Composition for preventing, alleviating, or treating radiation-resistant breast cancer and enhancing radiation sensitivity, comprising β-sitosterol as active ingredient
A β-sitosterol composition induces ferroptosis in radiation-resistant breast cancer cells, addressing treatment ineffectiveness by enhancing radiation sensitivity and improving therapeutic outcomes.
Patent Information
- Application Number
- PCT/KR2025/017186
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-06
- Filing Date
- 2025-10-27
- Publication Date
- 2026-05-15
AI Technical Summary
Current treatments for radiation-resistant breast cancer, particularly triple-negative breast cancer, are ineffective due to high radiation resistance, leading to poor prognosis and high recurrence rates, with no existing compositions utilizing β-sitosterol for prevention, improvement, or enhancement of radiation sensitivity.
A composition comprising β-sitosterol is developed to induce ferroptosis in radiation-resistant breast cancer cells, enhancing their radiation sensitivity when combined with radiation therapy.
β-sitosterol induces ferroptosis, increasing apoptosis and significantly enhancing the radiation sensitivity of radiation-resistant breast cancer cells, thereby improving treatment outcomes.
Smart Images

Figure KR2025017186_15052026_PF_FP_ABST
Abstract
Description
Composition for the prevention, improvement, or treatment of radiation-resistant breast cancer and for enhancing radiation sensitivity, comprising β-sitosterol as an active ingredient
[0001] The present invention relates to a composition for the prevention, improvement, or treatment of radiation-resistant breast cancer and for enhancing radiation sensitivity, comprising β-sitosterol as an active ingredient.
[0002]
[0003] This invention is a research project supported by the Regional Innovation System and Education (RISE) project conducted through the Jeju RISE Center with the support of the Ministry of Education and Jeju Special Self-Governing Province (2025-RISE-17-001). This achievement is a research project conducted with the support of the National Research Foundation of Korea, funded by the government (Ministry of Science and ICT) (RS-2025-21212975).
[0004] Breast cancer is the most commonly diagnosed cancer in women, and its heterogeneity and various subtypes reduce the effectiveness of breast cancer treatment. Identifying breast cancer subtypes in patients is one of the fundamental steps in selecting an appropriate treatment strategy. In addition to histopathological characteristics, breast cancer is classified according to the presence of estrogen receptors, progesterone receptors, and human epidermal growth factor receptor 2 (HER2).
[0005] Among the types of breast cancer, triple-negative breast cancer (TNBC) accounts for approximately 15% of all cases and frequently occurs in young patients. It is reported that about 15.9% of all breast cancer patients in Korea have triple-negative breast cancer. Furthermore, compared to other types of breast cancer, triple-negative breast cancer exhibits aggressive characteristics, such as a higher histological grade and an invasive ductal carcinoma. Because it lacks estrogen and progesterone receptors as well as human epidermal growth factor receptor 2 (HER2), conventional targeted therapies are ineffective, making radiation therapy the primary treatment strategy for patients with triple-negative breast cancer. Moreover, triple-negative breast cancer has higher radiation resistance than other types, resulting in a poor prognosis, high recurrence rates, and low patient survival rates. Therefore, overcoming radiation resistance is urgently needed for the effective treatment of triple-negative breast cancer.
[0006] Regarding prior art related to radiation-resistant cancer, Korean Registered Patent No. 2678420 discloses a composition for the prevention, improvement, or treatment of radiation-resistant cancer containing durumamide A, and Korean Registered Patent No. 2704414 discloses a composition for improving the radiation therapy sensitivity of cancer containing butyric acid as an active ingredient. However, there has not yet been any disclosure regarding the 'composition for the prevention, improvement, or treatment of radiation-resistant breast cancer and for enhancing radiation sensitivity containing β-sitosterol as an active ingredient' of the present invention.
[0007] The present invention was derived from the above-mentioned needs, and the present invention provides a composition for the prevention, improvement, or treatment of radiation-resistant breast cancer and for enhancing radiation sensitivity, comprising β-sitosterol as an active ingredient. More specifically, the present invention was completed by confirming that when the β-sitosterol of the present invention is treated to radiation-resistant breast cancer cells, ferroptosis is induced to increase the level of apoptosis, and when the β-sitosterol is treated in combination with radiation, the radiation sensitivity of the radiation-resistant breast cancer cells is significantly enhanced.
[0008] To solve the above problem, the present invention provides a health functional food composition for the prevention or improvement of radiation-resistant breast cancer comprising β-sitosterol represented by Chemical Formula 1 or a food-grade acceptable salt thereof as an active ingredient.
[0009] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of radiation-resistant breast cancer comprising β-sitosterol represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
[0010] In addition, the present invention provides a composition for enhancing radiation sensitivity of radiation-resistant breast cancer comprising β-sitosterol represented by Chemical Formula 1 as an active ingredient.
[0011] In addition, the present invention provides a method for preventing or treating radiation-resistant breast cancer comprising the step of administering β-sitosterol represented by Formula 1 or a pharmaceutically acceptable salt thereof to an individual other than a human.
[0012] The present invention relates to a composition for the prevention, improvement, or treatment of radiation-resistant breast cancer and for enhancing radiation sensitivity, comprising β-sitosterol as an active ingredient. More specifically, when the β-sitosterol of the present invention is treated to radiation-resistant breast cancer cells, ferroptosis is induced to increase the level of apoptosis, and when the β-sitosterol is treated in combination with radiation, the radiation sensitivity of the radiation-resistant breast cancer cells is significantly enhanced.
[0013] Figure 1 shows the results of confirming the radiation resistance and ferroptosis resistance of MDA-MB-231 / RR cells, a radiation-resistant breast cancer cell line. MDA-MB-231 is the progenitor cell of MDA-MB-231 / RR cells. (A) shows the level of colony formation after radiation irradiation, (B) shows the levels of intracellular ROS and lipid ROS, (C) shows the levels of intracellular GSH, (D) shows the cell viability following treatment with Erastin, a ferroptosis inducer, (E) shows the level of lipid peroxidation, (F) shows the mRNA expression levels of SLC7A11 and GPX4, and (G) shows the expression levels of SLC7A11 and GPX4 proteins. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, **** indicates p<0.0001 compared to the control group, and #### indicates p<0.0001 compared to the group treated with 4μM elastin in MDA-MB-231 cells.
[0014] Figure 2 shows the results of confirming cell viability when the β-sitosterol of the present invention was treated to breast cancer cells (MDA-MB-231), radiation-resistant breast cancer cells (MDA-MB-231 / RR), and normal breast cells (MCF-10A), respectively. *, # indicates p<0.05 compared to the control group, **, ## indicates p<0.01 compared to the control group, ***, ### indicates p<0.001 compared to the control group, and ****, #### indicates p<0.0001 compared to the control group.
[0015] Figure 3 shows the results of confirming the ferroptosis-inducing effect of β-sitosterol treatment on MDA-MB-231 / RR cells according to the present invention. (A) and (B) represent the cell viability and colony formation levels, respectively, when β-sitosterol is treated to cells together with the ferroptosis inhibitors N-acetylcysteine (NAC) and ferrostatin-1 (Fer-1); (C), (D), and (E) represent the levels of intracellular ROS, lipid ROS, and GSH, respectively; (F) represents the expression levels of SLC7A11 and GPX4 proteins; and (G) represents the lipid peroxidation level. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group. In (A), ### indicates p<0.001 compared to the group treated with β-sitosterol and NAC combination, and in (D), #### indicates p<0.0001 compared to the group treated with β-sitosterol alone.
[0016] Figure 4 shows the results of confirming the effect of combined treatment of β-sitosterol and radiation of the present invention on enhancing the radiosensitivity of MDA-MB-231 / RR cells. (A) indicates the level of colony formation, (B) indicates the expression level of γ-H2AX protein, a DNA damage marker, (C) indicates the level of γ-H2AX through immunofluorescence staining, (D), (E), and (F) indicate the levels of intracellular ROS, lipid ROS, and GSH, respectively, (G) indicates the expression levels of SLC7A11 and GPX4 proteins, and (H) indicates the level of lipid peroxidation. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group.
[0017] Figure 5 shows the results of confirming the activation of the ROR1 / YAP / TAZ signaling pathway in MDA-MB-231 / RR cells with ferroptosis resistance and radiation resistance. (A) shows the expression levels of WNT5a, ROR1, YAP, and TAZ proteins in MDA-MB-231 and MDA-MB-231 / RR cells; (B) shows the expression levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins in MDA-MB-231 cells cultured in conditioning medium derived from MDA-MB-231 cells (MDA-CM) or conditioning medium derived from MDA-MB-231 / RR cells (MDA / RR-CM); (C) shows the level of colony formation in MDA-MB-231 cells cultured in MDA-CM or MDA / RR-CM after radiation exposure; (D) shows the expression level of γ-H2AX protein in MDA-MB-231 cells cultured in MDA-CM or MDA / RR-CM after radiation exposure; and (E) shows the level of colony formation in MDA-MB-231 cells cultured in MDA-CM or MDA / RR-CM after radiation exposure γ-H2AX levels in MDA-MB-231 cells are shown by immunofluorescence staining, (F), (G), (H) and (I) show the levels of intracellular ROS, lipid ROS, GSH, and lipid peroxidation in MDA-MB-231 cells cultured in MDA-CM or MDA / RR-CM, respectively, and (J) shows the viability of MDA-MB-231 cells cultured in MDA-CM or MDA / RR-CM after elastin treatment. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group; in (J), # indicates p<0.05 compared to the group treated with 2μM elastin in MDA-MB-231 cells, and in (J), ## indicates p<0.05 compared to the group treated with 4μM elastin in MDA-MB-231 cells.01 means, and in (C), #### means p<0.0001 compared to the group of MDA-MB-231 cells cultured in MDA-CM treated with 4 Gy of radiation.
[0018] Figure 6 shows the results of confirming the effects of ROR1 inhibition on radiosensitivity and ferroptosis in MDA-MB-231 / RR cells. (A) shows the expression levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins after treatment with cirmtuzumab (Cir, cirmtuzumab), (B) to (H) show the levels of colony formation; γ-H2AX protein expression; γ-H2AX fluorescence; intracellular ROS; lipid ROS; GSH; and lipid peroxidation, respectively, when pretreated with cirmtuzumab before irradiation, and (I) shows the cell viability induced by elastin following cirmtuzumab treatment. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group; in (B), (C), and (I), ### indicates p<0.001 compared to the group not treated with sirtuzumab before irradiating 2 Gy or 4 Gy of radiation; or the group treated with 1 μM elastin without sirtuzumab; and in (B) and (I), #### indicates p<0.0001 compared to the group not treated with sirtuzumab before irradiating 4 Gy of radiation; or the group treated with 2 μM or 4 μM elastin without sirtuzumab.
[0019] Figure 7 shows the results of confirming the inhibitory effect on the ROR1 / YAP / TAZ pathway when β-sitosterol of the present invention was treated to MDA-MB-231 / RR cells. (A) shows the expression levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 proteins in MDA-MB-231 / RR cells cultured in DMEM, (B) shows the levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 proteins in MDA-MB-231 cells cultured in MDA / RR-CM, (C) shows the nuclear localization levels of YAP and TAZ through immunofluorescence staining, (D) shows the expression levels of YAP and TAZ proteins in the cytoplasm and nucleus, (E) shows the mRNA expression levels of CYR61, SLC7A11, and GPX4 in MDA-MB-231 / RR cells cultured in DMEM, and (F) shows the mRNA expression levels of CYR61, SLC7A11, and GPX4 in MDA-MB-231 cells cultured in MDA / RR-CM. * indicates p<0.05 compared to the control group, ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group.
[0020] Figure 8 shows the results of β-sitosterol of the present invention inducing ferroptosis in MDA-MB-231 / RR cells by targeting the ROR1 / YAP / TAZ signaling axis. (A) shows the protein expression levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 in MDA-MB-231 / RR cells transfected with ROR1 siRNA (siROR1) with or without β-sitosterol treatment, (B) shows the mRNA expression levels of CYR61, GPX4, and SLC7A11 in siROR1 transfected cells after β-sitosterol treatment, (C) shows the protein expression levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 in MDA-MB-231 / RR cells treated with sirtuzumab with or without β-sitosterol co-treatment, and (D) shows the mRNA expression levels of CYR61, GPX4, and SLC7A11 after co-treatment with sirtuzumab and β-sitosterol. (E) and (F) represent lipid ROS levels and intracellular glutathione (GSH) levels in MDA-MB-231 / RR cells under β-sitosterol treatment and ROR1 inhibition conditions, respectively, and (G) represents the levels of non-oxidative (red) and oxidative (green) lipid peroxidation in β-sitosterol-treated siControl cells and siROR1-transfected cells. Nuclei were stained with DAPI (blue), and the scale bar is 50 μm. *** indicates p<0.001 relative to the control group, and **** indicates p<0.0001 relative to the control group.
[0021] Figure 9 shows the results confirming the tumor proliferation inhibitory effect when the β-sitosterol of the present invention was treated in a xenograft mouse model. (A) is an experimental schematic diagram, (B), (C), and (D) show changes in tumor volume, mouse body weight, and tumor weight, respectively, (E) shows the expression levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins, (F) shows pathological damage through H&E staining, and (G) shows the levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins through IHC staining. ** indicates p<0.01 compared to the control group, *** indicates p<0.001 compared to the control group, and **** indicates p<0.0001 compared to the control group.
[0022] To achieve the objective of the present invention, the present invention provides a health functional food composition for the prevention or improvement of radiation-resistant breast cancer comprising β-sitosterol represented by the following chemical formula 1 or a food-grade acceptable salt thereof as an active ingredient.
[0023]
[0024] The above radiation-resistant breast cancer may be radiation-resistant triple-negative breast cancer, but is not limited thereto.
[0025] The above triple-negative breast cancer (TNBC) refers to breast cancer that does not have estrogen receptors, progesterone receptors, and epidermal growth factor (HER2) receptors.
[0026] The β-sitosterol of the present invention can induce ferroptosis in radiation-resistant breast cancer, but is not limited thereto.
[0027] The above composition is preferably prepared in any one formulation selected from powder, granules, pills, tablets, capsules, candy, syrup, and beverage, but is not limited thereto.
[0028] When the health functional food composition of the present invention is used as a food additive, the active ingredient may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient can be appropriately determined according to its purpose of use (prevention or improvement). Generally, when manufacturing food or beverages, the composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, relative to the raw material. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.
[0029] There are no specific restrictions on the types of the above-mentioned foods. Examples of foods to which the above-mentioned active ingredients may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health functional foods in the conventional sense.
[0030] When the composition of the present invention is used as a health beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as taumarin and stevia extract, or synthetic sweeteners such as saccharin or aspartame may be used. The proportion of the above natural carbohydrates is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention. The composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, the composition of the present invention is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight.
[0031] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of radiation-resistant breast cancer comprising β-sitosterol represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
[0032] The above radiation-resistant breast cancer may be radiation-resistant triple-negative breast cancer, but is not limited thereto.
[0033] The composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents in addition to the active ingredient, and may be in various oral or parenteral formulations. When formulating, it is prepared using commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, and other diluents or excipients. Solid formulations for oral administration include capsules, powders, granules, tablets, pills, etc., and these solid formulations are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with one or more compounds. In addition, lubricants such as magnesium stearate and talc are also used in addition to simple excipients. Liquid formulations for oral administration include suspensions, emulsions, syrups, and aerosols; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized agents, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspension solvents. Witepsol, Macrogol, Tween 61, cocoa dough, laurin dough, and glycerogelatin may be used as bases for suppositories. For parenteral administration, it is preferable to select a method of injection via the skin (topical), intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dura mater, or cerebrovascular system.
[0034] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the level of the effective amount may be determined according to factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above-mentioned factors into account, and this can be easily determined by a person skilled in the art.
[0035] The dosage of the composition of the present invention varies depending on the patient's body weight, age, gender, health status, diet, time of administration, method of administration, excretion rate, and severity of the disease. The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modulators.
[0036] In addition, the present invention provides a composition for enhancing radiation sensitivity of radiation-resistant breast cancer comprising β-sitosterol represented by Chemical Formula 1 as an active ingredient.
[0037] In the present invention, the term "radiation sensitivity" refers to the sensitivity of response to the use of radiation, and refers to a characteristic that can maximize the effect acting on an individual when radiation is irradiated. Increasing radiation sensitivity allows the radiation effect to function smoothly, thereby increasing the therapeutic effect of radiation.
[0038] The above radiation-resistant breast cancer may be radiation-resistant triple-negative breast cancer, but is not limited thereto.
[0039] The above β-sitosterol may be administered in combination with radiation, but is not limited thereto.
[0040] When the β-sitosterol of the present invention is treated with radiation, the effect of apoptosis in radiation-resistant breast cancer cells is enhanced compared to when radiation is treated alone.
[0041] In addition, the present invention provides a method for the prevention or treatment of radiation-resistant breast cancer comprising the step of administering β-sitosterol represented by Formula 1 or a pharmaceutically acceptable salt thereof to an individual other than a human.
[0042] The above radiation-resistant breast cancer may be radiation-resistant triple-negative breast cancer, but is not limited thereto.
[0043]
[0044] The present invention will be described in detail below by way of embodiments. However, the following embodiments are merely illustrative of the present invention, and the scope of the present invention is not limited to the following embodiments.
[0045]
[0046] Materials and Methods
[0047] 1. Compounds and Reagents
[0048] β-sitosterol, cirtuzumab (Cir), ferrostatin-1 (Fer-1), and elastin were purchased from MedChemExpress (Monmouth Junction, NJ, USA), and MTT (3-(4,5-dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium bromide) was purchased from Amresco Inc. (Solon, OH, USA). FBS (fetal bovine serum) and NAC (N-acetylcysteine) were purchased from Merck & Co, Inc. (Darmstadt, Land Hessen, Germany).
[0049]
[0050] 2. Cell Culture
[0051] Triple-negative breast cancer cell line MDA-MB-231 cells were purchased from ATCC (Rockville, MD, USA), and radiation-resistant MDA-MB-231 / RR cells of this cell line were obtained according to the method described in a previous study (Koh et al., 2019., Nutrients, 11(3), 624). MDA-MB-231 and MDA-MB-231 / RR cells were cultured in DMEM (Gibco, Grand Island, NY, USA) mixed with 10% FBS and streptomycin / penicillin at a concentration of 100 U / mL, respectively. Normal breast cell line MCF-10A cells were cultured according to ATCC's recommended guidelines and were cultured in MEBM (Lonza, Basel, Switzerland) supplemented with 10% FBS. Each cell culture was maintained at 37°C in a 5% CO2 incubator, and when the cells reached 80% density, they were subcultured with trypsin treatment.
[0052]
[0053] 3. Preparation of Conditioned Medium (CM)
[0054] After culturing MDA-MB-231 and MDA-MB-231 / RR cells for 48 hours, the medium was collected and filtered through a 30 kDa blocking filter (Amicon Ultra-15 Millipore, Billerica, MA, USA), and the medium was stored at -80°C for subsequent experiments.
[0055]
[0056] 4. Cell viability analysis
[0057] 5.0 × 10⁶ MDA-MB-231, MDA-MB-231 / RR, and MCF-10A cells in a 96-well plate 3 After plating at cell / well densities and culturing for one day, cells were exposed to 0, 15, 30, or 60 μM β-sitosterol for 24 hours, and cell viability was determined using MTT (0.5 mg / mL). Absorbance was measured at 570 nm using a microplate reader.
[0058]
[0059] 5. Cell Transfection
[0060] ROR1 expression inhibition was performed using RNA interference. MDA-MB-231 / RR cells were transfected with ROR1-targeted siRNA using AccuFect™ Transfection Reagent (Bioneer, Daejeon, Korea) according to the manufacturer's instructions.
[0061]
[0062] 6. Colony Formation Analysis
[0063] 1×10⁶ MDA-MB-231 and MDA-MB-231 / RR cells 3Cells were dispensed into 6-well plates at a cell / well concentration and treated with varying doses of β-sitosterol or irradiated with 0, 2, or 4 Gy for 10 days. The formed colonies were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. The stained colonies were expressed as a percentage compared to an untreated control group for each concentration of the treated substance.
[0064]
[0065] 7. Glutathione (GSH) Analysis
[0066] GSH levels were measured using a colorimetric GSH assay kit (Cayman Chemical, 703002) according to the manufacturer's instructions. After washing the cells with PBS, they were suspended in cold 5% MPA. The suspension was centrifuged, and the supernatant was used. In a 96-well plate, the calibration curve for GSSG, the oxidized form of glutathione, and the sample were mixed with MES buffer and DTNB solution, and the change in value was measured by the kinetic method at 405-414 nm for 30 minutes.
[0067]
[0068] 8. Detection of intracellular ROS and lipid ROS
[0069] Intracellular ROS levels were measured using 10 μM H2DCFDA (Thermo Fisher), and lipid ROS levels were measured using 5 μM C11-BODIPY581 / 591 (Thermo Fisher). After cell culture, ROS and lipid ROS levels were quantified using a FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA).
[0070]
[0071] 9. Lipid Peroxidation Analysis
[0072] Lipid peroxidation was stained by directly adding 5 μM of C11-BODIPY581 / 591 to the cell culture medium and staining at 37°C for 30 minutes. Fluorescence intensity was observed using a confocal microscope (Leica Microsystems, Wetzlar, Germany).
[0073]
[0074] 10. Immunofluorescence Analysis
[0075] After treatment with β-sitosterol, cells were washed three times with PBS, fixed with 4% paraformaldehyde solution, and blocked with a 0.1% Triton X-100 / PBS [1% BSA] mixture. Cells were incubated overnight at 4°C with a 1:500 diluted primary antibody (provided by Cell Signaling Technology), and the next day, after additional PBS washing, cells were treated with Alexa Fluor 488 stain (Thermo Fisher) for 1 hour at 4°C under dark conditions, and nuclei were stained with Hoechst 33342 (Thermo Fisher) and observed using a confocal microscope (Leica Microsystems, Wetzlar, Germany).
[0076]
[0077] 11. qRT-PCR (quantitative reverse transcription PCR)
[0078] After β-sitosterol treatment, RNA was extracted from cells using TRIzol® Rea-agent. Following RNA quantification, complementary DNA (c-DNA) was synthesized, and real-time PCR was performed using a 20 µl reaction mixture consisting of 1 µl of c-DNA, 2 µl of designated primers (1 µl for each primer in Table 1), 10 µl of master mix (Takara, Shiga, Japan), and 7 µl of RNA-free water. Gene expression was 2 -△△CqIt was quantified using the method (Livak, KJ Schmittgen, TD Methods (2001) 25:402-408).
[0079] Primer Information Used in the Present Invention Gene Sequence Information (5'→3') Sequence Number CYR61FATTCTTGAGTAGCATTAGG1RGTACTATGAAGCGAAGTC2SLC7A11FTGGGTGGAACTGCTCGTAAT3RAGGATGTAGCGTCCAAATGC4GPX4FCCACCGTGTATGCCTTCTCC5RGATCGTGGTGCCTCAGAGAG6
[0080]
[0081] 12. Western Blot Analysis
[0082] After exposing cells to β-sitosterol for 24 hours, the cells were lysed using RIPA (Radioimunopination assay) buffer, and protein samples were collected. To quantify the target proteins, proteins from each sample were isolated using 7.5–15% SDS-PAGE (Sodium dodecylsulfate-polyacrylamide gel). The isolated proteins were transferred to a PVDF membrane. Subsequently, the membrane was reacted with 5% skim milk powder for 16 hours to remove the background. The membrane was then incubated with the primary antibody at 4°C for 16 hours, washed three times with T-TBS, and conjugated with the secondary antibody. The protein bands were then detected using the ECL Plus kit on a ChemiDoc system (Bio-Rad Inc., Hercules, CA, USA). The antibody information used in the Western blot is as follows: WNT5a (sc-365370, Santa Cruz), ROR1 (#16540), YAP 190 (#14074), TAZ (#83669), CYR61 (#14479), γ-H2AX (#2577), β-actin (#4967), α-tubulin191 (#2144), SLC7A11 (#98051), and histone H3 (#9715) [#: Cell Signaling 192 Technology] and GPX4 (ab125066, AbCam).
[0083]
[0084] 13. Cell Fractionation Test
[0085] After exposing cells to β-sitosterol for 24 hours, the cell pellet was gently resuspended in buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.5% NP-40). The cell lysate was centrifuged at 1000 × g for 10 minutes to separate the pellet (nuclear fraction) and the supernatant (cytoplasmic fraction), and the fractions were analyzed using Western blot.
[0086]
[0087] 14. Tumor xenograft experiment
[0088] Female germ-free BALB / c nude mice (5 weeks old, 20 g) were used in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC, Jeju, Korea) of Jeju National University, and all procedures involving these mice were approved by the IACUC (Approval No. 2023-0011). MDA-MB-231 / RR cells (1×10⁶ 6 Cells were suspended in 50 µl of PBS and injected into the fat pads of each mouse. The size of the tumors was measured every 3 days using calipers. After 7 weeks, the mouse models were sacrificed, and the tumors were collected, weighed, and measured. They were then frozen and stored at -80°C for subsequent experiments.
[0089]
[0090] 15. Hematoxylin and Eosin (H&E) and Immunohistochemical (IHC) Staining
[0091] MDA-MB-231 / RR tumor tissues were excised from mice and immediately fixed in 4% buffered formalin. The tissues were embedded in paraffin and prepared into 3.5 μm thick sections for H&E (Hematoxylin and eosin) staining. For IHC (immunohistochemistry) staining, wax was removed from paraffin-embedded tissue sections using a decreasing xylene-alcohol series, the treated sections were blocked with 1% BSA, and then incubated with antibodies against ROR1, YAP, TAZ, SLC7A11, and GPX4 [1:100]. Staining signals were analyzed using the DAB detection kit according to the Streptavidin-Peroxidase System (Dako, Carpinteria, CA, USA) protocol, and counterstaining was performed using hematoxylin. Slides were analyzed using a LEICA DM 2500 microscope (Leica Microsystems, Wetzlar, Germany).
[0092]
[0093] 16. Database Analysis
[0094] The relationship between ROR1 expression and breast cancer patient survival was investigated using the Kaplan-Meier Plotter on the TIMER2.0 platform (http: / timer.cistrome.org / ). The LinkedOmics platform (http: / www.linkedomics.org / admin.php) is an online tool designed for the comprehensive analysis of cancer-related multi-omics data obtained from 32 TCGA datasets (Vasaikar et al., 2018., Nucleic acids research, 46(D1), D956-D963), and statistical analysis was performed using Pearson correlation to identify genes co-expressed with ROR1. Additionally, gene set analysis within the LinkedOmics functional module was used for KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis.
[0095]
[0096] 17. Statistical Analysis
[0097] Statistical analysis was performed using GraphPad Prism 9. The means and standard deviations of the three independent experiments were used to present the results. Differences between groups were evaluated by performing one-way ANOVA followed by Tukey post-hoc analysis or multiple t-tests with Holm-Sidak correction, and p < 0.05 was considered statistically significant.
[0098]
[0099] Example 1. Analysis of Radiation Resistance in MDA-MB-231 / RR Cells
[0100] The radioresistance of radiation-resistant breast cancer cells was confirmed. As described in the reference, MDA-MB-231 / RR cells, which are radiation-resistant breast cancer cells established by exposure to 2 Gy of ionizing radiation (IR) for 25 cycles, formed more colonies after irradiation compared to the parent cells, MDA-MB-231 cells (Fig. 1A), and the irradiation IC 50 The values were 3.024±1.48 Gy for MDA-MB-231 cells and 7.098±1.85 Gy for MDA-MB-231 / RR cells, showing a difference of more than twofold; compared to the control group, MDA-MB-231 cells, the levels of ROS and lipid ROS in MDA-MB-231 / RR cells were significantly reduced, while the levels of GSH increased statistically significantly (Figs. 1B and 1C).
[0101] In addition, when MDA-MB-231 / RR cells were treated with the ferroptosis inducer Erastin to determine ferroptosis resistance, MDA-MB-231 / RR cells responded less sensitively to Erastin-induced ferroptosis than MDA-MB-231 cells (Fig. 1D), and lipid peroxidation levels were lower when observing the fluorescence intensity of oxidized cells (green fluorescence) (Fig. 1E). Furthermore, compared to MDA-MB-231 cells, the expression levels of SLC7A11 mRNA and GPX4 proteins were increased in MDA-MB-231 / RR cells (Figs. 1F and 1G).
[0102] Through these results, it was found that MDA-MB-231 / RR cells exhibit resistance not only to radiation but also to ferroptosis, and that the expression of the associated SLC7A11 and GPX4 mRNA and proteins is upregulated.
[0103]
[0104] Example 2. Analysis of Ferroptosis Induction in MDA-MB-231 / RR Cells by β-Sitosterol Treatment
[0105] The ferroptosis-inducing effect of β-sitosterol treatment on MDA-MB-231 / RR cells according to the present invention was confirmed. As a result, β-sitosterol treatment reduced the viability of both MDA-MB-231 and MDA-MB-231 / RR cells in a concentration-dependent manner, whereas it did not significantly affect normal breast cells, MCF-10A cells (Fig. 2). IC50 of β-sitosterol in MDA-MB-231, MDA-MB-231 / RR, and MCF-10A cells 50 The values were 89.13μM, 52.99μM, and 2,733μM, respectively.
[0106] In addition, to determine whether the cytotoxicity induced by β-sitosterol was caused by the induction of ferroptosis, cells were treated with β-sitosterol in combination with the ferroptosis inhibitors N-acetylcysteine (NAC) or ferrostatin-1 (Fer-1). As a result, the cytotoxicity of β-sitosterol in MDA-MB-231 / RR cells was reduced by treatment with NAC or Fer-1 (Fig. 3A). Similarly, it was found that the apoptosis induced by β-sitosterol treatment was attributed to ferroptosis, as colony formation increased again upon treatment with NAC and Fer-1 (Fig. 3B).
[0107] In addition, intracellular ROS and lipid ROS levels were significantly increased compared to the control group (Con) upon treatment with β-sitosterol, whereas the increased lipid ROS levels were reduced when treated with NAC and Fer-1 (Figs. 3C and 3D). Furthermore, intracellular GSH levels decreased in a concentration-dependent manner upon treatment with β-sitosterol (Fig. 3E), which was found to be correlated with reduced expression levels of SLC7A11 and GPX4 proteins and increased lipid peroxidation, as disclosed in Figs. 3F and 3G.
[0108] In conclusion, it was confirmed that the β-sitosterol of the present invention promotes lipid peroxidation and induces ferroptosis in MDA-MB-231 / RR cells.
[0109]
[0110] Example 3. Analysis of Enhancement of Radiosensitivity in MDA-MB-231 / RR Cells by β-Sitosterol Treatment
[0111] When the β-sitosterol of the present invention was treated to MDA-MB-231 / RR cells and irradiated, the effect of enhancing the radiosensitivity of MDA-MB-231 / RR cells was confirmed. As a result, when the β-sitosterol of the present invention and radiation were treated in combination, the degree of colony formation in MDA-MB-231 / RR cells was significantly reduced (Fig. 4A), and the expression level of γ-H2AX protein, a DNA damage marker, was significantly increased compared to the control group (Con) that received no treatment (Fig. 4B).
[0112] In addition, immunofluorescence staining revealed that when β-sitosterol and radiation were combined, the levels of γ-H2AX protein increased compared to radiation treatment alone (Fig. 4C), intracellular ROS and lipid ROS levels also increased (Figs. 4D and 4E), and intracellular GSH levels decreased significantly (Fig. 4F). Furthermore, the expression levels of SLC7A11 and GPX4 proteins were reduced due to the combined treatment of β-sitosterol and radiation, and lipid peroxidation increased when observing the fluorescence intensity of oxidized cells (green fluorescence) (Figs. 4G and 4H).
[0113] Therefore, it was found that the radiation sensitivity of MDA-MB-231 / RR cells is enhanced and ferroptosis is induced by the combined treatment of β-sitosterol and radiation of the present invention.
[0114]
[0115] Example 4. Analysis of the relationship between the ROR1 / YAP / TAZ axis and ferroptosis resistance and radiation resistance of MDA-MB-231 / RR cells
[0116] Analysis of the Kaplan-Meier plotter database revealed that high expression of the ROR1 protein is associated with significantly lower cumulative survival rates in breast cancer patients over time. Therefore, the ROR1 protein can be a promising target for radiation therapy in patients with breast cancer and triple-negative breast cancer (TNBC). Accordingly, in Example 4, to investigate the function of the ROR1 protein on the radiation resistance of MDA-MB-231 / RR cells, the level of the WNT5a protein, which is reported to exhibit autocrine and paracrine signaling activity in the tumor microenvironment and bind to the ROR1 receptor, was measured.
[0117] As a result, the expression levels of WNT5a, ROR1, YAP, and TAZ proteins were significantly higher in the conditioned medium derived from MDA-MB-231 / RR cells (MDA / RR-CM) compared to the conditioned medium derived from MDA-MB-231 cells (MDA-CM) (Fig. 5A). These results indicate that an increase in WNT5a protein expression in MDA / RR-CM triggers a positive feedback loop through the ROR1 signal.
[0118] Furthermore, when MDA-MB-231 cells were cultured in conditioning medium derived from MDA-MB-231 / RR cells (MDA / RR-CM), the expression levels of ROR1, YAP, and TAZ proteins were found to be approximately twofold higher compared to cells cultured in the control group (MDA-CM) derived from MDA-MB-231 cells (Fig. 5B). Moreover, MDA-MB-231 cells cultured in MDA / RR-CM formed more colonies when exposed to radiation, and the expression of γ-H2AX protein was significantly reduced (Figs. 5C and 5D). Consistent with this, the level of γ-H2AX protein in MDA-MB-231 cells cultured in MDA / RR-CM was distinctly reduced (Fig. 5E), while ROS and lipid ROS levels were significantly reduced, and GSH levels were significantly increased (Figs. 5F-5H). In addition, lipid peroxidation levels were reduced compared to cells cultured in MDA-CM, and it was found that they had greater resistance to the ferroptosis inducer elastin (Figs. 5I and 5J).
[0119] These results indicate that ROR1 activation in triple-negative breast cancer (TNBC) cells may be associated with ferroptosis resistance and radiation resistance.
[0120]
[0121] Example 5. Analysis of Improvement in Resistance to Radiation and Ferroptosis through ROR1 Suppression
[0122] In Example 5, we analyzed whether radiation resistance and ferroptosis resistance could be overcome by treating MDA-MB-231 / RR cells with cirmtuzumab (Cir), a humanized anti-ROR1 monoclonal antibody that interferes with ROR1-dependent signaling induced by WNT5a protein.
[0123] As a result, treatment of MDA-MB-231 / RR cells with sirtuzumab significantly inhibited the expression of ROR1-dependent YAP, TAZ, SLC7A11, and GPX4 proteins compared to the control group not treated with sirtuzumab (Fig. 6A), and when MDA-MB-231 / RR cells were pretreated with sirtuzumab prior to irradiation, colony formation decreased and the expression of γ-H2AX protein increased compared to the control group not pretreated with sirtuzumab (Figs. 6B and 6C). Consistent with this, the fluorescence level of γ-H2AX protein significantly increased in MDA-MB-231 / RR cells treated with sirtuzumab (Fig. 6D), ROS and lipid ROS levels also significantly increased due to sirtuzumab treatment (Figs. 6E and 6F), and GSH levels significantly decreased (Fig. 6G). In addition, treatment with sirtuzumab increased lipid peroxidation levels in MDA-MB-231 / RR cells, promoting an elastin-induced apoptosis effect (Fig. 6I).
[0124] These results indicated that the ROR1 / YAP / TAZ pathway is important in controlling ferroptosis tolerance and radiation resistance.
[0125]
[0126] Example 6. Analysis of β-sitosterol's inhibition of the ROR1 / YAP / TAZ pathway in MDA-MB-231 / RR cells
[0127] Recognizing that activation of the ROR1 / YAP / TAZ pathway in MDA-MB345-231 / RR cells contributes significantly to ferroptosis resistance and radiation resistance, Example 6 analyzed whether the β-sitosterol of the present invention inhibits the ROR1 / YAP / TAZ pathway activity.
[0128] As a result, when MDA-MB-231 / RR cells were treated with the β-sitosterol of the present invention, the expression levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 proteins decreased in a concentration-dependent manner compared to the control group not treated with β-sitosterol (Fig. 7A). Consistently, when MDA-MB-231 cells cultured in conditioning medium (MDA / RR-CM) derived from MDA-MB-231 / RR cells were treated with the β-sitosterol of the present invention, the levels of ROR1, YAP, TAZ, CYR61, SLC7A11, and GPX4 proteins were also significantly reduced (Fig. 7B). Furthermore, the nuclear localization of YAP and TAZ in MDA-MB-231 / RR cells was significantly reduced due to β-sitosterol treatment (Figs. 7C and 7D). Furthermore, the β-sitosterol of the present invention significantly downregulated the mRNA expression of YAP / TAZ target genes such as CYR61, SLC7A11, and GPX4 in both MDA-MB-231 / RR cells cultured in DMEM and MDA-MB-231 cells cultured in MDA / RR-CM (Figs. 7E and 7F).
[0129] Therefore, it was found that the β-sitosterol of the present invention can inhibit the ROR1 / YAP / TAZ pathway and downregulate the expression of target genes.
[0130]
[0131] Example 7. Analysis of ROR1 / YAP / TAZ Axis Functional Inhibition and Ferroptosis Induction by β-Sitosterol
[0132] To determine whether the ferroptosis-inducing effect of β-sitosterol in MDA-MB-231 / RR cells is mediated through the ROR1 / YAP / TAZ signaling pathway, functional studies including genetic and pharmacological inhibition of ROR1 were performed.
[0133] As a result, inhibition of ROR1 expression alone induced a decrease in the expression of YAP, TAZ, CYR61, SLC7A11, and GPX4 proteins, and in particular, when β-sitosterol was treated under conditions of ROR1 inhibition, the inhibition of these proteins was further enhanced compared to inhibition of ROR1 expression alone (Fig. 8A). In qRT-PCR analysis as well, the expression of CYR61, GPX4, and SLC7A11 genes was significantly downregulated in the group treated with β-sitosterol in combination compared to the group with ROR1 inhibition alone (Fig. 8B).
[0134] In addition, to further verify the relevance of ROR1, the ROR1 inhibitor sirtuzumab (Cir) was used. As a result, the combined administration of β-sitosterol and Cir significantly reduced the expression of ROR1, YAP, TAZ, and their downstream target proteins and mRNA, which was similar to the effects observed when ROR1 expression was inhibited (Figs. 8C and 8D). Furthermore, when β-sitosterol was applied to ROR1-inhibited cells, lipid ROS significantly increased, and intracellular GSH levels were significantly reduced compared to the two single-treatment groups (Figs. 8E and 8F). Fluorescence imaging analysis also confirmed a distinct increase in lipid peroxidation in the combination treatment groups compared to the control group or single-treatment groups (Fig. 8G).
[0135] Therefore, it was found that the β-sitosterol of the present invention can induce ferroptosis in MDA-MB-231 / RR cells by functionally inhibiting the ROR1 / YAP / TAZ axis, thereby interfering with the downstream antioxidant defense mechanism mediated by SLC7A11 and GPX4.
[0136]
[0137] Example 8. Analysis of in vivo efficacy of β-sitosterol via the ROR1 / YAP / TAZ pathway
[0138] To confirm the effect of the β-sitosterol of the present invention on in vivo ferroptosis, a xenograft mouse model was established using MDA-MB-231 / RR cells in nude BALB / c mice. Mice were administered β-sitosterol intraperitoneally at a dose of 12.5 mg / kg (low dose) or 25 mg / kg (high dose) once a week for 30 days, physiological saline was administered as a control (Con), and the tumor size and body weight of the mice were monitored every 3 days (Fig. 9A).
[0139] As a result, compared to the control group (Con), tumor growth was significantly inhibited in the β-sitosterol administration group of the present invention, and body weight was maintained stably with no significant change (Figs. 9B and 9C).
[0140] In addition, tumor weight was reduced by 50.8% and 72.9% in the low-dose and high-dose administration groups of β-sitosterol of the present invention, respectively (Fig. 9D), and the expression levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins were also suppressed in a concentration-dependent manner due to the administration of β-sitosterol (Fig. 9E).
[0141] H&E staining and IHC analysis results showed that the administration of β-sitosterol of the present invention caused pathological damage in MDA-MB-231 / RR tumors, and at the same time, the levels of ROR1, YAP, TAZ, SLC7A11, and GPX4 proteins were also reduced (Figs. 9F and 9G).
Claims
1. A health functional food composition for the prevention or improvement of radiation-resistant breast cancer comprising β-sitosterol represented by the following chemical formula 1 or a food-grade acceptable salt thereof as an active ingredient. [Chemical Formula 1] 2. A health functional food composition for the prevention or improvement of radiation-resistant breast cancer, characterized in that, in claim 1, the radiation-resistant breast cancer is radiation-resistant triple-negative breast cancer.
3. A health functional food composition for the prevention or improvement of radiation-resistant breast cancer, characterized in that, in claim 1, the β-sitosterol induces ferroptosis in radiation-resistant breast cancer.
4. A health functional food composition for the prevention or improvement of radiation-resistant breast cancer, characterized in that, in claim 1, the composition is prepared in any one formulation selected from powder, granules, pills, tablets, capsules, candies, syrups, and beverages.
5. A pharmaceutical composition for the prevention or treatment of radiation-resistant breast cancer comprising, as an active ingredient, β-sitosterol represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof. [Chemical Formula 1] 6. A pharmaceutical composition for the prevention or treatment of radiation-resistant breast cancer, characterized in that, in claim 5, the radiation-resistant breast cancer is radiation-resistant triple-negative breast cancer.
7. A pharmaceutical composition for the prevention or treatment of radiation-resistant breast cancer, characterized in that, in addition to the active ingredient in claim 5, it further comprises a pharmaceutically acceptable carrier, excipient, or diluent.
8. A composition for enhancing radiation sensitivity of radiation-resistant breast cancer comprising β-sitosterol represented by the following chemical formula 1 as an active ingredient. [Chemical Formula 1] 9. A composition for enhancing the radiosensitivity of radiation-resistant breast cancer, characterized in that, in claim 8, the radiation-resistant breast cancer is radiation-resistant triple-negative breast cancer.
10. A composition for enhancing radiation sensitivity of radiation-resistant breast cancer, characterized in that, in claim 8, the β-sitosterol is administered in combination with radiation irradiation.
11. A method for the prevention or treatment of radiation-resistant breast cancer comprising the step of administering β-sitosterol represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof to an individual other than a human. [Chemical Formula 1]