Methods of preparing and purifying oligonucleotides

Abstract

Disclosed herein are novel methods for the preparation and purification of oligonucleotides, such as those for use in therapy. In particular, the novel methods disclosed herein involve a three-reaction cycle of solid-phase synthesis and eliminate the need for chromatography purification.

Description

[0001] METHODS OF PREPARING AND PURIFYING OLIGONUCLEOTIDES

[0002] FIELD OF THE INVENTION

[0003] The invention relates to methods for the preparation of oligonucleotides, including single-stranded oligonucleotides, such as those used in therapy.

[0004] BACKGROUND TO THE INVENTION

[0005] Oligonucleotides at commercial scale are usually manufactured by solid-phase synthesis and purified by chromatography to remove impurities. However, purification by chromatography has certain limitations. For example, chromatography generates many fractions each with a slightly different composition of product and impurities. To obtain a final product that meets specification, each of these fractions needs to be analysed and a decision made on whether to add the fraction to the product pool or discard it. This creates a significant analytical burden and is very time consuming.

[0006] Additionally, chromatography of oligonucleotides has been identified as one of the biggest challenges for the sustainable manufacture of oligonucleotides due to the large volumes of waste generated by the chromatography process.

[0007] There is, therefore, a need to avoid chromatography purification of oligonucleotides for commercial scale manufacturing of oligonucleotides that are scalable, less labour intensive and more sustainable.

[0008] SUMMARY OF THE INVENTION

[0009] The commercial manufacture of oligonucleotides typically consists of four parts: (1) oligonucleotide synthesis on a solid support; (2) cleavage from the solid support and removal of protecting groups; (3) purification by preparative chromatography; and (4) isolation by lyophilization. Oligonucleotides with phosphoroth ioate (PS) or phosphate (PO) linkages can be synthesized on a solid support, where nucleoside monomers are added stepwise in a four-reaction cycle: deprotection, coupling, sulfurization or oxidation, and capping. And the crude oligonucleotides prepared by the solid phase synthesis would require purification by chromatography before they can be used as therapeutic agents.

[0010] In one aspect, the present invention provides a method of preparing an oligonucleotide, comprising:

[0011] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group; (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0012] (c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5'-OH group;

[0013] (d) sulfurizing or oxidizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester- or phosphate triester-l inked oiigonucleoside which comprises a protected 5'- OH group;

[0014] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0015] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages;

[0016] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0017] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0018] wherein each sulfurizing or oxidation step of step (d) is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0019] In another aspect, the present invention provides a method of preparing an oligonucleotide, comprising:

[0020] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5f-OH group;

[0021] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0022] (c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5'-OH group;

[0023] (d) sulfurizing or oxidizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester- or phosphate triester-linked oligonucleoside which comprises a protected 5'- OH group;

[0024] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0025] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages; (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0026] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0027] wherein each sulfurizing step of step (d) is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0028] The invention also provides an oligonucleotide obtained by such methods of preparation.

[0029] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 illustrates a four-reaction cycle of solid-phase synthesis of oligonucleotides with phosphoroth ioate (PS) linkages, including: detritylation, coupling, sulfurization, and capping.

[0030] FIG. 2 illustrates a three-reaction cycle of solid-phase synthesis of oligonucleotides with phosphoroth ioate (PS) linkages, including: detritylation, coupling, and sulfurization.

[0031] FIG. 3 shows an overlay of the chromatograms of an oligonucleotide product at different stages of an improved method of preparing the oligonucleotide (Method B).

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word ”or” is intended to include "and" unless the context clearly indicates otherwise. The term "plurality" refers to two or more. The term "at least one" refers to one or more,

[0034] Additionally, numerical limitations given with respect to concentrations or levels of a substance, such as solution component concentrations or ratios thereof, and reaction conditions such as temperatures, pressures, and cycle times are intended to be approximate. Unless specified otherwise, where a numerical range is provided, it is inclusive, Ze, the endpoints are included.

[0035] " About” as used herein when referring to a measurable value such as an amount and the like, is meant to encompass variations of ±20% or ±10%, including ±5%, ±1 %, and ±0.1 % from the specified value, as such variations are appropriate to perform the disclosed methods.

[0036] As used herein, the term "nucleoside" means a compound comprising a nucleobase and a sugar. A nucleoside may be one as found in nature (i.e. a "natural nucleoside" or "naturally occurring nucleotide") or may be modified. A modified nucleoside is not a naturally occurring nucleotide (i.e. it is a non~natural nucleoside). The nucleobase and sugar may each, independently, be unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar. Examples of naturally occurring nucleosides include deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, deoxyuridine, adenosine, cytidine, guanosine, thymidine and uridine. Example of modified nucleosides include nucleosides comprising any modified nucleobase and / or modified sugar described elsewhere herein. It is acknowledged that certain modifications occur sporadically in nature, i.e. in naturally occurring nucleotises, such as 2'-OMe or C5 pyrimidine modifications, however, in the present disclosure these are considered modified nucleosides.

[0037] As used herein, the term "nucleoside monomer" means a nucleoside which is not part of an oligonucleotide. As used herein, the term "nucleoside phosphoramidite" means a nucleoside monomer (i.e. a nucleoside which is not part of an oligonucleotide) which comprises a phosphoramidite group at the 3' position of the nucleoside, A "nucleoside phosphoramidite" is an example of a modified nucleoside, as it comprises a modified sugar. Examples of phosphoramidite groups include diisopropylcyanoethoxy phosphoramidite. A nucleoside phosphoramidite may also be referred to as a modified nucleotide, wherein the phosphate group of the nucleotide is modified to be a phosphoramidite group.

[0038] As used herein, the term "nucleoside residue" means a nucleoside that is a single subunit residue of an oligonucleotide. A nucleoside monomer once incorporated into an oligonucleotide, becomes a nucleoside residue.

[0039] As used herein, the term "nucleotide" means a compound comprising a nucleoside (i.e. a nucleobase and a sugar) and a phosphate group. A "nucleotide" may be one as found in nature (i.e. a "natural nucleotide" or "naturally occurring nucleotide") or may be modified. A modified nucleotide is not a naturally occurring nucleotide (i.e. it is a non-natural nucleotide). The nucleobase, the sugar and the phosphate group may each, independently, be unmodified or modified. As used herein, "modified nucleotide" means a nucleotide comprising a modified nucleobase and / or a modified sugar and / or a modified phosphate group. Examples of naturally occurring nucleotides include deoxyadenosine monophosphate, deoxycytidine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, deoxyuridine monophosphate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate and uridine monophosphate. Example of modified nucleotides include nucleotides comprising any modified nucleobase and / or modified sugar and / or modified phosphate group as described elsewhere herein. It is acknowledged that certain modifications occur sporadically in nature, i.e. in naturally occurring nucleotides, such as 2'-OMe or C5 pyrimidine modifications, however, in the present disclosure these are considered modified nucleotides.

[0040] Examples of unmodified sugars (i.e. ones as found in nature, which may also be referred to as a "natural sugars" or "naturally occurring sugars") include ribose and deoxyribose. Examples of a modified sugars include modified version of the ribose, such as 2'-O-modified ribose such as 2'-O-alkyl or 2'-O- (substituted)alkyl e.g. 2'-O-methyl, 2'-O-(2-cyanoethyl), 2’-O-(2-methoxy)ethyi (2'-MOE), 2'-O-(2- thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2’~O-allyl, 2’~O-(3-amino)propyl, 2'-O-(3- (dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O"(2“(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O- (haloalkoxy)methyl (Aral K. et a. Bioorg, Med. Chem. 2011, 21, 6285) e.g. 2'-O-(2-chloroethoxy)methyl (MCEM), 2’-O-(2, 2-dichloroethoxy)methyl (DCEM); 2’-O-alkoxycarbonyl e.g. 2’-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoy!)ethyl] (MCE), 2!-O-[2-(N, N~ dimethylcarbamoyl)ethyl] (DCME); 2’~halo e.g. 2'-F, FANA (2’-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3'-O-alkyl e.g. 3'-O-methyl, 3'-O-butyryl, 3'-0-propargyl; and their derivatives. In certain embodiments the sugar is ribose with a modification that is selected from the group consisting of 2!-Fluoro (2'-F), 2'-O-methyl (2!-OMe), 2'-O-methoxyethyl (2'-MOE), and 2!-amino. In certain embodiments the sugar is 2'~MOE ribose. Other sugar modifications include the sugar moieties of "bridged" or "bicylic" nucleic acid (BNA), e.g. the sugar moiety of locked nucleic acid (LNA), xylo-LNA, a-L-LNA, p-D-LNA, cEt (2'-O,4’-C constrained ethyl) LNA, cMOEt (2'-O,4'-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), tricyclo DNA; unlocked nucleic acid (UNA); cyclohexenyl nucleic acid (CeNA), altriol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); morpholino (as e.g. in PMO, PPMO, PMOPIus, PMO-X); and their derivatives. Modified sugars also include those with other modifications, such as a modifications at the 3'-position of the sugar, such as a phosphoramidite group at the 3' position of the sugar (for example 3'-phosphoramidite modified ribose or 3'-phosphoramidite modified deoxyribose).

[0041] Examples of unmodified nucleobases (i.e. ones as found in nature, which may also be referred to as a "natural nucleobases” or "naturally occurring nucleobases") include the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine). Examples of a modified nucleobases include modified versions of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as inosine, hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-methylcytosine, 5-methyluracil, 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5- hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 2,6-diaminopurine, 7- deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2, 6-diaminopurine, Super G, Super A, and N4- ethylcytosine, or derivatives thereof; N2- cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent~AP), and N2-propyl-2~aminopurine (Pr-AP), or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1,2-dideoxyribose, l-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US6683173. cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. (2011), 133, 9200). In certain embodiments the nucelobase is selected from the group consisting of 5- methyl pyrimidines, 7-deazagua nosines and basic nucleotides. In certain embodiments the nucelobase is 5-methyl cytosine. Further examples of a modified nucleobases include natural nucleobases with a protected exocyclic primary amino group on the nucleobases (e.g. adenine, guanine or thymine with a protected exocyclic primary amino group on the nucleobase), for example wherein the exocyclic amino protecting group comprises a benzoyl or isobutyryl group.

[0042] Examples of modified phosphate groups include modified versions of the phosphodiester present in RNA, such as thiophosphate (which may also be referred to as phosphoroth ioate (PS)), phosphora midate (PA), phosphorodiamidate, thiophosphate triester (for example a 2-cyanoethyl thiophosphate triester group) phosphate triester (for example a 2-cyanoethyl thiophosphate triester group), phosphorod ith ioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphoroth ioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonoth ioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl bora nophosphoroth ioate, methyl boranophosphonate, methylboranophosphonothioate, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3'-> P5' phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamido nucleic acid (TANA) groups; and their derivatives.

[0043] In certain embodiments, the modified phosphate group is thiophosphate (which may also be referred to as phosphorothioate (PS)), phosphoramidate (PA), phosphorodiamidate, thiophosphate triester (for example a 2-cyanoethyl thiophosphate triester group) and phosphate triester groups (for example a 2-cyanoethyl thiophosphate triester group). In certain embodiments the modified phosphate group (modified backbone) is thiophosphate triester (for example a 2-cyanoethyl thiophosphate triester group) and phosphate triester groups (for example a 2-cyanoethyl thiophosphate triester group).

[0044] As used herein, the term "oligonucleotide", or "oligo" for short, means a polymer of two or more nucleotides, either deoxyribonucleotides (wherein the resulting oligonucleotide is DNA), ribonucleotides (wherein the resulting oligonucleotide is RNA), or a mixture thereof. An oligonucleotide may be entirely composed of nucleotide residues as found in nature or may contain at least one nucleotide, and / or at least one linkage between nucleotides, that has been modified. As used herein, a linkage between nucleosides may also be referred to as an internucleoside linkage. As used herein, a modified linkage between nucleotides, or a modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage. Examples of modified linkages include thiophosphate linkages (which may also be referred to as phosphoroth ioate linkages). Oligonucleotides can be single stranded or double stranded. An oligonucleotide of the present disclosure may be conjugated to another chemical moiety, e.g. a targeting moiety containing N-Acetylgalactosamine (GalNAc) or multiples thereof (GalNAc clusters).

[0045] An oligonucleotide may be entirely composed of nucleotide residues as found in nature (Ze "natural nucleotides" or "naturally occurring nucleotides") or may contain at least one modified nucleotide, and / or at least one linkage between nucleotides that has been modified. Examples of naturally occurring nucleotides include deoxyadenosine monophosphate, deoxycytidine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, deoxyuridine monophosphate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate and uridine monophosphate. A modified nucleotide is not a naturally occurring nucleotide (Ze. it is a non¬ natural nucleotide). Modified nucleotides may comprise modified backbones (which may also be referred to as modified phosphate groups), modified sugars, and / or modified nucleobases. It is acknowledged that certain modifications occur sporadically in nature, i.e. in naturally occurring nucleotides, such as 2'-OMe or C5 pyrimidine modifications, however, in the present disclosure these are considered modified nucleotides.

[0046] As used herein, the term "phosphite triester linked oligonucleotide” means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a phosphite triester group, for example a 2-cyanoethyl phosphite triester group. As used herein, the term "2-cyanoethyl phosphite triester linked oligonucleotide" means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a 2- cyanoethyl phosphite triester group.

[0047] As used herein, the term "thiophosphate triester-linked oligonucleotide" means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a thiophosphate triester group, for example a 2-cyanoethyl thiophosphate triester group. As used herein, the term "2-cyanoethyl thiophosphate triester-linked oligonucleotide" means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a 2-cyanoethyl thiophosphate triester group.

[0048] As used herein, the term "phosphate triester-linked oligonucleotide" means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a phosphate triester group, for example a 2-cyanoethyl phosphate triester group. As used herein, the term "2-cyanoethyl phosphate triester-linked oligonucleotide" means an oligonucleotide comprising at least one linkage between nucleotides (i.e. at least one internucleoside linkage) that comprises a 2-cyanoethyl phosphate triester group.

[0049] As used herein, the term "therapeutic oligonucleotide" means an oligonucleotide that has a therapeutic application, e.g. in the prevention or treatment of a condition or disease in a human or animal. Such an oligonucleotide typically contains one or more modified nucleotide residues or linkages. Therapeutic oligonucleotides act via one of several different mechanisms, including, but not limited to, antisense, splice-switching or exon-skipping, immunostimulation and RNA interference (RNAi), e.g. via microRNA (miRNA) and small interfering RNA (siRNA).

[0050] As used herein, the term “shortmer" is a smaller portion (for example at least 2 nucleotides in length, e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 nucleotides in length) of a longer, full length oligonucleotide, for example an intermediate for preparing an oligonucleotide product. For a given oligonucleotide product, when all its corresponding shortmers are ligated together, the product is formed.

[0051] Solid phase synthesis is widely used for preparing oligonucleotides. Solid supports (i.e. resins) are the insoluble particles to which the oligonucleotides are linked during synthesis. In some embodiments, the solid supports are commercially available with a first nucleoside monomer already attached thereto. In some embodiments, the solid supports are a universal support, which is functionalized with a universal linking group such as the UNYLINKER™ group. A universal support generally has protected hydroxyl groups. When a universal support is used, the first nucleoside monomer is added in the first coupling step to the deprotected hydroxyl groups.

[0052] The phosphoramidite method is commonly used for solid phase oligonucleotide synthesis and it proceeds in the 3'- to 5'-direction. See e.g. FIG. 1. Each cycle adds one nucleoside monomer of the desired oligonucleotide.

[0053] As used herein, the term "protected hydroxyl group" or "protected OH group" refers to a hydroxyl group with a protecting group, which can be substituted or unsubstituted trityl groups. Hydroxyl is used interchangeably herein with " OH." In one embodiment, the hydroxyl protecting group is 4,4'- dimethoxytrityl (DMT). In one embodiment, the hydroxyl protecting group is trityl. The hydroxyl groups include both those from the solid supports and those from nucleoside monomers or oligonucleotides. As used herein, the term "protected 5-OH group" of a nucleoside (for example a nucleoside monomer or a nucleoside phosphonamidite), a nucleotide, or an oligonucleotide refers to a hydroxyl group with a protection group at the 5'-position of the nucleoside, at the 5'-position of the nucleotide, or at the 5'- position of the terminal nucleotide at the 5' end of the oligonucleotide. Examples of hydroxyl protection groups for a protected 5'-OH group include trityl and 4,4'-dimethoxytrityl (DMT).

[0054] As used herein, the term "free 5'-OH group" of a nucleoside (for example a nucleoside monomer or a nucleoside phosphonamidite), a nucleotide, or an oligonucleotide refers to a hydroxyl group at the 5'-position of the nucleoside, at the 5'-position of the nucleotide, or at the 5'-position of the terminal nucleotide at the 5' end of the oligonucleotide, wherein the hydroxyl group is not protected, i.e. it is an - OH group.

[0055] Because it is not possible for the coupling steps to achieve 100% reaction even with an excess of the appropriate nucleoside monomer being used, there are always some unreacted, free hydroxyl groups at the end of each coupling step. The free hydroxyl groups may react in the next and subsequent cycles, but will still lack the nucleoside that should have been added at the failed coupling step. The resulting oligonucleotide will be shorter than the desired length and is described by the number of nucleosides absent from the desired length as " N minus [x]" where [x] is the number of missing nucleosides. Thus, an oligonucleotide in which a single coupling reaction fails is described as " N minus 1" or “N-l."

[0056] A capping step is generally used after the coupling step to block the unreacted hydroxyl groups, and thus to minimize the formation of shorter failed products. A mixture of capping reagents can be used for the capping step, such as acetic anhydride, N-methylimidazole (NMI), and 2,6-lutidine.

[0057] It was reported that some PS oligonucleotides were prepared by solid phase synthesis on a lab scale of up to 2.2 mmol with the capping step eliminated for each cycle, i.e., with a three-reaction cycle: deprotection, coupling, and sulfurization. See US Patent No, 9,403,865, US Patent No. 11,142,545, and Yang J., et al., " Solid-Phase Synthesis of Phosphoroth ioate Oligonucleotides Using Sulfurization Byproducts for in Situ Capping," J. Org. Chem. 2018, 83(19), 11577-11585. The crude PS oligonucleotides prepared by the three-reaction cycles were reported to have varying purities, with the UV purity ranging from about 71% to about 95% and the total purity up to about 89%. The crude products would require further purification before being used as a therapeutic agent.

[0058] The present disclosure provides a method of preparing oligonucleotides at a commercial scale by solid phase synthesis with the three-reaction cycle (i.e., no capping step) and purification with an ultrafiltration / diafiltration process and without use of chromatography. As used herein, the term "commercial scale" means that the oligonucleotides are prepared for a commercial manufacturing purpose and with a single batch scale of at least 100 grams. In some embodiments, the commercial scale is at least 500 grams, at least 1 kilogram, at least 2 kilograms, at least 3 kilograms, at least 4 kilograms, or at least 5 kilograms.

[0059] " Purification'' or "purifying" herein means the process of removing undesired components, e.g. impurities, from a solution. In other words, purification means increasing the degree of purity of the desired oligonucleotide. Purification is a relative term and does not require that all traces of the undesirable component be removed from the composition. Thus, the terms "purified" or "substantially pure" does not require absolute purity; rather, they are intended as a relative term. A preparation of purified oligonucleotide has a purity of at least 80%. In certain embodiments, a purified oligonucleotide, 70536

[0060] has a purity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% or more. Unless otherwise stated, the purity of oligonucleotides is measured by HPLC (%wt / wt).

[0061] " Ultrafiltration" or " UF" refers to the process of separating substances by passing a solution through a semi-permeable membrane or filter of a specified molecular weight cut off (MWCO) or a specific pore size diameter, wherein larger molecular weight molecules are retained in the retentate, while lower molecular weight molecules pass through the membrane. These lower molecular weight molecules may be a product and / or impurity. " Permeate" refers to the fraction of the solution that passes through the membrane during ultrafiltration. " Retentate" refers to the fraction of the solution that does not pass through the membrane during ultrafiltration. Suitable types of UF apparatuses are known to those in the art and can be selected based on various factors, e.g, the molecular weight of the product to be filtered, the amount and size of the components of the solution to be filtered, and the volume of the solution to be filtered.

[0062] " Ultrafiltration / Diafiltration" or " UF / DF" refers to an ultrafiltration process whereby the separation is combined with a step of adding a diafiltration medium to the retentate. UF / DF may also be referred to as Tangential Flow Filtration (TFF), and UF / DF and TFF are used interchangeably herein, For example, UF / DF allows a solution to be concentrated first and then its buffer system to be exchanged. Additional additives can be introduced, for example to adjust pH and / or ionic strength. A distinction may be made between two basic types of UF / DF: the variable volume UF / DF (sometimes referred to as "discontinuous" UF / DF in the art) and the constant volume UF / DF (sometimes referred to as "continuous" UF / DF in the art).

[0063] The present disclosure provides a method of preparing an oligonucleotide, comprising:

[0064] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;

[0065] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0066] (c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5'-OH group;

[0067] (d) sulfurizing or oxidizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester- or phosphate triester-linked oligonucleoside which comprises a protected 5'- OH group;

[0068] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group; 70536

[0069] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages;

[0070] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0071] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0072] wherein each sulfurizing or oxidation step of step (d) of is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0073] In one embodiment, the oligonucleotide includes only PS linkages and the method comprises:

[0074] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;

[0075] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0076] (c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5'-OH group;

[0077] (d) sulfurizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester-linked oligonucleoside which comprises a protected 5'-OH group;

[0078] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0079] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate linkages;

[0080] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0081] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0082] wherein each sulfurizing step (d) is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0083] In one embodiment, the present disclosure provides a method of preparing an oligonucleotide, comprising:

[0084] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;

[0085] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group; 70536

[0086] (c) coupling a nucleoside diisopropylcyanoethoxy phosphoramidite to the free 5'-OH group to provide a 2-cyanoethyl phosphite triester linked oligonucleoside, wherein the nucleoside diisopropylcyanoethoxy phosphoramidite comprises a protected 5'-OH group;

[0087] (d) sulfurizing or oxidizing the 2-cyanoethyl phosphite triester linked oligonucleoside to provide a 2-cyanoethyl thiophosphate triester- or 2-cyanoethyl phosphate triester-linked oligonucleoside which comprises a protected 5'-OH group;

[0088] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0089] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages;

[0090] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0091] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0092] wherein each sulfurizing or oxidation step of step (d) of is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0093] In one embodiment, the oligonucleotide includes only PS linkages and the method comprises:

[0094] (a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;

[0095] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0096] (c) coupling a nucleoside diisopropylcyanoethoxy phosphoramidite to the free 5'-OH group to provide a 2-cyanoethyl phosphite triester linked oligonucleoside, wherein the nucleoside diisopropylcyanoethoxy phosphoramidite comprises a protected 5'-OH group;

[0097] (d) sulfurizing the 2-cyanoethyl phosphite triester linked oligonucleoside to provide a 2- cyanoethyl thiophosphate triester-linked oligonucleoside which comprises a protected 5'-OH group;

[0098] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0099] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate linkages;

[0100] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0101] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide, 70536

[0102] wherein each sulfurizing step of step (d) of is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0103] In some embodiments, the oligonucleotide is prepared at a commercial scale, for example, at least 500 gram, at least 1 kg, at least 2 kg, at least 3 kg, at least 4 kg, at least 5 kg, at least 6 kg, or at least 7 kg with a single batch. In one embodiment, the oligonucleotide is prepared at a scale of at least 1 kg. In one embodiment, the oligonucleotide is prepared at a scale of at least 5 kg.

[0104] In some embodiments, the purified oligonucleotide prepared by the methods disclosed herein (e.g., the oligonucleotide in the retentate solution of step (h)) is substantially pure. In one embodiment, the purified oligonucleotide has a purity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% or more. In one embodiment, the purified oligonucleotide has a purity of at least 85%, at least 90%, or at least 95%.

[0105] In some embodiments, the method of preparing bepirovirsen described in the present disclosure provides a commercial batch of bepirovirsen, wherein the batch has an impurity profile comprising one or more of the following (as measured by LC-UV and LC-MS):

[0106] (1) early eluting impurity group of less than 1.6% or less than 1.5%;

[0107] (2) phosphorodithioate impurity of less than 0.40%, less than 0.38%, or less than 0.36%; and (3) a total product-related impurities content of less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%,

[0108] optionally wherein the batch has a bepirovirsen sodium content of at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and

[0109] wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0110] In another embodiment, the method of preparing bepirovirsen described in the present disclosure provides a commercial batch of bepirovirsen, wherein the batch has a total product-related impurities content of less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%, and wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0111] In another embodiment, the method of preparing bepirovirsen described in the present disclosure provides a commercial batch of bepirovirsen, wherein the batch has a bepirovirsen sodium content of at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities). 70536

[0112] In another embodiment, the method of preparing bepirovirsen described in the present disclosure provides a commercial batch of bepirovirsen, wherein the batch has a total product-related impurities content of less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%, wherein the batch has a bepirovirsen sodium content of at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and wherein the method has a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0113] In some embodiments, the solid support linked to a nucleoside monomer of step (a) is prepared by a process comprising:

[0114] (al) providing a solid support comprising a plurality of protected hydroxyl groups;

[0115] (a2) deprotecting the protected hydroxyl groups of step (al) to provide free hydroxyl groups; (a3) coupling a nucleoside phosphoramidite to the free hydroxyl groups of step (a2) to provide the solid support linked to a nucleoside monomer with a phosphite triester linkage;

[0116] (a4) sulfurizing the phosphite triester linkage of step (a3) to provide a thiophosphate triester linkage; and

[0117] (a5) optionally capping unreacted free hydroxyl groups present in the reaction mixture of step (a4) with a capping reagent.

[0118] In some embodiments, the solid support linked to a nucleoside monomer of step (a) is prepared by a process without a capping step, comprising:

[0119] (al) providing a solid support comprising a plurality of protected hydroxyl groups;

[0120] (a2) deprotecting the protected hydroxyl groups of step (al) to provide free hydroxyl groups; (a3) coupling a nucleoside phosphoramidite to the free hydroxyl groups of step (a2) to provide the solid support linked to a nucleoside monomer with a phosphite triester linkage; and (a4) sulfurizing the phosphite triester linkage of step (a3) to provide a thiophosphate triester linkage.

[0121] It is believed that the capping step for the first cycle for adding the first nucleoside phosphoramidite protects the unreacted hydroxyl groups of the solid support and thus minimizes the amount of the N-l impurity in the final oligonucleotide product. In some embodiments, the solid support linked to a nucleoside monomer of step (a) is prepared by a process comprising:

[0122] (al) providing a solid support comprising a plurality of protected hydroxyl groups;

[0123] (a2) deprotecting the protected hydroxyl groups of step (al) to provide free hydroxyl groups; (a3) coupling a nucleoside phosphoramidite to the free hydroxyl groups of step (a2) to provide the solid support linked to a nucleoside monomer with a phosphite triester linkage; 70536

[0124] (a4) sulfurizing the phosphite triester linkage of step (a3) to provide a thiophosphate triester linkage; and

[0125] (a5) capping unreacted free hydroxyl groups present in the reaction mixture of step (a4) with a capping reagent.

[0126] Solid supports used for oligonucleotide synthesis are insoluble particles, typically 50-200 pm in diameter. A solid support suitable for the methods of preparing an oligonucleotide disclosed herein is a crosslinked polystyrene or a controlled pore glass. In some embodiments, the solid support is a crosslinked polystyrene with a linker attached thereto or a porous, polydispersed divinyl benzene crosslinked polystyrene with a linker attached thereto.

[0127] In some embodiments, the solid support is a universal support, which does not have a nucleoside monomer pre-attached. Instead, the first nucleoside monomer is added in the first cycle. See Scheme 1. Examples of a universal support include UNYLINKER. and UNYSUPPORT. As used herein, the term "solid support” includes the linker attached thereto.

[0128] Scheme 1

[0129]

[0130] The loading capacity of a solid support refers to the molar amount of the solid support having a linker attached thereto that is available to react to prepare an oligonucleotide, e.g., an equivalent molar amount of the oligonucleotide. In some embodiments, the solid support having a linker attached thereto that is used in the methods disclosed herein has a loading capacity sufficient to prepare the oligonucleotide in an amount in the range of 300-5,400 mmol.

[0131] In some embodiments, the solid support has a linker attached thereto, and the linker comprises a hydroxyl group or protected hydroxyl group. Preferably, the solid support has a linker attached thereto, and the linker comprises a protected hydroxyl group.

[0132] In some embodiments, the loading density of the amount of linker attached to the solid support relative to the amount of solid support that is used during the synthesis of the oligonucleotide prepared according to the methods disclosed herein is in the range of 300-400 micromole of linker / gram of solid support. 70536

[0133] In some embodiments, the protecting group of the hydroxyl groups of the linker attached to the solid support is trityl and dimethoxytrityl (DMT). In one embodiment, the protecting group of the hydroxyl groups of the linker attached to the solid support is DMT.

[0134] In some embodiments, the column housing the solid support that is used in the methods disclosed herein has a column inner diameter in the range of between 35-100 cm. In some embodiments, the solid support has a loading capacity sufficient to prepare the oligonucleotide in an amount of at least 600 mmol, at least 700 mmol, at least 900 mmol, at least 1,600 mmol, at least 2,400 mmol, at least 2,700 mmol, at least 3,000 mmol, at least 3,600 mmol, or at least 4,500 mmol.

[0135] In some embodiments, the column housing the solid support has an inner diameter in the range of between 50-100 cm and a column volume in the range of between 20-35 L.

[0136] In some embodiments, the solid support is pre-loaded with a nucleoside monomer (A, C, G, or T), which can be selected depending on the nucleoside at the 3'-end of the desired oligonucleotide. The 5’-OH group of the pre-loaded nucleoside monomer is protected by a protecting group, e.g., trityl or di methoxytrityl (DMT). In some embodiments, the solid support is pre-loaded with a C monomer (e.g. 5- methylcytosine).

[0137] For the methods disclosed herein, the protected hydroxyl groups of the solid support (for example the universal support) (in embodiments comprising steps (al) to (a5)) and of the protected 5’-OH groups are deprotected before the subsequent coupling step. In some embodiments, protected hydroxyl groups (for example, of protected 5'-OH groups and / or protected hydroxyl groups of the solid support) can be deprotected with a protic acid, e.g., dichloroacetic acid. In some embodiments, the deprotection of protected hydroxyl groups (for example, of protected 5'-OH groups and / or protected hydroxyl groups of the solid support) are carried out using 3-15% of dichloroacetic acid (DCA) in toluene (v / v), e.g., 5% or 10% DCA in toluene. In some embodiments, the deprotection of protected hydroxyl groups (for example, of protected 5'-OH groups and / or protected hydroxyl groups of the solid support) are carried out using 10% DCA in toluene in the range of 2-4 column volumes.

[0138] In some embodiments, after deprotection of protected hydroxyl groups (for example, of protected 5'-OH groups and / or protected hydroxyl groups of the solid support), the solid support is washed with a solvent, e.g, acetonitrile in the range of 1-4 column volumes. In some embodiments, the solid support is washed with 1-2 column volumes of acetonitrile followed by 2-3 column volumes of 0.1M 1- methylimidazole (NMI) in acetonitrile.

[0139] In some embodiments, the coupling step of the methods disclosed herein is achieved by reacting the free hydroxyl group (for example, the free 5'OH group or the free hydroxyl groups of the solid support) with a nucleoside phosphoramidite in the presence of an activator to form a phosphite triester linked nucleoside. In some embodiments, the nucleoside phosphoramidite is a protected nucleoside 70536

[0140] phosphoramidite, comprising a protected 5'-hydroxyl group and a protected exocyclic primary amino group on the nucleobases (A, C, and G). In some embodiments, the exocyclic amino protecting groups comprises benzoyl and isobutyryl groups. In some embodiments, the nucleoside phosphoramidite comprises a (2-cyanoethyl)-N,N-diisopropyl-phosphoramidite group.

[0141] In some embodiments, the amount of the nucleoside phosphoramidite used in the coupling step of the methods disclosed herein is in the range of 1-5 equivalents, relative to the equivalents of the solid support. In some embodiments, the amount of the nucleoside phosphoramidite is in the range of 1.5-4 equivalents, relative to the equivalents of the solid support.

[0142] In some embodiments, the activator used for the coupling step is 4,5-dicyanoimidazole (DCI). In some embodiments, the nucleoside phosphoramidite and the activator are pre-mixed in a solution. In some embodiments, the nucleoside phosphoramidite and the activator are provided in separate solutions. In some embodiments, the activator is IM DCI with 0.1M NMI in acetonitrile. In some embodiments, the amount of the activator used in the coupling step of the methods disclosed herein is in the range of 5-15 equivalents, relative to the equivalents of the solid support. In some embodiments, the amount of the activator is in the range of 6-12 equivalents, relative to the equivalents of the solid support. In some embodiments, the reagents for the coupling step are recycled through the solid support for a certain time period to ensure complete coupling reaction.

[0143] In some embodiments, step (d) comprises sulfurizing the phosphite triester linked oligonucleotide using a sulfurizing agent, to provide a thiophosphate triester-linked oligonucleotide which comprises a protected 5'-OH group, In some embodiments, the phosphite triester linkage, e.g. a 2-cya noethoxy¬ protected phosphite triester linkage, is reacted with a sulfurizing agent, to form a thiophosphate triester linkage, e.g. a 2-cyanoethoxy-protected phosphorothioate linkage. In some embodiments, step (d) comprises oxidising the phosphite triester linked oligonucleotide using a oxidising agent, to provide a phosphate triester-linked oligonucleotide which comprises a protected 5'-OH group. In some embodiments, the phosphite triester linkage, e.g. a 2-cyanoethoxy-protected phosphite triester linkage, is reacted with an oxidizing agent, to form a phosphate triester linkage, e.g. a 2-cyanoethoxy-protected phosphate linkage.

[0144] In some embodiments, the sulfurizing agent is xanthane hydride (XH). In some embodiments, the sulfurizing agent is a disulfide such as phenylacetyl disulfide (PADS). In some embodiments, the sulfurizing agent is 3-((Dimethylamino-methylidene)amino)-3H-l,2,4-dithiazole-3-thione (DDTT). In some embodiments, the amount of the sulfurizing agent used in the sulfurizing step is in the range of 2-6 equivalents, relative to the equivalents of the solid support. In some embodiments, the sulfurizing agent is 4 equivalents of xanthane hydride in pyridine. In some embodiments, the sulfurizing agent is recycled through the solid support for a certain time period to ensure that the unreacted hydroxyl groups from the 70536

[0145] coupling step react with byproducts of the sulfurizing step and so are not available to react in subsequent coupling steps.

[0146] In some embodiments, the oxidizing agent is iodine or t-butyl hydroperoxide.

[0147] For the methods disclosed herein comprising steps (al) to (a4) as defined herein, a capping step may be used after steps (al) to (a4), i.e. after the steps where the first nucleoside phosphoramidite is added to a solid support (for example a universal support). Such a capping step is defined above as step (a5). In some embodiments, the unreacted free hydroxyl groups are capped with an acyl group, e.g. acetyl. In some embodiments, the capping step is carried out by using a first capping solution (Cap A), comprising N-methylimidazole (NMI), pyridine, and acetonitrile, and a second capping solution (Cap B), comprising a capping agent and acetonitrile. In some embodiments, the capping agent is alkyl anhydride, e.g. acetic anhydride.

[0148] In certain embodiments, the steps of deprotecting the protected 5'-OH group, (i.e. step (b)) coupling a nucleoside phosphoramidite (i.e. step (c)), and sulfurizing or oxidizing the phosphite triester linkage (i.e. step (d)) are repeated a predetermined number of times to provide a solid support-linked oligonucleotide. The predetermined number of times is based on the number of nucleosides present in the oligonucleotide product to be prepared.

[0149] In some embodiments, the thiophosphate triester or phosphate triester linkages of the solid support-linked oligonucleotide are deprotected with an amine, e.g. triethylamine, to provide a solid support-linked oligonucelotide which comprises thiophosphate and / or phosphate linkages (also referred to as "backbone deprotection"). In some embodiments, the thiophosphate triester or phosphate triester linkages of the solid support-linked oligonucleotide (e.g. 2-cyanoethyl thiophosphate triester or 2- cyanoethyl phosphate triester linkages of the solid support-linked oligonucleotide) are deprotected with 10-60% (v / v) triethylamine in acetonitrile, to provide a solid support-linked oligonucelotide which comprises thiophosphate and / or phosphate linkages (also referred to as "backbone deprotection".

[0150] In embodiments, the protected 5'-OH group of the solid support-linked oligonucleotide is deprotected before the oligonucleotide is cleaved from the solid support.

[0151] In some embodiments, deprotection of the protected 5'-OH group takes place before the backbone deprotection. In some embodiments, deprotection of the protected 5'-OH group takes place after the backbone deprotection.

[0152] In some embodiments, the solid support-linked oligonucleotide is cleaved from the solid support by using a solution of ammonium hydroxide. In some embodiments, the cleaving step also deprotects the nucleoside base groups of the oligonucleotide, i.e. the exocyclic amino groups on the nucleobases of the oligonucleotide. In some embodiments, the cleaving step is carried out with 28-30% (w / w) ammonium 70536

[0153] hydroxide solution. In some embodiments, the ammonium hydroxide solution is heated to about 50° C and recycled through the solid support for about 12 hours.

[0154] The methods of the present disclosure do not use chromatography to purify the crude oligonucleotide. The crude oligonucleotide synthesized according to the methods disclosed herein has such a purity profile that it does not require chromatography for further purification. Instead, Tangential Flow Filtration (TFF) is sufficient to provide a purified oligonucleotide for use as a therapeutic agent. The term " Tangential Flow Filtration (TFF)" is used interchangeably herein with " Ultrafiltration and / or Diafiltration (UF / DF)."

[0155] In some embodiments, the crude oligonucleotide is purified by:

[0156] (hl) subjecting the crude oligonucleotide to ultrafiltration / diafiltration (UF / DF) using a membrane having a first molecular weight cut off (MWCO), to provide a permeate solution comprising the oligonucleotide; and

[0157] (h2) subjecting the permeate solution of step (hl) to ultrafiltration / diafiltration (UF / DF) using a membrane having a second molecular weight cut off (MWCO), to provide a retentate solution comprising the purified oligonucleotide.

[0158] For step (hl), the first molecular weight cut off (MWCO) is higher than the molecular weight of the oligonucleotide and step (hl) purges high molecular weight impurities (or late eluting impurities, " LEI") which remain in the retentate. For Step (h2), the second molecular weight cut off (MWCO) is lower than the molecular weight of the oligonucleotide and step (e2) purges lower molecular weight impurities (or early eluting impurities, " EEI") and salts which passes through the membrane into the permeate.

[0159] In some embodiments, the crude oligonucleotide is purified by:

[0160] (h2) subjecting the crude oligonucleotide to ultrafiltration / diafiltration (UF / DF) using a membrane having a second molecular weight cut off (MWCO), to provide a retentate solution comprising the purified oligonucleotide.

[0161] In some embodiments, the first molecular weight cut off (MWCO) is about 10,000 Da. In some embodiments, the second molecular weight cut off (MWCO) is about 3,000 Da.

[0162] In some embodiments, a basic solution is used for UF / DF of step (hl). In some embodiments, the basic solution comprises about 500 mM to about 2500 mM cations and has a pH of about 11-14. In one embodiment, the pH of the basic solution is about 10-14, about 10-13.5, about 10-13, about 11-14, about 11-13.5, about 11-13, about 11-12.5, about 11-12 or about 11.5-12.5. In one embodiment, the pH of the basic solution is about 10-14. In one embodiment, the pH of the basic solution is about 10-13.5. In one embodiment, the pH of the basic solution is about 10-13. In one embodiment, the pH of the basic solution is about 10-12.5. In one embodiment, the pH of the basic solution is about 11-14. In one 70536

[0163] embodiment, the pH of the basic solution is about 11-13.5. In one embodiment, the pH of the basic solution is about 11-13. In one embodiment, the pH of the basic solution is about 11-12.5. In one embodiment, the pH of the basic solution is about 11-12. In one embodiment, the pH of the basic solution is about 11.5-12.5. In one embodiment, the pH of the basic solution is about 12-13.5.

[0164] In some embodiments, the basic solution comprises a buffer. The skilled person knows that a buffer solution is a solution where the pH does not change significantly on dilution or if an acid or base is added at constant temperature. Buffer solutions resist pH change because of a chemical equilibrium between the acid and its conjugate base.

[0165] In some embodiments, the basic solution comprises a phosphate buffer. In the case of phosphate buffers, phosphoric acid (H3PO4) is a triprotic acid which undergoes a stepwise dissociation to form H2POT, HPC and PO ’.

[0166] Phosphate acts best as a buffer in the regions of pH near its three pK's: pK1= 2.12, pK2= 7.21; and pK3= 12.44. The " Henderson Hasselbalch Equation" is a convenient form to use in buffer calculations, particularly when the pH is within one unit above or one unit below the pK. Taking tribasic phosphate buffers as an example, at pH 12,44 ± 1 (pH 11,44 - 13.44), the ratio of the two predominant species in the buffer, HPCk2’ and PO3' can be calculated.

[0167] The skilled person understands that a buffer with the required pH can be prepared via multiple ways. For example, the buffer solution may be prepared from 300 mM tripotassium phosphate and titrated to the desired pH with an acid or a base. The resulting buffer solution at the desired pH may comprise other phosphate species in addition to tripotassium phosphate, e.g. dipotassium phosphate. As used herein, the term "300 mM tripostassium phosphate buffer" with a specified pH refers to a buffer solution prepared by adding an acid (e.g, H3PO4) to 300 mM tripostassium phosphate until the specified pH is reached.

[0168] Alternatively, the same buffer solution may be prepared by mixing in water the two predetermined phosphate salts, i.e. dipotassium phosphate and tripotassium phosphate, in the amounts calculated from Henderson Hasselbalch Equation, to achieve the specified pH,

[0169] In some embodiments, the basic solution used in step (hl) has a high ionic strength. In some embodiments, the ionic strength of the basic solution can be derived from the cations of a buffer. In one embodiment, the basic solution comprises a buffer derived from about 100 to about 1000 mM, about 100 to about 800 mM, about 100 to about 600 mM, about 100 to about 500 mM, about 100 to about 450 mM, about 100 to about 400 mM, about 100 to about 350 mM, about 150 to about 300 mM, about 150 to about 350 mM, about 200 to about 500 mM, about 200 to about 400 mM, about 200 to about 350 mM, about 200 to about 300 mM, about 250 to about 500 mM, about 250 to about 400 mM, about 250 to about 350 mM phosphate solution. In some embodiments, the ionic strength of the basic solution can be 70536

[0170] derived from addition of NaCI, e.g., adding NaCI to 0.1 M NaOH solution to make a 2 M NaCl solution. In some embodiments, the basic solution comprises about 500 mM to about 2500 mM, about 750 mM to about 2500 mM, about 1000 mM to about 2500 mM, about 1250 mM to about 2500 mM, about 1500 mM to about 2500 mM, about 1750 mM to about 2500 mM, about 2000 mM to about 2500 mM, about 500 mM to about 2000 mM, about 750 mM to about 2000 mM, about 1000 mM to about 2000 mM, about 1250 mM to about 2000 mM, about 1500 mM to about 2000 mM, about 1750 mM to about 2000 mM, about 500 mM to about 1500 mM, about 750 mM to about 1500 mM, about 1000 mM to about 1500 mM, about 1250 mM to about 1500 mM, about 500 mM to about 1000 mM, or about 750 mM to about 1000 mM sodium ions.

[0171] In some embodiments, the basic solution comprises 0.1 M NaOH and 2M NaCI. In some embodiments, the basic solution comprises 300 mM Na₃PO₄.

[0172] In some embodiments, step (h2) of the methods disclosed herein comprises a concentration step, a neutralization step to provide a retentate with pH of 6-8, and a diafiltration step to remove salts. In some embodiments, the concentration step provides an oligonucleotide solution of more than 800 OD / mL (e.g. 600-800 OD / mL). In some embodiments, the neutralization step uses HCI to provide a retentate with pH of 6-8. In some embodiments, the diafiltration step uses water to remove salts until the conductivity of the oligonucleotide solution is less than 50 pS / cm.

[0173] In some embodiments, the methods disclosed herein further comprises concentrating the oligonucleotide solution from the UF / DF purification to provide the purified oligonucleotide in a concentrated solution. In some embodiments, the oligonucleotide solution from the UF / DF purification is concentrated by Thin Film Evaporation (TFE).

[0174] In some embodiments, the methods disclosed herein further comprises lyophilizing the oligonucleotide solution to provide the purified oligonucleotide in solid form.

[0175] In one embodiment, the disclosed method is for preparing an oligonucleotide, wherein the oligonucleotide is 10 to 200 nucleotides long. In one embodiment, the oligonucleotide is 10 to 150 nucleotides long. In one embodiment, the oligonucleotide is 10 to 100 nucleotides long. In one embodiment, the oligonucleotide is 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, or 10 to 30 nucleotides long. In one embodiment, the oligonucleotide is 10 to 50 nucleotides long. In one embodiment, the oligonucleotide is 10 to 40 nucleotides long. In one embodiment, the oligonucleotide is 10 to 35 nucleotides long. In one embodiment, the oligonucleotide is 10 to 30 nucleotides long. In a further embodiment of the invention the oligonucleotide is 15 to 35 nucleotides long. In a further embodiment of the invention the oligonucleotide is 15 to 30 nucleotides long. In one embodiment, the oligonucleotide is 20 to 30 nucleotides long. In an embodiment of the invention the oligonucleotide is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides long. In an embodiment of the invention the oligonucleotide is 20 70536

[0176] nucleotides long, a "20-mer", In an embodiment of the invention the oligonucleotide is 21 nucleotides long, a "21-mer". In an embodiment of the invention the oligonucleotide is 22 nucleotides long, a "22- mer", In an embodiment of the invention the oligonucleotide is 23 nucleotides long, a "23-mer". In an embodiment of the invention the oligonucleotide is 24 nucleotides long, a "24-mer". In an embodiment of the invention the oligonucleotide is 25 nucleotides long, a "25-mer". In an embodiment of the invention the oligonucleotide is 26 nucleotides long, a "26-mer", In an embodiment of the invention the oligonucleotide is 27 nucleotides long, a "27-mer". In an embodiment of the invention the oligonucleotide is 28 nucleotides long, a "28-mer", In an embodiment of the invention the oligonucleotide is 29 nucleotides long, a "29-mer". In an embodiment of the invention the oligonucleotide is 30 nucleotides long, a "30- mer".

[0177] In one embodiment, the disclosed method is for preparing an oligonucleotide shortmer, wherein the oligonucleotide is 3 to 16 nucleotides long.

[0178] In one embodiment, the method is for preparing a therapeutic product. In one embodiment, the method is for preparing an oligonucleotide for therapeutic use.

[0179] One embodiment of the invention provides a method as disclosed herein, wherein the oligonucleotide contains at least one modified nucleotide residue. In one embodiment, the at least one modified nucleotide comprises modification of the sugar moiety, modification of the nucleobase and / or modification of the backbone. In one embodiment, the at least one modified nucleotide comprises 2' position modification of the sugar moiety, modification of the nucleobase and / or modification of the backbone, In a further embodiment, the modification is at the 2' position of the sugar moiety, In a further embodiment, the modifications are at the 2' position of the sugar moiety and modification of the backbone.

[0180] The oligonucleotide may include sugar modifications, i.e. a modified version of the ribosyl moiety, such as 2'-O-modified RNA such as 2'-O-alkyl or 2'-O-(substituted)alkyl e.g. 2'-O-methyl, 2'-O-(2- cyanoethyl), 2’-O-(2-methoxy)ethyl (2'-MOE), 2’-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'- O-allyl, 2'-O-(3-amino)propyl, 2'-O-(3-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl (Aral K. eta / . Bioorg. Med. Chem. 2011, 21, 6285) e.g. 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2, 2-dichloroethoxy)methyl (DCEM); 2'-O- alkoxycarbonyl e.g. 2’-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2’-O-[2-(N, N-dimethylcarbamoyl)ethyl] (DCME); 2'-halo e.g. 2’-F, FANA (2’-F arabinosyl nucleic acid); carbasugarand azasugar modifications; 3’-O-alkyl e.g. 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl; and their derivatives. 70536

[0181] In one embodiment, the sugar modification is selected from the group consisting of 2'-Fluoro (2'- F), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), and 2'-amino. In a yet further embodiment, the modification is 2'-MOE.

[0182] Other sugar modifications include "bridged" or "bicylic" nucleic acid (BNA), e.g. locked nucleic acid (LNA), xylo-LNA, o-L-LNA, p-D-LNA, cEt (2'-O,4'-C constrained ethyl) LNA, cMOEt (2'-O,4’-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), tricyclo DNA; unlocked nucleic acid (UNA); cyclohexenyl nucleic acid (CeNA), altriol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); morpholino (as e.g. in PMO, PPMO, PMOPIus, PMO-X); and their derivatives. LNA is a modified ribosyl moiety the 2'-hydroxyl group of the ribosyl sugar ring is linked to the 4’ carbon atom of the sugar ring a with a methylene (-CH2-) group bridging the 2' oxygen atom and the 4’ carbon atom, thereby forming a 2'-C,4'-C-oxymethylene linkage to form the bicyclic sugar moiety. ENA is a modified ribosyl moiety the 2’-hydroxyl group of the ribosyl sugar ring is linked to the 4’ carbon atom of the sugar ring a with a ethylene (- CH2CH2-) group bridging the 2' oxygen atom and the 4' carbon atom, thereby forming a 2’-C,4'-C-oxymethylene linkage to form the bicyclic sugar moiety.

[0183] The oligonucleotide may include other modifications, such as peptide-base nucleic acid (PNA), boron modified PNA, pyrrolidine-based oxy-peptide nucleic acid (POPNA), glycol- or glycerol-based nucleic acid (GNA), threose-based nucleic acid (TNA), acyclic threoninol-based nucleic acid (aTNA), oligonucleotides with integrated bases and backbones (ONIBs), pyrrolidine-amide oligonucleotides (POMs); and their derivatives.

[0184] In one embodiment, the nucleobase modification is selected from the group consisting of 5-methyl pyrimidines, 7-deazaguanosines and abasic nucleotides. In an embodiment, the modification is a 5-methyl cytosine.

[0185] In a further embodiment, the modification is in the backbone and is selected from the group consisting of: phosphoroth ioate (PS), phosphora midate (PA) and phosphorodiamidate. In one embodiment, the modified oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO). A PMO has a backbone of methylenemorpholine rings with phosphorodiamidate linkages. In one embodiment, the oligonucleotide has a phosphoroth ioate (PS) backbone.

[0186] In one embodiment, the oligonucleotide comprises a combination of two or more modifications as disclosed above.

[0187] In some embodiments, the oligonucleotide comprises only phosphorothioate (i.e. thiophosphate) linkages. In some embodiments, the oligonucleotide comprises only phosphorothioate (i.e. thiophosphate) linkages and further comprises one or more modified sugar moieties (for example one or more modified sugar moieties wherein the modification is at the 2' position of the sugar moiety). 70536

[0188] In some embodiments, the oligonucleotide product comprises both phosphorothioate (i.e. thiophosphate) linkagesand phosphate linkages. In some embodiments, the number of the thiophosphate linkages is m and the number of the phosphate linkages is n, and wherein m is 2 to 50 and n is 0, 1, 2, 3, 4, or 5. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and no phosphate linkage. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 1, 2, 3, 4, or 5 phosphate linkage. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 1 phosphate linkage. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 2 phosphate linkages. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 3 phosphate linkages. In some embodiments, the oligonucleotide product comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 4 phosphate linkages.

[0189] In some embodiments, the oligonucleotide product comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and no phosphate linkage. In some embodiments, the oligonucleotide product comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 thiophosphate linkages and 1, 2, 3, 4, or 5 phosphate linkage.

[0190] In one embodiment, the oligonucleotide is a gapmer. In one embodiment, the 5' and 3' wings of the gapmer comprise or consist of 2'-MOE modified nucleotides. In an embodiment, the gap segment of the gapmer comprises or consists of nucleotides containing hydrogen at the 2' position of the sugar moiety, In one embodiment, the 5' and 3' wings of the gapmer consist of 2'-MOE modified nucleotides and the gap segment of the gapmer consists of nucleotides containing hydrogen at the 2' position of the sugar moiety. In one embodiment, the 5' and 3' wings of the gapmer consist of 2'-MOE modified nucleotides, the gap segment of the gapmer consists of nucleotides containing hydrogen at the 2' position of the sugar moiety, and the linkages between all of the nucleotides are phosphorothioate linkages.

[0191] In some embodiments, the oligonucleotide consists of 20 linked nucleosides and has a nucleobase sequence of SEQ ID NO:1 (5'–GCAGAGGTGAAGCGAAGTGC–3').

[0192] In some embodiments, the oligonucleotide comprises:

[0193] a gap segment consisting of linked deoxy nucleosides,

[0194] a 5’ wing segment consisting of linked nucleosides, and

[0195] a 3' wing segment consisting of linked nucleosides, 70536

[0196] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

[0197] In some embodiments, the oligonucleotide comprises a separator segment placed in between gap segments as disclosed in WO2023 / 131098.

[0198] In one embodiment, the oligonucleotide is selected from Compounds AUS1233 / AUS1138, AUS1444, AUS1458, AUS1459, AUS1460, AUS1427 / AUS1461, AUS1462, AUS1463, AUS1464, AUS1465, AUS1463, AUS1467, AUS1468, AUS1470, AUS1471, AUS1472, AUS1473, AUS1474, AUS1475, AUS1476 / AUS1493, AUS1478, AUS1479, AUS1489, AUS1490, AUS1443, and AUS1322 as disclosed in WO2023 / 131098. In one embodiment, the oligonucleotide is selected from Compounds AUS1233 / AUS1138, AUS1463, and AUS1476 / AUS1493. In one embodiment, the oligonucleotide is Compound AUS1493. AUS1493 has the modified nucleotide sequence set out in SEQ ID NO: 2.

[0199] SEQ ID NO 2: 5' moeG-s-moeSMeC-s-moeA-s-moeG-s-dA-s-dG-s-dG-s-dT-s-dG-s-moeA-s-dA-s-dG-s- d5MeC-s-dG-s-dA-s-moeA-s-lnaG-s- moe5MeU-s-lnaG-s-lna5MeC 3'

[0200] wherein:

[0201] moeA ~ 2’-O-(2-methoxyethyl) adenosine

[0202] moe5MeC = 2’-O-(2-methoxyethyl) 5-methylcytidine

[0203] moeG = 2’-O-(2-methoxyethyl) guanosine

[0204] moe5MeU = 2'-O-(2-methoxyethyl) 5-methyl uridine

[0205] dA = 2'-deoxy adenosine

[0206] d5MeC = 2'-deoxy 5-methylcytidine

[0207] dG = 2'-deoxy guanosine

[0208] dT = 2'-deoxy thymidine

[0209] lna5MeC = LNA 5-methylcytidine

[0210] lnaG = LNA guanosine

[0211] -s- = phosphorothioate

[0212] In some embodiments, the oligonucleotide comprises:

[0213] a gap segment consisting of ten linked deoxynucleosides,

[0214] a 5' wing segment consisting of 5 linked nucleosides, and

[0215] a 3' wing segment consisting of 5 linked nucleosides,

[0216] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment includes a 2'-O~methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine. 70536

[0217] In one embodiment, the oligonucleotide is bepirovirsen. Bepirovirsen has the modified nucleotide sequence set out in SEQ ID NO: 3.

[0218] SEQ ID NO 3: 5' moeG-s-moe5MeC~s-moeA-s-moeG-s-moeA~s-dG-s~dG-s-dT-s~dG-s-dA-s~dA-s-dG-s- d5MeC-s-dG-s-dA-s-moeA-s-moeG-s-moe5MeU-s-moeG-s-moe5MeC 3'

[0219] wherein:

[0220] moeA ~ 2’-O-(2-methoxyethyl) adenosine

[0221] moe5MeC = 2'-O-(2-methoxyethyl) 5-methylcytidine

[0222] moeG ~ 2'-O-(2-methoxyethyl) guanosine

[0223] moe5MeU = 2'-O-(2-methoxyethyl) 5-methyl uridine

[0224] dA = 2'-deoxy adenosine

[0225] d5MeC ” 2'-deoxy 5-methyicytidine

[0226] dG 2’-deoxy guanosine

[0227] dT = 2’-deoxy thymidine

[0228] -s- = phosphoroth ioate

[0229] In another embodiment, the oligonucleotide is AHB-137.

[0230] Bepirovirsen is an antisense oligonucleotide currently in clinical evaluation for treating chronic HBV infections. It is compound ISIS No. 505358 as disclosed in WO2012 / 145697. Bepirovirsen has 20 linked nucleosides and has a nucleobase sequence of 5'-GCAGAGGTGAAGCGAAGTGC-3' (SEQ ID NO:1), and it includes:

[0231] a gap segment consisting of ten linked deoxynucleosides,

[0232] a 5' wing segment consisting of 5 linked nucleosides, and

[0233] a 3' wing segment consisting of 5 linked nucleosides,

[0234] wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment includes a 2'-O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine. The CAS Registry Number of bepirovirsen is 1403787-62-1.

[0235] In some embodiments, the oligonucleotide is a full-length oligonucleotide product. In other embodiments, the oligonucleotide is a shortmer, e.g., an intermediate for preparing a full-length oligonucleotide product.

[0236] In one embodiment, the oligonucleotide is a sense strand of a double-stranded oligonucleotide. In one embodiment, the oligonucleotide is an anti-sense strand of a double-stranded oligonucleotide. The purified sense strand and the purified anti-sense strand may form a double stranded oligonucleotide e.g. an siRNA. 70536

[0237] The present disclosure also provides an oligonucleotide obtained by the methods disclosed herein. The present disclosure also provides a therapeutic product comprising an oligonucleotide obtained by the methods disclosed herein. The present disclosure also provides an oligonucleotide for therapeutic use obtained by the methods disclosed herein. In some embodiments, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide prepared by the methods disclosed herein. In some embodiments, the present disclosure provides a pharmaceutical composition comprising bepirovirsen prepared by the methods disclosed herein. In some embodiments, the present disclosure provides a commercial batch of an oligonucleotide prepared by the methods disclosed herein. In some embodiments, the present disclosure provides a commercial batch of bepirovirsen prepared by the methods disclosed herein.

[0238] In some embodiments, the present disclosure provides a commercial batch of bepirovirsen prepared by a method disclosed herein, wherein the batch has an impurity profile comprising one or more of the following (as measured by LC-UV and LC-MS):

[0239] (1) early eluting impurity group of less than 1.6% or less than 1.5%;

[0240] (2) phosphorodithioate impurity of less than 0.40%, less than 0.38%, or less than 0.36%; and (3) a total product-related impurities content of less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%,

[0241] optionally wherein the batch has a bepirovirsen sodium content of at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and

[0242] wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0243] In some embodiments, the present disclosure provides a commercial batch of bepirovirsen prepared by a method disclosed herein, wherein the batch has an impurity profile comprising one or more of the following (as measured by LC-UV and LC-MS):

[0244] (1) phosphorodithioate impurity of less than 0.40%, less than 0.38%, or less than 0.36%; and (2) a total product-related impurities content of less than 10.0%, less than 9.5%, less than 9.0%, or less than 8.5%,

[0245] optionally wherein the batch has a bepirovirsen sodium content of at least 90% or at least 91% by HPLC-UV (% w / w, corrected), and

[0246] wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities). 70536

[0247] In another embodiment, the present disclosure provides a commercial batch of bepirovirsen prepared by a method disclosed herein, wherein the batch has a total product-related impurities content of less than 10.0%, less than 9.5%, less than 9.0%, less than 8.5%, less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%, and wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0248] In another embodiment, the present disclosure provides a commercial batch of bepirovirsen prepared by a method disclosed herein, wherein the batch has a bepirovirsen sodium content of at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and wherein the method provides a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0249] In another embodiment, the present disclosure provides a commercial batch of bepirovirsen prepared by a method disclosed herein, wherein the batch has a total product-related impurities content of less than 10.0%, less than 9.5%, less than 9.0%, less than 8.5%, less than 8.0%, less than 7.5%, less than 7.0%, or less than 6.5%, wherein the batch has a bepirovirsen sodium content of at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or at least 96% by HPLC-UV (% w / w, corrected), and wherein the method has a yield of at least 4.4 g / mmol, at least 4.5 g / mmol, or at least 4.6 g / mmol (corrected for water and impurities).

[0250] Embodiments:

[0251] 1. A method for preparing an oligonucleotide, comprising:

[0252] (a) providing a sol id support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;

[0253] (b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;

[0254] (c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5'-OH group;

[0255] (d) sulfurizing or oxidizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester- or phosphate triester-linked oligonucleoside which comprises a protected 5'- OH group;

[0256] (e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5'-OH group;

[0257] (f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages; 70536

[0258] (g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and

[0259] (h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,

[0260] wherein each sulfurizing step of step (d) of is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

[0261] 2. The method of Embodiment 1, wherein the oligonucleotide is prepared at a scale of at least 500 gram, at least 1 kg, or at least 5 kg.

[0262] 3. The method of Embodiment 1 or Embodiment 2, wherein the purified oligonucleotide in the retentate solution of step (h) has a purity of at least 85%, 90%, or 95% by HPLC (%wt / wt).

[0263] 4. The method of any of Embodiments 1 to 3, wherein the solid support linked to a nucleoside monomer of step (a) is prepared by a process comprising:

[0264] (al) providing a solid support comprising a plurality of protected hydroxyl groups;

[0265] (a2) deprotecting the protected hydroxyl groups of step (al) to provide free hydroxyl groups; (a3) coupling a nucleoside phosphoramidite to the free hydroxyl groups of step (a2) to provide the solid support linked to a nucleoside monomer with a phosphite triester linkage;

[0266] (a4) sulfurizing the phosphite triester linkage of step (a3) to provide a thiophosphate triester linkage; and

[0267] (a5) optionally capping unreacted free hydroxyl groups present in the reaction mixture of step (a4) with a capping reagent,

[0268] 5. The method of any of Embodiments 1 to 4, wherein step (f) comprises:

[0269] (fl) deprotecting the protected 5'~OH group of step (e) to provide a solid support-linked oligonucleotide with a free 5'-OH group; and

[0270] (f2) deprotecting the thiophosphate triester or phosphate triester linkages of the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide with thiophosphate or phosphate linkages;

[0271] wherein step (fl) can take place before or after step (f2).

[0272] 6. The method of any of Embodiments 1 to 5, wherein step (h) comprises:

[0273] (hl) optionally subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) using a membrane having a first molecular weight cut off (MWCO), to provide a permeate solution comprising the oligonucleotide; and 70536

[0274] (h2) subjecting the crude oligonucleotide of step (g) or the permeate solution of step (hl) to ultrafiltration / diafiltration (UF / DF) using a membrane having a second molecular weight cut off (MWCO), to provide a retentate solution comprising the purified oligonucleotide.

[0275] 7. The method of any of Embodiments 1 to 6, further comprising:

[0276] (i) concentrating the retentate solution of step (h) to provide the purified oligonucleotide in a concentrated solution.

[0277] 8. The method of any of Embodiments 1 to 7, further comprising:

[0278] (j) lyophilizing the retentate solution of step (h) or the concentrated solution of step (i) to provide the purified oligonucleotide in solid form.

[0279] 9. The method of any of Embodiments 1 to 8, wherein the internucleoside linkages of the oligonucleotide comprise thiophosphate linkages and optionally phosphate linkages, wherein the number of the thiophosphate linkages is m and the number of the phosphate linkages is n, and wherein m is 2 to 50 and n is 0, 1, 2, 3, 4, or 5.

[0280] 10. The method of Embodiment 9, wherein m is 10 to 30 and n is 1, 2, 3, 4, or 5, and wherein each oxidizing step of step (d) of is not followed by a capping step.

[0281] 11. The method of Embodiment 9, wherein m is 10 to 30 and n is 0.

[0282] 12. The method of any of Embodiments 1 to 11, wherein the solid support is a universal support.

[0283] 13. The method of any of Embodiments 1 to 12, wherein the hydroxyl protecting group of each protected 5'-OH group is 4,4’-dimethoxytrityl (DMT) and wherein the phosphoramidite group of each nucleoside phosphoramidite is diisopropylcyanoethoxy phosphoramidite.

[0284] 14. The method of Embodiment 13, wherein dichloroacetic acid in toluene is used for deprotecting the protected hydroxyl groups.

[0285] 15. The method of any of Embodiments 1 to 14, wherein 4,5-dicyanoimidazole and N- methylimidazole in acetonitrile is used in each coupling step (c).

[0286] 16. The method of any of Embodiments 1 to 15, wherein xanthane hydride in pyridine is used in each step (d) comprising a sulfurizing step.

[0287] 17. The method of any of Embodiments 1 to 16, wherein aqueous ammonium hydroxide is used in step (g).

[0288] 18. The method of any of Embodiments 4 to 17, wherein the solid support linked to a nucleoside monomer of step (a) is prepared by the process as defined in Embodiment 4, and wherein the capping agent in step (a4) comprises acetic anhydride, N-methylimidazole, and 2,6-lutidine in acetonitrile; and / or wherein the hydroxyl protecting group of each protected hydroxyl groups of the a solid support in step 70536

[0289] (al) is 4,4’-d I methoxytrityl (DMT) and optionally wherein dichloroacetic acid in toluene is used for deprotecting the protected hydroxyl groups.

[0290] 19. The method of any of Embodiments 6 to 18, wherein step (h) comprises optionally step (hl) and step (h2) as defined in Embodiment 6, and wherein the first molecular weight cut off (MWCO) is about 10,000 Da and the second molecular weight cut off (MWCO) is about 3,000 Da.

[0291] 20. The method of Embodiment 19, wherein a basic solution is used for UF / DF of step (hl), and wherein the basic solution comprises about 500 mM to about 2500 mM cations and has a pH of about 11- 14,

[0292] 21. The method of Embodiment 19 or Embodiment 20, wherein step (h2) comprises a concentration step, a neutralization step to provide a retentate with pH of 6-8, and a diafiltration step to remove salts.

[0293] 22. The method of any of Embodiments 1 to 21, wherein the oligonucleotide comprises from about 10 to about 40 nucleotides.

[0294] 23. The method of any of Embodiments 1 to 22, wherein the oligonucleotide has a nucleobase sequence of 5'-GCAGAGGTGAAGCGAAGTGC-3' (SEQ ID NO:1) or fragments thereof.

[0295] 24. The method of any of Embodiments 1 to 23, wherein the oligonucleotide is bepirovirsen, 25. The method of any of Embodiments 1 to 23, wherein the oligonucleotide is AHB-137.

[0296] 26. An oligonucleotide obtained by the method of any of Embodiments 1 to 25.

[0297] EXAMPLES

[0298] Example 1: Generali Methods for Preparing Bepirovirsen

[0299] 1A, Solid Phase Oligonucleotide Synthesis (SPOS)

[0300] Oligonucleotide bepirovirsen was synthesized with Nittophase HL Unilynker (Kinovate, loading 350 pmol / g) as the solid support, using two methods (Method A and Method B). For Method A, the synthesis cycle for attaching each nucleoside consisted of four reaction steps: detritylation, coupling, sulfurization, and capping. The order or inclusion of these reaction steps can vary based on the cycle. For Method A, all synthesis cycles included the capping step following the sulfurization. For Method B, Cycle 1 consisted of the detritylation, coupling, sulfurization, and capping steps and the remaining cycles did not include any capping step.

[0301] The detritylation step was accomplished with dichloroacetic acid (DCA) in toluene (10 % by vol) as the reagent. The coupling step was carried out by circulating a solution of the corresponding nuceloside phosphoramidite and 4,5-dicyanoimidizole (DCI) in Acetonitrile containing 0.1 M N-methylimidizole (NMI) 70536

[0302] through the solid support. The sulfurization step was completed by using 0.2M 3"amino“l,2,4“dithiazole“ 5-thione (Xanthane Hydride, XH) in Pyridine. The capping step was accomplished by charging a mixture of Cap A (NMI and 2,6-Lutidine in ACN) and Cap B (AC2O in ACN).

[0303] Method B includes an additional detritylation step after the last sulfurization step, and the additional detritylation step is referred to as Cycle 21. The final step of Method A and Method B is the backbone deprotection, which is accomplished by using Triethylamine (TEA) in acetonitrile (42.5-57.5 % by vol).

[0304] For both Method A and Method B, cleavage of the oligonucleotide from the solid support and base deprotection are performed in 28-30% ammonium hydroxide in water at elevated temperature (45- 55CC) for 10-14 hours. The crude oligonucleotide of Method A included the trityl protecting group (DMT- on), which was removed during chromatography purification step.

[0305] More detailed reaction conditions and parameters of Method A and Method B and the crude product analysis are described in Table 1 below.

[0306] Table 1: Bepirovirsen Synthesis by Method A and Method B.

[0307] Process Step Variable Method A Method B

[0308] Support Nittophase Nittophase

[0309] Synthesis Support Unilynker HL Unilynker HL

[0310] Loading 350 pmol / g 350 pmol / g

[0311] Reagent 10% DCA (by vol) 10% DCA (by vol)

[0312] Deblock Volume Cl: 3.21 CV Cl: 3.21 CV

[0313] C2-16: 2.15 CV C2,4: 2.58 CV

[0314] C17-20: 2.57 CV C3, 5-16: 2.15 CV

[0315] C17-21: 2.57 CV

[0316] Detritylation

[0317] Flow Rate 420 cm / h 420 cm / h

[0318] Wash 1 Reagent Acetonitrile Acetonitrile

[0319] Wash 1 Amount 1.74 CV 1 CV

[0320] Wash 2 Reagent Acetonitrile 0.1M NMI in ACN

[0321] Wash 2 Amount 1.74 CV 2.48 CV

[0322] Eq amidite Cl-15: 1.55 eq Cl-15: 1.55 eq

[0323] C16-20: 1.75 eq C16-20: 2 eq

[0324] Cone. Amidite 0.2 M 0.2 M

[0325] Eq activator Cl-15: 7.75 eq Cl-15: 7.75 eq

[0326] C16-20: 8.75 eq C16-20: 10 eq

[0327] Activator DC! [1.0M] and DCI [1.0M] and

[0328] Coupling NMI [0.1M] NMI [0.1M]

[0329] Recycle flow rate Cl-15: 3 min at Cl-15: 3 min at

[0330] 212 cm / h 212 cm / h

[0331] C16-20: 5 min at C16-20: 5 min at

[0332] 424 cm / h 212 cm / h

[0333]

[0334] Wash Reagent Acetonitrile Acetonitrile 70536

[0335] Wash Amount 0.87 CV 0.87 CV

[0336] Reagent 0.2M XH in 0.2M XH in

[0337] Pyridine Pyridine

[0338] Reagent eq 4.0 eq 4.0 eq

[0339] Reaction Time Flow through Cl: Flow through

[0340] Sulfurization mode, 5 min mode, 5 min;

[0341] C2-C2.0: Recycle

[0342] mode, 20 min at

[0343] 212 cm / h

[0344] Reagent CAP A, 2:3:5 CAP A, 2:3:5

[0345] [N MI / 2, 6- [N MI / 2, 6- Lutidine. ACN] Lutidine, ACNl

[0346] Cap B, 1:4 Cap B, 1:4

[0347] Capping [AC2O / ACN] [AC2O / ACN]

[0348] Charge Volume Cl: 1.04 CV Cl: 1.04 CV

[0349] C2-19: 0.35 CV

[0350] Wash Reagent Acetonitrile Acetonitrile

[0351] Wash Amount 3 CV 3 CV

[0352] Reagent 50% triethylamine 50% triethylamine

[0353] in ACN (by vol) in ACN (by vol)

[0354] Backbone Charge Volume 1.74 CV for 5 min 1.74 CV for 5 min

[0355] deprotection and Reaction 3.48 CV for 145 3.48 CV for 145

[0356] Time min min

[0357] Reagent 28-30% aqueous 28-30% aqueous

[0358] ammonium ammonium

[0359] Cleavage and

[0360] hydroxide hydroxide

[0361] Deprotection

[0362] Time 11.5-12.5 Hours 11.5-12.5 Hours

[0363] Temperature 47-53’C 47-53'C

[0364] Early Eluting 7.7-10.3 %area 3.9 %area

[0365] Impurity group

[0366] N-l Impurity 2.2-2.3 %area 1.6 %area

[0367] Population

[0368] N+l Impurity 0.7-0.9 %area 0.7 %area

[0369] HPLC-UV

[0370] Population

[0371] Late Eluting 1.2-1.6 %area 0.5 %area

[0372] impurity group

[0373] Full Length 85.0-88.1 %area 93.2 %area

[0374] Product

[0375]

[0376] Yield 163-165 OD / pmol 167 OD / pmol

[0377] Cl: Cycle 1; CV: Column Volume; Eq: Equivalent

[0378] Yield is shown as OD / pmol, which represents the optical density result per the pmol of active sites on the solid support. The product is in solution during the crude stage and the OD / pmol values are obtained for estimate and comparison purposes.

[0379] I. Purification of Crude Oiigonudeotide 70536

[0380] For Method A, the crude DMT-protected oligonucleotide was purified by anion-exchange chromatography with on-column det itylation. The crude material was loaded onto the column and excess ammonium hydroxide and small molecule impurities were washed away using dilute aqueous sodium hydroxide solution. A series of washes were performed with sodium chloride / sodium hydroxide solution to remove early eluting impurities (EEI) that do not possess a DMT group. Detritylation of the DMT-on oligonucleotide intermediate was achieved on the resin by treatment with aqueous acetic acid solution. Excess acetic acid was removed with a water wash and the column was re-equilibrated with dilute aqueous sodium hydroxide solution. Finally, the product was eluted using a linear gradient of sodium chloride in sodium hydroxide solution. This provided separation of impurities which elute before drug substance (i.e. early eluting impurity group and N-l impurity population) and those that elute after drug substance (i.e. late eluting impurity group (LEI) and N+l impurity population). Fractions were collected across the gradient elution and a range of mock pools were prepared and analysed to determine which fractions are selected for further processing.

[0381] Method B did not use chromatography to purify the crude oligonucleotide (bepirovirsen). Instead, Tangential Flow Filtration (TFF) was used for purification, including a first TFF using a membrane having a molecular weight cut off (MWCO) that is higher than the molecular weight of the product to purge high molecular weight impurities, and a second TFF using a membrane having a MWCO membrane that is lower than the molecular weight of the product to purge lower molecular weight impurities and salts. These two TFF processes are detailed in Table 2 below. The first TFF with high MWCO used a solution with a high ionic strength and basicity (examples include: 25mM NaOH and 2M NaCI, or 300 mM NaaPOq). It was a diafiltration unit operation where the permeate comprised primarily of the oligonucleotide and the retentate comprised primarily of high molecular weight impurities. The amount of diafiltration volumes used was based on the desired yield and the incoming impurity level in the crude solution. A typical amount of diafiltration volumes used in the experimentation was at least 5 diavolumes. The permeate were collected in portions and analyzed for impurities and the later portions were rejected if the impurity levels were higher than desired. The collected and selected permeate solutions were then brought forward to the second TFF with the lower MWCO to purge the salts and the lower molecular weight impurities.

[0382] The second TFF with low MWCO consisted of a concentration step to not more than 800 OD / mL, a neutralization step using HCI to a retentate with pH of 6-8, and a subsequent diafiltration unit operation using water until the conductivity is less than 50 pS / cm. The permeate of these operations comprised of salts and lower molecular weight impurities and the retentate comprised primarily of the oligonucleotide product. 70536

[0383] The Transmembrane pressure (TMP) and cross flowrate ranges used in TFF are dependent on the membrane selected and the solution characteristics. For Method B a target of 2 bar TMP and 5.5 L / min / m2cross flow rate was used.

[0384] Table 2. TFF Purification Process Used in Method B

[0385] Process Step Variable Conditions

[0386] Membrane 10 kDa Cellulose

[0387] Retentate Concentration 600-800 OD / mL

[0388] Diafi Itration Solution 300mM Na3PO4or [25mM NaOH

[0389] First TFF with High

[0390] and 2M NaCI]

[0391] MWCO

[0392] Cross flow rate 5.5 L / min / m2

[0393] TMP 2 bar

[0394] Amount of Buffer in Diafiltration 19 Diavolumes

[0395] Membrane 3kDa Cellulose

[0396] Retentate Concentration 300 OD / mL

[0397] pH Target 6-8

[0398] Second TrF with Low

[0399] Diafiltration Solvent Water

[0400] MWCO

[0401] End of Diafiltration Target <50 uS / cm

[0402] Cross flow rate 5.5 L / min / m2

[0403]

[0404] TMP 2 bar

[0405] The purified oligonucleotide solution from the TFF process was concentrated by Thin Film Evaporation and then lyophilized to provide the purified oligonucleotide in solid state.

[0406] An overlay of the chromatograms of the oligonucleotide product at different stages of Method B is displayed in FIG. 3, and the percentages of the product and key impurities are shown in Table 3 (HPLC with UV detection, area%).

[0407] Table 3. Percentages of the oligonucleotide and key impurities

[0408] | Full Length

[0409] EEX hl-1 i Product N+l LEX

[0410] Crude Product 4.5% | 1.6% i 92.4% 0.7% 0.8%

[0411] Post lOkDa TFF 3.4% 1 1.7% | 93.5% 0.8% 0.6%

[0412] Post 3kDa TFF 1.6% 1.6% | 95.3% 0.8% 0.6%

[0413] Lyophilized

[0414]

[0415] Product 2.0% 1.6% i 95.7% 0.72% 0.53%

[0416] A reversed-phase gradient HPLC procedure was used to measure the percentages of the oligonucleotide product and key impurities.

[0417] Column: Waters XBridge BEH C18, 2.1*100mm, 2.5pm

[0418] Detector wavelength: 260 nm Detector type: Variable wavelength UV or diode array UV

[0419] Column temperature: 70 °C

[0420] Flow rate: 0.5 mL / min

[0421] Mobile phase A: 5mM tributylammonium acetate + I M EDTA in H2O: ACN-9:1 v / v

[0422] Mobile phase B: 5mM tributylammonium acetate + IpM EDTA in H2O: ACN=2:8 v / v Gradient program:

[0423] i Time (min) A% B%

[0424] | 0.0 65 35

[0425] 35.0 30 70

[0426] 35.1 65 35

[0427] 42.0 65 35

[0428]

[0429] 1C. Other Versions of Method B for Preparing Bepirovirsen

[0430] Two other versions of Method B were carried out at a smaller scale with slightly different reaction conditions and parameters as shown in Table 4 below (Method Bl and Method B2). For the coupling step of Method Bl, a different activator (ETT, 5-Ethylthiotetrazole) was also tested. For the coupling step of Method B2, " X2" represents two cycles of the coupling step, which means after the first cycle of charging the amidite and activator and recycling, a second amidite and activator charge was performed with subsequent recycling. Method B3, another version of Method B, was carried out at the same scale with slight modifications as shown in Table 4, such as no capping step used for Cycle 1.

[0431] Table 4. Synthesis of Bepirovirsen by Method Bl, Method B2, Method B3, and Method B.

[0432] Process Variable Method Bi Method B2 Method B Method B3 Step

[0433] Support Nittophase Nitophase Nittophase Nittophase Unilynker HL Unilynker HL Unilynker HL Unilynker HL Synthesis

[0434] Loading 350 pmol / g 350 pmol / g 350 pmol / g 350 pmol / g Set Up

[0435] Scale 3.06 mmol 24.99 mmol 3.06 mmol 3.06 mmol Synthesizer OligoPilotlOO OligoPilot400 OligoProcess OligoProcess Reagent 10% DCA (by 10% DCA (by vol) 10% DCA (by vol) 10% DCA (by vol) vol)

[0436] Deblock Cl: 3.21 CV Cl: 3.21 CV Cl: 3.21 CV Cl: 3.21 CV Detritylati

[0437] Volume C2-16: 2.15 CV C2-16: 2.15 CV C2,4: 2.58 CV C2-16: 2.15 CV on

[0438] C17-21: 2.57 CV C17-21: 2.57 CV C3,5-16: 2.15 CV C17-21: 2.57 CV C17-21: 2.57 CV

[0439]

[0440] Flow Rate 420 cm / h 420 cm / h 420 cm / h Cl: 376cm / h C2-21: 420 cm / h Wash 1 Acetonitrile Acetonitrile i Acetonitrile Acetonitrile Reagent

[0441] Wash 1 1 CV 1 CV | 1 CV Cl-15: 1 CV Amount C16-21: 2CV Wash 2 0.1M NMI in 0.1M NMI in ACN | 0.1M NMI in ACN Acetonitrile Reagent ACN

[0442] Wash 2 2.48 CV 2.48 CV | 2.48 CV 3 CV Amount

[0443] Eq amidite Cl-15: 2.0 eq Cl-15: 1.55 eq i Cl-15: 1.55 eq Cl-15: 1.55 eq C16-20: 3.0 eq C16-18: 2 eq | C16-20: 2.0 eq C16-20: 2.0 eq C19&2.0: 2 eq X 2 |

[0444] Cone. 0.2 M 0.2 M | 0.2 M 0.2 M Amidite

[0445] Activator (DC! [1.0M] and DCI [1.0M] and | DCI [1.0M] and DCI [1.0M] and NMI [0.1M] in NMI [0.1M] | NMI [0.1M] NMI [0.1M] ACN) or (ETT Cl-15: 7.75 eq | Cl-15: 7.75 eq Cl-15: 7.75 eq [0.6M] in ACN) C16-18: 10 eq. | C16-20: 10 eq C16-20: 10 eq Cl-15: 10 eq C19&20: 10 eq. X |

[0446] Coupling

[0447] C16-20: 15 eq2

[0448] Recycle flow Cl-15: 3 min at Cl-15: 3 min at i Cl-15: 3 min at Cl-15: 2.88 min rate 212 cm / h 212 cm / h | 212 cm / h at 212 cm / h C16-20: 5 min at C16-20: 5 min at | C16-2.0: 5 min at C16-20: 4.44 min 424 cm / h 424 cm / h i 212 cm / h at 212 cm / h Wash N / A N / A i Acetonitrile Acetonitrile Reagent

[0449] Wash N / A N / A | 0.87 CV 0.87 CV Amount

[0450] Sulfurizati Reagent 0.2M XH in 0.2M XH in | 0.2M XH in 0.2M XH in on Pyridine Pyridine i Pyridine Pyridine Reagent eq 4.0 eq 4.0 eq i 4.0 eq 4.0 eq Reaction Recycle mode, Recycle mode, 20 i Cycle 1: flow Recycle mode, 5 Time 20 min at 212 min at 212 cm / h i through mode, 5 min at 212 cm / h cm / h i min;

[0451] 1 Cycle 2-20:

[0452] i Recycle mode, 20

[0453] i min at 212 cm / h

[0454] Wash N / A N / A i Acetonitrile Acetonitrile Reagent

[0455] Wash N / A N / A | 0.87 CV 2 CV Amount

[0456] Reagent N / A N / A | CAP A, 2:3:5 N / A

[0457] | [N MI / 2, 6- Capping 1 Lutidine, ACN]

[0458] | Cap B, 1:4

[0459]

[0460] | lAc2O / ACN) Charge N / A N / A | 1.04 CV N / A Volume

[0461] Wash N / A N / A i Acetonitrile N / A Reagent

[0462] Wash N / A N / A | 3 CV N / A Amount

[0463] Reagent 50% 50% | 50% triethylamine 50% triethylamine in triethyiamine in 1 in ACN (by vol) triethyiamine in ACN (by vol) ACN (by vol) i ACN (by vol) Backbone

[0464] Charge 1.74 CV for 5 1.74 CV for 5 min i 1.74 CV for 5 min 1.74 CV for 5 min deprotecti

[0465] Volume min 3.48 CV for 145 | 3.48 CV for 145 3.48 CV for 145 on

[0466] 3.48 CV for 145 min i min min

[0467] min

[0468] Reagent 28-30% aqueous 28-30% aqueous 1 28-30% aqueous 28-30% aqueous Cleavage ammonium ammonium 1 ammonium ammonium and hydroxide hydroxide i hydroxide hydroxide Deprotecti

[0469] on Time 11.5-12.5 hours 11.5-12.5 hours | 11.5-12.5 hours 11.5-12.5 hours

[0470]

[0471] Temperature 47-53’C 47-53'C | 47-53°C 47-53°C

[0472] When the crude oligonucleotide from the solid-phase synthesis contains low levels of high molecular weight impurities, the first TFF with High MWCO is not needed, and purification can be achieved with just the second TFF with Low MWCO. For example, the crude oligonucleotide prepared by Method Bl, B2, and B3 was purified by TFF with Low MWCO only as described in Table 5 below.

[0473] Table 5. Purification by TFF with Low MWCO

[0474] Process Step Variable Conditions

[0475] Membrane 3kDa Cellulose

[0476] Retentate Concentration 400-800 OD / mL

[0477] pH Target 6-8

[0478] f FF with Low

[0479] Salt Swap Solution 0.5-1.0 M NaCI

[0480] MWCO

[0481] Number of Salt Swap Diafiltrations >6

[0482] Diafiltration Solvent Water

[0483]

[0484] End of Diafiltration Target <50 uS / cm

[0485] ID. Comparison of Different Methods for Preparing Bepirovirsen

[0486] Method A used conventional four-reaction cycles to synthesize bepirovirsen on a solid support and ion-exchange chromatography for purification to achieve an oligonucleotide product with a suitable purity profile. However, chromatography purification has certain downsides, for example, limitation on the scale, use of large amounts of solvent, a longer cycle time, and a higher cost of goods. 70536

[0487] Method B is an improved method for preparing bepirovirsen, which removed the capping steps in the solid-phase synthesis and removed chromatography purification. Instead, TFF process was sufficient to purge early- and late-eluting impurities and achieve a suitable purity profile of the oligonucleotide after its solid phase synthesis without capping steps. For example, from Method A to Method B, the crude purity was improved from about 82% to 92%, And the final total product-related impurity (LCUV+LCMS) was reduced from 10.4% to 7.1%. The yield (corrected for water and impurities) was improved from 3.81 g / mmol (Method A) to 4.54 g / mmol (Method B), with a 19% increase. Comparison of impurity profiles and yields of the oligonucleotide products prepared by various methods are shown in Table 6 below.

[0488] Process Mass Intensity (PMI) is used to measure the sustainability of a process by focusing on the total mass of materials used to produce a given mass of product. Because of removing the capping steps and chromatography purification, Method B is estimated to reduce the PMI (kg / kg) to 3027 from 6124 for Method A, amounting to about 50% reduction. 70536

[0489] Table 6. Comparison of Impurity Profiles and Yields

[0490] Test items Product Method Bl Method B2 Method B3 Method 8 Method A (21

[0491] Specification Isolated solid isolated solid Isolated solid isolated solid batches)

[0492] product product product product

[0493] Scale 3 mmol synthesis 25 mmol 3.06 mmol 3.06 mmol 1600 mmol*

[0494] 1.5 mmol TFF

[0495] impurities LC-UV and LC-MS

[0496] Early eluting impurity group NGT 7.0 1.9 2.2 2.8 2.0 1.7 - 3.8 (avg 2.6) N-l impurity population (N-l) NGT 4.0 2.5 2.2 3.5 1.6 1.3 - 2.7 (avg 2.0) N+l impurity population (N+l) NGT 2.0 1.4 0.74 0.72 0.50- 1.6 (avg 1.1) Late eluting impurity group NGT 3.0 1.7 2.0 0.67 0.53 <0.20- 1.1 (avg 0.32) Abasic impurity population NGT 2.0 0.93 0.91 0.56 0.74 0.24- 1.2 (avg 0.77) Phosphate impurity population NGT 4.0 0.59 0.78 0.95 0.58 0.39- 1.5 (avg 0.92) Phosphorodithioate impurity NGT 2.0 0.3 0.73 0.34 0.35 0.42 - 1.4 (avg 0.87) population

[0497] Any unspecified impurity NGT 1.0 m / zl821.0: 0.34 m / zl821.1: 0.62 m / zl820.8: 0.20 m / zl821.0: 0.28 0.31-0.59 (avg 0.45) population m / zl826.3: 0.14 m / zl826.6: 0.23 m / z!859.1: 0.20

[0498] m / zl843.2: 0.43 m / zl843.7: 0.53

[0499] Total product-related impurities m / zl856.1: 0.27

[0500] content NGT 15.0 10.8 12.7 9.9 7.1 8.3 - 14.0 (avg 10.4) Sodium content by ICP-OES (% w / w, 4.5 -6.8 5.8 5.5 5.9 4.9 5.2 -6.5 (avg 6.1) corrected)

[0501] Bepirovirsen sodium content by 82.0- 101.5 92.5 92.4 90.2 91.5 87.2-93.6 (avg 90.4) HPLC-UV (% w / w, corrected)

[0502] Water content by CKF (% w / w) NGT10.0 5.8 9.3 3.8 3.3 2.7 -8.1 (avg 4.6) Isolated yield 7g 142g 1.66kg 1.55kg

[0503] Yield (corrected for water and imps) - 3.98 g / mmol 4.51 g / mmol 4.72 g / mmol 4.54 g / mmol 3.25-4.33 g / mmol

[0504]

[0505] (avg 3.81)

[0506] * Includes a combined 3xl600mmol and a 621.5mmol batch

[0507]

[0508] 70536

[0509] Example 2: Preparation of Other Oligonucleotides

[0510] Four other antisense oligonucleotides were prepared with Method A and Method B. The sequence information of the four oligonucleotides is listed in Table 7.

[0511] Table 7. Sequence Information of Oligonucleotides

[0512] Compound Sequence

[0513] 5'-moeGs-moeCMes-moeCMes-moeTs-moeCMes-dAs-dGs-dTs-dCMes-dTs-dGs-dCMes-dTs-dTs- Mipomersen

[0514] dCMes-moeGs-moeCMes-moeAs-moeCMes-moeCMe-3’ (SEQ ID NO: 4)

[0515] 5'- dGs-dCs-dGs-dTs-dTs-dTs-dGs-dCs-dTs-dCs-dTs-dTs-dCs-dTs-dTs-dCs-dTs-dTs-dGs-dCs-dG-3' Fomiversen

[0516] (SEQ ID NO: 5)

[0517] 5'- moeTs-moeCMes-moeAs-moeCMes-moeTs-moeTs-moeTs-moeCMes-moeAs-moeTs-moeAs- Nusinersen

[0518] moeAs-moeTs-moeGs-moeCMes-moeTs-moeGs-moeG-3' (SEQ ID NO: 6)

[0519] 5’- moeCMes-moeA-moeGs-moeG-moeAs-dTs-dAs-dCMes-dAs-dTs-dTs-dTs-dCMes-dTs-dAs- Tofersen

[0520] moeCMe-moeAs-moeG-moeCMes-moeT-3' (SEQ ID NO: 7)

[0521]

[0522] dR: DNA nucleoside

[0523] moe-R: 2′-O-MOE nucleoside

[0524] Me: 5-Me modified nucleobase

[0525] s: Phosphorothioate linkage

[0526] The synthesis of the four oligonucleotides with Method A were conducted on the Cytiva OP100, with a scale of 3.06 mmol and a solid support loading of 350 pmol / g. Each synthesis was carried out to the crude stage. At the end of the synthesis, the products were washed with 0.5% ammonia, purged of liquid, and subjected to ammonolysis. Cleavage and deprotection (C& D) were performed for 12 hours at 48-52°C with 28%-30% ammonia. All syntheses were DMT-on and were analysed using both DMT-off and DMT-on analytical methods. Yields were calculated based on total optical densities (ODs).

[0527] The crude ammonolysis solution was purified using anion exchange (AEX) chromatography. The AEX chromatography purification solution was ultrafiltered and concentrated using a 3 kDa, 0.11 m2membrane pack. The product was then neutralized with 1 M HCI and 0.1 M HCI, followed by additional ultrafiltration and diafiltration. The solution was desalted until the permeate conductivity was less than 0.10 mS / cm and concentrated. The solution was passed through a sterile filter, and the samples were concentrated using a rotary evaporator (temperature: 48-52°C, rotation speed: 60-70 rpm). The final product was obtained by lyophilization in a plate lyophilizer.

[0528] The parameters for the synthesis of the four oligonucleotides with Method B are listed in Table 8. Each synthesis was carried to the crude stage. At the end of synthesis, the products were washed with 0.5% ammonia, the liquid was purged, and ammonolysis was performed. Cleavage and 70536

[0529] deprotection (C& D) were conducted for 12 hours at 48-52°C with 28%-30% ammonia. All syntheses were conducted using the DMT-on approach and analyzed by both DMT-off and DMT-on analytical methods, with yields calculated by total ODs.

[0530] Table 8. Process Parameters of Method B for the synthesis of the four oligonucleotides.

[0531] Process Step Parameter Mipomersen Fomiversen Nusinersen Tofersen Scale 3.06 mmol 3.06 mmol 3.06 mmol 3.06 mmol Solid

[0532] Support 8.743 g 8.743 g 8.743 g 8.743 g Weight

[0533] Solid

[0534] Support 350 pmol / g 350 pmol / g 350 pmol / g 350 pmol / g Loading

[0535] Solid

[0536] Synthesis Support

[0537] Column and Specific 10.564 mL / g 10.564 mL / g 10.564 mL / g 10.564 mL / g Synthesizer Volume

[0538] Column

[0539] Volume 92.36 mL 92.36 mL 92.36 mL 92.36 mL Column

[0540] Diameter 3.5 cm 3.5 cm 3.5 cm 3.5 cm Column

[0541] Height 9.6 cm 9.6 cm 9.6 cm 9.6 cm Synthesizer Oligo Pilot 100 Oligo Pilot 100 Oligo Pilot 100 Oligo Pilot 100 Reagent ACN ACN ACN ACN Pre-synthesis

[0542] Wash Volume 3.48 CV 3.48 CV 3.48 CV 3.48 CV Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h Toluene (10-16 Toluene (10-16 Reagent ”C for cycles 7- Toluene(14°C for Toluene(22°C for °C for cycles 7- 20) all cycles) ail cycles) 20) Pre-detrityiation 1.74 CV for cycle 1.74 CV for cycle 1.74 CV for cycle 1.74 CV for cycle Wash 1 1 1

[0543] Volume

[0544] 0.43 CV for 0.43 CV for 0.43 CV for 0.43 CV for cycles 2-20 cycles 2-21 cycles 2-18 cycles 2-20 Flow Rate 420 cm / h 420 cm / h 420 cm / h 420 cm / h Reagent 10% DCA in 10% DCA in 10% DCA in 10% DCA in toluene toluene toluene toluene Ambient for cycle Ambient for cvcle 1-6 1-6 Temperahjr 14 °C for all 22’C for all Detrityiation e 10-16 °C for cycles cycles

[0545] Charge cycles 7-20 and 10-16 °C for final detrityiation cycles 7-20

[0546] 3.21 CV for cycle 3.21 CV for cycle 3.21 CV for cycle 3.21 CV for cycle 1 1 1 Volume

[0547] 2.58 CV for 2.58 CV for 2.58 CVfor 2.58 CV for

[0548]

[0549] cycles 2,4 cycles 2,4 cycles 2,4 cycles 2,4 70536

[0550] Process Step Parameter Mipomersen Fomiversen Nussnersen Tofersen 2.15 CV for 2.15 CV for 2.15 CV for 2.15 CVfor cycles 3,5-16 cycles 3,5-16 cycles 3,5-16 cycles 3,5-16 2.57 CV for 2.57 CV for 2.57 CV for 2.57 CV for cycles 17-20 cycles 17-21 cycles 17-18 cycles 17-20 Flow Rate 420 cm / h 420 cm / h 420 cm / h 420 cm / h Reagent 1 ACN ACN ACN ACN Wash 1

[0551] Volume 2.00 CV 2.00 CV 2.00 CV 2.00 CV Wash 1

[0552] Flow Rate 200 cm / h 200 cm / h 200 cm / h 200 cm / h Detrityiation

[0553] Wash Reagent 2 0.1M NMI in 0.1M NMI in 0.1 M NMi in 0.1 M NMi in ACN Solution ACN Solution ACN Solution ACN Solution Wash 2

[0554] Volume 4.96 CV 4.96 CV 4.96 CV 4.96 CV Wash 2

[0555] Flow Rate 200 cm / h 200 cm / h 200 cm / h 200 cm / h Amidites

[0556] Reagent & 0.2 M amidites 0.2 M amidites 0.2 M amidites 0.2 M amidites Concentratio solution in ACN solution in ACN solution in ACN solution in ACN n

[0557] Activator

[0558] Reagent & 1 M DC! with 0.1 1 M DC! with 0.1 1 M DCI with 0.1 1 M DCI with 0.1 Concentratio M NMi in ACN M NM! in ACN M NMI in ACN M NMI in ACN n

[0559] 1.55 eq. for 1.55 eq for 1.55 eq for 1.55 eq. for cycles 1-15 cycles 1 -15 cycles 1-15 cycles 1 -15 Amidite Eq.

[0560] 2.00 eq. for 2.00 eq. for 2.00 eq. for 2.00 eq. for cycles 16-20 cycles 16-21 cycles 16-18 cycles 16-20 Coupling Charge 7.75 eq. for 7.75 eq. for 7.75 eq. for 7.75 eq. for cycles 1-15 cycles 1 -15 cycles 1 -15 cycles 1-15 Activator Eq.

[0561] 10.00 eq. for 10.00 eq. for 10.00 eq. for 10.00 eq. for cycles 16-20 cycles 16-21 cycles 16-18 cycles 16-20 47.43 mL for 47.43 mL for 47.43 mL for 47.43 mL for cycles 1 -15 cycles 1-15 cycles 1-15 cycles 1 -15 Total

[0562] Volume

[0563] 61.20 mL for 61.20 mL for 61.20 mL for 61.20 mL for cycles 16-20 cycles 16-21 cycles 16-18 cycles 16-20 Flow Rate of

[0564] Amidite 10.0 mL / min 10.0 mL / min 10.0 mL / min 10.0 mL / min Flow Rate of

[0565] Activator 10.0 mL / min 10.0 mL / min 10.0 mL / min 10.0 mL / min Reagent ACN ACN ACN ACN Coupling Push Volume 6 mL 6 mL 6 mL 6 mL Total Flow

[0566] Rate 125 cm / h 125 cm / h 125 cm / h 125 cm / h

[0567]

[0568] Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h 70536

[0569] Process Step Parameter Mipomersen Fomiversen Nusinersen Tofersen 3 min for cycles 3 min for cycles 3 min for cycles 3 min for cycles 1-15 1-15 1-15 1-15 Coupling

[0570] Recycle Time

[0571] 5 min for cycles 5 min for cycles 5 min for cycles 5 min for cycles 16-20 16-21 16-18 16-20 Reagent ACN ACN ACN ACN Coupling Wash Volume 0.87 CV 0.87 CV 0.87 CV 0.87 CV Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h Reagent 0.05 M 12 in N / A N / A N / A Py / H2O Oxidation Equivalents N / A N / A N / A 3 eq. Charge

[0572] Flow Rate N / A N / A N / A 45.9 mL / min Time N / A N / A N / A 4.00 min Reagent N / A N / A N / A ACN Oxidation Push Volume N / A N / A N / A 1.20 CV Flow Rate N / A N / A N / A 45.9 mL / min Reagent N / A N / A N / A ACN Oxidation Wash Volume N / A N / A N / A 0.87 CV Flow Rate N / A N / A N / A 424 cm / h Reagent 0.2 M XH in Py 0.2 M XH in Py 0.2 M XH in Py 0.2 M XH in Py Equivalents 4 eq. 4 eq. 4 eq. 4 eq. Sulfurization

[0573] Charge

[0574] Flow Rate 12.2 mL / min 12.2 mL / min 12.2 mL / min 12.2 mL / min

[0575] Time 5.00 min 5.00 min 5.00 min 5.00 min Reagent ACN ACN ACN ACN 1.09 CV for 1.09 CV for 1.09 CV for 1.09 CV for cycle 1 cyclel cyclel cyclel

[0576] Sulfurization Volume

[0577] 6.00 mL for 6.00 mL for 6.00 mL for 6.00 mL for Push

[0578] cycles 2-20 cycles 2-20 cycles 2-21 cycles 2-18

[0579] Flow Rate 12.2 mL / min 12.2 mL / min 12.2 mL / min 12.2 mL / min

[0580] Reagent ACN ACN ACN ACN Thiolation 212 cm / h for 212 cm / h for 212 cm / h for 212 cm / h for Flow Rate RecyclefThiolati cycles 2-20 cycles 2-21 cycles 2-18 cycles 2-20 on recycle no

[0581] capping) 20.00 min for 20.00 min for 20.00 min for 20.00 min for Time cycles 2-20 cycles 2-21 cycles 2-18 cycles 2-20

[0582] Reagent ACN ACN ACN ACN Sulfurization 0.87 CV Volume 0.87 CV 0.87 CV 0.87 CV Wash

[0583] Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h Cap A: Cap A: Cap A: Cap A: Capping Charge Reagents Ac2O / ACN=2 / 8 Ac2O / ACN=2 / 8 Ac2O / ACN=2 / 8 Ac2O / ACN=2 / 8

[0584]

[0585] 70536

[0586] Process Step Parameter Mipomersen Fomiversen Nusinersen Tofersen Cap B: NMI / 2,6- Cap B: NMI / 2,6- Cap B: NMI / 2,6- Cap B: NMi / 2,6- lutidine / ACN=2 / 3 lutidine / ACN=2 / 3 lutidine / ACN=2 / 3 lutidine / ACN=2 / 3 / 5 / 5 / 5 / 5 Total 1.04 CV for cycle 1.04 CV for cycle 1.04 CV for cycle 1.04 CV for cycle Volume 1 1 1 Total Flow 212 cm / h for 212 cm / h for 212 cm / h for 212 cm / h for Rate cycle 1 cycle 1 cycle 1 cycle 1 Reagent ACN ACN ACN ACN Total 1.05 CV for cycle 1.05 CV for cycle 1.05 CV for cycle 1.05 CV for cycle Capping Push Volume 1 1 1 Total Flow 212 cm / h for 212 cm / h for 212 cm / h for 212 cm / h for Rate cycle 1 cycle 1 cycle 1 cycle 1 Reagent ACN ACN ACN ACN Total 3.00 CV for cycle 3.00 CV for cycle 3.00 CV for cycle 3.00 CV for cycle Capping Wash Volume 1 1 1 Total Flow

[0587] Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h Toluene (10-16 Toluene (10-16 Reagent °C) Toluene (14 °C) Toluene (22 °C)

[0588] Pre-Detrityiation

[0589] Wash Volume 0.43 CV 0.43 CV 0.43 CV 0.43 CV Flow Rate 420 cm / h 420 cm / h 420 cm / h 420 cm / h 10% DCA in 10% DCA in toluene (10 10% DCA in 10% DCA in

[0590] Reagent -16 toluene (10-16 Final °C) toluene (14 °C) toluene (22 °C) °C) Detrityiation

[0591] Charge

[0592] Volume 2.57 CV 2.57 CV 2.57 CV 2.57 CV Flow Rate 420 cm / h 420 cm / h 420 cm / h 420 cm / h Reagent 1 ACN ACN ACN ACN Wash 1

[0593] Volume 2.00 CV 2.00 CV 2.00 CV 2.00 CV Wash 1

[0594] Flow Rate 200 cm / h 200 cm / h 200 cm / h 200 cm / h Detritytation

[0595] Wash Reagent 2 0.1 M NMI in 0.1M NMI in 0.1 M NMI in 0.1 M NMI in ACN Solution ACN Solution ACN Solution ACN Solution Wash 2

[0596] Volume 4.96 CV 4.96 CV 4.96 CV 4.96 CV Wash 2

[0597] Flow Rate 200 cm / h 200 cm / h 200 cm / h 200 cm / h Reagent ACN ACN ACN ACN Post Synthesis

[0598] Wash Volume 3.48 CV 3.48 CV 3.48 CV 3.48 CV Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h Reagent 50% TEA in ACN 50% TEA in ACN 50% TEA in ACN 50% TEA in ACN Volume 1 1.74 CV 1.74 CV 1.74 CV 1.74 CV Time 1 5.00 min 5.00 min 5.00 min 5.00 min Amine Wash

[0599] Flow Rate 1 200 cm / h 200 cm / h 200 cm / h 200 cm / h Volume 2 3.48 CV 3.48 CV 3.48 CV 3.48 CV

[0600]

[0601] Time 2 145.00 min 145.00 min 145.00 min 145.00 min 70536

[0602] Process Step Parameter Mipomersen Fomiversen Nussnersen Tofersen Flow Rate 2 14 cm / h 14 cm / h 14 cm / h 14 cm / h Reagent ACN ACN ACN ACN Post Synthesis

[0603] Wash Volume 3.48 CV 3.48 CV 3.48 CV 3.48 CV

[0604]

[0605] Flow Rate 212 cm / h 212 cm / h 212 cm / h 212 cm / h

[0606] After the crude ammonia solution was diluted and flushed through a 10 kDa membrane pack, the product was exchanged with sodium salt using 25 mM NaOH with 2 M NaCI or 400 mM Na3PO4. The diafiltration volume (DV) was collected until the yield reaches 90%. The product solution was ultrafiltered and concentrated using a 3 kDa, 0.11 m2membrane pack. The product was then neutralized with 1 M HCI, followed by additional ultrafiltration and diafiltration. The solution was desalted until the permeate conductivity was less than 0.10 mS / cm. Finally, the product was collected after the final concentration.

[0607] The ultrafiltrate was passed through a sterile filter, and the solution was concentrated using a rotary evaporator (temperature: 48-52°C, rotation speed: 60-70 rpm). The final product was obtained by lyophilization in a plate lyophilizer.

[0608] Tables 9A and 9B provide a comparison of the oligonucleotide products prepared by Method A and Method B, including UV purity, MS purity, and yield at various stages. The results showed that Method B provided the four oligonucleotide products with comparable or better purity and yield as compared to Method A.

[0609] Table 9A. Comparison of Fomlversen and Mipomersen Products Prepared by Method A and Method B

[0610] Fomiversen Mipomersen Results

[0611] Method A Method B Method A Method B DMT- UV Purity 91.50% N / A 94.60% N / A On MS Purity 88.00% N / A 91.40% N / A 93.20%

[0612] Synthesis DMT- UV Purity 92.98% 94.50% 95.50%

[0613] off MS Purity 84.80% 89.20% 91.40% 92.90% Yield 146OD / umol 143 OD / umot 127 OD / umot 127 OD / umol UV Purity 96.30% N / A 96.10% N / A Purification

[0614] OD recovery 84.80% N / A 81.65% N / A 10 kD UV Purity N / A 94.30% N / A 95.90% High

[0615] TFF OD recovery N / A 92.70% N / A 85.85%

[0616] MWCO

[0617]

[0618] UV Purity 97.30% 95.50% 97.70% 96.30% 70536

[0619] 3 kD

[0620] Low OD recovery 78.30% 75.94% 81.47% 80.72% MWCO

[0621] Weight (g) 3.2146 3.9889 4.292 4.7595 Yield(gZmmol) 3.8 3.9 4.4 4.7 UV Purity 96.90% 95.00% 97.80% 96.40% MS Purity 94.20% 92.10% 95.50% 93.60% Lyophilized

[0622] NH4+N / / A 0.57% N / / A 0.32% Water

[0623] 3.10% 2.50% 2.60% 2.20% Content

[0624] Sodium

[0625] 6.30% 5.70% 5.50% 5.00%

[0626]

[0627] Content

[0628] Table 9A. Comparison of Nusinersen and Tofersen Products Prepared by Method A and Method B

[0629] Nusinersen Tofersen Results

[0630] Method A Method B Method A Method B DMT- UV Purity 95.70% N / A 91.80% N / A On MS Purity 93.70% N / A 89.30% N / A Synthesis DMT- UV Purity 94.80% 95.30% 90.90% 93.00% off MS Purity 92.70% 93.20% 86.90% 89.40% Yield 137 OD / umol 127 OD / umol 152 OD / umol 153 OD / umol UV Purity 97.60% N / A yo > yu / o N / A Purification

[0631] OD recovery 79.29% N / A 79.05% N / A 10 kD UV Purity N / A 96.80% N / A 93.60% High

[0632] OD recovery N / A 88.48% N / A 91.32% MWCO TFF

[0633] 3 kD UV Purity 97.80% 97.10% 97.30% 94.40% Low

[0634] OD recovery 89.49% 90.88% 90.77% 88.82% MWCO

[0635] Weight (g) 4.2742 4.9216 3.5798 5.1688 Yield(g / mmo

[0636] 4.7 4.8 4.4 5.1 I)

[0637] UV Purity 97.70% 97.00% 97.30% 93.50% MS Purity 96.00% 94.90% 94.90% 90.00% Lyophilized

[0638] NH4+N / / A 0.53% N / / A 0.67% Water

[0639] 2.50% 1.50% 3.50% 1.90% Content

[0640] Sodium

[0641] 5.00% 4.40% 6.50% 4.70%

[0642]

[0643] Content

Claims

CLAIMS1. A method for preparing an oligonucleotide, comprising:(a) providing a solid support linked to a nucleoside monomer wherein the nucleoside monomer comprises a protected 5'-OH group;(b) deprotecting the protected 5'-OH group to provide a free 5'-OH group;(c) coupling a nucleoside phosphoramidite to the free 5'-OH group to provide a phosphite triester linked oligonucleoside, wherein the nucleoside phosphoramidite comprises a protected 5- OH group;(d) sulfurizing or oxidizing the phosphite triester linked oligonucleoside to provide a thiophosphate triester- or phosphate triester-linked oligonucleoside which comprises a protected 5'-OH group;(e) repeating step (b) through step (d) a predetermined number of times to provide a solid support-linked oligonucleotide with a protected 5’'-OH group;(f) deprotecting the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide which comprises a free 5'-OH group and thiophosphate and / or phosphate linkages;(g) cleaving the oligonucleotide of step (f) from the solid support and deprotecting nucleoside base groups to provide a crude oligonucleotide; and(h) subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) to provide a retentate solution comprising a purified oligonucleotide,wherein each sulfurizing or oxidation step of step (d) of is not followed by a capping step, and wherein the oligonucleotide is not purified by chromatography.

2. The method of claim 1, wherein the oligonucleotide is prepared at a scale of at least 500 gram, at least 1 kg, or at least 5 kg.

3. The method of claim 1 or claim 2, wherein the purified oligonucleotide in the retentate solution of step (h) has a purity of at least 85%, 90%, or 95% by HPLC (%wt / wt).

4. The method of any of claims 1 to 3, wherein the solid support linked to a nucleoside monomer of step (a) is prepared by a process comprising:(al) providing a solid support comprising a plurality of protected hydroxyl groups; (a2) deprotecting the protected hydroxyl groups of step (al) to provide free hydroxyl groups;(a3) coupling a nucleoside phosphoramidite to the free hydroxyl groups of step (a2) to provide the solid support linked to a nucleoside monomer with a phosphite triester linkage;70536(a4) sulfurizing the phosphite triester linkage of step (a3) to provide a thiophosphate triester linkage; and(aS) optionally capping unreacted free hydroxyl groups present in the reaction mixture of step (a4) with a capping reagent.

5. The method of any of claims 1 to 4, wherein step (f) comprises:(fl) deprotecting the protected 5'-OH group of step (e) to provide a solid support-linked oligonucleotide with a free 5'-OH group; and(f2) deprotecting the thiophosphate triester or phosphate triester linkages of the oligonucleotide of step (e) to provide a solid support-linked oligonucleotide with thiophosphate or phosphate linkages;wherein step (fl) can take place before or after step (f2).

6. The method of any of claims 1 to 5, wherein step (h) comprises:(hl) optionally subjecting the crude oligonucleotide of step (g) to ultrafiltration / diafiltration (UF / DF) using a membrane having a first molecular weight cut off (MWCO), to provide a permeate solution comprising the oligonucleotide; and(h2) subjecting the crude oligonucleotide of step (g) or the permeate solution of step (hl) to ultrafiltration / diafiltration (UF / DF) using a membrane having a second molecular weight cut off (MWCO), to provide a retentate solution comprising the purified oligonucleotide.

7. The method of any of claims 1 to 6, further comprising:(I) concentrating the retentate solution of step (h) to provide the purified oligonucleotide in a concentrated solution,8. The method of any of claims 1 to 7, further comprising:(j) lyophilizing the retentate solution of step (h) or the concentrated solution of step (I) to provide the purified oligonucleotide in solid form.

9. The method of any of claims 1 to 8, wherein the internucleoside linkages of the oligonucleotide comprise thiophosphate linkages and optionally phosphate linkages, wherein the number of the thiophosphate linkages is m and the number of the phosphate linkages is n, and wherein m is 2 to 50 and n is 0, 2, 3, 4, or 5.

10. The method of claim 9, wherein m is 5 to 30 and n is 1, 2, 3, 4, or 5, and wherein each oxidizing step of step (d) of is not followed by a capping step,11. The method of claim 9, wherein m is 5 to 30 and n is 0.

12. The method of any of claims 1 to 11, wherein the solid support is a universal support, 13. The method of any of claims 1 to 12, wherein the hydroxyl protecting group of each protected 5’-OH group is 4,4'-dimethoxytrityl (DMT) and wherein the phosphoramidite group of each nucleoside phosphoramidite is diisopropylcyanoethoxy phosphoramidite.

14. The method of claim 13, wherein dichloroacetic acid in toluene is used for deprotecting the protected hydroxyl groups.

15. The method of any of claims 1 to 14, wherein 4,5-dicyanoimidazole and N-methylimidazole in acetonitrile is used in each coupling step (c).

16. The method of any of claims 1 to 15, wherein xanthane hydride in pyridine is used in each step (d) comprising a sulfurizing step.

17. The method of any of claims 1 to 16, wherein aqueous ammonium hydroxide is used in step (g).

18. The method of any of claims 4 to 17, wherein the solid support linked to a nucleoside monomer of step (a) is prepared by the process as defined in claim 4, and wherein the capping agent in step (a4) comprises acetic anhydride, N-methylimidazole, and 2,6-lutidine in acetonitrile; and / or wherein the hydroxyl protecting group of each protected hydroxyl groups of the a solid support in step (al) is 4,4'-dimethoxytrityl (DMT) and optionally wherein dichloroacetic acid in toluene is used for deprotecting the protected hydroxyl groups.

19. The method of any of claims 6 to 18, wherein step (h) comprises optionally step (hl) and step (h2) as defined in claim 6, and wherein the first molecular weight cut off (MWCO) is about 10,000 Da and the second molecular weight cut off (MWCO) is about 3,000 Da.

20. The method of claim 19, wherein a basic solution is used for UF / DF of step (hl), and wherein the basic solution comprises about 500 mM to about 2500 mM cations and has a pH of about 11-14.

21. The method of claim 19 or claim 20, wherein step (h2) comprises a concentration step, a neutralization step to provide a retentate with pH of 6-8, and a diafiltration step to remove salts.

22. The method of any of claims 1 to 21, wherein the oligonucleotide comprises from about 5 to about 30 nucleotides or from about 3 to about 16 nucleotides.

23. The method of any of claims 1 to 22, wherein the oligonucleotide has a nucleobase sequence of 5'-GCAGAGGTGAAGCGAAGTGC-3' (SEQ ID NO:1) or fragments thereof.

24. The method of any of claims 1 to 23, wherein the oligonucleotide is bepirovirsen.

25. The method of any of claims 1 to 23, wherein the oligonucleotide is AHB-137.

26. An oligonucleotide obtained by the method of any of claims 1 to 25.

Images