Compositions and methods for the detection of enteroviruses

Molecular diagnostic methods and compositions for Enterovirus-D68 detection and characterization address the limitations of existing assays by enabling sensitive and specific detection, facilitating early intervention and surveillance.

WO2026112387A1PCT designated stage Publication Date: 2026-05-28TRANSLATIONAL GENOMICS RESEARCH INSTITUTE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/056493
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-22
Filing Date
2025-11-21
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

Current diagnostic methods are inadequate for distinguishing between circulating Enterovirus-D68 variants and do not provide sensitive and specific amplification-based assays for detecting and monitoring EV-D68 variants in clinical and environmental samples, limiting the understanding of their distribution and potential health risks.

Method used

Development of molecular diagnostic methods and compositions, including specific primer sets and amplification protocols, for detecting and characterizing Enterovirus-D68 variants through amplification and sequencing, with kits designed for public health surveillance and clinical diagnostics.

Benefits of technology

Enables sensitive and specific detection of Enterovirus-D68 variants, allowing for early identification and treatment of infected subjects, initiation of public health responses, and monitoring of viral circulation patterns in populations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025056493_28052026_PF_FP_ABST
    Figure US2025056493_28052026_PF_FP_ABST
Patent Text Reader

Abstract

An in vitro approach for detecting Enterovirus-D68 (EV-D68) is disclosed. In one aspect, two or more EV-D68 genomic regions are amplified with primers that each include a 5' universal tail and an EV-D68-specific sequence (SEQ ID NOs: 47-92). The tails enable indexing and sequencing of tiled amplicons to confirm EV-D68 presence and permit lineage or subclade assignment. In another aspect, a type-specific RT-qPCR assay employs a forward primer (SEQ ID NO: 95), a reverse primer (SEQ ID NO: 96), and a fluorescent probe (SEQ ID NO:97) for rapid detection. Primer sets and kits comprising the primers, probe, and optional reagents are provided for environmental, clinical, or research testing performed outside the body, including wastewater-based surveillance. The universal tails are selected to avoid sequence overlap with any target amplicon. The methods, uses, and kits support sensitive EV-D68 detection across circulating variants and facilitate scalable sequencing and public-health monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket 91482.272WO-PCTCOMPOSITIONS AND METHODS FOR THE DETECTION OF ENTEROVIRUSESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 724,248, filed November 22, 2024, to The Translational Genomics Research Institute, titled “COMPOSITIONS AND METHODS FOR THE DETECTION OF ENTEROVIRUSES,” the entirety of the disclosure of which is hereby incorporated by this reference. The entire contents of the above-identified application are hereby fully incorporated herein by reference.INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY FILED

[0002] The official copy of the sequence listing is submitted electronically in an .xml file format having the file name “272WO_PCT.xml” created on November 13, 2025, and having a size of 87,099 bytes, and is filed concurrently with the specification. The Sequence Listing is part of the specification and is herein incorporated by reference in its entirety.TECHNICAL FIELD

[0003] The present invention relates to the field of detection of enterovirus species, for example, Enterovirus-D68 (EV-D68), which has been implicated in the pathogenesis of acute flaccid myelitis (AFM).BACKGROUND

[0004] The Enterovirus genus, within the Picornaviridae family, encompasses 15 viral species (Enterovirus A-L and Rhinovirus A-C), of which seven are known to be infectious to humans (Enterovirus A-D and Rhinovirus A-C) (see, e.g., Current ICTV Taxonomy Release, [cited 4 May 2023], Available: ictv.global / taxonomy). While the prefix “entero” means “relating to the intestine”, the nearly 300 enterovirus subtypes composing the seven species infecting humans are known to be diverse in their clinical manifestations (Genus: Enterovirus, [cited 4 May 2023], Available: ictv.global / report / chapter / picomaviridae / picomaviridae / enterovirus). Poliovirus (i.e. a subtype of Enterovirus C) is the most well-known within the genus, and while vaccine availability reduced case counts in higher income countries by the 1960s, there were several hundredAttorney Docket 91482.272WO-PCT thousand cases of paralytic polio annually worldwide prior to the Global Polio Eradication Initiative in 1988 (Economic analysis of the global polio eradication initiative. Vaccine. 2010;29: 334-343). The virus commonly presents with flu-like symptoms in the case of symptomatic infection, including sore throat, fever, fatigue, nausea, headache, and stomach pain, and less frequently as paralysis (CDC. What is Polio? In: Centers for Disease Control and Prevention [Internet], 9 Jan 2023 [cited 4 May 2023], Available: www.cdc.gov / polio / what-is- polio / index.htm). Although wild poliovirus has been eliminated from the United States and most other countries, a case of acute flaccid myelitis (AFM) due to vaccine-derived poliovirus type 2 (VDPV2) was discovered in New York in July 2022. The investigation was accompanied by geographically proximal and genetically linked VDPV2-positive wastewater samples collected between May and December of 2022, underscoring the utility of wastewater for estimating duration and extent of viral shedding in a population (Link-Gelles R. Public Health Response to a Case of Paralytic Poliomyelitis in an Unvaccinated Person and Detection of Poliovirus in Wastewater — New York, June-August 2022. MMWR Morb Mortal Wkly Rep. 2022;71. doi: 10.15585 / mmwr.mm7133e2).

[0005] Aside from poliovirus, there are other clinically-relevant enteroviruses that have been associated with varying symptomologies, including substantial outbreaks of hand foot and mouth disease (e.g. coxsackievirus A6) (Osterback R, Vuorinen T, Linna M, Susi P, Hyypia T, Waris M. Coxsackievirus A6 and hand, foot, and mouth disease, Finland. Emerg Infect Dis. 2009;15: 1485-1488), neurologic disease (e.g. EV-D68, EV-A71) (Messacar K. Notes from the Field: Enterovirus A71 Neurologic Disease in Children — Colorado, 2018. MMWR Morb Mortal Wkly Rep. 2018;67. doi: 10.15585 / mmwr.mm6736a5), severe respiratory illness (e.g. EV-D68) (Midgley CM, Watson JT, Nix WA, Cums AT, Rogers SL, Brown BA, et al. Severe respiratory illness associated with a nationwide outbreak of Enterovirus-D68 in the USA (2014): a descriptive epidemiological investigation. Lancet Respir Med. 2015;3: 879-887; Shah MM. Enterovirus-D68-Associated Acute Respiratory Illness — New Vaccine Surveillance Network, United States, July-November 2018-2020. MMWR Morb Mortal Wkly Rep. 2021;70. doi: 10.15585 / mmwr.mm7047al), and acute hemorrhagic conjunctivitis (e.g. coxsackievirus A24) (Epidemiologic Notes and Reports Acute Hemorrhagic Conjunctivitis Caused by Coxsackievirus A24 — Caribbean. 1 May 1987 [citedAttorney Docket 91482.272WO-PCT4 May 2023], Available: www.cdc.gov / mmwr / preview / mmwrhtml / 00000909.htm). Of these, EV-D68 has arguably been the most clinically important enterovirus within the United States over the past decade, first identified in 1962, and linked to a series of pediatric clusters of AFM in 2014 (Midgley CM, Jackson MA, Selvarangan R, Turabelidze G, Obringer E, Johnson D, et al. Severe respiratory illness associated with Enterovirus-D68 - Missouri and Illinois, 2014. MMWR Morb Mortal Wkly Rep. 2014;63: 798-799). Since August of 2014, there have been 729 confirmed cases of AFM (CDC. AFM Cases and Outbreaks. In: Centers for Disease Control and Prevention [Internet], 6 Jul 2023 [cited 13 Jul 2023], Available: www.cdc.gov / acute-flaccid-myelitis / cases-in-us.html), spiking in 2014, 2016, and 2018, thought to have been caused by EV-D68 (CDC. Causes of AFM. In: Centers for Disease Control and Prevention [Internet], 2 Nov 2022 [cited 13 Jul 2023], Available: www.cdc.gov / acute-flaccid-myelitis / causes.html). Although the biennial pattern observed in previous years indicated that AFM cases should have spiked in 2020 and 2022, seasonality of several respiratory viruses was disrupted during initial years of the COVID-19 pandemic (Wang L, Davis PB, Berger NA, Kaelber DC, Volkow ND, Xu R. Disruption in seasonality, patient characteristics and disparities of respiratory syncytial virus infection among young children in the US during and before the COVID-19 pandemic: 2010-2022. medRxiv. 2022. p. 2022.11.29.22282887. doi: 10.1101 / 2022.11.29.22282887; Olsen SJ. Changes in Influenza and Other Respiratory Virus Activity During the COVID-19 Pandemic — United States, 2020- 2021. MMWR Morb Mortal Wkly Rep. 2021;70. doi: 10.15585 / mmwr.mm7029al).

[0006] Most enteroviruses circulate undetected due to a predominance of asymptomatic or mildly symptomatic infections and are only further investigated as a reactive response to syndromic surveillance, or as part of a disease outbreak response. In rare cases, enterovirus infection with some subtypes can result in paralysis or death. Of the 300 subtypes known, only poliovirus is reportable, limiting the understanding of the distribution of other enteroviruses that can cause clinical disease. Current diagnostic methods may not distinguish between circulating variants or subclades. There is a need for sensitive and specific amplification-based assays to detect, classify, and monitor EV-D68 variants in both clinical and environmental samples.Attorney Docket 91482.272WO-PCT

[0007] Citation or identification of any document in this application is not an admission that such a document is available as prior art to the present invention.SUMMARY

[0008] In certain example embodiments, the present invention relates to molecular diagnostic methods and compositions for detecting and characterizing Enterovirus-D68 (EV- D68), including specific primer sets, amplification and sequencing protocols, and diagnostic kits useful for public health surveillance and clinical diagnostics.

[0009] In one aspect, the present invention provides for a method of detecting the presence of one or more Enterovirus-D68 variants in a sample comprising a) producing one or more amplicons by amplifying one or more nucleic acid segments from the sample using at least one forward primer comprising a first 5’ universal tail sequence and an Enterovirus-D68 specific sequence selected from the group consisting of SEQ ID NOS: 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, and 91, and at least one reverse primer comprising a second 5’ universal tail sequence and an Enterovirus-D68 specific sequence selected from the group consisting of SEQ ID NOS: 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, and 92; and b) sequencing the one or more amplicons to detect the presence of the one or more Enterovirus-D68 variants, wherein each universal tail sequence does not overlap in sequence with any of the one or more amplicons. In certain embodiments, the method further comprises classifying the one or more Enterovirus-D68 variants into a lineage, subclade, or strain based on phylogenetic analysis of the amplified sequences.

[0010] In certain embodiments, the one or more Enterovirus-D68 variants are detected before any symptomatic subjects are identified at the location where the sample was collected. In certain embodiments, the sample is obtained from a human subject. In certain embodiments, if an Enterovirus-D68 variant is detected in the sample the subject is treated with an antiviral treatment. In certain embodiments, the sample comprises an environmental sample. In certain embodiments, the environmental sample is wastewater. In certain embodiments, if one or more Enterovirus-D68 variants is detected in the sample a public health response is initiated.Attorney Docket 91482.272WO-PCT

[0011] In certain embodiments, the Enterovirus-D68 specific sequences of the forward and reverse primers consist of SEQ ID NOS: 47-92. In certain embodiments, the forward and reverse primers consist of SEQ ID NOS: 1-46.

[0012] In another aspect, the present invention provides for a method of detecting the presence of Enterovirus-D68 in a sample comprising a) performing real-time polymerase chain reaction (PCR) to amplify nucleic acid segments from the sample, wherein the amplifying step includes using a forward primer consisting of TMCATGGCTCTCCAGGAACT, wherein M is either A or C, a reverse primer consisting of CTTAGGGTCTGGGGGCARGG, wherein R is either A or G, and a fluorescently labeled probe consisting of TGGCCTCAAATTTAATTGCCAGGGC; and b) detecting the presence of Enterovirus-D68 in the sample by comparing the amplification results to a control value.

[0013] In certain embodiments, the Enterovirus-D68 is detected before any symptomatic subjects are identified at the location where the sample was collected. In certain embodiments, the sample is obtained from a human subject. In certain embodiments, if Enterovirus-D68 is detected in the sample the subject is treated with an antiviral treatment. In certain embodiments, the sample comprises an environmental sample. In certain embodiments, the environmental sample is wastewater. In certain embodiments, if Enterovirus-D68 is detected in the sample a public health response is initiated.

[0014] In another aspect, the present invention provides for a kit for amplifying and sequencing Enterovirus-D68 variants comprising one or more forward and reverse primers, wherein the one or more forward primers comprise a first 5’ universal tail sequence and an Enterovirus-D68 specific sequence selected from the group consisting of SEQ ID NOS: 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, and 91, and the one or more reverse primers comprise a second 5’ universal tail sequence and an Enterovirus-D68 specific sequence selected from the group consisting of SEQ ID NOS: 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, and 92, wherein each universal tail sequence does not overlap in sequence with any target of the one or more forward and reverse primers. In certain embodiments, the Enterovirus-D68 specific sequences of the forward and reverse primers consist of SEQ ID NOS: 47-92. In certain embodiments, the forward andAttorney Docket 91482.272WO-PCT reverse primers consist of SEQ ID NOS: 1-46. In certain embodiments, the kit further comprises a nucleotide polymerase, buffer, diluent, and / or excipient.

[0015] In another aspect, the present invention provides for a kit for detecting Enterovirus- D68 comprising a forward primer consisting of TMC ATGGCTCTCCAGGAACT, wherein M is either A or C, a reverse primer consisting of CTTAGGGTCTGGGGGCARGG, wherein R is either A or G, and a fluorescently labeled probe consisting of TGGCCTCAAATTTAATTGCCAGGGC. In certain embodiments, the kit further comprises a nucleotide polymerase, buffer, diluent, and / or excipient.

[0016] These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those having ordinary skill in the art upon consideration of the following detailed description of example embodiments.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0018] An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, and the accompanying drawings of which:

[0019] FIG. 1 - shows a ddPCR Amplitude plot (y-axis) of 2C Region assay on BEI Resources (NR-52357) EV-D68 isolate cDNA in 10-fold serial dilution (x-axis) from Direct Quantification Experiment on a BioRad QX200 AutoDG Droplet Digital PCR System. The threshold (solid line) separates positive droplets from negative droplets. The Reverse- Transcription No Template Control (A01) and the ddPCR No Template Control (H01) have 100% negative droplets. The No Template Control wells were used to threshold all wells to normalize positive droplets. The dilutions 1 : 100 (B01), 1 : 1,000 (C01), 1 : 10,000 (D01), 1 : 100,000 (E01), and 1 : 1,000,000 (F01) all contained positive droplets. The 1 : 10,000,000 dilution in the series did not contain positive droplets, therefore, it was too dilute for the assay to detect the EV-D68 control. Final concentrations were back-calculated across each dilution and an average concentration was determined (see FIG. 2).Attorney Docket 91482.272WO-PCT

[0020] FIG. 2 - shows ddPCR summary results from the 2C Region assay for each BEI Resources (NR-52357) EV-D68 Isolate cDNA dilution, including Reverse Transcription (RT) and ddPCR No Template Controls (NTC) from Direct Quantification Experiment on a BioRad QX200 AutoDG Droplet Digital PCR System. Each sample had greater than 10,000 droplets generated and both NTCs contained zero positive droplets. Manual thresholding was performed on all dilutions with the use of the NTC amplitudes of both NTCs present on the run, the final threshold was 617.56. All dilutions of the EV-D68 Isolate cDNA dilution had positive droplets in the reactions, however, the 1 : 10,000,000 dilution had zero positive droplets. The 1 : 10,000,000 dilution was too dilute for ddPCR quantification and detection. Dilutions with too few or too many positive droplets were omitted from the average concentration calculation (see FIG 3).

[0021] FIG. 3 - shows ddPCR concentrations in copies / pL (y-axis) of 2C Region assay on BEI Resources (NR-52357) EV-D68 isolate cDNA in 10-fold serial dilution (x-axis) from Direct Quantification Experiment on a BioRad QX200 AutoDG Droplet Digital PCR System. Concentrations for each sample are not back-calculated to the original stock concentration. The Reverse-Transcription No Template Control (A01) and the ddPCRNo Template Control (H01) had a concentration of 0 copies / pL, which reflects the 0 positive droplets observed in FIG. 2. The 1 : 100 (B01), 1 : 1,000 (C01), 1 : 10,000 (D01), 1 : 100,000 (E01), and 1 : 1,000,000 (F01) all have a concentration in 10-fold differences from one another. Since the 1 :10,000,000 dilution did not contain positive droplets (see FIG. 2), therefore its concentration was determined to be 0 copies / pL. The 1 : 100 dilution has very large error bars around its calculated concentration, this is due to the low number of negative droplets, resulting in lower confidence in the poisson algorithm’s concentration estimation of EV-D68 at this dilution.

[0022] FIG. 4 - shows the percent positivity at the Medical Center between June and October 2022 compared to EV-D68 viral load in two city wastewater treatment plants. FIG. 4 shows the viral load that was assessed with the D68-Detect assay. Dotted vertical lines indicate the 1st of each month.

[0023] FIG. 5 - shows Enterovirus subspecies that had at least 1% of the total reads classified as that subspecies are shown in this plot. Samples were sorted by Location Type andAttorney Docket 91482.272WO-PCTCollection Date. Columns showing only black bars indicate samples where no sequencing reads were produced, and white indicates uncharacterized reads.

[0024] FIG. 6A-6D -shows EV-D68 viral loads in City of Flagstaff WWTPs and Tempe Biointel Sampling Basins between July and October 2022. Viral load in both cities was assessed using two different RT-qPCR assays: CDC2022 (FIG. 6A) and D68-Detect (FIG. 6B) with City of Flagstaff in teal and City of Tempe in purple. Assay comparisons for each city can be seen in FIG. 6C (Flagstaff) and FIG. 6D (Tempe) with CDC2022 in gray and D68- Detect in orange. A trend line was fitted to each set of data points on each plot coupled with a 99% confidence interval around each trend line. Data points in red boxes represent true zeros in viral load detection that were removed from the trend lines and confidence intervals then reintroduced into the plots.

[0025] FIG. 7A-7C - shows the genome coverage using the newly developed tiled amplicon design. The number of sequencing reads, displayed on the y-axis (log-scale), across all positions of each genome are shown: FIG. 7A NR-49135 (accession MH708882), FIG. 7B NR-52357 (accession MN246009), and FIG. 7C NR-55939.

[0026] FIG. 8 - shows the percent identity matrix between three EV-D68 positive controls and contemporary reference genome using the newly developed tiled amplicon sequencing panel. NR49135 (Isolated 2014, Subclade Bl), NR52357 (Isolated 2018, Subclade B3), NR55939 (Isolated 2020, Subclade D), and the reference genome OP267522.1 were used to develop the tiled amplicon sequencing scheme (Isolated 2021, Subclade B3). The contemporary reference genome and PTCs used represent three different subclades (D, B 1, B3) and percent identity between any of these genomes ranged between 85.03-95.87%.

[0027] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTSGeneral Definitions

[0028] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2ndedition (1989) (Sambrook, Fritsch, andAttorney Docket 91482.272WO-PCTManiatis); Molecular Cloning: A Laboratory Manual, 4thedition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (FM. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M.J. MacPherson, B.D. Hames, and G.R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2ndedition 2013 (E.A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton etal., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2ndedition (2011).

[0029] It is to be understood that unless specifically stated otherwise, references to “a,” “an,” and / or “the” may include one or more than one and that reference to an item in the singular may also include the item in the plural. Reference to an element by the indefinite article "a," "an" and / or “the” does not exclude the possibility that more than one of the elements are present, unless the context clearly requires that there is one and only one of the elements. As used herein, the term “comprise,” and conjugations or any other variation thereof, are used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.

[0030] The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0031] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0032] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less,Attorney Docket 91482.272WO-PCT+ / -5% or less, + / -1% or less, and + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.

[0033] As used herein, “amplification reaction” refers to a method of detecting target nucleic acid by in vitro amplification of DNA or RNA.

[0034] As used herein, “polymerase chain reaction (PCR)” refers to the amplification of a specific DNA sequence, termed target or template sequence, that is present in a mixture, by adding two or more short oligonucleotides, also called primers, that are specific for the terminal or outer limits of the template sequence. The template-primers mixture is subjected to repeated cycles of heating to separate (melt) the double-stranded DNA and cooling in the presence of nucleotides and DNA polymerase such that the template sequence is copied at each cycle.

[0035] The term “primer” refers to DNA oligonucleotides complementary to a region of DNA and serves as the initiation of amplification reaction from the 5' to 3' direction.

[0036] The term “primer pair” refers to the forward and reverse primers in an amplification reaction leading to amplification of a double-stranded DNA region of the target.

[0037] The term “target” refers to a nucleic acid region bound by a primer pair that is amplified through an amplification reaction. The PCR “product” or “amplicon” is the amplified nucleic acid resulting from PCR of a set of primer pairs. The term “amplicon” refers to a nucleic acid fragment generated by amplification of a target sequence, such as by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), or another nucleic acid amplification technique.

[0038] The term “multiplex amplification reaction” herein refers to the detection of more than one template in a mixture by the addition of more than one set of oligonucleotide primers.

[0039] “Amplification” is a special case of nucleic acid replication involving template specificity. Amplification may be a template-specific replication or a non-template-specific replication (i.e., replication may be specific template-dependent or not). Template specificity is here distinguished from fidelity of replication (synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that theyAttorney Docket 91482.272WO-PCT are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out. The amplification process may result in the production of one or more amplicons.

[0040] The term “template” refers to nucleic acid originating from a sample that is analyzed for the presence of one or more markers. In contrast, “background template” or “control” is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is most often inadvertent. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified out of the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.

[0041] In addition to primers and probes, template specificity is also achieved in some amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under the conditions in which they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. Other nucleic acid sequences will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al. (1970) Nature (228):227). In the case of T4 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (Wu and Wallace (1989) Genomics (4): 560). Finally, Taq and Pfu polymerases, by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.) (1989) PCR Technology, Stockton Press).

[0042] The term “amplifiable nucleic acid” refers to nucleic acids that may be amplified by any amplification method. It is contemplated that “amplifiable nucleic acid” will usually comprise “sample template.” The terms “PCR product,” “PCR fragment,” “amplification product,” and “amplicon” refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.Attorney Docket 91482.272WO-PCT

[0043] The term “sample” refers to any biological or environmental material that may contain nucleic acids derived from an enterovirus (e.g., EV-D68). Examples of biological samples include nasal or throat swabs, nasopharyngeal aspirates, sputum, stool, blood, or cerebrospinal fluid obtained from a subject. Environmental samples include wastewater, surface water, air filters, or materials collected from public or clinical facilities.

[0044] The present invention encompasses embodiments wherein a sample is a biological sample. As used herein, a “biological sample” may contain whole cells and / or live cells and / or cell debris. The biological sample may contain (or be derived from) a “bodily fluid”. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.

[0045] The present invention encompasses embodiments wherein a sample is an environmental sample. Non-limiting examples of an environmental sample include wastewater, air, soil, water from aircraft lavatories, water from schools, water from nursing or assisted living homes, and environmental samples in poultry areas.

[0046] In examples embodiments, the term “location” refers to the place where a sample is collected and may include, without limitation, a specific address or facility (e.g., school, hospital, restaurant, hotel), a municipality or district (e.g., town or city such as Flagstaff or Tempe), a county, state, or province (e.g., Arizona), a region or country, and geographic coordinates (e.g., GPS latitude and longitude).

[0047] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues,Attorney Docket 91482.272WO-PCT cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0048] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment s). Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.

[0049] Reference is made to Erickson DE, Simmons KM, Barrand ZA, Ridenour CL, Hawkinson PB, Lemke L, Sellner SP, Brock BN, Rivas AN, Sheridan K, Lemmer D, Yaglom HD, Porter WT, Belanger M, Torrey RM, Stills AJR, McCormack K, Black M, Holmes W, Rostain D, Mikus J, Sotelo K, Haq E, Neupane R, Weiss J, Johnson J, Collins C, Avalle S, White C, Howard BJ, Maltinsky SA, Whealy RN, Gordon NB, Sahl JW, Pearson T, Fofanov VY, Furstenau T, Driebe EM, Caporaso JG, Barber J, Terriquez J, Engelthaler DM, Hepp CM. Pan-Enterovirus Characterization Reveals Cryptic Circulation of Clinically Relevant Subtypes in Arizona Wastewater. medRxiv [Preprint], 2024 Mar 20:2023.11.20.23297677. doi: 10.1101 / 2023.11.20.23297677. PMID: 38562876; PMCID: PMC10984038.

[0050] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication,Attorney Docket 91482.272WO-PCT published patent document, or patent application was specifically and individually indicated as being incorporated by reference.OVERVIEW

[0051] Embodiments disclosed herein provide methods of detecting the EV-D68 subtype of the enterovirus species within a sample. Methods are provided for detecting one or more EV-D68 variants using multiplexed amplification and sequencing of specific genomic regions. Primers include universal tail sequences for downstream sequencing compatibility. Methods also include real-time PCR detection using specific primer / probe combinations. Kits are provided for use in both research and clinical / public health applications.

[0052] The present disclosure demonstrates the utility of viral pan-assay approaches in detecting Enterovirus-D68 (EV-D68). Presented here are the efforts to deploy a panenterovirus assay coupled with next generation sequencing, and a novel use of the QIIME2 bioinformatics platform (Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al- Ghalith GA, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37: 852-857) for the purposes of viral discovery and classification followed by near-whole viral genome sequencing of EV-D68.

[0053] Applicants initiated EV-D68 wastewater-based surveillance in November of 2021 with a now-deprecated RT-qPCR assay that Applicants had originally designed for routine use. This initial assay never detected EV-D68 in human or wastewater samples but was more sensitive than the CDC2015 assay when used on controls dated 2018 and earlier. In summer of 2022, Applicants became interested in more broadly characterizing enterovirus circulation in Arizona, prompting the use of a pan-enterovirus amplicon assay followed by sequencing, reference database development, and the novel application of QIIME2 (Bolyen, Nat Biotechnol, 2019) for enterovirus characterization. The assay was applied to human nasal and wastewater samples collected from April through October of 2022 and given the increased mixing of individuals at this time in the COVID-19 pandemic, Applicants expected seasonal circulation of several clinically relevant enteroviruses. Of the QIIME2 classified sequencing reads, CV-A6 was most abundant across location types, and was found in samples collected during April-October of 2022. CV-A6 is a more recently identified cause of hand, foot, andAttorney Docket 91482.272WO-PCT mouth disease and is generally thought to emerge in the late summer to early fall (Osterback, Emerg Infect Dis, 2009). Similarly, CV-A19, most commonly associated with gastroenteritis and herpangina (i.e. mouth blisters), was detected during April-October of 2022. CV-A4, another enterovirus frequently associated with hand, foot, and mouth disease, was found sporadically in the larger community samples collected from the cities of Flagstaff and Tempe from June through September. The lack of CV-A4 in congregate living sites of Flagstaff may be associated with the younger age range of the population, generally spanning from 18 to 25 years. Surprisingly, Applicants also detected EV-D68 with the pan-enterovirus assay, first just as a one-time low-level hit in June of 2022, but frequently from August to mid-October in both the cities of Flagstaff and Tempe. Applicants determined that detections using the panenterovirus versus previous RT-qPCR assays can be attributed to mutations accumulated in primer binding sites during 2018-2022.

[0054] Given the discovery of cryptic EV-D68 circulation using the pan-enterovirus assay, Applicants retested all human and wastewater samples from June-October of 2022 using both the CDC2022 and newly developed D68-Detect assays. While Applicants did not detect EV- D68 in human nasal samples, both assays detected the virus in the wastewater from Tempe and Flagstaff, Arizona in early August 2022. Viral load peaked the last week of August and subsided in mid to late October. Trends found in this study are in alignment with expectations of EV-D68 seasonality observed in even years within the United States (FIG. 1), and align with human clinical case trends reported for Phoenix (Iverson SA, Ostdiek S, Prasai S, Engelthaler DM, Kretschmer M, Fowle N, et al. Notes from the Field: Cluster of Acute Flaccid Myelitis in Five Pediatric Patients - Maricopa County, Arizona, 2016. MMWR Morb Mortal Wkly Rep. 2017;66: 758-760; Bowers JR, Valentine M, Harrison V, Fofanov VY, Gillece J, Delisle J, et al. Genomic Analyses of Acute Flaccid Myelitis Cases among a Cluster in Arizona Provide Further Evidence of Enterovirus-D68 Role. MBio. 2019; 10. doi: 10.1128 / mBio.02262- 18), Kansas City, MO (Gummersheimer S, Hayes A, Harrison C, Lee B, Schuster J, Dhar M, Sasidharan A, Baneijee D, Selvarangan R. Prevalence and clinical presentation of EV-D68 infections in Kansas City children during the 2022 season. Diagn Microbiol Infect Dis. 2023 Sep; 107(1): 115992), and the state of Maryland (Fall A, Han L, Abdullah O, Norton JM, Eldesouki RE, Forman M, Morris CP, Klein E, Mostafa HH. An increase in Enterovirus-D68Attorney Docket 91482.272WO-PCT circulation and viral evolution during a period of increased influenza like illness, The Johns Hopkins Health System, USA, 2022. J Clin Virol. 2023 Mar;160: 105379). An additional effort surveyed for EV-D68 in San Jose and Oceanside, C A wastewater, and similarly found evidence of circulation from July 2022 into December 2022, with wastewater viral load trends correlating with counts of human EV-D68 cases in nearby counties (Boehm AB, Wadford DA, Hughes B, Duong D, Chen A, Padilla T, et al. Trends of Enterovirus-D68 Concentrations in Wastewater, California, USA, February 2021-April 2023 - Volume 29, Number 11 — November 2023 - Emerging Infectious Diseases journal - CDC. [cited 24 Oct 2023], doi: 10.3201 / eid2911.231080). The detection of EV-D68 in both California and Arizona wastewater sewersheds in the latter half of 2022 indicates that even in years when AFM caseloads are low, wastewater-based surveillance can provide an estimate of risk.

[0055] The Arizona Department of Health Services reported one case of AFM within the state, occurring in August of 2022 (personal communication and CDC, MMWR, 2023). However, EV-D68 was not detected in cerebrospinal fluid, stool, serum, or nasopharyngeal samples (NP) collected from the patient and tested with RT-qPCR (all samples) or culture (stool). This is not particularly surprising given that in 2018, 2019, and 2020, entero- or rhinoviral RNA was only detected in 50%, 37%, and 26% of AFM cases, respectively, across the United States (Kidd S, Yee E, English R, Rogers S, Emery B, Getachew H, et al. National Surveillance for Acute Flaccid Myelitis - United States, 2018-2020. MMWR Morb Mortal Wkly Rep. 2021;70: 1534-1538). Additionally, members of the study team previously found EV-D68 RNA in four of six NP swabs and none of the eleven CSF samples collected from suspect AFM cases in a 2016 Phoenix, AZ pediatric cluster (Bowers, MBio, 2019). EV-D68 is not a notifiable disease unless AFM is reported and associated samples are also EV-D68 positive. Otherwise, most clinical systems test for the presence of all enteroviruses and rhinoviruses, and Applicants’ have shown here that a diverse distribution exists at any given time (FIG. 2). This effort demonstrates the utility of wastewater surveillance for the identification of EV-D68 in a population, even in the absence of AFM cases, and explains the increase of enteroviruses and rhinoviruses in the clinical setting (FIG. 4). While the timelines between the EV-D68 wastewater signal and AFM case do coincide, the single patient with AFM in Arizona may have been infected with a different virus that can cause AFM (e.g.Attorney Docket 91482.272WO-PCT flaviviruses, adenoviruses, herpesviruses, and other enteroviruses) (CDC, MMWR, 2022). Another possibility is that clearance of EV-D68 viral particles by neutralizing antibodies may have occurred prior to tests being conducted (Fang X, Huda R. Acute Flaccid Myelitis: Current Status and Diagnostic Challenges. J Clin Neurol. 2020; 16: 376-382). The analyses in this study indicate that wastewater-based epidemiology can be a complementary tool to further inform population-level situational awareness to public health agencies and clinicians regarding the presence of EV-D68.

[0056] To better understand how EV-D68 genomes from Arizona are related to globally sampled counterparts, Applicants designed a new EV-D68 tiled amplicon sequencing panel using a B3 subclade reference genome. As expected, breadth of coverage was highest for the B3 subclade positive control (-98%) but was still approximately 86% for the subclade D positive control (FIG. 8), indicating that this primer scheme should be effective for amplifying across the distribution of EV-D68 when given enough space on a sequencing run. Applicants built a maximum likelihood phylogeny using 31 Arizona genomes sequenced as part of this effort and 934 publicly available genomes. Twenty-nine of the Arizona genomes clustered monophyletically within genomes from Maryland, USA, which were the only other United States-based genomes sequenced in summer and fall of 2022 at the time of submission. The monophyletic cluster indicates a single primary entrance of EV-D68 into Arizona which then circulated throughout the northern and central parts of the state. Given the limited representation of EV-D68 genomes from the United States, it is highly likely that there were many intermediary locations between Maryland and Arizona, rather than a direct link between the two states. Additional sequencing of clinical and wastewater samples from other locations may reveal common trends of EV-D68 dispersal each year, for example, from the eastern to western coasts of the United States. Applicant’s hope is that the new EV-D68 tiled amplicon sequencing panel can facilitate additional sequencing efforts.

[0057] Applicant’s understanding of communicable disease circulation is based primarily on those cases that are reported to public health agencies, information gleaned from syndromic surveillance, and administrative hospital discharge databases. Yet in just the past few years, there have been nationwide and global instances of morbidity and mortality due to non- reportable pathogens known to seasonally circulate, e.g. multiple adenoviruses and adeno-Attorney Docket 91482.272WO-PCT associated virus (Servellita V, Sotomayor Gonzalez A, Lamson DM, Foresythe A, Huh HJ, Bazinet AL, et al. Adeno-associated virus type 2 in US children with acute severe hepatitis. Nature. 2023;617: 574-580), EV-D68 (Midgley CM, Watson JT, Nix WA, Curns AT, Rogers SL, Brown BA, et al. Severe respiratory illness associated with a nationwide outbreak of Enterovirus-D68 in the USA (2014): a descriptive epidemiological investigation. Lancet Respir Med. 2015;3: 879-887; Fall A, Kenmoe S, Ebogo-Belobo JT, Mbaga DS, Bowo-Ngandji A, Foe-Essomba JR, et al. Global prevalence and case fatality rate of Enterovirus-D68 infections, a systematic review and meta-analysis. PLoS Negl Trop Dis. 2022; 16: e0010073; Ma KC. Increase in Acute Respiratory Illnesses Among Children and Adolescents Associated with Rhinoviruses and Enteroviruses, Including Enterovirus-D68 — United States, July-September 2022. MMWR Morb Mortal Wkly Rep. 2022;71). Wastewater testing as an early warning system for viral outbreaks has been suggested by several teams, starting in the early 1940’s (Melnick JL. Poliomyelitis virus in urban sewage in epidemic and in nonepidemic times. Am J Hyg. 1947;45: 240-253), but very purposefully implemented during the ongoing COVID-19 pandemic. The efforts here have demonstrated another use case for wastewater-based epidemiology, as EV-D68 can be routinely screened for and sequenced from wastewater samples. Furthermore, although far fewer AFM cases presented in 2022 than in comparably higher years, RT-qPCR assays deployed in this study and others (Rognes T, Flouri T, Nichols B, Quince C, Mahe F. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016;4: e2584; Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011; 17: 10-12; Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13: 581-583; Colman RE, Anderson J, Lemmer D, Lehmkuhl E, Georghiou SB, Heaton H, et al. Rapid Drug Susceptibility Testing of Drug- Resistant Mycobacterium tuberculosis Isolates Directly from Clinical Samples by Use of Amplicon Sequencing: a Proof-of-Concept Study. J Clin Microbiol. 2016;54: 2058-2067; Bowers JR, Lemmer D, Sahl JW, Pearson T, Driebe EM, Wojack B, et al. KlebSeq, a Diagnostic Tool for Surveillance, Detection, and Monitoring of Klebsiella pneumoniae. J Clin Microbiol. 2016;54: 2582-2596) still detected shedding in wastewater. Applicants expect that during larger outbreak years (e.g. 2014, 2016, and 2018), there would be substantially moreAttorney Docket 91482.272WO-PCT shedding of EV-D68 into wastewater, and that these approaches will be useful for outbreak monitoring in the absence of EV-D68-specific clinical testing. This research supports the importance of continued wastewater-based surveillance in some key locations over the longterm, to learn more about the magnitude of EV-D68 viral loads and the association with AFM cases in peak years.

[0058] Much of the response to infectious disease threats is reactive, even in the case of seasonally circulating viruses. Wastewater-based epidemiology has been successfully used for mitigation purposes throughout the SARS-CoV-2 pandemic and has potential to be implemented for other pathogens that can cause severe infections. While vaccines and treatment beyond supportive care are not available for many infections, this method of surveillance can provide situational awareness to public health agencies, medical professionals, and the general population, possibly paving the way for earlier public health response.

[0059] The foregoing features and elements may be combined in various combinations without exclusivity, unless expressly indicated otherwise. These features and elements as well as the operation thereof will become more apparent in light of the following description. It should be understood, however, the following description is intended to be exemplary in nature and non-limiting.METHODS OF DETECTING ENTERO VIRUS-D68

[0060] The present invention provides compositions and methods for the detection and characterization of Enterovirus-D68 (EV-D68) in a biological or environmental sample. EV- D68 is a member of the Enterovirus D species within the Picornaviridae family. The virus has been associated with respiratory disease and neurological complications such as acute flaccid myelitis. Detection and differentiation of EV-D68 variants are critical for outbreak tracking and early intervention, particularly given the periodic emergence of novel strains with altered pathogenicity or transmission characteristics. The methods described herein are capable of detecting and classifying EV-D68 variants directly from patient samples or environmental sources such as wastewater. In particular, the invention relates to primer and probe sets designed to specifically amplify and / or detect genomic regions of EV-D68 with high sensitivity and specificity. The disclosed methods include amplification followed by sequencing of targeted genomic regions to identify and classify EV-D68 variants, as well as real-time PCRAttorney Docket 91482.272WO-PCT methods for rapid detection. Kits comprising the disclosed primers and reagents are also provided for use in clinical diagnostics, research, and public health surveillance.

[0061] As used herein, the term “Enterovirus-D68 (EV-D68)” refers to any virus belonging to the Enterovirus D species of the Picornaviridae family that shares substantial sequence identity with reference EV-D68 strains, including all known and newly identified variants, clades, subclades, and strains.

[0062] The term “variant” refers to a genetically distinct form of EV-D68 differing from a reference strain by at least one nucleotide substitution, insertion, or deletion in a genomic region targeted by the primers or probes disclosed herein. Variants may include but are not limited to known clades or subclades.

[0063] The terms “lineage,” “subclade,” and “strain” refer to classifications of EV-D68 based on phylogenetic analysis of genomic sequences, reflecting evolutionary divergence among circulating viral populations.

[0064] The term “phylogenetic analysis” refers to computational or statistical comparison of nucleotide or amino acid sequences to infer evolutionary relationships among EV-D68 variants. Such analyses may classify sequences into clades, subclades, or strains based on nucleotide similarity, branching patterns, or genetic distance. In example embodiments, phylogenetic analysis of the amplified sequences is performed to classify detected variants into a lineage, subclade, or strain. Classification may be carried out using reference sequence databases and computational methods such as maximum likelihood or Bayesian inference.

[0065] In some embodiments, the present invention comprises a method of detecting the presence of Enterovirus-D68 in a sample comprising the steps of producing one or more amplicons by amplifying one or more nucleic acid segments from the sample using (a) at least one forward primer comprising a sequence selected from the group consisting of SEQ ID NOS: 1-23, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, and 91; and (b) at least one reverse primer comprising a sequence selected from the group consisting of SEQ ID NOS: 24-46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, and 92; and sequencing the one or more amplicons to detect the presence of Enterovirus-D68. In some embodiments the primers include a tail sequence, such as SEQ ID NOS: 93 and 94.Attorney Docket 91482.272WO-PCT

[0066] A “universal tail sequence” refers to a sequence of nucleotides added to the 5' end of a primer that does not hybridize to the target nucleic acid. The universal tail allows for secondary amplification, barcoding, or sequencing adapter attachment. Each universal tail sequence is designed such that it does not overlap with any part of the EV-D68 amplicons generated by the primer pairs.

[0067] A “specific sequence” is the portion of a primer that hybridizes to a complementary region of the EV-D68 genome and directs amplification of that region.

[0068] The term “non-overlapping sequence” means that a universal tail or other primer sequence shares no contiguous identical nucleotide region with any segment of the amplified target region or its complement, ensuring specificity and reducing primer-dimer formation.

[0069] In some embodiments, the present invention comprises a method of detecting the presence of Enterovirus-D68 in a sample comprising (a) performing real-time polymerase chain reaction (PCR) to amplify nucleic acid segments from the sample, wherein the amplifying step includes using a forward primer consisting of SEQ ID NO: 95, a reverse primer consisting of SEQ ID NO: 96, and a fluorescently labeled probe consisting of consisting of SEQ ID NO: 97; and (b) detecting the presence of Enterovirus-D68 in the sample by comparing the amplification results to a control value. Amplification is carried out under conditions suitable for detecting fluorescence associated with accumulation of the target amplicon. The presence of EV-D68 in the sample is determined by comparing the amplification results to a control value. The assay may be conducted as a one-step RT-qPCR if the sample contains RNA.

[0070] Detection according to some embodiments of the disclosure may comprise contacting the amplified nucleic acid with a probe; and detecting the hybridization of probe with the amplified nucleic acid. Detection may be performed by a variety of methods, such as but not limited to, by a nucleic acid amplification reaction. In some embodiments the amplification reaction maybe an end-point determination or the amplification reaction maybe quantitative. The quantification may be a real-time PCR method. In some embodiments, the real-time PCR may be a SYBR® Green Assay or a TAQMAN® Assay. Detection, in various embodiments, maybe performed by hybridization using probes specific to target sequences. According to various embodiments, combinations of amplification and hybridization may be used for detection.Attorney Docket 91482.272WO-PCT

[0071] As used herein, “real-time PCR” may refer to the detection and quantitation of a DNA or a surrogate thereof in a sample. The term “real-time PCR” (also referred to as quantitative PCR or qPCR) also encompasses a polymerase chain reaction method in which amplification of a target nucleic acid is monitored as it occurs using a fluorescent signal that correlates with the accumulation of the amplified product. In some embodiments, the amplified segment or “amplicon” can be detected in real time using a 5 '-nuclease assay, particularly the TaqMan® assay as described by e.g., Holland et al. (Proc. Natl. Acad. Sci. USA 88:7276-7280, 1991); and Heid et al. (Genome Research 6:986-994, 1996). For use herein, a TaqMan® nucleotide sequence to which a TaqMan® probe binds can be designed into the primer portion or known to be present in DNA of a sample. In some embodiments, the PCR methods use endpoint PCR and a positive result is obtained when there is a detectable signal after the PCR is finished. Real-time and end-point PCR methods useful in accordance with the present methods and compositions include, but are not limited to, fluorescence resonance energy transfer (FRET), TAQMAN®, Molecular Beacons, Amplifluor®, Scorpion™, Plexor™, BHQplus™.

[0072] A “fluorescently labeled probe” is an oligonucleotide that hybridizes to a target sequence and carries a fluorophore and quencher. During amplification, the fluorophore emits a detectable signal upon separation from the quencher, indicating the presence of the target sequence. Detection method embodiments using a TaqMan® probe sequence comprise combining the test sample with PCR reagents, including a primer set having a forward primer and a reverse primer, a DNA polymerase, and a fluorescent detector oligonucleotide TaqMan® probe, as well as dNTP's and a salt, to form an amplification reaction mixture; subjecting the amplification reaction mixture to successive cycles of amplification to generate a fluorescent signal from the detector probe; and quantitating the nucleic acid presence based on the fluorescent signal cycle threshold of the amplification reaction.

[0073] As described in greater detail herein, some embodiments of the invention may include amplicon-based sequencing of the one or more markers to make the aforementioned determinations. Some embodiments of the invention include systems and methods of preparing samples for one or more downstream processes that can be used for assessing one or more markers for any of the previously mentioned purposes. Some embodiments of the invention may comprise a universal indexing sequencing strategy for use in downstream sequencingAttorney Docket 91482.272WO-PCT platform processes. By way of example only, some embodiments of the invention comprise a universal indexing sequencing strategy that can be used to amplify multiple genomic regions (e.g., markers, as described below) from a DNA sample simultaneously in a single reaction for the sequencing of one or more amplicons. One or more embodiments of the invention can be used with any desired sequencing platform, such as the ILLUMINA® Next Generation Sequencing (e.g., MiSEQ) platform, Life Technologies’ Ion Torrent System, or any other sequencing system now known or developed in the future.

[0074] Some embodiments may be configured to enable relatively simple, rapid (e.g., microorganism-culture independent), inexpensive, and efficient preparation of samples for use on, in, and / or with downstream sequencing platforms. For example, some embodiments may use a sequence coupled to one or more oligonucleotides / primers (as used herein, oligonucleotides and primers are used interchangeably). More specifically, one or more amplicons per sample can be generated using a hybrid oligonucleotide that is designed for amplification of a marker and incorporation of at least one universal tail sequence into the resulting amplicon. As a result, additional steps that may be conventionally required to prepare samples for sequencing can be limited or removed entirely. Further information regarding the universal tail, amplicon-based sequencing strategy can be found in PCT / US2014 / 064890, which is hereby incorporated by reference in its entirety for all purposes.

[0075] In some embodiments, the methodology may include performing downstream sequencing on one or more amplicons. For example, in order to minimize and / or eliminate the need for cultures of microorganisms or large inputs of nucleic acids, methodologies of the instant invention may include an initial PCR step to create amplicons that correspond to the one or more pre-selected markers. As such, some embodiments require only limited amounts of starting material are necessary and the starting material need not be of high quality (e.g., genomic DNA, crude DNA extracts, single stranded DNA, RNA, cDNA, etc.). In contrast, many conventional sample preparation systems may require relatively large amounts of starting material of relatively high quality, which can limit the use of some conventional systems.

[0076] Some embodiments of the invention can be used for and / or in complement with high-throughput amplicon sequencing of markers, which can be very useful for a variety of molecular genetic genotyping / predicted-phenotyping applications, including clinical sampleAttorney Docket 91482.272WO-PCT analysis. For example, use of the systems and methods of the invention can be employed with sequencing platforms to provide rapid, high-yield sequence data, which can enable the sequencing of multiple markers / amplicons from many samples in a relatively short period of time. Specifically, in some embodiments, amplicons can be selected and PCR reactions can be designed to provide information that can be used to make clinically relevant determinations after sequencing of the amplicons.

[0077] In some preferred aspects, the methodology may include creating a series of oligonucleotides designed to provide multiplexed amplification of one or more markers to produce the desired amplicons. In particular, the one or more markers and amplicons thereof can be selected / amplified to provide users with clinically relevant information related to identification of one or more potentially infectious microorganisms and phenotypic and genotypic information about the microorganisms. After production of the amplicons (e.g., via PCR amplification), which may include the universal tail sequences, the method may include processing the resulting amplicons for downstream sequencing and thereafter sequencing the processed amplicons. After processing and analysis of the resulting sequencing data, one of skill in the art can make any necessary determinations regarding the identification of one or more microorganisms that may have been contained within the sample and predicted- phenotypic and / or genotypic information revealed.

[0078] Generally, some embodiments of the present invention can be used to detect, identify, assess, sequence, or otherwise evaluate a marker. A marker may be any molecular structure produced by a cell, expressed inside the cell, accessible on the cell surface or secreted by the cell. A marker may be any protein, carbohydrate, fatty acid, nucleic acid, catalytic site, or any combination of these such as an enzyme, glycoprotein, cell membrane, virus, a particular cell, or other uni- or multimolecular structure. A marker may be represented by a sequence of a nucleic acid or any other molecules derived from the nucleic acid. Examples of such nucleic acids include miRNA, tRNA, siRNA, mRNA, cDNA, genomic DNA sequences, singlestranded DNA, or complementary sequences thereof. Alternatively, a marker may be represented by a protein sequence. The concept of a marker is not limited to the exact nucleic acid sequence or protein sequence or products thereof; rather it encompasses all molecules that may be detected by a method of assessing the marker. Without being limited by the theory, theAttorney Docket 91482.272WO-PCT detection, identification, assessment, sequencing, or any other evaluation of the marker may encompass an assessment of a change in copy number (e.g., copy number of a gene or other forms of nucleic acid) or in the detection of one or more translocations. Moreover, in some embodiments, the marker may be relevant to a particular phenotype or genotype. By way of example only, in some embodiments, the marker may be related to phenotypes including antibiotic resistance, virulence, or any other phenotype.

[0079] Therefore, examples of molecules encompassed by a marker represented by a particular sequence further include alleles of the gene used as a marker. An allele includes any form of a particular nucleic acid that may be recognized as a form of the particular nucleic acid on account of its location, sequence, or any other characteristic that may identify it as being a form of the particular gene. Alleles include but need not be limited to forms of a gene that include point mutations, silent mutations, deletions, frameshift mutations, single nucleotide polymorphisms (SNPs), inversions, translocations, heterochromatic insertions, and differentially methylated sequences relative to a reference gene, whether alone or in combination. An allele of a gene may or may not produce a functional protein; may produce a protein with altered function, localization, stability, dimerization, or protein-protein interaction; may have overexpression, underexpression or no expression; may have altered temporal or spatial expression specificity; or may have altered copy number (e.g., greater or less numbers of copies of the allele). An allele may also be called a mutation or a mutant. An allele may be compared to another allele that may be termed a wild type form of an allele. In some cases, the wild type allele is more common than the mutant.

[0080] In some aspects, the markers may include one or more sets of amplifiable nucleic acids that can provide diagnostic information about the microorganisms. For example, the markers may include amplifiable nucleic acid sequences that can be used to assess the presence and / or absence of one or more microorganism that may have the potential to cause a diseased state in the subject. In some embodiments, the markers may include amplifiable nucleic acid sequences that can be used to identify one or more of the following exemplary microorganisms and / or viruses: Enterovirus-D68 (EV-D68).

[0081] In some embodiments, the methods may include the use of one or more than one marker per microorganism. Moreover, in some embodiments, one or more of theAttorney Docket 91482.272WO-PCT microorganisms may not be considered pathogenic to certain subjects, but the methodology employed herein can still rely on detection of pathogenic and non-pathogenic microorganisms for differential diagnoses / diagnostics. In some embodiments, the oligonucleotides (with or without the universal tail sequences detailed herein) listed in Tables 1, 2 and 3 can be used with embodiments of the invention to amplify one or more markers from the microorganisms to provide diagnostic / identification information to the user.

[0082] Moreover, in some embodiments, one or more the markers associated with the plurality of microorganisms can be amplified in a multiplex manner. For example, in some aspects, nucleic acids can be obtained from the sample and the oligonucleotides used to amplify one or more of the markers used to identify / diagnose can be added to a single mixture to produce a plurality of amplicons in a single reaction mixture. In other aspects, the oligonucleotides can be added to multiple mixtures to provide for the creation of multiple amplicons in multiple mixtures.

[0083] Moreover, in some embodiments, one or more the markers can be amplified in a multiplex manner. For example, in some aspects, nucleic acids can be obtained from the sample and the oligonucleotides used to amplify one or more of the markers used to identify the strain of the microorganism can be added to a single mixture to produce a plurality of amplicons in a single reaction mixture. In other aspects, the oligonucleotides can be added to multiple mixtures to provide for the creation of multiple amplicons in multiple mixtures. In some aspects, amplification of the markers used to identify microorganisms / diagnose an infection can also occur in a multiplex manner such that some or all of the amplicons are generated in a single reaction for a particular sample. In other aspects, amplification of the markers used to identify microorganisms / diagnose an infection can occur in multiple reaction vessels. Overall, as described in greater detail below, regardless of the multiplex nature of some embodiments of the invention, after amplification of the markers, the method may include processing and sequencing the resulting amplicons to provide information related to the identification, characterization, and strain identity of one or more microorganisms that may be present within the sample.

[0084] Some embodiments of the invention may comprise the use of one or more methods of amplifying a nucleic acid-based starting material (i.e., a template, including genomic DNA,Attorney Docket 91482.272WO-PCT crude DNA extract, single-stranded DNA, double-stranded DNA, cDNA, RNA, or any other single-stranded or double-stranded nucleic acids). Nucleic acids may be selectively and specifically amplified from a template nucleic acid contained in a sample. In some nucleic acid amplification methods, the copies are generated exponentially. Examples of nucleic acid amplification methods known in the art include: polymerase chain reaction (PCR), ligase chain reaction (LCR), self-sustained sequence replication (3 SR), nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA), amplification with QP replicase, whole genome amplification with enzymes such as cp29, whole genome PCR, in vitro transcription with T7 RNA polymerase or any other RNA polymerase, or any other method by which copies of a desired sequence are generated.

[0085] In addition to genomic DNA, any polynucleotide sequence can be amplified with an appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.

[0086] PCR generally involves the mixing of a nucleic acid sample, two or more primers or oligonucleotides (primers and oligonucleotides are used interchangeably herein) that are designed to recognize the template DNA, a DNA polymerase, which may be a thermostable DNA polymerase such as Taq or Pfu, and deoxyribose nucleoside triphosphates (dNTP's). In some embodiments, the DNA polymerase used can comprise a high fidelity Taq polymerase such that the error rate of incorrect incorporation of dNTPs is less than one per 1,000 base pairs. Reverse transcription PCR, quantitative reverse transcription PCR, and quantitative real time reverse transcription PCR are other specific examples of PCR. In general, the reaction mixture is subjected to temperature cycles comprising a denaturation stage (typically 80-100° C), an annealing stage with a temperature that is selected based on the melting temperature (Tm) of the primers and the degeneracy of the primers, and an extension stage (for example 40-75° C). In real-time PCR analysis, additional reagents, methods, optical detection systems, and devices known in the art are used that allow a measurement of the magnitude of fluorescence in proportion to concentration of amplified template. In such analyses, incorporation of fluorescent dye into the amplified strands may be detected or measured.

[0087] Either primers or primers along with probes allow a quantification of the amount of specific template DNA present in the initial sample. In addition, RNA may be detected by RT-Attorney Docket 91482.272WO-PCTPCR analysis by first creating a DNA template from RNA through a reverse transcriptase enzyme (i.e., the creation of cDNA). In embodiments where the sample comprises RNA, the method may include reverse transcribing the RNA to cDNA prior to amplification. The RNA marker expression may be detected by quantitative PCR analysis facilitating gene expression analysis of the samples.

[0088] In some forms of PCR assays, quantification of a target in an unknown sample is often required. Such quantification may be determined in reference to the quantity of a control sample. The control sample starting material / template may be co-amplified in the same tube in a multiplex assay or may be amplified in a separate tube. Generally, the control sample contains template at a known concentration. The control sample template may be a plasmid construct comprising only one copy of the amplification region to be used as quantification reference. To calculate the quantity of a target in an unknown sample, various mathematical models are established. Calculations are based on the comparison of the distinct cycle determined by various methods, e.g., crossing points (CP) and cycle threshold values (Ct) at a constant level of fluorescence; or CP acquisition according to established mathematic algorithm.

[0089] Some embodiments of the invention may comprise a multiplex assay. As used herein, the term “multiplex” refers to the production of more than one amplicon, PCR product, PCR fragment, amplification product, etc. in a single reaction vessel. In other words, multiplex is to be construed as the amplification of more than one marker-specific sequences within a PCR reaction or assay within the same PCR assay mixture (e.g., more than one amplicon is produced within a single vessel that contains all of the reagents necessary to perform a PCR reaction). In some embodiments, a step prior to performing the PCR (or RT-PCR, quantitative RT-PCR, etc.) reaction can occur such that sets of primers and / or primers and probes are designed, produced, and optimized within a given set of reaction conditions to ensure proper amplicon production during the performance of the PCR.

[0090] The algorithm for Ct values in real time-PCR calculates the cycle at which each PCR amplification reaches a significant threshold. The calculated Ct value is proportional to the number of marker copies present in the sample, and the Ct value is a precise quantitative measurement of the copies of the marker found in any sample. In other words, Ct valuesAttorney Docket 91482.272WO-PCT represent the presence of respective marker that the primer sets are designed to recognize. If the marker is missing in a sample, there should be no amplification in the Real Time-PCR reaction.

[0091] Alternatively, the Cp value may be utilized. A Cp value represents the cycle at which the increase of fluorescence is highest and where the logarithmic phase of a PCR begins. The LIGHTCYCLER® 480 Software calculates the second derivatives of entire amplification curves and determines where this value is at its maximum. By using the second-derivative algorithm, data obtained are more reliable and reproducible, even if fluorescence is relatively low.

[0092] The various and non-limiting embodiments of the PCR-based method detecting marker expression level as described herein may comprise one or more probes and / or primers. Generally, the probe or primer contains a sequence complementary to a sequence specific to a region of the nucleic acid of the marker gene. A sequence having less than 60% 70%, 80%, 90%, 95%, 99% or 100% identity to the identified gene sequence may also be used for probe or primer design if it is capable of binding to its complementary sequence of the desired target sequence in marker nucleic acid.

[0093] Some embodiments of the invention may include a method of comparing a marker in a sample relative to one or more control samples. A control may be any sample with a previously determined level of expression. A control may comprise material within the sample or material from sources other than the sample. Alternatively, the expression of a marker in a sample may be compared to a control that has a level of expression predetermined to signal or not signal a cellular or physiological characteristic. This level of expression may be derived from a single source of material including the sample itself or from a set of sources. A “control value” also refers to a reference measurement, such as a threshold cycle (Ct) value or standard curve, used to determine whether a sample is positive or negative for a target (e.g., EV-D68).

[0094] In some embodiments, sample or biological sample may include a bodily tissue, fluid, or any other specimen that may be obtained from a living organism that may comprise additional living organisms. By way of example only, in some embodiments, sample or biological sample may include a specimen from a first organism (e.g., a human) that may further comprise an additional organism (e.g., bacteria, including pathogenic or non-pathogenicAttorney Docket 91482.272WO-PCT / commensal bacteria, viruses, parasites, fungi, including pathogenic or non-pathogenic fungi, etc.). In some embodiments of the invention, the additional organism may be separately cultured after isolation of the sample to provide additional starting materials for downstream analyses. In some embodiments, the sample or biological sample may comprise a direct portion of the additional, non-human organism and the host organism (e.g., a biopsy or sputum sample that contains human cells and bacteria).

[0095] With respect to use of the sample or biological sample, embodiments of the claimed methodology provide improvements compared to conventional methodologies. Specifically, conventional methodologies of identifying and characterizing microorganisms include the need for morphological identification and culture growth. As such, conventional methodologies may take an extended period of time to identify the microorganism and may then require further time to identify whether the microorganism possesses and certain markers. Some embodiments of the invention can provide a user with information about any microorganisms present in a sample without the need for additional culturing because of the reliance of nucleic acid amplification and sequencing. In other words, direct extraction of nucleic acids coupled with amplification of the desired markers and downstream sequencing can reduce significantly the time required to obtain diagnostic and strain identifying information.

[0096] The invention may further comprise the step of sequencing the amplicon. Methods of sequencing include but need not be limited to any form of DNA sequencing including Sanger, next-generation sequencing, pyrosequencing, SOLiD sequencing, massively parallel sequencing, pooled, and barcoded DNA sequencing or any other sequencing method now known or yet to be disclosed.

[0097] In Sanger Sequencing, a single-stranded DNA template, a primer, a DNA polymerase, nucleotides and a label such as a radioactive label conjugated with the nucleotide base or a fluorescent label conjugated to the primer, and one chain terminator base comprising a dideoxynucleotide (ddATP, ddGTP, ddCTP, or ddTTP, are added to each of four reaction (one reaction for each of the chain terminator bases). The sequence may be determined by electrophoresis of the resulting strands. In dye terminator sequencing, each of the chain termination bases is labeled with a fluorescent label of a different wavelength that allows the sequencing to be performed in a single reaction.Attorney Docket 91482.272WO-PCT

[0098] In pyrosequencing, the addition of a base to a single-stranded template to be sequenced by a polymerase results in the release of a pyrophosphate upon nucleotide incorporation. An ATP sulfuryrlase enzyme converts pyrophosphate into ATP that in turn catalyzes the conversion of luciferin to oxyluciferin which results in the generation of visible light that is then detected by a camera or other sensor capable of capturing visible light.

[0099] In SOLiD sequencing, the molecule to be sequenced is fragmented and used to prepare a population of clonal magnetic beads (in which each bead is conjugated to a plurality of copies of a single fragment) with an adaptor sequence and alternatively a barcode sequence. The beads are bound to a glass surface. Sequencing is then performed through 2-base encoding.

[0100] In massively parallel sequencing, randomly fragmented targeted nucleic acids and / or amplicons are attached to a surface. The fragments / amplicons are extended and bridge amplified to create a flow cell with clusters, each with a plurality of copies of a single fragment sequence. The templates are sequenced by synthesizing the fragments in parallel. Bases are indicated by the release of a fluorescent dye correlating to the addition of the particular base to the fragment.

[0101] Nucleic acid sequences may be identified by the IUAPC letter code which is as follows: A - Adenine base; C- Cytosine base; G - guanine base; T or U - thymine or uracil base; I - inosine base. M - A or C; R - A or G; W - A or T; S - C or G; Y - C or T; K - G or T; V - A or C or G; H - A or C or T; D - A or G or T; B - C or G or T; N or X - A or C or G or T. Note that T or U may be used interchangeably depending on whether the nucleic acid is DNA or RNA. A sequence having less than 60%, 70%, 80%, 90%, 95%, 99% or 100% identity to the identifying sequence may still be encompassed by the invention if it is able of binding to its complimentary sequence and / or facilitating nucleic acid amplification of a desired target sequence. In some embodiments, as previously mentioned, the method may include the use of massively parallel sequencing, as detailed in U.S. Patent Nos. 8,431,348 and 7,754,429, which are hereby incorporated by reference in their entirety.

[0102] Some embodiments of the invention comprise multiple steps and / or processes that are carried out to execute the universal tail indexing strategy to prepare amplicons corresponding to desired markers for sequencing. In some embodiments, one or more makers for a given sample or template can be selected, as described above. Some embodiments of theAttorney Docket 91482.272WO-PCT invention can be used in conjunction with an analysis of one or more markers (e.g., genes / alleles) associated with a particular phenotype (e.g., virulence).

[0103] After selection of the markers, marker-specific primers / oligonucleotides can be designed for the amplification of the markers to produce the desired amplicons, as detailed above. As is known in the art, a forward and a reverse marker-specific primer can be designed to amplify the marker from a nucleic acid sample. In some embodiments, the forward and reverse primers can be designed to produce an amplicon (e.g., some or all of the sequence of the marker) of a desired length. For example, the length of the amplicon may comprise approximately 50 base pairs (bp), 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 1,000 bp, or any size amplicon greater in size or therebetween.

[0104] As previously mentioned, some embodiments of the invention may include a multiplex PCR reaction. For example, marker-specific primers can be designed for multiple markers or multiple regions of the same marker such that multiple amplicons of between about 50 bp and 1,000 bp are being produced within a single PCR reaction vessel. In other words, the forward and reverse primers can be designed to function within a given set of temperature parameters such that more than one amplicon can be successfully amplified from a given template within a single PCR reaction mixture. As such, multiple amplicons can be prepared using the universal tail indexing strategy for sequencing preparation.

[0105] In some embodiments, the forward and reverse primers that have been designed for each of the markers can be modified to include a universal tail. For example, the universal tail sequences can be relatively or completely unique sequences of nucleotides that are coupled to the 5’ ends of some or all of the forward and reverse marker-specific primers. In some aspects, the universal tail sequences can be selected such that there is little to no overlap in sequence between portions of the markers that are being amplified and the universal tail sequences. Moreover, the universal tail sequences can comprise a length between ten and twenty nucleotides in length. In some embodiments, the universal tail sequences can be any other length, as desired by the user to meet the needs and requirements of the reaction. As such, the universal tail sequences can exhibit a relatively negligible impact on binding of the forward and reverse marker-specific primers to the template sequence to enable amplification. Moreover, as a result of being included on the 5’ end of the forward and reverse marker-specificAttorney Docket 91482.272WO-PCT primers, the universal tail sequences will form a portion of the resulting amplicons. In addition, in some aspects of the invention, the sequences selected for the universal tail sequences can be at least partially correlated with the chemical composition of the template nucleic acids. For example, in some aspects, the sequences selected for the universal tail sequences can be at least partially correlated with the G-C content of the organism from which the template is isolated.

[0106] In some aspects, some or all of the universal tail sequences can be at least partially unique. In some embodiments, each of the 5’ ends of all of the forward marker-specific primers within a given PCR assay mixture can comprise the same or a similar universal tail sequence (e.g., a first universal tail sequence or UT1). Similarly, each of the 5’ ends of all of the reverse marker-specific primers within the same PCR assay mixture can comprise a second universal tail sequence (UT2) that differs from the first universal tail sequence. As such, each respective sample from which a template sequence is used in the multiplex PCR assay will have two unique universal tail sequences. Accordingly, each forward and reverse marker-specific primer within a multiplex PCR mixture will include a unique universal tail sequence. For example, if the PCR includes 35 different samples, 35 universal tail sequences can be employed for the forward primers in each of the 35 unique reactions (i.e., not including technical replicates) and 35 universal tail sequences can be employed for the reverse primers in each of the 35 unique reactions (i.e., not including technical replicates). Overall, the forward and reverse markerspecific primers that each comprise the universal tail sequences can comprise a generally short length (e.g., 25-50 bp), which can facilitate simultaneous amplification of multiple targets in a single reaction.

[0107] In addition, some embodiments of the invention may comprise performing quantitative PCR to optimize the multiplex PCR assay. For example, after design of the forward and reverse marker-specific primers that each include a universal tail sequence, the contemplated multiplex PCR assays can be performed using quantitative PCR (e.g., using DNA as a template) to assess relative quantities of the amplicons produced. Accordingly, the sequence coverage of each amplicon is considered to be equal if the quantities of the amplicons produced by the multiplex quantitative PCR appear to be equal. If the quantities of the amplicons produced by the multiplex quantitative PCR do not appear to be equal, the forwardAttorney Docket 91482.272WO-PCT and / or reverse marker-specific primers can be altered and re-optimized until adequate quantities of amplicons are produced.

[0108] After design and adequate optimization of the multiplex PCR assay comprising multiple forward and reverse marker-specific primers that each includes universal tail sequences, the multiplex PCR can be performed to obtain the amplicons associated with the above-described markers. In some embodiments, template that has been previously isolated from a sample can be used for the amplification of the amplicons. In some aspects, multiple PCR reaction replicates can be performed for each sample template and one or more control templates.

[0109] In some embodiments, after successful production of the amplicons during the multiplex PCR assay, the resulting amplicons can be further processed to provide sequencingready amplicons. For example, some embodiments of the invention may comprise an indexing extension step. In some aspects, the indexing extension step may comprise extending the optimized multiplex amplicons using a set of indexing and common primers that recognize the respective universal tail sequences used for the particular group of amplicons in a minimal cycle PCR assay (e.g., 5-10 total cycles). In particular, each multiplex set of amplicons to be sequenced can be extended with a different set of index oligonucleotides and common oligonucleotides that recognize UT1 and UT2, respectively. In some aspects, the index sequence of the index oligonucleotides can be custom designed to allow for the selection of an index sequence from potentially thousands of different index sequences.

[0110] After this step, the resulting products include a set of amplicons for each sample / template that comprise the same index and any necessary sequences that may be required for a particular sequencing platform (e.g., platform sequences associated with the ILLUMINA® Next Generation sequencing platform). Thereafter, the resulting extension-reaction products can be quantified, pooled, and sequenced using a desired platform. In some aspects, the inclusion of the universal tail sequences on the index and common primers can coincide with the use of genomic and index read primers in the mixture of sequencing primer reagents. For example, some embodiments of the invention are capable of pooling multiple amplicons with multiple indices in a single sequencing run to provide 40,000x-95,000x coverage across the amplicons. In other embodiments, the systems and methods associated with the invention canAttorney Docket 91482.272WO-PCT be configured to provide any level of sequencing coverage that is desirable to the user (e.g., higher or lower that the coverage levels discussed above). In some embodiments, after sequencing and generation of the sequence data, the resulting data can be demultiplexed and the sequence files can be aligned to the appropriate references sequences for subsequent sequence analyses.[OHl] Embodiments of the invention offer additional advantages relative to conventional systems. For example, some embodiments of the invention comprise the use of PCR before sequencing such that only limited amounts of starting material are necessary and the starting material need not be of high quality (e.g., genomic DNA, crude DNA extracts, single stranded DNA, RNA, cDNA, etc.). In contrast, many conventional sample preparation systems may require relatively large amounts of starting material of relatively high quality, which can limit the use of these systems. Moreover, the inclusion of non-desirable template materials can also interfere in one or more downstream processes in conventional systems and methods. For example, if an investigation is being conducted that focuses on one or more organisms that may be associated with another organism (e.g., bacteria associated with a human); the sampling of the target organism may result in template contamination from the host organism.

[0112] In particular, in some aspects, obtaining samples of pathogenic or commensal bacteria from, on, or within a human may also result in the collection of human tissue. As such, when isolating the template, human nucleic acids may contaminate the bacterial template. Some embodiments of the invention are configured such that the contaminating template (e.g., from a human) would not interfere with downstream processes, including sequencing. For example, some embodiments of the invention operate such that only a limited amount of starting template (e.g., 500 femtograms or greater) can be used. Moreover, some embodiments are also configured such that the starting material (e.g., template contaminated with foreign nucleic acids) can still produce the required amplicons for sequencing in the presence of more than a 1,000-fold excess of contaminating template with no discernible inhibition of the multiplex PCR.

[0113] In certain aspects, the present invention provides an assay that works with as little as about Ipg, about 900fg, about 800fg, about 700fg, about 600fg, about 500fg, about 400fg, about 300fg, about 200fg, or about lOOfg of genomic DNA.Attorney Docket 91482.272WO-PCTKITS

[0114] The invention further provides kits for performing the disclosed methods. These methods and kits are applicable to clinical diagnostics, epidemiological surveillance, and wastewater-based monitoring to detect EV-D68 presence and variant dynamics.

[0115] In one embodiment, a kit for amplifying and sequencing EV-D68 variants comprises one or more forward primers and one or more reverse primers, each containing a 5' universal tail and an EV-D68-specific sequence as described above. Each universal tail sequence is non-overlapping with any target amplicon. The kit may optionally include a nucleotide polymerase, reaction buffer, diluent, and excipients, as well as instructions for use.

[0116] In another embodiment, a kit for detecting EV-D68 by real-time PCR is provided. The kit includes the specific forward primer, reverse primer, and fluorescent probe sequences described above, together with a polymerase, reaction buffer, and optional controls. The kit may be formulated in liquid or lyophilized form and may include written or electronic instructions describing how to perform the detection assay.METHODS OF TREATMENT OR PUBLIC HEALTH RESPONSE

[0117] In example embodiments, detection of EV-D68 in a subject or EV-D68 in a public location (e.g., wastewater) indicates that the subject should be treated and / or a public health response should be initiated. In some embodiments, the EV-D68 is detected prior to identification of symptomatic subjects at the location of sampling, allowing early warning of viral circulation. The sample may be obtained from a subject or from an environmental source such as wastewater. Detection of EV-D68 in environmental samples may prompt a public health response.

[0118] In example embodiments, the sample is obtained from a human subject. Detection of an EV-D68 variant may be followed by administration of an antiviral treatment or further diagnostic evaluation. In another embodiment, the sample is an environmental sample, such as wastewater. Detection of EV-D68 variants in the sample may trigger a public health response or increased surveillance in the affected area.

[0119] As used herein, “antiviral” refers to a medication or substance that acts against a virus, either by treating an existing viral infection or by preventing one. These drugs work by interfering with the virus's ability to replicate and function, helping to shorten the illness, reduce symptoms, and prevent the spread of the virus. In example embodiments, antiviralsAttorney Docket 91482.272WO-PCT inhibit a virus from entering a host cell, replicating, or assembling new viral particles. In example embodiments, a subject positive for Enterovirus-D68 is treated with an antiviral (see, e.g., Lee MF, Tham SK, Poh CL. Antiviral Strategies Targeting Enteroviruses: Current Advances and Future Directions. Viruses. 2025; 17(9): 1178. Published 2025 Aug 28. doi: 10.3390 / vl7091178). In example embodiments, the antiviral is a capsid binder (e.g., VP1), protease inhibitor (e.g., 3C), replication complex-targeting agents (e.g., 3A, 2C, RdRp), receptor-blocking antibodies, such as those targeting human scavenger receptor Class B member 2 (SCARB2), and / or host-targeted or repurposed drugs.

[0120] The term “public health response” refers to any action taken by a healthcare or governmental authority following detection of EV-D68, such as alerting clinicians, conducting contact tracing, issuing health advisories, or implementing community-level interventions.

[0121] Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the invention.EXAMPLES

[0122] This study utilizes pooled nasal samples collected from school-aged children and long-term care facility residents, and wastewater from multiple populations in Arizona from July-October of 2022. PCR was used to amplify and sequence a region common to all enteroviruses, followed by species-level bioinformatic characterization using the QIIME2 platform. EV-D68 detection was carried out using reverse transcription quantitative PCR (RT- qPCR), followed by confirmation using near-complete whole EV-D68 genome sequencing using a tiled amplicon approach. This study demonstrates the utility of viral pan-assay approaches that can be followed up by targeted assays and phylogenomics.Sample and Clinical Data CollectionWastewater

[0123] Raw wastewater samples used for this project were collected from two City of Flagstaff wastewater treatment plants from April 27, 2022 through October 26, 2022 (n=30), eleven Flagstaff congregate living settings from September 7 through October 26, 2022 (n=52), and eleven City of Tempe Biointel Sampling Basins (i.e. metering, lift, and wastewater sampling stations) from August 5, 2022 through October 26, 2022 (n=61). At the wastewaterAttorney Docket 91482.272WO-PCT treatment plants and Biointel Sampling Basins, 24-hour composite samples were collected (125mL every 30 minutes) as part of ongoing operations. From each composite sample, Applicants collected 80mL split evenly into two 50mL conicals. Samples from the eleven congregate living settings were collected from proximal manholes using an approach inspired by the Moore Swab. Briefly, Moore described their technique as “taking a piece of gauze about four feet in length and six inches wide, folding it into a pad of eight thicknesses and attaching it firmly (usually with fishing wire) by one end to a long piece of string. The gauze was immersed into the flowing sewage, the string attached suitably just under the manhole cover, and the gauze left in position for 48 hours (Moore B. The detection of enteric carriers in towns by means of sewage examination. J R Sanit Inst. 1951;71 : 57-60; Sikorski MJ, Levine MM. Reviving the “Moore Swab”: a Classic Environmental Surveillance Tool Involving Filtration of Flowing Surface Water and Sewage Water To Recover Typhoidal Salmonella Bacteria. Applied and Environmental Microbiology. 2020. doi: 10.1128 / aem.00060-20). Instead of gauze, Applicants immerse ultra-sized Tampax tampons attached to Rexlace plastic craft lace tied to a plastic hook glued with Gorilla Glue Construction Adhesive to the inside of the manhole. After 48 hours, tampons were pulled from the wastewater flow and placed in a plastic 125 mL jar with 20mL of molecular grade water and shaken vigorously.Nasal Swabs

[0124] Applicants retrospectively tested 809 nasal swabs collected from 146 school-aged children in Coconino County and 92 long-term care facility residents in Maricopa County, biweekly, from August through October of 2022. Each individual swabbed their own nose for 15 seconds per nostril with a micro flocked swab followed by storage in liquid Amies solution at 4°C prior to processing. All school-aged children attended schools within the tested sewersheds in the City of Flagstaff, while residents of long-term care facilities live adjacent to the sewersheds tested in the City of Tempe.Wastewater Concentration and Extraction

[0125] Immediately following collection, samples were concentrated using the Environ Water RNA Kit (Zymo Research) following manufacturer protocol for viral enrichment and sample homogenization. Promptly after sample homogenization, samples were extracted using the Quick-DNA / RNA Pathogen Miniprep Kit (Zymo Research), including the optionalAttorney Docket 91482.272WO-PCTProteinase K treatment, following manufacturer protocol. RNA was eluted into lOOpL of DNase / RNase free water pre-warmed to 37°C.Wastewater RT-qPCR and cDNA Synthesis

[0126] Post extraction, all samples were also treated using Invitrogen’s ezDNAse reagent. The lOpL ezDNase reactions contained 8pL RNA input and were incubated for 2 minutes at 37°C following manufacturer recommendations. The full volume of each DNase-treated sample was reverse transcribed using the SuperScript (TM) IV First Strand Synthesis System (Invitrogen) following manufacturer recommendations with modified thermal cycling conditions. Initial primer annealing with random hexamers was performed with maximum RNA input and incubated at 70°C for 7 minutes. Following primer annealing, reverse transcription of RNA was performed by cycling at 23°C for 10 minutes, 50°C for 45 minutes, 55°C for 15 minutes, and 80°C for 10 minutes. All synthesized cDNA was treated with the included RNase H to remove RNA in the RNA / cDNA hybrids that formed during reverse transcription. cDNA was stored at -20°C awaiting further analyses.

[0127] Following concentration and extraction of wastewater, samples were tested for the presence of or absence of EV-D68 using real-time quantitative PCR (RT-qPCR) methods, using the CDC2022 EV-D68-specific primers and probe, Forward: AN993, Reverse: AN995, and Probe: AN992

[0047] , Each 20pL RT-qPCR reaction contained Luna® Probe One-Step RT- qPCR 4X Mix with UDG (New England BioLabs) at final concentration of IX, and forward primer, reverse primer, and probe all with the final concentration of 0.5pM. All reactions contained 5pL of RNA template input. Thermal cycling conditions were as follows: carryover prevention at 25°C for 30 s, reverse transcription at 55°C for 10 min, activation and denaturation at 95°C for 1 min, and 40 cycles of 95°C for 10 s, 55°C for 30 s. Viral load in positive samples was calculated using a synthetic DNA control, designed in-house, of known concentration. Importantly, the CDC2022 assay was validated by the CDC using a 7500 Fast Real-Time PCR System (Applied Biosystems) with qScript™ XLT One-Step RT-qPCR ToughMix® (Quanta Biosciences), and may have performed differently given different equipment and reagents used here.

[0128] In addition to the CDC2022 RT-qPCR assay, Applicants also selected a subset of samples to be tested with a new RT-qPCR that the team developed, termed the “D68-Detecf ’ assay, targeting a 108bp fragment of the 2C gene due to its higher level of conservation. EachAttorney Docket 91482.272WO-PCT lOpL RT-qPCR reaction contained Luna® Probe One-Step RT-qPCR 4X Mix with UDG at final concentration of IX, D68-Detect-F sense primer (TMCATGGCTCTCCAGGAACT) (SEQ ID NO: 95) and D68-Detect-R antisense primer (CTTAGGGTCTGGGGGCARGG) (SEQ ID NO: 96) at a final concentration of 0.4pM, and D68-Detect-P probe (FAM- TGGCCTCAAATTTAATTGCCAGGGC) (SEQ ID NO: 97) at a final concentration of 0.2pM, covering positions 4,440-4,546. All reactions contained 2pL of RNA template input. Thermal cycling conditions were the same as those used with the CDC2022 assay. Viral load in positive samples was calculated using an EV-D68 positive control isolated in 2018 from BEI Resources (NR-52357) in which concentration was determined using Droplet Digital PCR (ddPCR). All RT-qPCR reactions for both assays were carried out on a QuantStudioTM 7 Flex Real-Time PCR System (Applied Biosystems).DDPCR for positive control quantification

[0129] The EV-D68 isolate from BEI Resources (NR-52357) underwent cDNA synthesis using New England BioLabs Luna® Script RT Supermix kit following manufacturer recommendations. A 10-fold serial dilution was performed on the newly synthesized cDNA down to a 1 : 10,000,000 dilution. Droplet Digital PCR was performed on the dilution series using the newly designed RT-qPCR assay described above on a BioRad QX200 AutoDG Droplet Digital PCR System, however, the first dilution was omitted to avoid 100% positive droplets in the reaction. The 22pL ddPCR reactions consisted of 2X ddPCR Supermix for Probes (No dUTP), forward and reverse primers, and probe at final concentrations of IX, 0.9pM, and 0.25 pM respectively. Following droplet generation on the automated droplet generator, samples were cycled on a BioRad C1000 Touch Thermal Cycler with 96-Deep Well Reaction Module using manufacturer recommended cycling conditions with slight modification. Reactions were cycled for a total of 50 cycles and an annealing temperature of 55°C. Following cycling, droplets were read using a Direct Quantification experiment on a BioRad QX200 Droplet Reader. Thresholds were manually set for all samples using amplitudes of the Reverse Transcription and ddPCR No Template Controls to normalize positive droplet thresholding across samples (see FIG. 1).Nasal Swab Testins

[0130] Liquid Amies solution from 2-6 swabs was pooled together to a final volume of 50pL and digested following Workflow 1 from the SalivaDirectTM protocol (Vogels C,Attorney Docket 91482.272WO-PCTAllicock OM, Brackney DE, Kalinich CC, Ott IM, Grubaugh N, et al. SalivaDirectTM: RNA extraction-free SARS-CoV-2 diagnostics. 2021 [cited 14 Jul 2023], Available: www.protocols.io / view / salivadirect-rna-extraction-free-sars-cov-2-diagno-btdnni5e.pdf).Digested pools were then tested for the presence or absence of EV-D68 using the same RT- qPCR methods described previously.PCR Amplification and SequencingPan-Enterovirus Assay

[0131] Synthesized cDNA from all samples was amplified using previously designed panenterovirus primers targeting a conserved 440bp 5’ UTR region of the Enterovirus genome (Zoll GJ, Melchers WJ, Kopecka H, Jambroes G, van der Poel HJ, Galama JM. General primer- mediated polymerase chain reaction for detection of enteroviruses: application for diagnostic routine and persistent infections. J Clin Microbiol. 1992;30: 160-165), with attached universal tails (Colman RE, Schupp JM, Hicks ND, Smith DE, Buchhagen JL, Valafar F, et al. Detection of Low-Level Mixed-Population Drug Resistance in Mycobacterium tuberculosis Using High Fidelity Amplicon Sequencing. PLoS One. 2015;10: e0126626). Each 20uL PCR reaction contained Invitrogen PCR Buffer, Invitrogen MgC12, Invitrogen dNTPs, Invitrogen PlatTaq, and primers at final concentrations of IX, 2mM, 0.2mM, O.lU / pL, 0.375pM and respectively. Additionally, the reactions contained 2pL of cDNA template input. Thermal cycling conditions were as follows: initial denaturation at 95°C for 1 min, 35 cycles of 95°C for 15 s, 60°C for 15 s, 72°C for 30 s, and a 7 minute final extension at 72°C. Amplified product was cleaned using 0.8X Agencourt AMPure XP beads (Beckman Coulter).EV-D68 Tiled Amplicon Assay

[0132] Primal Scheme (Quick J, Grubaugh ND, Pullan ST, Claro IM, Smith AD, Gangavarapu K, et al. Multiplex PCR method for MinlON and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nat Protoc. 2017; 12: 1261-1276) was used to develop a multiplex of tiled EV-D68-specific primers. A total of 23 primer pairs with attached Illumina-compatible universal tails were designed, covering genome positions 60- 7308 of a contemporary EV-D68 genome (OP267522.1), amplifying regions averaging 356bp. The primer set was assessed using three positive controls from the Biodefense and Emerging Infections Research Resources Repository (BEI Resources): NR-49135 (accession MH708882) (Evans WJ, Hurst BL, Peterson CJ, Van Wettere AJ, Day CW, Smee DF, TarbetAttorney Docket 91482.272WO-PCTEB. Development of a respiratory disease model for Enterovirus-D68 in 4-week-old mice for evaluation of antiviral therapies. Antiviral Res. 2019 Feb; 162:61-70. doi: 10.1016 / j.antiviral.2018.11.012. Epub 2018 Dec 3. PMID: 30521834; PMCID: PMC6997929), NR-52357 (accession MN246009), and NR-55939 (isolate sequence not yet available). Synthesized cDNA from samples identified positive for EV-D68 with RT-qPCR with Ct values less than or equal to 35 were amplified using these newly designed primers, with the primers separated out into two pools.

[0133] TABLES 1 and 2 illustrate amplicon and PCR sequencing assays targeting the EV- D68 genome. In TABLE 1, the universal tails added to the primers for amplicon sequencing are underlined. Universal tail sequences are ACCCAACTGAATGGAGC (SEQ ID No: 93) for forward read and ACGCACTTGACTTGTCTTC (SEQ ID No: 94) for reverse read. The universal tail sequences (underlined) precede the assay-specific primer sequence, for example, in SEQ ID NOS: 1-46. In Table 2, EV-D68 specific sequences as for the primers in Table 1 are shown without universal tails, for example in SEQ ID NOS: 47-92.

[0134] TABLE 1Attorney Docket 91482.272WO-PCTAttorney Docket 91482.272WO-PCTAttorney Docket 91482.272WO-PCT

[0135] TABLE 2Attorney Docket 91482.272WO-PCT

[0136] TABLE 3Attorney Docket 91482.272WO-PCTLibrary Preparation and Sequencing

[0137] A second PCR using universal tail-specific primers was performed to add the Illumina specific indexes (Colman, PLoS One. 2015). Each 25uL indexing PCR reaction consisted of 12.5 pL of 2X Kapa HiFi HotStart Ready Mix (Kapa Biosystems) for a final IX concentration, 400 nM of each forward and reverse index primer, and 4, 6, or 8 pL of the cleaned amplified Pan-enterovirus product. Reactions were cycled as follows: 98°C for 2 min, 6 cycles of 98°C for 30 s, 60°C for 20 s, and 72°C for 30 s, and a final extension at 72°C for 5 min. Indexed samples were cleaned using 0.8X Agencourt AMPure XP beads (Beckman Coulter). Cleaned, indexed product was quantified using the Kapa Library Quantification kit (Kapa Biosystems) on an Applied Biosystems QuantStudio 7Flex System. The samples were then pooled equal molar and final sample pools were sequenced on one of three of the following Illumina platforms: MiSeq (using a v2 500 cycle kit), NextSeq 1000 (using a Pl 600 cycle kit), NovaSeq 6000 (using an SP vl.5 500 cycle kit).Statistical Analyses

[0138] To investigate the leading predictive ability of viral load for test positivity of viral infection, a low-rank penalized regression spline was fit to each of the viral load (average copies per mL) and viral test positivity count data sets as functions of time (Wood SN. Generalized Additive Models: An Introduction with R, Second Edition. CRC Press; 2017). These are semi-parametric models whose smoothness and complexity are determined via data- based out-of-sample prediction optimality criteria. Then each model was used to obtain daily interpolated predicted values — viral load and test probability of positivity — over a range of time, and the predicted (log odds of) test probabilities of positivity where regressed on the predicted (log) viral loads for a range of time lags for which test results are expected to lag loads, or, conversely, load values are expected to lead test results.Bioinformatic Processing

[0139] To characterize all enteroviruses sequenced using the pan-assay, Applicants took a marker gene-based approach as has been well-documented for microbiome analyses using QIIME 2 (Bolyen, Nat Biotechnol, 2019). This approach involves the development of an appropriate reference database, and classifier training, and classifying paired-end sequencing reads with the trained classifier. For samples where EV-D68 was detected, additional nearwhole genome sequencing was carried out followed by phylogenetic reconstruction.Attorney Docket 91482.272WO-PCTCurating a Picornaviridae Reference Dataset

[0140] Reference sequences were downloaded from the NCBI nucleotide database using QIIME 2 2022.11 (Bolyen, Nat Biotechnol, 2019) plugin RESCRIPt (Robeson MS 2nd, O’Rourke DR, Kaehler BD, Ziemski M, Dillon MR, Foster JT, et al. RESCRIPt: Reproducible sequence taxonomy reference database management. PLoS Comput Biol. 2021; 17: el 009581). Using the method get-ncbi-data with the NCBI search query of “Picornaviridae(ORGANISM) AND 5000: 10000000(SLEN)”, which finds all sequences for the virus family Picornaviridae with sequence length over 5,000 base pairs (Mazloum A, Van Schalkwyk A, Chernyshev R, Shotin A, Korennoy FI, Igolkin A, et al. Genetic Characterization of the Central Variable Region in African Swine Fever Virus Isolates in the Russian Federation from 2013 to 2017. Pathogens. 2022;l l. doi: 10.3390 / pathogensl 1080919; NCBI Resource Coordinators. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2018;46: D8-D13). The search resulted in 15,473 downloaded sequences. The downloaded sequences were trimmed to the target region with the q2-feature-classifier plugin’s (Bokulich NA, Kaehler BD, Rideout IR, Dillon M, Bolyen E, Knight R, et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome. 2018;6: 90) extract-reads method with the forward and reverse pan-enterovirus primers as input. If the primers had more than three mismatches, the sequence was removed from the dataset. After extracting the target region, 8,635 sequences remained. To ensure the reference database did not contain any identical sequences, Applicants used RESCRIPt's dereplicate method, a wrapper for VSEARCH (Rognes T, Flouri T, Nichols B, Quince C, MaheF. VSEARCH: a versatile open source tool for metagenomics. Peer . 2016;4: e2584) methods, to remove duplicated sequences. After dereplication, the final reference dataset and taxonomy files contained 5,039 sequences and taxon, respectively.Training Naive Bayes Classifier

[0141] The naive-Bayes classifier was trained using RESCRIPt's evaluate-fit-classifier (Robeson, PLoS Comput Biol., 2021), a wrapper over scikit-learn’s (Pedregosa F, VaroquauxG, Gramfort A, Michel V, Thirion B, Grisel O, et al. Scikit-leam: Machine Learning in Python. I Mach Learn Res. 2011;12: 2825-2830; McKinney W. Data Structures for Statistical Computing in Python. Proceedings of the 9th Python in Science Conference. SciPy; 2010. doi: 10.25080 / majora-92bfl922-00a) built-in naive-Bayes classification methods. ApplicantsAttorney Docket 91482.272WO-PCT trained the multinomial naive-Bayes classifier using the reference dataset from the previous section with default parameters. The classifier was validated by k-fold cross-validation (Bokulich NA, Kaehler BD, Rideout JR, Dillon M, Bolyen E, Knight R, et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature- classifier plugin. Microbiome. 2018;6: 90; Kaehler BD, Bokulich NA, McDonald D, Knight R, Caporaso JG, Huttley GA. Species abundance information improves sequence taxonomy classification accuracy. Nat Commun. 2019; 10: 4643).Preparing and Classifying Sequences with Trained Naive-Bayes Classifier

[0142] The 143 wastewater sample reads, from 30 City of Flagstaff, 61 City of Tempe, and 52 congregate living sites, were trimmed using QIIME 2’s Cutadapt (Martin, EMBnet.journal, 2011) plugin to remove primer and adapter sequences. After trimming, the reads were clustered into amplicon sequence variants (ASVs) using the QIIME 2 DADA2 plugin’s denoise-paired method (Callahan, Nat Methods., 2016), resulting in 901 unique ASVs. The ASVs were taxonomically annotated using the classifier trained in the previous section using QIIME 2 feature-classifier (Bokulich, Microbiome., 2018) classify-sklearn (Pedregosa, J Mach Learn Res. 2011; McKinney W. Data Structures for Statistical Computing in Python. Proceedings of the 9th Python in Science Conference. SciPy; 2010. doi: 10.25080 / majora-92bfl922-00a).EV-D68 Consensus Sequence Generation

[0143] Virus genome consensus sequences were built using the Amplicon Sequencing Analysis Pipeline (ASAP) (Colman, J Clin Microbiol., 2016; Bowers, J Clin Microbiol. 2016). First, reads were adapter-trimmed using bbduk (BBMap. In: SourceForge [Internet], 15 Jul 2022 (cited 22 Aug 2023). Available: sourceforge.net / projects / bbmap / ) and mapped to an EV- D68 reference genome (OP267522.1) (Benschop KS, Albert J, Anton A, Andres C, Aranzamendi M, Armannsdottir B, et al. Re-emergence of Enterovirus-D68 in Europe after easing the COVID-19 lockdown, September 2021. Euro Surveill. 2021;26. doi: 10.2807 / 1560- 7917.ES.2021.26.45.2100998), with bwa mem (Li H, Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 2010;26: 589-595) using local alignment with soft-clipping. BAM alignment files were then processed to generate the consensus sequence and statistics on the quality of the assembly by the following: 1) Individual basecalls with a quality score below 20 were discarded. 2) Remaining basecalls at each position were tallied. 3) If coverage >10X and >80% of the read basecalls agreed, a consensus basecallAttorney Docket 91482.272WO-PCT was made. 4) If either of these parameters were not met, an ‘N’ consensus call was made. 5) Deletions within reads, as called during the alignment, were left out of the assembly, while gaps in coverage (usually the result of a missing amplicon) were denoted by lowercase ‘n’s. This method has previously been used to generate SARS-CoV-2 consensus genomes (Ladner JT, Larsen BB, Bowers JR, Hepp CM, Bolyen E, Folkerts M, et al. An Early Pandemic Analysis of SARS-CoV-2 Population Structure and Dynamics in Arizona. MBio. 2020;l l. doi: 10.1128 / mBio.02107-20; Folkerts ML, LemmerD, Pfeiffer A, Vasquez D, French C, Jones A, et al. Methods for sequencing the pandemic: benefits of rapid or high-throughput processing. FlOOORes. 2021;10. doi:10.12688 / fl000research.28352.2). Statistics reported for each sample included: total reads, number of reads aligned to reference, percent of reads aligned to reference, coverage breadth, average depth, and any SNPs and INDELs found in >10% of the reads at that position.EV-D68 Phyloge etic Analysis

[0144] Public genomes were selected from the NCBI Virus database based on genome completeness (at least 7,000 bases in length) and metadata availability, where country of origin was included at a minimum. Additionally, genomes from non-human hosts and duplicates from the same sample were removed. Consensus genomes built using ASAP along with 935 publicly available EV-D68 genomes were aligned using Multiple Alignment using Fast Fourier Transform (MAFFT) (Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30: 772-780). Model selection and maximum likelihood reconstruction was carried out using IQTree vl .6.12 (Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37: 1530-1534), with the ModelFinder (Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017; 14: 587-589) identifying GTR+F+R5 as the best fit model. The resulting consensus tree file, including the associated bootstrap values, was then input into iTOL (Letunic I, Bork P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49: W293-W296) for visualization. Genome clade determination (A, Bl, B2, B3, C, D) was based on a previous study (Fall, J Clin Virol. 2023). A sub-tree was annotated from the same dataset to betterAttorney Docket 91482.272WO-PCT visualize the genomes obtained during this study using FigTree (FigTree. [cited 12 Sep 2023], Available: tree.bio.ed.ac.uk / software / figtree / ).RESULTSEnterovirus Discovery

[0145] From April 27 to October 26, 2022, Applicants screened a total of 177 wastewater samples from congregate living sites, wastewater treatment plants, and Biointel Sampling Basins in Coconino and Maricopa counties, using previously published pan-enterovirus primers (Primer 1 and Primer 3 of the 5 ’-NCR) (Zoll, J Clin Microbiol, 1992). Of those samples, 143 demonstrated banding indicative of a 440bp amplification product when agarose gel electrophoresis or fragment analysis on a tapestation was performed and were moved forward for sequencing. Of these, four samples produced no enterovirus-related reads (FIG. 5, solid black columns), while amplification products from the remaining 139 samples resulted in 35 to 83,113 reads, with a mean of 9,926 and a median of 1,279 reads.

[0146] Sequencing reads from wastewater samples collected during this proj ect were either classified as one of 25 different enteroviruses, or “uncharacterized”. The latter indicates that the combination of the selected reference database coupled with the QIIME 2-based approach could not classify the reads because 1) they were not from enteroviruses (e.g. non-specific amplification), 2) the classification method was too conservative (i.e. did not allow for enough mismatches), 3) the reference database included too much overlap, preventing conclusive subspecies calls, or 4) that novel enteroviruses were present in the collected samples. Enteroviruses that accounted for at least 1% of reads across all sites using the pan-enterovirus assay, in order of greatest to least number of reads, were CV-A6, 34%, EV-D68 (17%), CV- A19 (7%), CV-A4 (2%), and CV-A10 (2%). However, CV-A4 was not present at the congregate living sites. CV-B5, EV-C99, EV-A71, CV-A9, CV-A1, and EV-A76 were limited to Biointel Sampling Basins and wastewater treatment plants. Notably, Applicants also detected Enterovirus G at Northern Arizona (Flagstaff) wastewater treatment plants. This enterovirus species is generally associated with domestic and wild pigs, but has been recently detected in human wastewater sources in the southern part of the state (Faleye TOC, Driver EM, Bowes DA, Holm RH, Talley D, Yeager R, et al. Detection of human, porcine and canine picornaviruses in municipal sewage sludge using pan-enterovirus amplicon-based long-read Illumina sequencing. Emerg Microbes Infect. 2022;l l : 1339-1342).Attorney Docket 91482.272WO-PCTEV-D68 Viral Load in Two Arizona Communities

[0147] The pan-enterovirus assay revealed the presence of EV-D68 in 65 samples (FIG. 5). Applicants further investigated EV-D68 viral loads in wastewater using an RT-qPCR assay recently published by the CDC (Ng TFF, Allan Nix W, Rogers SL, Emery B, Chern S-W, Butler K, et al. Type-specific EV-D68 real-time RT-PCR assay for the detection of all extant Enterovirus-D68 strains. bioRxiv. 2023. p. 2022.10.06.511205. doi: 10.1101 / 2022.10.06.511205), as well as the D68-Detect assay developed as part of this project. The first sample found to have EV-D68 reads using the pan-enterovirus assay dated to June 22, 2022 (n=20 reads), however neither RT-qPCR assay resulted in detection. Panenterovirus sequencing reads from this sample also revealed the higher relative abundance of CV-A4, CV-A6, and CV-A19, which are more likely to be responsible for the agarose gel electrophoresis banding that prompted further processing of this sample for pan-enterovirus sequencing. Using both the RT-qPCR and pan-enterovirus approaches, EV-D68 was not detected again until August 10, 2022 at the City of Flagstaff s Wildcat Hill wastewater treatment plant. An additional 114 samples were found to be RT-qPCR positive in the late summer and early fall of 2022, where the viral load in both Tempe and Flagstaff peaked in late August and declined throughout September (FIGs. 6A-6D). In both cities, the D68-Detect assay estimated a higher viral load compared to the CDC2022 assay which could be due to differences in optimization and validation methods (e.g. positive control(s) used, RT-qPCR platform). The last RT-qPCR positive wastewater samples from Tempe and Flagstaff were collected October 11 and October 19, 2022, respectively. In contrast to wastewater samples, none of the 382 nasal samples from school-age children in Coconino County or long-term care facility patients in Maricopa County were positive for EV-D68.

[0148] In summary, multiple enterovirus species were identified in Arizona wastewater during late summer and early fall of 2022, with Coxsackievirus A6, EV-D68, and Coxsackievirus Al 9 composing 86% of the characterized reads sequenced. An in-depth analysis of EV-D68 revealed that while no pooled human samples were found to be positive by Applicants and no acute flaccid myelitis cases were reported to the Arizona Department of Health Services, the virus was circulating in the state from August through mid-October. A phylogenetic analysis revealed that just one importation into the state led to local circulation.Attorney Docket 91482.272WO-PCT

[0149] These results further support the utility of wastewater-based epidemiology using the disclose assays to identify potential public health threats. In the case of EV-D68, this strategy can be used for diagnosis and treatment of EV-D68 infection. Results of testing using the disclosed assay can be used by pediatricians, physicians, and other healthcare personnel to consider this virus if a subject presents with neurological symptoms. If EV-D68 virus is detected in the sample, the subject may then be treated with an antiviral treatment.

[0150] A direct comparison of EV-D68 load in City of Flagstaff wastewater versus total enterovirus / rhinovirus percent positivity at Flagstaff Medical Center indicates that wastewater trends led hospital trends by 3 days. Both the Akaike information criterion and generalized cross-validation were optimized with this lag, with change in wastewater explaining 98.6% of the deviance in hospital positivity rates. However, the wastewater date of collection used in this analysis was the date the samples were collected, while the hospital date is the last day in the reporting week, and includes cases reported throughout the entire week. Therefore, the three-day lag between EV-D68 load in wastewater and enterovirus / rhinovirus percent positivity at the hospital indicates essentially no difference between the two surveillance methods.Efficacy of a New Tiled Amplicon Sequencing Scheme

[0151] A multiplex of tiled EV-D68-specific primers covering genome positions 60-7308 was designed as part of this study for targeted sequencing of 31 contemporary EV-D68 genomes from Arizona wastewater. Efficacy of the multiplex was assessed on three different positive controls (PTCs) from BEI Resources from 2014 (NR-49135), 2018 (NR-52537), and 2020 (NR-55939). Breadth of coverage ranged from 86-100% within the 60-7308 position range, with depth of at least 50x (FIG. 7).

[0152] Each PTC was sequenced on an Illumina NextSeq 1000 system using a Pl 600 cycle kit and results were as follows: 2014 PTC received 10,221,430 paired-end reads (3.93% of lane), 2018 PTC received 15,921,338 paired-end reads (6.12% of lane), 2020 PTC received 18,979,870 paired-end reads (7.29% of lane). Phylogenetic analysis of the controls revealed each control clustered in three different subclades (Bl, B3, and D respectively). The 2018 control performed the best with just 1.90% of the genome receiving less than 50X coverage and more than 92% of the genome receiving greater than 10,000X coverage. The 2020 control performed the worst of the three with 13.43% of the genome receiving less than 50X coverageAttorney Docket 91482.272WO-PCT and only 67.75% receiving greater than 10,000X coverage. Efficacy of the multiplex on the 2014 control was comparable to the 2018 control with less than 3% of the genome receiving less than 50X coverage and 84.54% receiving greater than 10,000X coverage. Through the validation of the new tiled primer multiplex using PTCs, Applicants were able to assess the panel’s efficacy on diverse EV-D68 genomes. The pairwise percent identity between the PTCs and 2021 reference genome (OP267522.1) used to design the multiplex can be seen in FIG. 8. Application of a New Tiled Amplicon Sequencing Scheme on Wastewater Samples

[0153] Once the tiled amplicon primer set was assessed on positive controls, Applicants applied the same protocol to 31 wastewater samples that had tested positive for EV-D68 using both RT-qPCR assays. The total breadth of coverage ranged from 61.36-97.47%, with at least lOx coverage, when using OP267522.1 as a reference genome. While Illumina platforms were used to sequence genomes from all 31 samples, those sequenced on a NovaSeq 6000 (SP vl .5 500 cycle kit) received more paired end reads (1,556,926-8,623,394) than samples sequenced on a MiSeq using a v2 500 cycle kit (22,084-311,666). Correspondingly, EV-D68 genomes sequenced on the NovaSeq 6000 had a median breadth of coverage of 92.21%, versus 76.55% for the MiSeq, not indicating a difference between the platform, but rather the greater number of reads allocated per sample. The percentage of sequenced reads mapping to EV-D68 ranged between 0.7-66.2%, indicating that the tiled amplicon primers generated a substantial amount of non-specific binding and amplification, or that residual DNA from the starting sample was carried through the entire process, which would not be surprising for wastewater samples.Phylogenetic Analysis of EV-D68 from Arizona within a Global Context

[0154] A global maximum likelihood phylogenetic reconstruction was carried out to provide context around dispersal of EV-D68 into and within Arizona. All 31 Arizona wastewater genomes were part of the B3 subclade. Of those, 30 were nested within genomes collected in Maryland, USA, overlapping the same time frame — July to September of 2022 (FIG. 4, bootstrap support of 100). Twenty -nine clustered monophyletically within the Maryland genomes, although not by city, location type, or date of collection. Importantly, bootstrap support for the cluster of 29 Arizona wastewater genomes was lower than for clusters primarily composed of clinical genomes (FIG. 4). This is likely the result of a larger number of uncalled sites (N’s) that arose either due to lower genome coverage or mixed nucleotide calls, both common for viruses sequenced from wastewater.Attorney Docket 91482.272WO-PCT

[0155] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth.

Claims

Attorney Docket 91482.272WO-PCTCLAIMSWhat is claimed is:

1. A method of detecting the presence of one or more Enterovirus-D68 (EV-D68) variants in a sample comprising: a) producing one or more amplicons by amplifying one or more nucleic acid segments from the sample using: i. at least one forward primer comprising a first 5’ universal tail sequence and an EV- D68 specific sequence selected from the group consisting of SEQ ID NOS: 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, and 91, and ii. at least one reverse primer comprising a second 5’ universal tail sequence and an EV-D68 specific sequence selected from the group consisting of SEQ ID NOS: 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, and 92; and b) sequencing the one or more amplicons to detect the presence of the one or more EV- D68 variants, wherein each universal tail sequence does not overlap in sequence with any of the one or more amplicons.

2. The method of claim 1, further comprising classifying the one or more EV-D68 variants into a lineage, subclade, or strain based on phylogenetic analysis of the amplified sequences.

3. The method of claim 1 or 2, wherein the one or more EV-D68 variants are detected before any symptomatic subjects are identified at the location where the sample was collected.

4. The method of any of claims 1 to 3, wherein the sample is obtained from a human subject.

5. The method of claim 4, wherein if an EV-D68 variant is detected in the sample the subject is treated with an antiviral treatment.

6. The method of any of claims 1 to 3, wherein the sample comprises an environmental sample.Attorney Docket 91482.272WO-PCT7. The method of claim 6, wherein the environmental sample is wastewater.

8. The method of claim 6 or 7, wherein if one or more EV-D68 variants is detected in the sample a public health response is initiated.

9. The method of any of claims 1 to 8, wherein the EV-D68 specific sequences of the forward and reverse primers consist of SEQ ID NOS: 47-92.

10. The method of claim 9, wherein the forward and reverse primers consist of SEQ ID NOS: 1-46.

11. A method of detecting the presence of Enterovirus-D68 (EV-D68) in a sample comprising: a) performing real-time polymerase chain reaction (PCR) to amplify nucleic acid segments from the sample, wherein the amplifying step includes using: i. a forward primer consisting of TMCATGGCTCTCCAGGAACT, wherein M is either A or C, ii. a reverse primer consisting of CTTAGGGTCTGGGGGCARGG, wherein R is either A or G, and iii. a fluorescently labeled probe consisting of TGGCCTCAAATTTAATTGCCAGGGC; and b) detecting the presence of EV-D68 in the sample by comparing the amplification results to a control value.

12. The method of claim 11, wherein the EV-D68 is detected before any symptomatic subjects are identified at the location where the sample was collected.

13. The method of claim 11 or 12, wherein the sample is obtained from a human subject.

14. The method of claim 13, wherein if EV-D68 is detected in the sample the subject is treated with an antiviral treatment.

15. The method of claim 11 or 12, wherein the sample comprises an environmental sample.Attorney Docket 91482.272WO-PCT16. The method of claim 15, wherein the environmental sample is wastewater.

17. The method of claim 15 or 16, wherein if EV-D68 is detected in the sample a public health response is initiated.

18. A kit for amplifying and sequencing Enterovirus-D68 (EV-D68) variants comprising one or more forward and reverse primers, wherein the one or more forward primers comprise a first 5’ universal tail sequence and an EV-D68 specific sequence selected from the group consisting of SEQ ID NOS: 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, and 91, and the one or more reverse primers comprise a second 5’ universal tail sequence and an EV-D68 specific sequence selected from the group consisting of SEQ ID NOS: 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, and 92, wherein each universal tail sequence does not overlap in sequence with any target of the one or more forward and reverse primers.

19. The kit of claim 18, wherein the EV-D68 specific sequences of the forward and reverse primers consist of SEQ ID NOS: 47-92.

20. The kit of claim 19, wherein the forward and reverse primers consist of SEQ ID NOS: 1-46.

21. The kit of any of claims 18 to 20, further comprising a nucleotide polymerase, buffer, diluent, and / or excipient.

22. A kit for detecting EV-D68 comprising: i. a forward primer consisting of TMCATGGCTCTCCAGGAACT, wherein M is eitherA or C, ii. a reverse primer consisting of CTTAGGGTCTGGGGGCARGG, wherein R is either A or G, and iii. a fluorescently labeled probe consisting of TGGCCTCAAATTTAATTGCCAGGGC.

23. The kit of claim 22, further comprising a nucleotide polymerase, buffer, diluent, and / orAttorney Docket 91482.272WO-PCT excipient.

24. An in vitro method for detecting Enterovirus-D68 (EV-D68) in a sample, the method comprising: i. amplifying at least two EV-D68 genomic regions using a primer set comprising at least one forward primer and at least one reverse primer, each primer including a 5' universal tail and an EV-D68-specific primer sequence selected from SEQ ID NOs: 47-92; and ii. sequencing the resulting amplicons and determining the presence of EV-D68 in the sample; wherein each 5' universal tail sequence shares no stretch of >12 contiguous nucleotides with any target amplicon sequence generated in step (a).

25. The method of claim 24, wherein the amplified regions include a region within the EV-D68 2C gene.

26. The method of claim 1 or 2, wherein the sample is wastewater.

27. The method of any preceding claim, further comprising assigning the detected EV-D68 to a lineage, clade or subclade based on the amplicon sequence(s).

28. A primer set for in vitro detection and / or sequencing of Enterovirus-D68 (EV-D68), comprising: i. one or more forward primers consisting of a 5' universal tail of SEQ ID NO:93 and an EV-D68-specific sequence selected from SEQ ID NOs: 47, 49, 51, 53, 55, 57, 59, 61,63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89 or 91; and ii. one or more reverse primers consisting of a 5' universal tail of SEQ ID NO:94 and an EV-D68-specific sequence selected from SEQ ID NOs: 48, 50, 52, 54, 56, 58, 60, 62,64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90 or 92; wherein the 5' universal tail sequences each share no stretch of >12 contiguous nucleotides with any EV-D68 target amplicon.

29. A kit for in vitro detection of EV-D68 comprising the primer set of claim 28 andAttorney Docket 91482.272WO-PCT instructions for use in amplicon sequencing, optionally further comprising a polymerase, buffers and a positive control.

30. An in vitro method for detecting EV-D68 in a sample by RT-qPCR, comprising using: i. a forward primer comprising SEQ ID NO:95 or a sequence >95% identical thereto, ii. a reverse primer comprising SEQ ID NO:96 or a sequence >95% identical thereto, and iii. a probe comprising SEQ ID NO:97 or a sequence >95% identical thereto, under conditions that produce a detectable fluorescent signal indicative of EV-D68.

31. The method of claim 30, wherein identity is determined by global Needleman-Wunsch alignment with gap-open 10 and gap-extend 0.5 and where each primer sequence differs by no more than two mismatches from the respective SEQ ID NO under the claimed RT-qPCR conditions.

32. Use of a primer and probe set comprising SEQ ID NOs:95-97 for in vitro detection of EV-D68 in wastewater to provide information suitable for public health surveillance.