and animals, preferably mammals. Preferably, a subject is a mammal, including humans, and non-human primates, rodents, such as mice, rats and guinea pigs, farm animals such as cattle, sheep goats and horses, domestic animals, such as cats and dogs, more preferably a human.

[0030] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to compounds comprising amino acids joined via peptide bonds. The protein, peptide or polypeptide can be naturally occurring, such as a biologically active protein, e.g. antibody, cytokine, growth factor, plasma protein, etc., or a synthetic protein, peptide or polypeptide, e.g. an engineered protein, peptide or polypeptide, such as a variant or part of a biologically active protein, e.g. antibody, cytokine, growth factor, plasma protein, etc. The term “therapeutic protein” is well known in the art and refers to a protein or (poly)peptide that has a therapeutic or prophylactic effect when administered to a subject.

[0031] As used herein with respect to the amino acids sequence of a polypeptide, the terms “N- terminal” and “C-terminal” refer to relative positions in the amino acid sequence of the polypeptide toward the N-terminus and the C-terminus, respectively. “N- terminus” and “C-terminus” refer to the extreme amino and carboxyl ends of the polypeptide, respectively. “Immediately N-terminal” and “immediately C-terminal” refers to a position of a first amino acid sequence relative to a second amino acid sequence where the first and second amino acid sequences are covalently bound to provide a contiguous amino acid sequence.

[0032] In amino acid sequences as defined herein amino acids are denoted by singleletter symbols. These single-letter symbols, as well as three-letter symbols, are well known to the person skilled in the art and have the following meaning: A (Ala) is alanine, C (Cys) is cysteine, D (Asp) is aspartic acid, E (Glu) is glutamic acid, F (Phe) is phenylalanine, G (Gly) is glycine, H (His) is histidine, I (Ile) is isoleucine, K (Lys) is lysine, L (Leu) is leucine, M (Met) is methionine, N (Asn) is asparagine, P (Pro) is proline, Q (Gln) is glutamine, R (Arg) is arginine, S (Ser) is serine, T (Thr) is threonine, V (Val) is valine, W (Trp) is tryptophan, Y (Tyr) is tyrosine.

[0033] As used herein, a nucleic acid molecule, oligonucleotide or nucleic acid sequence(s) of the invention comprises a chain of nucleotides of any length, preferably DNA and / or RNA. The term nucleic acid molecule includes recombinant and synthetic nucleic acid molecules. The nucleotides in an RNA sequences or molecule are indicated as adenine (A), uracil (U), cytocine (C) and guanine (G). It will be understood that in a DNA sequence or molecule, such as a plasmid, that encodes an RNA sequence or molecule, instead of U thymine (T) will be present.

[0034] The percentage of identity of an amino acid sequence or nucleic acid sequence, or the term “% sequence identity”, is defined herein as the percentage of residues of the full length of an amino acid sequence or nucleic acid sequence that is identical with the residues in a reference amino acid sequence or nucleic acid sequence after aligning the two sequences to achieve the maximum percent identity. As used herein sequence identity is calculated on the basis of consecutive amino acids of the subject amino acid sequence. Methods and computer programs for the alignment are well known in the art, for example "Align 2". Programs for determining nucleotide sequence identity are also well known in the art, for example, the BESTFIT, FASTA and GAP programs. These programs are readily utilized with the default parameters recommended by the manufacturer.

[0035] As used herein, the term “complementary” refers to a nucleic acid sequence that, when arranged in an anti-parallel fashion with another nucleic acid sequence, forms Watson-Crick base-pairs. In particular, C and G bases pair together and A and U bases pair together.

[0036] The present inventors have developed a novel technology for efficient delivery of siRNA into target cells. The technology is based on delivery via EVs, viral particles or VLPs and uses a novel strategy to attach an siRNA which is incorporated into an RNA molecule to the luminal side of the EV membrane or to the viral particle or VLP. By making use of EV membrane proteins, viral particle proteins or VLP proteins that bind an RNA molecule via an RNA-binding domain, high loading of the RNA molecule and thus of the siRNA is achieved. As demonstrated in the Examples herein, the technology allows for efficient loading of inter alia EVs and VLPs without compromising processing of the RNA molecule into the active siRNA and the functionality of the siRNA and with low cellular toxicity. The technology of the present invention provides a simple and straightforward process to prepare siRNA loaded EVs, viral particles or VLPs by host cells, which can subsequently be isolated and used in a wide array of applications, including therapeutic applications.

[0037] Figure 1 schematically shows the technology of the invention for EVs. EVs can be loaded with the RNA molecules comprising an siRNA according to the invention. Following uptake by the target cell, the EV membrane fuses with the endosomal membrane thereby exposing the RNA molecule to the cytoplasm. The siRNA is then cleaved from the remainder of the RNA molecule by cellular enzymes such as the endoribonuclease DICER, and can perform its silencing activity. The platform technology of the invention is independent of the specific siRNA that is incorporated into the RNA molecule and can be used with a wider variety of RNA binding domains and RNA sequences bound by such domains.

[0038] The Examples herein describe the development of the technology whereby EV’s or VLPs loaded with an RNA molecule according to the invention comprising an siRNA against the reporter genes GFP and / or firefly luciferase and an aptamer are produced and isolated from host cells. The siRNA were shown to be processed and to be active in silencing the respective target reporter genes. In addition, isolated EV’s and VLPs loaded with an RNA molecule comprising an siRNA against GFP were able to silence gene expression in target cells.

[0039] In a first aspect, the invention therefore provides an extracellular vesicle (EV), viral particle or virus like particle (VLP) comprising an RNA molecule attached to the internal surface of the EV membrane, to the viral particle or to the VLP via a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain, wherein the RNA molecule comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by the RNA-binding domain, and wherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain. Also provided is an RNA molecule comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain.

[0040] As used herein the term “extracellular vesicle”, abbreviated as “EV”, refers to a cell-derived vesicle having a lipid bilayer membrane that encloses an internal space. EVs typically range in size from approximately 20 to 1000 nm. They are formed through the outward budding of the cell membrane, giving rise to microvesicles that are released to the external environment, or through the inward budding of the cellular membrane, giving multivesicular bodies that in turn release vesicles upon fusion with the plasma membrane (exosomes). Extracellular vesicles can be prepared by culturing appropriate producer cells in a suitable medium and harvesting extracellular vesicles. The extracellular vesicle according to the invention can be a microvesicle or an exosome. In preferred embodiments, the extracellular vesicle is an exosome. As used herein, an exosome preferably refers to an EV having a diameter of 20-300 nm.

[0041] As used herein, the term “viral particle” refers to single unit of virus comprising a capsid which encloses a viral polynucleotide, e.g. the viral genome or a subject targeting vector, in case of a recombinant virus). In some embodiments, the viral particle is selected from the group consisting of a retrovirus, an adenovirus, a lentivirus, a herpes virus, a pox virus, a human foamy virus and an adeno-associated virus.

[0042] As used herein, the term “virus-like particle” or “VLP” refers to particle that contains viral protein, e.g. proteins from the outer coat of a virus, but that does not contain the viral genome. Therefore, VLPs are nonreplicative in nature, which make them safe for administration. In some embodiments, the VLP is selected from the group consisting of human immunodeficiency virus (HIV) VLP, a simianhuman immunodeficiency virus (SHIV) VLP, a feline immunodeficiency virus (FIV) VLP, a feline leukemia virus VLP, a bovine immunodeficiency virus VLP, a bovine leukemia virus VLP, a equine infectious anemia virus VLP, a human T-cell leukemia virus VLP, a Bunya Virus VLP, a Lassa fever virus VLP, an Ebola virus VLP, a corona virus VLP, an Arena virus VLP, a Filovirus VLP, an influenza virus VLP, a paramyxovirus VLP, a rhabdovirus VLP, an alphavirus VLP, and a flavivirus VLP. In the EV of the invention, the RNA molecule is attached to the internal surface of the EV membrane. As used herein “EV membrane” refers to the lipid bilayer membrane that separates the internal space of the EV from the external environment. The lipid bilayer membrane protects the material that is encapsulated in the EV, including proteins, nucleic acids, lipids and metabolites, from the extracellular environment. The internal space of the EV is also referred to as the lumen. The “internal surface” of the EV membrane refers to the luminal side of the membrane. RNA molecules that are attached to the internal surface of the EV membrane are thus located in the internal space or lumen of the EV.

[0043] The RNA molecule is attached to the EV membrane, viral particle or VLP via a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain.

[0044] As used herein, the term “fusion protein” refers to a non-naturally occurring protein or proteinaceous molecule comprising at least two proteins, polypeptides, peptides, parts thereof or a combination thereof. The EV, viral particle or VLP of the invention comprise a plurality of fusion proteins. The EV, viral particle or VLP of the invention may further comprise two or more different fusion proteins, e.g. fusion proteins comprising different protein or part thereof and / or different RNA-binding domain. The EV, viral particle or VLP of the invention may further comprise two or more different RNA molecules, e.g. RNA molecules comprising different siRNAs and / or RNA molecules comprising different sequences that are recognized by an RNA-binding domain, e.g. comprising different aptamers.

[0045] An “EV membrane, viral particle or VLP protein or part thereof’ refers to an EV membrane protein or part thereof (in case of an EV according to the invention), a viral particle protein or part thereof (in case of a viral particle according to the invention) or a VLP protein or part thereof (in case of a VLP according to the invention).

[0046] An “EV membrane protein” refers to a protein present in the membrane of an EV, referred to as a membrane domain, and which further comprises a luminal domain, i.e. a domain that is extends from the membrane into the lumen of the EV. In some preferred embodiments, the EV membrane protein is enriched in the EV membrane as compared to other membranes, such as the cellular membrane, lysosomal membrane, etc. “Enriched” in this context refers to a higher presence in the EV membrane per surface area as compared to such other membranes. Nonlimiting examples of suitable EV membrane proteins are CD9, CD63, CD81, PDGFR (Platelet-derived growth factor receptor), ALIX (ALG-2 interacting protein X), TSG101 (tumor susceptibility gene 101 protein), MHC1 (major histocompatibility complex 1), HSP90 (heat shock protein 90), syndecan-1, syntenin, flotillin-1, ADRB2 (adrenoceptor beta 2), Tspan 2, Tspan 3, LAMP2B (lysosomal-associated membrane protein 2), palmitoylation signal peptide, myristoylation signal peptide, IGSF8 (immunoglobulin superfamily member 8), MARCKSL1 (MARCKS like 1), BASP1 (brain acid-soluble protein 1), MARCKS (Myristoylated alanine-rich C kinase substrate) and PTGRFN (prostaglandin F2 receptor inhibitor). A part of a EV membrane protein refers to a part of such protein, that comprises at least a membrane domain (part of the EV membrane protein that is present in the EV membrane) and at least part of the luminal domain (part of the EV membrane protein that extends from the membrane into the lumen of the EV). Therefore, a fusion protein comprising a part of such EV membrane protein and an RNA-binding domain is attached to the luminal side of the EV membrane. After formation of the EV, the fusion protein is present in the lumen of the EV.

[0047] A viral particle protein or VLP protein refers to a protein that is part of or attached to the external surface of the viral particle or VLP. A part of a viral particle protein or VLP protein comprises at least a part of such protein that is present in or attached to the external surface of the viral particle or VLP.

[0048] Therefore, a fusion protein comprising a part of such protein and an RNA-binding domain is attached to the viral particle or VLP. Non-limiting examples of suitable viral particle or VLP proteins include structural viral proteins such as the family of Gag (group- specific antigen) proteins, paramyxovirus M protein, Nef7, and VSV-G (Vesicular stomatitis virus glycoprotein G) and endogenous counterparts such as PEG 10 (Paternally Expressed Gene 10) or Arc (Activity-regulated cytoskeleton-associated protein). In further preferred embodiments the viral particle or VLP protein or part thereof is a Gag protein or part thereof. As used herein an “RNA-binding domain” refers to a domain of a protein or polypeptide that is capable of binding to an RNA molecule. In the fusion protein, the RNA-binding domain is preferably attached, optionally via a linking sequence, to the luminal domain or part thereof of the EV membrane protein or part thereof or to the viral particle protein or part thereof or VLP protein or part thereof. In some preferred embodiments, the DNA-binding domain is an aptamer-binding domain or an RNA-binding domain that is bound by an RNA motif, e.g. PUM-HD, preferably an aptamer-binding domain. I will be understood that the RNA-binding domain is specific for the sequence that is recognized by the RNA-binding domain in an RNA molecule of the invention. E.g. if the sequence that is recognized by the RNA-binding domain is an aptamer, the RNA-binding domain comprises a domain of a protein or polypeptide that is recognized by the aptamer, preferably by an MS2 aptamer, a PP7 aptamer, a QB aptamer, a Pepper aptamer, a AN aptamer, a His aptamer, an aptamer recognized by the HIV Tat domain, such as an HIV transactivation response (TAR) aptamer. In some preferred embodiments, the RNA binding domain comprises or consists of the MS2 bacteriophage coat protein or a part thereof that recognizes an MS2 aptamer.

[0049] The fusion protein may comprise a linking sequence located between the EV membrane, viral particle or VLP protein or part thereof and the RNA-binding domain, preferably aptamer-binding domain. Such linker may provide for flexibility in the RNA molecule that is attached to the EV membrane internal surface, the viral particle or the VLP. Peptide linker for attachments of e.g. proteins and polypeptides to a cell membrane are widely used and a skilled person is well capable of selecting suitable linkers. Preferably the linking sequence is an amino acid sequence, i.e. a peptide linking sequence, preferably consisting of between 2 and 30 amino acids, more preferably between 3 and 30 amino acid, more preferably between 4 and 30 amino acids, more preferably between 5 and 30 amino acids, more preferably between 6 and 30 amino acids, such as between 10 and 30 amino acids or between 2 and 10 amino acids. In some preferred embodiments the linking sequences consists of between 2 and 10 amino acids, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. In preferred embodiments, the linking sequence consists of between 2 and 7 amino acids, more preferably of between 3 and 6 amino acids. In other preferred embodiments, the linking sequence has a length of between 10 and 30 amino acids, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acids.

[0050] An RNA molecule according to the invention comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by the RNA-binding domain, wherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain.

[0051] Without being bound to theory, it is believed that the combination of these three elements in the RNA molecules allows efficient cleavage of the siRNA from the remainder of the RNA molecule. As demonstrated in the Examples herein, an RNA molecule in accordance with the invention is expressed in extracellular vesicles and provides a functional siRNA, as evidenced by the silencing activity of the RNA molecule against two reporter genes in cells that produce the RNA molecule and in cells to which EVs deliver the RNA molecule. Such molecule shows the highest silencing activity amongst the different RNA molecules that were tested.

[0052] As used herein an siRNA refers to small interfering RNA, also referred to as short interfering RNA, which are short double stranded RNA molecules, which operate within the RNA interference (RNAi) pathway. siRNA’s are typically 20-25 base pairs long. siRNA’s interfere with the expression of genes with a sequence that is complementary to the siRNA sequence. In particular, they degrade mRNA after transcription which has the result that translation is prevented. Naturally occurring siRNAs exist that are produced by cleavage from long double- stranded RNA’s and short hairpin RNA’s (shRNA’s) by the DICER enzyme. Synthetic siRNA’s have been identified as useful therapeutics in a wide variety of disorders, including genetic disorders and cancer. As detailed herein above, the technology of the invention is independent of the specific gene that is targeted by the siRNA and as such any siRNA can be incorporated in the RNA molecule of the invention. For instance, siRNA’s targeting a therapeutic gene can be incorporated into an RNA molecule in accordance with the invention. As another example, siRNA can be used as an adjuvant for gene therapy applications, whereby gene replacement therapy is combined with an siRNA directed against a defective copy of the gene. In preferred embodiments, the siRNA sequence is a 20-25 base pair RNA sequence, more preferably a 20 or 21 base pair RNA sequence.

[0053] The RNA molecule further comprises at least one stemloop. The term “stemloop” refers to a secondary RNA structure formed by a single stranded RNA when the strand is folded back on itself to form an antiparallel duplex via complementary base pairing. The “stem” refers to the region of complementarity and the “loop” refers to a region intervening between the two complementary regions where no base pairing occurs and that thus forms a loop structure.

[0054] The size and nucleotide sequence of the stemloop comprised in RNA molecule can be varied as long as the secondary structure of a stemloop is present in the RNA molecule. Hence, in the stemloop, the stem consists of two complementary strands of RNA and the loop consists of a non-complementary strand of RNA, whereby in the linear RNA the loop is located between the two strands of complementary RNA that form the stem. In preferred embodiments, the stemloop consists of between 10 and 40 nucleotides, preferably whereby the stem consist of at least 4 nucleotides and the loop consists of at least 6 nucleotides. In further preferred embodiments, the stemloop consists of between 12 and 35 nucleotides, more preferably between 14 and 30 nucleotides, more preferably between 16 and 25 nucleotides, more preferably between 18 and 20 nucleotides, preferably whereby the stem consist of between 4 and 16 nucleotides, more preferably between 4 and 12 nucleotides, and the loop consists of between 6 and 19 nucleotides, more preferably between 8 and 14. In particularly preferred embodiment, the stemloop consists of 19 nucleotides, more preferably whereby the stem consists of 6-10 nucleotides and the loop consists of 9-13 nucleotides, more preferably whereby the stem consists of 8 nucleotides and the loop consists of 11 nucleotides. An exemplary stemloop comprises or consists of the sequence indicated in

[0055]

[0056] The RNA molecule in accordance with the invention further comprises one or more sequences that is / are recognized by the RNA-binding domain in the fusion protein. As used herein “recognized” means that the sequence can be bound by the RNA-binding domain. Said sequence can be any sequence that is recognized by an RNA-binding domain, such as an aptamer or another RNA motif recognized by an RNA-binding domain, e.g. PUM-HD.

[0057] An RNA molecule of the invention may comprise more than one sequence that is recognized by an RNA-binding domain in a fusion protein as defined herein. In particular, the RNA molecule may comprise two or three of such sequences, more preferably two sequences that is recognized by an RNA-binding domain in a fusion protein as defined herein. In some embodiments, said more than one, preferably two or three, more preferably two, sequences are recognized by the same RNA-binding domain. Alternatively, said more than one, preferably two or three, more preferably two, sequences are recognized by different RNA-binding domains.

[0058] Hence, an RNA molecule of the invention comprising more than one sequence that is recognized by an RNA-binding domain can be attached to the internal surface of the EV membrane, to the viral particle or to the VLP via a single fusion protein or via more than one fusion proteins, which may be the same or different. In preferred embodiments, an RNA molecule of the invention comprises one sequence that is recognized by an RNA-binding domain in a fusion protein as defined herein, preferably one aptamer.

[0059] Both the at least one stemloop and the one or more sequences that is / are recognized by the RNA-binding domain are attached to the siRNA sequence. In preferred embodiments, the stemloop and sequence are attached to the siRNA sequence via a bulge. Hence, the RNA molecule of the invention further preferably comprise a bulge. As used herein the term “bulge” refers to a secondary RNA structure consisting of non-complementary nucleotides, that forms a loop-like structure. The bulge serves as a spacer that connects the functional RNA sequences of the RNA molecule. In addition, the bulge may serve as a recognition signal for cellular enzymes such as Dicer and allows the correct processing of the siRNA. For instance, Dicer is believed to cleave double stranded RNA two nucleotide pairs from a bulge sequence (Gu et al. 2012. Cell 151(4): 900-911). The bulge is thus preferably located between two or more stretches of complementary RNA. In preferred embodiments, the bulge is located between the siRNA and a stemloop, wherein the stemloop is attached to the bulge. In other preferred embodiments, the bulge is further located between the siRNA sequence and the sequence that is recognized by the RNA-binding domain. In further preferred embodiments, the bulge is attached to the siRNA sequence, the stemloop and the sequence that is recognized by the RNA-binding domain and is located between the siRNA sequence and the stemloop and between the siRNA sequence and the sequence that is recognized by the RNA-binding domain. Optionally a doublestranded spacer is present between the siRNA and the bulge. Hence, in some preferred embodiments the RNA molecule comprises:

[0060] - a double- stranded spacer located between the siRNA sequence and a bulge, - a bulge located between the double-stranded spacer and a stemloop, wherein the stemloop is attached to the bulge.

[0061] In further preferred embodiments, the RNA molecule comprises one bulge and one stemloop, whereby:

[0062] - a double- stranded spacer is located between the siRNA sequence and the bulge,

[0063] - the bulge is located between the double- stranded spacer and the stemloop, and - the stemloop is attached to the bulge.

[0064] The one or more sequences that is / are recognized by the RNA-binding domain, preferably one or more aptamers, is / are further preferably attached to the bulge. Optionally, a spacer is optionally located between the bulge and the one or more sequences that is / are recognized by the RNA-binding domain, preferably aptamer(s). If more than one, preferably two, of such sequences are present, they preferably both extend from the bulge.

[0065] Hence, in preferred embodiments, the at least one stemloop, the siRNA sequence and the one or more sequences that are recognized by the RNA-binding domain are attached to the bulge.

[0066] The size of the bulge may vary, and preferably consist of 3 to 15 nucleotides, more preferably 3 to 10 nucleotides, more preferably 3 to 7 nucleotides. In one embodiments, the bulge consist of 5 nucleotides.

[0067] In particular the bulge is formed by at least three stretches of single stranded RNA, which are located between the siRNA and the sequence that is recognized by an RNA-binding domain, between the sequence that is recognized by an RNA-binding domain and a stemloop and between the stemloop and the siRNA. Each of these stretches of nucleotides that form the bulge may consists of 1 to 7 nucleotides, preferably 1 to 5 nucleotides, more preferably 1 to 3 nucleotides. In some embodiments, the bulge consists of one nucleotide between the siRNA and the sequence that is recognized by an RNA-binding domain, one nucleotide between the sequence that is recognized by an RNA-binding domain and a stemloop and three nucleotides between the stemloop and the siRNA. The specific nucleotides present in the bulge are not critical. In some embodiments, the bulge comprises or consist of a cytosine between the siRNA and the sequence that is recognized by an RNA-binding domain, a uracil between the sequence that is recognized by an RNA-binding domain and a stemloop and uracil-uracil-adenine between the stemloop and the siRNA, as demonstrated in figure 2.

[0068] Optionally one or more double-stranded spacers are present between the bulge and the siRNA sequence, between the bulge and the stemloop and / or between the bulge and the one or more sequences that is / are recognized by the RNA-binding domain. Figure 2 shows a schematic example of an RNA molecule according to the invention. As will be understood by the skilled person, the sequence of the RNA molecule in figure 2 is not limiting to the invention. In particular, the sequence of the siRNA is varied based on the desired target gene of the siRNA.

[0069] The one or more double-stranded spacers are present between the bulge and the siRNA sequence, between the bulge and the stemloop and / or between the bulge and the one or more sequences that is / are recognized by the RNA-binding domain can be of any length.

[0070] In preferred embodiments, a double-stranded spacer that is present between the bulge and the siRNA has a length of between 1 and 10 base pairs, preferably between 1 and 5 base pairs, more preferably between 1 and 4 base pairs, more preferably between 1 and 3 base pairs. In some preferred embodiments, a doublestranded spacer that is present between the bulge and the siRNA consists of one or two base pairs, preferably two base pairs. The specific nucleotides present in such double-stranded spacer is not critical, in particular not for cleavage of the siRNA from the RNA molecule. In one embodiment, the double-stranded spacer comprises G-A

[0071]

[0072] or consist of the sequence C-U, whereby * indicates the side to which the siRNA is attached and # indicates the side to which the bulge is attached.

[0073] In preferred embodiments, a double-stranded spacer that is present between the bulge and the stemloop has a length of between 1 and 10 base pairs, preferably between 1 and 5 base pairs, more preferably between 1 and 4 base pairs, more preferably between 1 and 3 base pairs. In some preferred embodiments, if present, a double- stranded spacer between the bulge and the stemloop consists of one or two base pairs. The specific nucleotides present in such double- stranded spacer are not critical.

[0074] In preferred embodiments, a double-stranded spacer that is present between the bulge and the one or more sequences that is / are recognized by the RNA-binding domain has a length of between 1 and 10 base pairs, preferably between 1 and 5 base pairs, more preferably between 1 and 4 base pairs, more preferably between 1 and 3 base pairs. In some preferred embodiments, if present, a double-stranded spacer between the bulge and the one or more sequences that is / are recognized by the RNA-binding domain consists of one or two base pairs. The specific nucleotides present in such double-stranded spacer are not critical.

[0075] The RNA molecule preferably can be cleaved by an endonuclease, in particular an endoribonuclease, to release the siRNA from the remainder of the RNA molecule. Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain (DNA or RNA). Endoribonuclease are enzymes that cleave the phosphodiester bond within an RNA chain. In preferred embodiments, the endoribonuclease is further an intracellular endoribonuclease, preferably a mammalian intracellular endoribonuclease, more preferably a human intracellular endoribonuclease. “Intracellular endoribonuclease” refers to an endoribonuclease that exerts RNAse activity intracellularly, i.e. in the cytoplasm. In further preferred embodiments, the endoribonuclease is DICER or a DICER-like enzyme. DICER is a type III ribonuclease, and plays a key role in the production of miRNA and siRNA. In the RNAi pathway, DICER cleaves long double-stranded RNAs (dsRNAs) to generate siRNAs. These siRNAs are approximately 20-25 base pairs long.

[0076] An RNA molecule of the invention preferably has a length of between 60 and 200 nucleotides, more preferably between 70 and 150 nucleotides. In further preferred embodiments, an RNA molecule of the invention preferably has a length of between 80 and 120 nucleotides, such as between 80 and 90 nucleotides, between 90 and 100 nucleotides, or between 100 and 110 nucleotides.

[0077] In preferred embodiments, the RNA-binding domain is an aptamer-binding domain and the sequence that is recognized by the RNA-binding domain comprises or is an aptamer. An “aptamer” refers to a short, single-stranded DNA or RNA molecule (ssDNA or ssRNA) that can selectively bind to a specific target, including targets in proteins and peptides. Binding to their target is determined by the tertiary structure of the aptamer.

[0078] Any aptamer, and thus any aptamer binding domain, can be used in accordance with the invention. Preferably, the aptamer is an RNA molecule. It is possible to use known aptamers. Examples thereof include, but are not limited to, an MS2 aptamer, a PP7 aptamer, a QB aptamer, a Pepper aptamer, a AN aptamer, a His aptamer, an aptamer towards the HIV Tat domain, such as a TAR aptamer. In such case, the fusion protein comprises a protein or part or domain thereof that recognizes an MS2 aptamer, a PP7 aptamer, a QB aptamer, a Pepper aptamer, a AN aptamer, a His aptamer, an aptamer recognized by the HIV Tat domain, such as a TAR aptamer, respectively. However, it is also possible to use newly designed aptamers. Aptamers with binding affinity to a desired target that is part of the fusion protein in accordance with the invention, can for instance be selected using the SELEX methodology. SELEX stands for Sequential Evolution of Ligands by Exponential Enrichment and involves the screening of a large oligonucleotide library for binding properties. Through an iterative process, non-binding aptamers are discarded and aptamers binding to the desired target are expanded. Multiple rounds of SELEX are performed with increasing stringency to enhance enrichment of the oligonucleotide pool. Positive selection rounds can be alternated by negative selection round, which improves the selectivity of the resulting aptamers.

[0079] The aptamer present in an RNA molecule of the invention preferably has a length of between 10 and 100 nucleotides, more preferably between 12 and 80 nucleotides, more preferably between 15 and 60 nucleotides.

[0080] In some preferred embodiments, the aptamer is an MS2 aptamer. An MS2 aptamer is recognized by the MS2 bacteriophage coat protein and is for instance described in Parrott et al. (2000 Nucleic Acids Res, 28(2):489-497), which is incorporated herein by reference. Such MS2 aptamer for instance comprising or consists of the sequence ACAUGAGGAUCACCCAUGU or ACAUGAGGAUUACCCAUGU.

[0081] In some preferred embodiments, the aptamer is a PP7 aptamer. A PP7 aptamer is recognized by the coat protein of the Pseudomonas Phage PP7 and is for instance described in Lim et al. (2001 The Journal of biological chemistry. 276. 22507-13. 10.1074 / jbc. M102411200), which is incorporated herein by reference. Such PP7 aptamer for instance comprising or consists of the sequence UAAGGAGUUUAUAUGGAAACCCUUA.

[0082] In some preferred embodiments, the aptamer is a QB aptamer. A QB aptamer recognizes the coat protein of the Enterobacteria QB phage and is for instance described in Lim et al. (2001 The Journal of biological chemistry. 276. 22507-13. 10.1074 / jbc. M102411200), which is incorporated herein by reference. Such QB aptamer for instance comprising or consists of the sequence AUGCAUGUCUAAGACAGCAU.

[0083] In some preferred embodiments, the aptamer is a Pepper aptamer, e.g. as described in Uang et al. (2021, Nature Chemical Biology. 17. 10.1038 / s41589-021- 00884-6), which is incorporated herein by reference. A Pepper aptamer recognizes. Such Pepper aptamer for instance comprising or consists of the sequence CUGGGCGACGCGGGCUUCCGCGUCGCUGUCG or GGCGCCUGGGCGACGCGGGCUUCCGCGUCGCUGUCGGCGCC.

[0084] In some preferred embodiments, the aptamer is a His aptamer, e.g. as described in Yang et al. (Taianta, Volume 263, 1 October 2023, 124722), which is incorporated herein by reference. A His aptamer has high affinity for a stretch of histidine (His) amino acids. Such His aptamer for instance comprising or consists of the sequence GACUUAGUAGCGUUAGGAUUCGUCAGGAAUAAGUCUU.

[0085] In some preferred embodiments, the aptamer is an aptamer targeting the HIV Tat domain, such as a TAR aptamer, which is for instance described in Matsugami et al. (2003 Structure, 11(5):533-545), which is incorporated herein by reference. Such aptamer towards the HIV Tat domain for instance comprising or consists of the sequence GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC.

[0086] The EVs of the invention may comprise one or more additional compounds. Preferably, such compound is a compound that stimulates or enhances loading of the RNA molecule, into the EVs and / or release of EV contents in target cells.

[0087] Preferably, such compound is a compound that facilitates the interaction of EVs with target cells and endosomal membranes therein and as a result enhance their cargo release in the target cells. As such, the compound enhances delivery of RNA molecules via the EVs to target cells.

[0088] Such compound can be introduced into the EV, expressed on the EV membrane or both. Expression on the EV membrane can be either expression on the external surface of the EV membrane or expression on the internal surface of the EV membrane. In preferred embodiments, the compound is a protein or polypeptide. In further preferred embodiments, the compound or compounds, preferably protein or polypeptide, is expressed on the outer surface of the EV membrane.

[0089] In preferred embodiments, the compound is selected from the group consisting of Vesicular Stomatitis Virus G (VSV G) protein or a homolog thereof, such as syncytin-1 and syncytin-2, herpes simplex virus glycoprotein B (HSV gB), rabies viral glycoprotein, influenza virus hemagglutinin (HA), human immunodeficiency virus envelope glycoprotein gpl60 (gpl60), Caenorhabditis elegans Eff-1 and / or Caenorhabditis elegans Aff-1, or an active part thereof. As used herein, the term “active part” of a compound or protein refers to a part of compound or protein, respectively, that has the same functional activity as the compound or protein, respectively. In the present case, the active part of the recited compounds is a part that stimulates or enhances release of the RNA molecule into the cytoplasm of the target cells following uptake of the EVs. As used herein the term “homolog” refers to an equivalent compound or protein that performs the same biological function from another species than the reference species. In particular, a homolog of VSV G protein is an equivalent of VSV G protein from a species other than Vesicular Stomatitis Virus, such as a human homolog. The compound or part thereof is preferably expressed on the outer surface of the EV membrane. In further preferred embodiments, the EV expresses VSV G protein or a homolog thereof, such as syncytin-1 and syncytin-2 on the external surface of the EV membrane. In further preferred embodiments, the EV expresses VSV G protein on the external surface of the EV membrane.

[0090] Expression of a compound can for instance be achieved by transfection of the EV producer cell with a nucleic acid molecule comprising a nucleic acid sequence encoding the compound, such as a plasmid. For instance, after transfection of a VSV-G encoding plasmid in the producer cell, VSV-G is expressed automatically on the EVs outer membrane. Expression of VSV-G on the internal surface of EVs is not expected, but, if for some reason VSV-G is found in the internal space or lumen of the EV, it is not detrimental to the EV's function.

[0091] EVs, viral particles and VLPs according to the invention are preferably produced in host cells. Any suitable method known in the art can be used to deliver the RNA molecule to the host cell. In preferred embodiments the host cell is provided with a nucleic acid molecule that encodes the RNA molecule, such that the host cell produces the RNA molecule.

[0092] Also provided is therefore a nucleic acid molecule encoding an RNA molecule as defined herein. The secondary structure of the RNA molecule contains several parts of complementary RNA strands that are formed via complementary base pairing after transcription of the linear RNA molecule. Hence, in preferred embodiments the nucleic acid molecule comprises an oligonucleotide comprising the linear sequence of an RNA molecule according to the invention. A person skilled in the art is well capable of determining the linear sequence of an RNA molecule according to the invention. Preferably the oligonucleotide comprises at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain. The stemloop, siRNA sequence and sequence that is recognized by an RNA-binding domain are as defined herein above. In preferred embodiments, the oligonucleotide encodes an RNA molecule comprising:

[0093] - a double- stranded spacer located between the siRNA sequence and a bulge, - a bulge located between the double-stranded spacer and a stemloop, wherein the stemloop is attached to the bulge, and

[0094] wherein the nucleic acid molecule further comprises a promoter for an RNA polymerase and the RNA molecule is operably linked to the promoter, preferably wherein the RNA molecule comprises one bulge and one stemloop, whereby:

[0095] - a double- stranded spacer is located between the siRNA sequence and the bulge,

[0096] - the bulge is located between the double-stranded spacer, and

[0097] - the stemloop is attached to the bulge.

[0098] The promoter can be any promoter known in the art for RNA polymerases to transcribe an RNA molecule from a nucleic acid molecule such as a plasmid. Nonlimiting examples include RNA polymerase II promoters and RNA polymerase III promoters. Examples of RNA polymerase II promoters include, but are not limited to, cytomegalovirus (CMV) promoter, simian virus 40 (SV40) promoter, herpes simplex virus (HSV) promoter, Rous sarcoma virus (RSV) promoter. Examples of RNA polymerase III promoters include, but are not limited to, H1 promoter, U6 promoter and 7SK promoter. In preferred embodiments, the promoter is an RNA polymerase III promoter.

[0099] In further preferred embodiments, in the RNA molecule the sequence that is recognized by an RNA-binding domain is attached to a bulge, and whereby a spacer is optionally located between the bulge and the sequence that is recognized by an RNA-binding domain. In further preferred embodiments, the nucleic acid molecule and / or the oligonucleotide comprises from 5’ to 3’:

[0100] 1) sense strand sequence of the siRNA;

[0101] 2) one strand sequence of a double-stranded spacer;

[0102] 3) a sequence that is recognized by an RNA-binding domain;

[0103] 4) one strand of a double-stranded sequence of a stemloop;

[0104] 5) a loop sequence of the stemloop;

[0105] 6) a complementary strand of the double-stranded sequence of the stemloop; 7) complementary strand sequence of the double-stranded spacer; and

[0106] 8) antisense strand sequence of the siRNA,

[0107] Optionally, the nucleic acid molecule and / or the oligonucleotide further comprises a spacer sequence that is part of a bulge located between the double-stranded spacer and the stemloop, wherein the spacer sequence is located between the sequences of 2) and 3), the sequences of 3) and 4), and / or the sequences of 6) and 7). Preferably, these spacer sequences together will form a bulge that is located between the double-stranded spacer and stemloop and between the double-stranded spacer and the sequence that is recognized by an RNA-binding domain in the RNA molecule following transcription.

[0108] It is particularly preferred that the such spacer sequences are located between the sequences of 2) and 3), between the sequences of 3) and 4), and between the sequences of 6) and 7).

[0109] In some embodiments, a nucleic acid molecule comprises a sequence CTCACATGAGGATCACCCATGTTGCTACCCTGACCCAGTAGCCCAAG, corresponding to the sequence encoding an RNA molecule as shown in figure 2 without the siRNA, or a sequence that has at least 80% sequence identity therewith, more preferably at least 85% sequence identity, more preferably at least 90% sequence identity, more preferably at least 95% sequence identity. This sequence thus comprises a bulge as defined herein, an MS2 aptamer and a stemloop as defined herein. In some embodiments, a nucleic acid molecule comprises a sequence

[0110] CTCACATGAGGATCACCCATGTTGCTACCCTGACCCAGTAGCCCAAG. In some embodiments, the host cell is provided with the sequences encoding the RNA molecule and the fusion protein on a single nucleic acid molecule. Hence, in some preferred embodiments, the nucleic acid molecules further comprises an oligonucleotide encoding a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain as defined herein.

[0111] Suitable techniques for preparation of EV’s are known in the art and described in more detail below and in the Examples herein. As described, EVs can be isolated using tangential flow filtration and (Sepharose 4 Fast Flow-based) size exclusion chromatography as described in de Voogt et al. (bioRxiv.

[0112] 2023:2023.10.25.563755), which is incorporated herein by reference. In one aspect, the invention provides a method for producing extracellular vesicles (EVs) according to the invention comprising:

[0113] - introducing a nucleic acid molecule according to the invention comprising the linear sequence of an RNA molecule comprising at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain into a mammalian host cell;

[0114] - allowing the host cell to produce EVs; and

[0115] - isolating the produced EVs.

[0116] Isolation of EVs is not required if EVs are produced in vivo or in situ. Hence, in one aspect, the invention provides a method for producing extracellular vesicles (EVs) according to the invention comprising:

[0117] - introducing a nucleic acid molecule according to the invention comprising the linear sequence of an RNA molecule comprising at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain into a mammalian host cell, organism or subject; and

[0118] - allowing the host cell to produce EVs.

[0119] In some preferred embodiments, a method of the invention further comprises introducing a nucleic acid molecule comprising an oligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain. In some preferred embodiments, an oligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain is present on the nucleic acid molecule according to the invention comprising the linear sequence of an RNA molecule comprising at least one stemloop, an siRNA sequence and a sequence that is recognized by an RNA-binding domain.

[0120] The term “host cell” as used herein refers to any cell capable of producing extracellular vesicles. In preferred embodiments, the host cell is a cell that is capable of producing a heterologous protein, polypeptide or peptide. The term “host cell” encompasses to any eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells). Host cells may be in vitro or in vivo, e.g. located in a transgenic animal.

[0121] Any cell that is capable of producing EVs can be used as host cell, such cells include cells from a cell line and primary cells, including all adult-derived progenitor and stem cells. Suitable, but non-limiting examples of host cells, include HEK293, HEK293T, Gesicle 293T, Expi293, Expi293F, HER911, PER. C6, CHO, MSC-1, MCF-7, MDA-MB-231, Huh7, A549, HepG2, THP-1, PC3, B16-F10, C2C12, RAW264.7, A549, NIH-3T3, CT26. WT, EL4, HCT116, SCC-7, PANC-1, 4T1, MC38, U937, Jurkat, K562, Raji, Ramos, dendritic cells, macrophages, mesenchymal stem cells (MSCs) such as adipose-derived stem cells (ADSCs), bone marrow-derived mesenchymal stem cells (BM-MSCs), placenta-derived mesenchymal stem cells (PD-MSCs), and umbilical cord-derived mesenchymal stem cells (UC-MSCs), induced pluripotent stem cells (iPSCs), cardiac-derived progenitor cells (CPCs), cardiomyocytes, endothelial cells, fibroblasts, Schwann cells, astrocytes, oligodendrocytes, neurons, myoblasts, chondrocytes, tenocytes, hepatocytes, glioblastoma cells and pancreatic islet cells.

[0122] In further preferred embodiments the host cell is selected from the group consisting of HEK293, HEK293T, Expi293, Expi293F, HER911, PER. C6, CHO and MSC-1 cells.

[0123] In some preferred embodiments, the host cell is selected from the group consisting of HEK293, HEK293T, Expi293, Expi293F, HER911, PER. C6, and MSC-1 cells.

[0124] In some preferred embodiments, the host cell is a HEK293 or HEK293T cell. In some preferred embodiments, the host cell is a human host cell, such as PER. C6.

[0125] In some preferred embodiments, the host cell is a Expi293 or Expi293F cell.

[0126] A host cell in accordance with the invention is used to prepare EVs as disclosed herein. A host cell is also referred to as a “producer cell”. In some preferred embodiments, the host cell has a reduced activity or expression of an endonuclease, in particular endoribonuclease, that ensures cleavage of the siRNA from the RNA molecule. This provides the advantage that cleavage of the siRNA is reduced or avoided during production of the EVs by the host cell and cleavage of the siRNA from the EV mainly occurs in the target cell after administration of the EVs of the invention. As such, the introduction of RNA molecules in the EVs, i.e. attached via the fusion protein, is increased. As such, the use of endonuclease knock-out host cell and / or an endonuclease inhibitor enhances the efficiency of the EV drug delivery system of the invention.

[0127] Hence, in some preferred embodiments, the host cell is characterized by reduced activity or expression of endoribonucleases. Reduced activity or expression of such endoribonucleases can be achieved using any method known in the art for reducing activity or expression of a protein, in particular an endoribonucleases.

[0128] An example thereof includes the use of engineered host cells that have a reduced expression of the endoribonucleases, including endoribonucleases knockout cells. Such host cell can be prepared by any known method for reducing expression and / or knock-out of the polynucleotide and / or gene encoding the endoribonucleases, e.g. by RNA interference, and gene editing using genetic editing tools such as zinc finger nucleases, transcription activator-like effectors (TALEN) and CRISPR-Cas technology.

[0129] As another example, the host cell can be cultured in the presence of an inhibitor of the endoribonuclease, such as a small molecule inhibitor of the endoribonuclease. For example, a method of the invention for producing EVs according to the invention is performed in the presence of an endoribonuclease inhibitor. In particular, at least the step of allowing the host cell to produce EVs is performed in the presence of an endoribonuclease inhibitor. This can for instance be achieved by using culture medium comprising the endoribonuclease inhibitor and comprising the host cells when performing a method of the invention, in particular for the step of allowing the host cell to produce EVs.

[0130] Hence, in preferred embodiment, the host cell is an endoribonuclease knockout host cell and / or the method is performed in the presence of an inhibitor of the endoribonuclease, in particular intracellular endoprotease. In preferred embodiments, the host cell is a DICER knock-out host cell or a cell that is knockout cell for one or more of the components of the RNA-induced silencing (RISC) complex.

[0131] In other preferred embodiments, the method is performed in the presence of an inhibitor of DICER, and / or the method, or at least the step of allowing the host cell to produce EVs, is performed in the presence of a Dicer inhibitor, such as an siRNA against Dicer.

[0132] A method of the invention for producing EVs may further comprise providing the host cell with a nucleotide sequence encoding one or more compounds that stimulate or enhance loading of the RNA molecule into the EVs and / or release of EV’s in target cells. In preferred embodiments, the compound is a protein or polypeptide. In further preferred embodiments, the compound or compounds, preferably protein or polypeptide, is expressed on the outer surface of the EV membrane. In preferred embodiments, the compound is selected from the group consisting of Vesicular Stomatitis Virus G (VSV G) protein or a homolog thereof, such as syncytin-1 and syncytin-2, herpes simplex virus glycoprotein B (HSV gB), rabies viral glycoprotein, influenza virus hemagglutinin (HA), human immunodeficiency virus envelope glycoprotein gpl60 (gpl60), Caenorhabditis elegans Eff-1 and / or Caenorhabditis elegans Aff-1, or an active part thereof as disclosed herein, and combinations or fusions thereof.

[0133] The nucleotide sequence encoding one or more compounds that stimulate or enhance loading of the RNA molecule may be comprised in the nucleic acid molecule encoding the RNA molecule. Alternatively, a separate nucleic acid molecule may be used that comprises the nucleotide sequence encoding one or more compounds that stimulate or enhance loading of the RNA molecule.

[0134] A nucleic acid molecules may be any nucleic acid molecule suitable for introduction into host cell, such as a plasmid or viral vector. A nucleic acid molecule may be introduced into the host cell by any method known in the art, such as by transfection, transduction, e.g. lentiviral transduction or retroviral transduction, baculoviral expression system, DNA electroporation, or RNA electroporation. The nucleic acid molecule is either transiently, or, stably provided to the cell. Methods for transfection, transduction or electroporation of cells with a nucleic acid are known to the skilled person.

[0135] Alternatively, EVs according to the invention can be produced in vivo, e.g. after administration of e.g. a nucleic acid molecule or nucleic acid sequence or one or more nucleic acid sequence(s) according to the invention to a subject. In particular, one or more nucleic acid sequences can be delivered to an organ, such as the liver, muscle tissue, heart, or lung, of a subject, following which EV’s according to the invention are produced by the organ.

[0136] A nucleic acid molecule or nucleic acid sequence(s) according to the invention can be introduced in a subject using any method known in the art. For example, said nucleic acid molecule or nucleic acid sequence(s) is an expression vector. Said vector preferably additionally comprises means for high expression levels such as strong promoters, for example of viral origin (e.g., human cytomegalovirus) or promoters derived from genes that are highly expressed in a cell such as a mammalian cell. The expression vector can be a viral or non-viral vector. Nonlimiting examples of suitable expression vectors include retroviral, adenoviral, adeno-associated viral and herpes simplex viral vectors, non-viral vectors and engineered vectors. Non-viral expression vectors include nude DNA, such as plasmids, and nucleic acid molecules or sequences packaged into synthetic or engineered compositions such as liposomes, polymers, (lipid) nanoparticles and molecular conjugates. Methods for the generation of such non-viral expression vectors are well known in the art. As an alternative, a nucleic acid molecule or nucleic acid sequence(s) according to the invention may be provided to a subject by gene editing technology, including CRISPR / Cas, zinc-finger nucleases, and transcription activator-like effector nucleases-TALEN.

[0137] Also provided is a pharmaceutical composition comprising an EV or nucleic acid molecule according to the invention and at least one pharmaceutically acceptable carrier, diluent and / or excipient. By "pharmaceutically acceptable" it is meant that the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious, e.g. toxic, to the recipient thereof. In general, any pharmaceutically suitable additive which does not interfere with the function of the active compounds can be used. A pharmaceutical composition according to the invention is preferably suitable for human use.

[0138] In a preferred embodiment said suitable carrier is a solution, for example saline. The pharmaceutical composition is preferably a formulation for parenteral administration. Formulations for parenteral administration include intraarticular, intracardiac, intramuscular, intraocular, intravenous, intraventricular, intraarterial, intrathecal and subcutaneous administration. Further, the pharmaceutical composition may be administered to a subject or to an ex situ perfused organ of subject in hospital via infusion or via injection by a healthcare professional. Compositions for parenteral administration may for example be solutions of the EV or nucleic acid molecule of the invention in sterile isotonic aqueous buffer. Where necessary, the parenteral formulations may include for instance solubilizing agents, stabilizing agents and / or a local anaesthetic to ease the pain at the site of the injection.

[0139] The EVs, nucleic acid molecules and pharmaceutical compositions of the invention are advantageously used in therapy. Provided is therefore an EV, nucleic acid molecule, or pharmaceutical composition according to the invention for use as a medicament. Also provided is an EV, nucleic acid molecule, or pharmaceutical composition according to the invention for use in therapy. Also provided an EV, nucleic acid molecule, one or more nucleic acid sequences or pharmaceutical composition according to the invention for use in treatment, prevention or diagnosis of disease. Also provided is a method of treatment, prevention or diagnosis of a disease in an individual in need thereof, comprising administering the EV, nucleic acid molecule or pharmaceutical composition according to the invention to the individual.

[0140] The disease can be any disease, e.g. selected from the group consisting of a genetic disorder, cancer, a cardiovascular disorder, an infectious disease, an inflammatory disease, a central nervous system disorder, a respiratory disorder, a musculoskeletal disorder, a metabolic disorder and an immunological disorder. Non-limiting examples of diseases that can be treated with the EV, nucleic acid molecule, or pharmaceutical composition according to the invention are endocrine disorders, gastrointestinal disorders, renal and urological disorders, haematological disorders, dermatological disorders, ophthalmological disorders, otolaryngologic disorders, obstetrical and gynaecological disorders, psychiatric disorders, neurodegenerative disorders, congenital disorders, autoimmune disorders, allergic disorders, nutritional disorders, substance-related disorders, environmental disorders and rare disorders.

[0141] Features may be described herein as part of the same or separate aspects or embodiments of the present invention for the purpose of clarity and a concise description. It will be appreciated by the skilled person that the scope of the invention may include embodiments having combinations of all or some of the features described herein as part of the same or separate embodiments.

[0142] The invention will be explained in more detail in the following, non-limiting examples.

[0143] Brief description of the drawings

[0144] Figure 1: Schematic overview of the technology of the invention. EVs or VLPs loaded with modified shRNA are taken up by recipient cells via endocytosis. The nanoparticles fuse with the endosomal membrane, exposing their content to the cell’s cytosol. Without appropriate release mechanism, the RNA cargo remains attached to the endosomal membrane and cannot be active.

[0145] However, in the present invention, the membrane-bound shRNA can still be processed into active, single- stranded antisense siRNA by cellular enzymes (e.g. Dicer). This results in decreased production of targeted proteins.

[0146] Figure 2: Schematic example of an RNA molecule according to the invention. The RNA molecule contains a double-stranded siRNA molecule connected to a protein-binding aptamer, which provides an anchor for cell-based loading into biological nanoparticles. Additional bulge and stemloop structures support appropriate cellular processing into active single-stranded siRNA. This structure is in further figures referred to as ‘configurations’.

[0147] Figure 3: Silencing of reporter genes in the cell in which the aptamer-modified RNA molecule is produced. HEK293T cells expressing two different reporter genes were transfected with plasmids encoding appropriate shRNAs fused to protein-binding aptamers in 5 different configurations, or a control non-specific shRNA (NSsiRNA). In (A), shRNAs targeting eGFP were transfected in cells expressing eGFP and mCherry, whereas in (B), shRNAs targeting Firefly luciferase were transfected in cells expressing Firefly and Renilla luciferase. After 72h gene silencing was analyzed with flow cytometry (A) or luminescence assays (B), and target gene expression was normalized to cells expressing NSsiRNA.

[0148] Figure 4: Processing of the RNA molecule compared with an RNA molecule lacking an RNA-binding domain. Northern blots of HEK293T cells transfected with plasmids encoding shRNAs targeting either eGFP (A) or Firefly luciferase (B) fused to protein-binding aptamers in 5 different configurations. RNA was extracted 48h after transfection and analyzed by northern blotting (8 pg cellular RNA per lane). Membranes were probed with IRDye 680RD-conjugated probes against U6 as loading control and IRDye800CW-conjugated probes against the antisense strand of either siGFP (A) or siLuc (B).

[0149] Figure 5: Silencing of reporter genes in the cell in which the RNA molecule is produced, in presence of an RNA-binding protein. HEK293T cells expressing two different reporter genes were transfected with plasmids encoding membrane protein CD 9 with no affinity for MS2 RNA aptamers (CD 9-Halotag), a soluble cytoplasmic MS2-coat protein (MCP) with high affinity for MS2 aptamers (sol-MCP) or CD9 fused N-terminally to MCP, which binds MS2 aptamers and is incorporated in membranes. Twenty-four after transfection, cells were transfected again with plasmids encoding shRNAs fused to protein-binding aptamers in 5 different configurations. In (A), shRNAs targeting eGFP were transfected in cells expressing eGFP and mCherry, whereas in (B), shRNAs targeting Firefly luciferase were transfected in cells expressing Firefly and Renilla luciferase. After 72h gene silencing was analyzed with flow cytometry (A) or luminescence assays (B), and target gene expression was normalized to cells expressing NSsiRNA. Figure 6: shRNA processing in the cell in which the RNA molecule is produced, in presence of an RNA-binding protein. RNA was isolated from cells expressing RNA binding proteins and shRNAs described in figure 5. RNA was extracted 48h after transfection with shRNA- encoding plasmids and analyzed by northern blotting (8 pg cellular RNA per lane). Membranes were probed with IRDye 680RD-conjugated probes against U6 as loading control and IRDye800CW-conjugated probes against the antisense strand of either siGFP (A) or siLuc (B).

[0150] Figure 7: The internal bulge allows insertion of various aptamers without loss of shRNA function. HEK293T cells expressing eGFP and mCherry reporter genes were transfected with plasmids encoding shRNAs targeting eGFP and incorporating either an MS2 or TAR aptamer in their internal bulge according to the design of configuration 5. Alternatively, shRNAs contained a QB aptamer in an alternative position of the shRNA molecule (siGFP QB), without an internal bulge. After 72h eGFP silencing was analyzed with flow cytometry. eGFP expression was normalized to cells transfected to express NSsiRNA at similar doses.

[0151] Figure 8: Enrichment of the RNA molecule in EVs engineered with RNA-binding molecules. HeLa cells were transfected with shRNA targeting eGFP fused to an MS2 aptamer in configurations, in combination with plasmids encoding a control (non-RNA-binding) CD9-Halotag or RNA-binding CD9-MCP. RNA was isolated from cells and EVs and expression of shRNA in each EV type relative to its producer cell was quantified by RT-qPCR.

[0152] Figure 9: Silencing of a reporter gene in cells in which the RNA molecule is delivered by means of EVs with (Fig. 9B) and without (Fig. 9A) VSV-G. HeLa cells were transfected to express NSsiRNA or siGFP fused to an MS2 aptamer (configurations) and CD9-MCP. EVs were isolated and quantified by NTA. EVs were added to eGFP-expressing HEK293T reporter cells in high (4.8E10 particles / well), medium (1.2E10 particles / well) or low (0.3E10 particles / well) doses. After 72h, eGFP expression was analyzed by flow cytometry and expressed as a percentage of the same dose of NSsiRNA-containing EVs.

[0153] Figure 10: Silencing of a reporter gene in cells in which the RNA molecule is delivered by means of MMLV VLPs. Gesicle Producer 293T cells were transfected with plasmids encoding VSV-G, Gag-pol, Gag-MCP-pol and shRNA fused to MS2 aptamers (configurations). Equal volumes of VLPs were added to eGFP-expressing HEK293T reporter cells (high: VLPs from ¼ T175 flask of cells; medium: VLPs from 1 / 8 T175 flask of cells; low: VLPs from 1 / 32 T175 flask of cells). After 72h, eGFP expression was analyzed by flow cytometry and expressed as a percentage of the same dose of NSsiRNA-containing EVs.

[0154] Examples

[0155] Materials and methods

[0156] Cell culture

[0157] All cells used in this work were cultured at 37°C and 5% CO2. HEK293T and HeLa cells were obtained from American Type Culture Collection (ATTC). Gesicle Producer 293T cells were obtained from Takara Bio. All cells were cultured in Dulbecco’s Modified Eagle Medium with L- glutamine (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (Gibco). HEK293T-SL5 and HEK293T-dLuc cells were generated by lentiviral transduction of HEK293T cells using FUW- Stoplights or pHAGE2-PGK-FFluc-SV40-Rluc-NeoR_fusion-WPR plasmids, respectively, as described in reference (1). Transduced cells were maintained in aforementioned medium containing 1mg / mL G418.

[0158] Plasmids

[0159] A pU6 plasmid was generated from a pcDNA3.1 by removing the CMV promotor and inserting a U6 promotor and a Te terminator (performed by Tom Roberts, Oxford University), and was a kind gift of dr. Pieter Vader (UMC Utrecht). The pU6 vector was digested with BBsI and annealed oligonucleotides encoding shRNA sequences with incorporated MS2 aptamers and BBsI-compatible overhangs (Table 1) were inserted using T4 DNA ligase according to manufacturer’s instructions. Correct insertions were confirmed by sequencing (Macrogen). To generate pHAGE2-CD9-MCP, a gBlock encoding HA-CD9 flanked by BsrGI and BamHI restriction sites was ordered from IDT. The gBlock and destination vector pHAGE2-EFla-MCP-CD81-IRES-puro (kind gift of dr. Olivier de Jong, described here (2)) were digested with BsrGI and BamHI, ligated using T4 DNA ligase and sequenced as described above. Plasmids encoding spike glycoprotein of vesicular stomatitis virus (VSV-G), Gag-pol and Gag-MCP-pol were obtained from Addgene (#12259, #35614, #211370). pHAGE2 plasmid encoding CD9 fused to a Halotag were kindly provided by dr. Maria Laura Tognoli, UMC Utrecht. To produce a pHAGE2 vector encoding sol-MCP, a gBlock encoding a Twin-Strep tag fused via a 2x GGGGS linker to the N-terminus of a tandem MCP and flanked by NheI and BamHI restriction sites was ordered from IDT. The gBlock was inserted into the Nhel and BamHI sites of a pHAGE2 vector (kind gift of dr. Olivier de Jong) as described above. The FUW- Stoplights vector was prepared by digesting the FUW backbone (Addgene #52962) with Pmel and Kasl. Subsequently pHAGE2-CMV-MCS-IRES-NeoR-WPRE (3) was digested with Smal and Kasl and insert was ligated into the FUW backbone. Finally, two gBlocks encoding for destabilized eGFP and mCherry were inserted in the multiple cloning site. Both genes are expressed from separate CMV promoters.

[0160] Assessment of shRNA silencing efficacy

[0161] To test functionality of shRNAs, pU6 plasmids encoding shRNAs with inserted aptamers were transfected into appropriate HEK293T-SL5 or HEK293T-dLuc reporter cells (seeded in 96-well plates) using Lipofectamine 2000 (Thermo Fisher Scientific) according to manufacturer’s instructions. HEK293-SL5 cells constitutively express mCherry and a destabilized eGFP, whereas HEK293T-dLuc constitutively express Renilla and Firefly luciferases. Seventy-two hours after transfection, gene silencing was assessed using flow cytometry (HEK293T-SL5) or luciferase assays (HEK293T-dluc). For flow cytometry, cells were harvested and analyzed using a FACSCanto II (BD Biosciences) or Cytoflex S flow cytometer (Beckman Coulter). To assess luciferase activity, a Dual-Glo Luciferase Assay System (Promega) was used according to manufacturer’s instructions. For assessment of shRNA functionality in the presence of aptamer-binding proteins, reporter cells were seeded in 6-well plates and transfected with plasmids encoding CD9-Halotag, sol-MCP or CD9-MCP using Lipofectamine 2000. After 24h, cells were split into 96-well plates and transfected with shRNA-encoding plasmids. After 72h, gene expression was analyzed using flow cytometry or luciferase assays as described above.

[0162] Northern blotting

[0163] To evaluate shRNA processing, plasmids encoding shRNAs were transfected in HEK293T cells seeded in 6-well plates as described above. After 48 hours, cells were washed with PBS and RNA was isolated using TRIzol (Invitrogen) according to manufacturer’s instructions. RNA was quantified using spectroscopy (DeNovix DS- 11), mixed with equal volumes of 2x RNA loading dye (8M urea, 1mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol, 0.1% orange G and 20% glycerol) and loaded onto 15% polyacrylamide / urea gels. A microRNA marker (New England Biolabs) was loaded as a reference. RNA was electrotransferred to Hybond N+ Nylon membranes (Cytiva). Membranes were UV-irradiated at 120 mJ / cm2using a UVC-500 UV-crosslinker (Hoefer) and stained with probes against siLuc, siGFP and / or U6 labelled with either IRDye800CW-DBCG or IRDye680RD-DBCO (Li-cor) as described elsewhere(4). Membranes were imaged using an Odyssey M imager (LI-COR Biosciences).

[0164] EV isolation

[0165] HeLa were seeded in T175 flasks and grown until 80% confluency. Cells were transfected with plasmids encoding shRNA and CD9-MCP in a ratio of 2:1 using linear 25K MW polyethylenimine (PEI, Polysciences) at a dose of 20 pg total plasmid DNA using 50 pg linear PEI per T175 flask. Alternatively, cells were transfected with plasmids encoding shRNA, CD9-MCP and VSV-G in a ratio of 2:1:1. After 24 hours, cells were washed 3 times with phosphate buffered saline (PBS), after which medium was replaced for OptiMEM with GlutaMAX (Gibco) supplemented with 1% penicillin / streptomycin for 16-20 hours. EVs were subsequently isolated using tangential flow filtration (TFF) and Sepharose 4 Fast Flow-based size exclusion chromatography as described elsewhere(5). EV containing fractions were pooled, filtered through 0.45 pm filters and concentrated on 100kD MWCO Amicon Ultra-4 centrifugal filters (Merck Millipore). EVs were quantified using nanoparticle tracking analysis as described below, and equal concentrations were added to HEK293T-SL5 cells, seeded in a 96-well plate at 20,000 cells / well 24h prior to EV addition. After 72h, cells were analyzed using flow cytometry as described above.

[0166] Nanoparticle tracking analysis

[0167] EVs were diluted to appropriate dilutions using PBS and analyzed using a Nanosight NS500 system equipped with an LM14405 nm laser unit (Malvern Instruments). Five 30-second movies were recorded at camera level 15 at a fixed temperature of 25°C and analyzed with NTA 3.4 software at detection threshold 7. Measured particle concentrations were corrected for particle concentrations measured in PBS used for sample dilution.

[0168] Reverse transcription-quantitative polymerase chain reactions (RT-qPCR) RNA was isolated from cells and EVs using TRIzol or TRIzol LS (Invitrogen), respectively, following the protocol of the manufacturer. RNA was dissolved in 25pL and treated with DNAse using TURBO DNA-free kit (Invitrogen) according to manufacturer’s instructions. Reverse transcription was performed using SuperScript IV Reverse Transcriptase (Invitrogen) in a custom 2-step protocol. First, RNA (3.5 pL) was mixed with 0.25 pL of each reverse primer (Rv_Y4 and Rv_siGFP, 2pM each), 0.5 pL of 10 mM dNTPs and 2 pL nuclease-free water (Ambion). Reactions were incubated at 65°C for 5 min, and kept on ice for at least 1 min. Then, 2 pL of 5x RT buffer, 0.5 pL lOOmM DTT, 0.5 pL recombinant RNAsin RNAse inhibitor (Promega) and 0.5 pL SuperScript IV Reverse Transcriptase were added. Reactions were run at 52°C for 45 min, 80°C for 10 min and stored at 4°C. cDNA was diluted 5 times with nuclease-free water and 3 pL was used as input in 10 pL qPCR reactions containing IX iQ SYBR Green Supermix (Bio-Rad), 250nM of forward primers and 250nM of reverse primers against Y4 or siGFP (Table 1). Reactions were run at 95°C for 3 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 30 sec, and a final melt curve analysis on a CFX Opus 96 Real-Time PCR System (BioRad). Y4 was used as a housekeeping gene to normalize gene expression of siGFP.

[0169] VLP isolation Gesicle Producer 293T cells were seeded in T175 flasks and transfected with plasmids encoding for VSV-G (920ng), Gag-pol (6470ng), Gag-MCP-pol (2587ng) and shRNAs with MS2 aptamers (11415ng) using 57.5 pL lipofectamine 2000 (Invitrogen). After 48 hours, conditioned medium was harvested and centrifuged at 500g for 5 min. Supernatant was filtered through 0.45 µm filters and ultracentrifuged at 100.000g at 4°C for 2h in a SW 32 Ti Swinging-bucket rotor (Beckman Coulter). Supernatant was discarded and pellets derived from two T175 flasks were resuspended in 70 pL PBS. VLPs and EVs were stored at 4°C for a maximum of 3 days before addition to cells.

[0170] Results

[0171] shRNA functionality is affected by insertion of a protein-binding aptamer sequence Here, we describe a novel method to generate shRNA-loaded EVs or VLPs with the capacity to release their content into recipient cells, as depicted in Figure 1. To develop this method, we inserted a 19nt MS2 aptamer sequence in plasmid-encoded shRNA sequences targeting eGFP (siGFP) or Firefly luciferase (siLuc). Aptamers were inserted in five different positions of the shRNA sequence, termed ‘configurations’ (Table 1). In configuration 1 and 2, the MS2 aptamer (in italics) was inserted in the middle of the shRNA stemloop. In configuration 2, we truncated the MS2 aptamer to 17nt to possibly reduce steric hindrance of the aptamer on shRNA functionality. In configuration 3 and 4, the aptamer was attached to the 5’ of the sense strand or the 3’ of the antisense strand, respectively. Finally, in configuration 5, the aptamer was inserted in an internal bulge in the shRNA molecule, designed according to (6) and depicted in Figure 2.

[0172] Plasmids encoding these aptamer- modified shRNAs were transfected in HEK293T reporter cells expressing either a combination of eGFP and mCherry (HEK293-SL5) or a combination of Firefly luciferase and Renilla luciferase (HEK293T-dLuc). After 72h, silencing capacity of the aptamer-modified shRNAs was compared with that of their unmodified counterparts. As shown in Figure 3A, in HEK293T-SL5 cells, the position of the inserted aptamer had a pronounced effect on the functionality of an shRNA against eGFP. In this experimental setup, configuration 3 showed a complete loss of shRNA silencing capacity, whereas configuration 5 showed silencing capacity comparable to unmodified shRNA. Configurations 1, 2 and 4 showed a moderate decline in silencing capacity compared to unmodified shRNAs. For shRNAs against Firefly luciferase which were expressed in HEK293T-dLuc cells, similar patterns were observed (Figure 3B). In these two reporter systems, only aptamer-modified shRNAs in configuration 5 showed robust silencing capacity.

[0173] shRNA cellular processing is affected by insertion of a protein-binding aptamer sequence

[0174] To explain why some configurations of the shRNAs showed lower silencing capacity than others, RNA was isolated from shRNA-expressing cells and analyzed by northern blotting (Figure 4). For unmodified shRNAs against eGFP and Firefly luciferase a single band of fully processed (~21nt) siRNA was observed. In contrast, when MS2 aptamers were inserted, shRNA processing was retarded, as observed by the appearance of multiple higher molecular weight bands. These band patterns were highly similar between shRNAs targeting eGFP and Firefly luciferase, indicating that the shRNA scaffold rather than the siRNA sequence itself dictates shRNA processing. Interestingly, the bands corresponding to fully processed siRNA were most intense for configurations 1, 4 and 5, which corresponded with their superior silencing capacity compared to other configurations. In a similar fashion, configuration 3 showed no fully processed siRNA, in line with its lack of silencing capacity. Among the best performing configurations, configurations 4 and 5 showed the lowest number of byproducts.

[0175] shRNA functionality and processing are not affected by binding to RNA-binding proteins

[0176] To investigate whether shRNA binding to aptamer-binding proteins affects shRNA processing and concomitant silencing activity, reporter HEK293T-SL5 and HEK29T-dLuc cells were transfected with plasmids encoding the EV transmembrane protein CD9 fused at its N-terminus to an MS2-coat protein (CD9-MCP), which has high affinity for the MS2 aptamer. As controls, an irrelevant non-RNA-binding protein fused to CD9 (CD9-Halotag) or a cytosolic soluble MCP, which was not fused to CD9 (sol-MCP), were expressed. Subsequently, cells were transfected with plasmids encoding aptamer-modified shRNAs. Analyses of silencing capacity (Figure 5A) showed that again, shRNA against eGFP modified with configuration 3 showed a complete lack of silencing capacity, whereas the other configurations showed silencing capacities similar to unmodified shRNA. Neither of the co-expressed MCPs decreased silencing capacity of these configurations, indicating that MCP binding to the shRNAs did not sterically hinder the RNAi machinery in these cells. Similar results were found for siRNAs against Firefly luciferase (Figure 5B). In these analyses, again configuration 5 showed the most robust gene silencing capacity.

[0177] To confirm that shRNA processing was not hindered by the presence of RNA-binding proteins, HEK293T cells were transfected with plasmids encoding aforementioned proteins and best performing aptamer-modified shRNAs (configurations 4 and 5). Northern blots of these cells confirmed that shRNA processing was not significantly affected by the presence of RNA-binding proteins for both siGFP (Figure 6A) and siLuc (Figure 6B).

[0178] As in all aforementioned assays, shRNAs modified in configuration 5 showed most robust gene silencing and processing, this configuration was selected for EV loading.

[0179] The aptamer moiety can be exchanged without loss of functionality

[0180] To evaluate the modularity of the aptamer sequence in the engineered shRNAs, the MS2 aptamer in the internal bulge of configuration 5 was replaced by a TAR aptamer, which can interact with an HIV-derived TAT peptide as described by Sutaria and coworkers (8). Plasmids encoding aptamer-modified shRNAs targeting eGFP, or unmodified shRNAs as controls, were transfected in HEK293T-SL5. As shown in Figure 7, shRNAs with both aptamers showed similar GFP silencing capacity, suggesting that the aptamer moiety in the internal bulge of the shRNA molecule can be altered without functional consequences. In contrast, when the internal bulge was omitted, and a previously published aptamer integration approach was used to integrate a QB aptamer in the shRNA backbone (9), a moderate loss of eGFP silencing capacity was observed (Figure 7). This suggests that the internal bulge is a critical element for optimal functional aptamer- shRNA processing. Loading of aptamer-modified shRNAs in EVs is enhanced by interaction with aptamer-binding EV fusion proteins

[0181] To test whether the newly developed aptamer-shRNA conjugates could be loaded in EVs, plasmids encoding siGFP modified with aptamers (configuration 5) and CD9-MCP were overexpressed in HeLa cells. As a control, cells were engineered to overexpress a CD9 protein fused to a non-RNA binding protein (Halotag) instead of MCP. EVs were isolated from these cells, and expression levels of shRNA in EVs and cells were quantified by RT-qPCR using primers against the antisense sequence and MS2 aptamers (Figure 8), using Y4 RNA as a housekeeping gene. Through this strategy, only aptamer- modified shRNAs are detected; fully processed siRNAs lacking an MS2 aptamer would not be amenable to primer binding. As expected, the combined expression of CD9-MCP and aptamer-modified shRNA resulted in a pronounced 380-fold enrichment of shRNA in the EVs compared their parent cells. In contrast, when aptamer- modified shRNAs were co-expressed with CD9-Halotag, expression levels in EVs increased only moderately (8-fold) compared to their parent cells. This indicates that shRNA loading in EVs is dramatically improved by incorporation of RNA-binding motifs in the shRNA and the use of EV proteins fused to RNA-binding proteins.

[0182] EVs loaded with shRNAs cause gene silencing upon uptake by recipient cells We investigated whether the generated CD9-MCP modified shRNA-loaded HeLa EVs could silence shRNA target genes in cells exposed to these EVs. EVs containing shRNAs against eGFP were added to HEK293T-SL5 reporter cells in three different particle doses, as determined by NTA. As controls, EVs were loaded with NSsiRNA modified with aptamers in the same configuration (configuration 5) and added to cells at equal doses. As shown in Figure 9A, dose-dependent eGFP silencing was observed in HEK293T-SL5 cells 72h after EV addition. We also expressed the viral fusogen spike glycoprotein of vesicular stomatitis virus (VSV-G) along with shRNA loading constructs in HeLa cells. The resulting EVs have improved fusogenic capacity (2). Indeed, the VSV-G expressing EVs showed improved ability to deliver shRNAs to the reporter cells, reaching 50% of gene silencing at the highest tested dose (Figure 9B). Of note, RT-qPCR analysis of EVs indicated that shRNA content did not significantly differ between EVs with and without VSV-G (not shown).

[0183] These data indicate that our aptamer- modified shRNAs can be processed into functional siRNAs in EV recipient cells.

[0184] VLPs loaded with shRNAs cause gene silencing upon uptake by recipient cells

[0185] To test whether our aptamer- modified shRNAs can also be delivered by alternative biological nanoparticles than EVs, we employed a previously developed VLP platform (7). These VLPs contain three components: Gag-pol polyprotein from the Moloney murine leukemia virus (MMLV), Gag-MCP-pol, which is a modified Gagpolyprotein containing an RNA-binding MOP, and VSV-G. We expressed these three components along with our aptamer-modified shRNAs against eGFP (configuration 5) in Gesicle Producer 293T cells and isolated VLPs. In a similar fashion, we generated VLPs loaded with aptamer-modified NSsiRNA. The eGFP-targeting VLPs showed a dramatic dose-dependent reduction of eGFP expression 72h after addition to HEK293T-SL5 cells, whereas the same doses of NSsiRNA-containing VLPs did not (Figure 10). Likely, this improved shRNA delivery capacity of VLPs compared to EVs results from an improved loading of shRNA in the VLPs due to the high density of Gag-pol proteins in these particles compared with CD9 molecules in EVs.

[0186] Table 1: Sequences of used nucleotide inserts.

[0187]

[0188]

[0189] References

[0190] 1. Evers MJW, van de Wakker SI, de Groot EM, de Jong OG, Gitz-Fran^ois JJJ, Seinen CS, et al. Functional siRNA Delivery by Extracellular Vesicle- Liposome Hybrid Nanoparticles. Adv Healthc Mater. 2022;11(5):e2101202. 2. Elsharkasy OM, Hegeman CV, Lansweers I, Cotugno OL, de Groot IY, de Wit ZEMNJ, et al. A modular strategy for extracellular vesicle-mediated CRISPR-Cas9 delivery through aptamer-based loading and UV-activated cargo release. bioRxiv. 2024:2024.05.24.595612.

[0191] 3. de Jong OG, Murphy DE, Mager I, Willms E, Garcia-Guerra A, Gitz-Francois JJ, et al. A CRISPR-Cas9-based reporter system for single-cell detection of extracellular vesicle-mediated functional transfer of RNA. Nature communications. 2020;11(1):1113.

[0192] 4. Fields C, Sheng P, Miller B, Wei T, Xie M. Northern Blot with IR Fluorescent Probes: Strategies for Probe Preparation. Bio Protoc. 2019;9(8).

[0193] 5. de Voogt WS, Frunt R, Leandro RM, Triesscheijn CS, Monica B, Paspali I, et al. EV-Elute: a universal platform for enrichment of functional surface marker-defined extracellular vesicle subpopulations. bioRxiv.

[0194] 2023:2023.10.25.563755.

[0195] 6. Gu S, Jin L, Zhang Y, Huang Y, Zhang F, Valdmanis PN, Kay MA. The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo. Cell. 2012;151(4):900-ll.

[0196] 7. An M, Raguram A, Du SW, Banskota S, Davis JR, Newby GA, et al. Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo. Nat Biotechnol. 2024;42(10):1526-37.

[0197] 8. Sutaria DS, Jiang J, Elgamal OA, Pomeroy SM, Badawi M, Zhu X, et al. Low active loading of cargo into engineered extracellular vesicles results in inefficient miRNA mimic delivery. J Extracell Vesicles. 2017;6(l):1333882.

[0198] 9. Fang PY, Gomez Ramos LM, Holguin SY, Hsiao C, Bowman JC, Yang HW, et al. Functional RNAs: combined assembly and packaging in VLPs. Nucleic Acids Res. 2017;45(6):3519-27.

Claims

Claims1. An extracellular vesicle (EV), viral particle or virus-like particle (VLP) comprising an RNA molecule attached to the internal surface of the EV membrane, to the viral particle or to the VLP membrane via a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain, wherein the RNA molecule comprises:- at least one stemloop,- an siRNA sequence,- a sequence that is recognized by the RNA-binding domain,- a bulge located between the siRNA sequence and a stemloop,wherein the stemloop is attached to the bulge,wherein the sequence that is recognized by the RNA-binding domain is attached to the bulge, andwherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain.

2. The EV, viral particle or VLP according to claim 1, wherein the RNA molecule comprises a double-stranded spacer located between the siRNA sequence and the bulge.

3. The EV, viral particle or VLP according to claim 1 or 2 wherein the RNA molecule comprises one bulge and one stemloop, whereby:- a double- stranded spacer is located between the siRNA sequence and the bulge,- the bulge is located between the double-stranded spacer and the stemloop, and- the stemloop is attached to the bulge.

4. The EV, viral particle or VLP according to any one of the preceding claims, wherein the EV membrane protein is selected from the group consisting of CD9, CD63, CD81, PDGFR (Platelet- derived growth factor receptor), ALIX (ALG-2 interacting protein X), TSG101 (tumor susceptibility gene 101 protein), MHC1(major histocompatibility complex 1), HSP90 (heat shock protein 90), syndecan-1, syntenin, flotillin-1, ADRB2, Tspan 2, Tspan 3, LAMP2B, palmitoylation signal peptide, myristoylation signal peptide, IGSF8, MARCKSL1, BASP1, MARCKS, PTGRFN, or a part thereof, or wherein the viral particle or VLP protein is selected from the group consisting of structural viral proteins such as the family of Gag proteins, paramyxovirus M protein, Nef7, and VSV-G or endogenous counterparts such as PEG 10 or Arc or a part thereof.

5. The EV, viral particle or VLP according to any one of the preceding claims, wherein the sequence that is recognized by the RNA-binding domain is an aptamer selected from the group consisting of an MSs aptamer, a PP7 aptamer, a Pepper aptamer, a AN aptamer, a His aptamer, an aptamer against the HIV Tat domain, or an RNA motif recognized by RNA-binding proteins, such as PUM-HD.

6. The EV according to any one of the preceding claims, wherein the EV expresses Vesicular Stomatitis Virus G (VSV G) protein or a homolog thereof, such as syncytin-1 and syncytin-2, herpes simplex virus glycoprotein B (HSV gB), rabies viral glycoprotein, influenza virus hemagglutinin (HA), human immunodeficiency virus envelope glycoprotein gp41 (gp41), Caenorhabditis elegans Eff-1 and / or Caenorhabditis elegans Aff-1, on the external surface of the EV membrane.

7. A nucleic acid molecule comprising an oligonucleotide comprising the linear sequence of an RNA molecule comprising at least one stemloop, an siRNA sequence, a sequence that is recognized by an RNA-binding domain, and a bulge located between the siRNA sequence and a stemloop,wherein the stemloop is attached to the bulge,wherein the sequence that is recognized by the RNA-binding domain is attached to the bulge, andwherein the sequence that is recognized by the RNA-binding domain is bound by the RNA-binding domain.

8. The nucleic acid molecule according to claim 7, further comprising an oligonucleotide encoding a fusion protein comprising an EV membrane, viral particle or VLP protein or part thereof and an RNA-binding domain.

9. The nucleic acid molecule according to claim 7 or 8, wherein the RNA molecule comprises a double-stranded spacer located between the siRNA sequence and the bulge.

10. The nucleic acid molecule according to any one of claims 7-9, wherein the nucleic acid molecule further comprises an RNA promoter and the RNA molecule is operably linked to the RNA promoter.

11. The nucleic acid molecule according to any one of claims 7-10, wherein the RNA molecule comprises one bulge and one stemloop, whereby:- a double- stranded spacer is located between the siRNA sequence and the bulge,- the bulge is located between the double-stranded spacer, and- the stemloop is attached to the bulge.

12. The nucleic acid molecule according to any one of claims 7-11, whereby in the RNA molecule the sequence that is recognized by an RNA-binding domain is attached to a bulge, and whereby a spacer is optionally located between the bulge and the sequence that is recognized by an RNA-binding domain, preferably comprising from 5’ to 3’:1) sense strand sequence of the siRNA;2) one strand sequence of a double-stranded spacer;3) a sequence that is recognized by an RNA-binding domain;4) one strand of a double-stranded sequence of a stemloop;5) a loop sequence of the stemloop;6) a complementary strand of the double-stranded sequence of the stemloop; 7) complementary strand sequence of the double-stranded spacer; and8) antisense strand sequence of the siRNA,optionally further comprising a spacer sequence that is part of a bulge located between the double-stranded spacer and a stemloop, wherein the spacer sequence is located between the sequences of 2) and 3), the sequences of 3) and 4), and / or the sequences of 6) and 7).

13. The EV, viral particle or VLP or nucleic acid molecule according to any one of the preceding claims, wherein the RNA-binding domain is an aptamerbinding domain and the sequence that is recognized by the RNA-binding domain is an aptamer.

14. A pharmaceutical composition comprising the EV, viral particle or VLP or nucleic acid molecule according to any one of claims 1-13 and a pharmaceutically acceptable carrier.

15. A method for producing extracellular vesicles (EVs) according to any one of claims 1-6 and 13 comprising:- introducing a nucleic acid molecule according to any one of claims 7-11 into a mammalian host cell or organism;- optionally introducing a nucleic acid molecule comprising an oligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain; and- allowing the host cell to produce EVs; and optionally- isolating the produced EVs,optionally, wherein a nucleic acid molecule comprising an oligonucleotide encoding Vesicular Stomatitis Virus G (VSV G) protein or a homolog thereof, such as syncytin-1 and syncytin-2, herpes simplex virus glycoprotein B (HSV gB), rabies viral glycoprotein, influenza virus hemagglutinin (HA), human immunodeficiency virus envelope glycoprotein gp41 (gp41), Caenorhabditis elegans Eff-1 and / or Caenorhabditis elegans Aff-1 is further introduced into the host cell.

16. A mammalian host cell provided with a nucleic acid molecule according to any one of claims 7-11 and optionally a nucleic acid molecule comprising anoligonucleotide encoding a fusion protein comprising an EV membrane or part thereof and an RNA-binding domain.

17. The method or host cell according to claim 15 or 16, wherein the host cell is characterized by reduced activity or expression of one or more endoribonucleases, preferably by a knock down or knock out of the one or more endoribonucleases, and / or wherein the method is performed in the presence of an inhibitor of one or more endoribonucleases, preferably wherein the one or more small RNA processing enzymes comprises DICER.

18. EV, viral particle, VLP, nucleic acid molecule, or pharmaceutical composition according to any one of claims 1-14 for use as a medicament, or for use in treatment, prevention or diagnosis of disease.

19. The EV, viral particle VLP, nucleic acid molecule, or pharmaceutical composition for use according to claim 15, wherein the treatment comprises administering a nucleic acid molecule according to any one of claims 7-11 to an individual.

20. A method of treatment or prevention of a disease in an individual in need thereof, comprising administering the EV, viral particle VLP, nucleic acid molecule or pharmaceutical composition according to any one of claims 1-14 to the individual.

21. The method according to claim 20, comprises administering a nucleic acid molecule according to any one of claims 7-11 to the subject.

Citation Information

Patent Citations

  • Exosomes comprising RNA therapeutics

    WO2019092145A1

  • Targeted and modular exosome loading system

    US20150093433A1

  • Exosome delivery system

    WO2015002956A1

  • Delivery of therapeutic RNAS via arrdc1-mediated microvesicles

    WO2018067546A1

  • Compositions and methods for delivering cargo to a target cell

    WO2021055855A1