Composition and method for treating mitochondrial disorders
The antioxidant peptide composition addresses the inadequacies of current mitochondrial disorder treatments by restoring mitochondrial function and reducing oxidative stress, effectively treating diseases like cardiovascular disease, aging, type 2 diabetes, and obesity.
Patent Information
- Application Number
- PCT/KR2025/021791
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-09-05
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-25
Smart Images

Figure KR2025021791_25062026_PF_FP_ABST
Abstract
Description
Composition and method for treating mitochondrial disorders
[0001] The present invention relates to a composition and method for treating mitochondrial disorders, and more specifically, to the use of an antioxidant peptide having an antioxidant function that restores the function of mitochondria damaged by reactive oxygen species generated from various stress factors and removes reactive oxygen species generated by damaged mitochondria. The invention relates to a composition and method for treating mitochondrial disorders to effectively treat or prevent mitochondrial disorders, including cardiovascular disease, aging, type 2 diabetes and metabolic disease, and obesity, which are reported to originate from mitochondrial damage.
[0002]
[0003] Mitochondria are intracellular organelles whose primary function is to produce ATP, the source of usable energy, through the oxidative phosphorylation of intracellular substrates (carbohydrates, proteins, and lipids). They also regulate intracellular signaling and oxidative damage through the reactive oxygen species (ROS) generated during this process. Furthermore, they control cell apoptosis and cell recycling by regulating signals for cell death. In addition, they are important intracellular organelles that regulate cell survival and death through the regulation of intracellular calcium signaling, hormone synthesis, and inflammatory responses.
[0004] Meanwhile, although mitochondria perform the vital function of generating energy to sustain life within cells, they can have adverse effects on cells by generating harmful reactive oxygen species (ROS) in the process. Harmful ROS damage DNA and various proteins, cause cell loss, and are a cause of various diseases. In particular, the primary mechanism of mitochondrial dysfunction occurs through mitochondrial DNA (mtDNA) mutations, and mtDNA damage is largely attributed to ROS. Furthermore, excessive NO generated from iNOS is reported to increase mitochondrial damage. Considering the above, it can be presumed that mitochondria act as initiators and / or promoters of the aging process.
[0005] Recent studies have suggested that deletions and mutations in mitochondrial DNA (mtDNA) play a significant role in the progression of chronological and photo-induced skin aging. Indeed, mitochondria are key intracellular organelles essential for maintaining cellular function due to their role in supplying adenosine triphosphate (ATP) through oxidative phosphorylation. Therefore, a decrease in ATP supply resulting from the degradation of MT is expected to be one of the initiators and / or promoters of the aging process.
[0006] In this regard, the major mechanisms of cardiovascular disease, aging, type 2 diabetes and metabolic diseases, obesity, drug addiction, and skin diseases are reported to originate from stress-induced mitochondrial damage. Recently, many studies are being conducted to verify the potential for treating diseases through the control of mitochondrial dysfunction.
[0007] Since mitochondrial dysfunction is not a single symptom or disease but can manifest in various phenotypes across different organs of the human body, the potential for treatments specific to lesions and diseases associated with damaged mitochondria has been raised; however, the development of precise targets or suitable therapeutic technologies remains insufficient to date. In particular, increased oxidative stress caused by elevated intracellular reactive oxygen species has recently been proposed as a fundamental cytological and molecular mechanism in cardiovascular, metabolic, and neurodegenerative diseases; yet, metabolic therapeutic agents or antioxidants currently used in clinical and preclinical stages have proven ineffective. Therefore, identifying targets capable of directly controlling mitochondrial function and developing therapeutic methods is an essential task.
[0008] Mitochondria are organized into a highly dynamic tubular network that is continuously reformed by opposing processes known as fusion and fission. These dynamic processes control not only mitochondrial morphology but also their intracellular localization and function. Defects in either fusion or fission restrict mitochondrial motility, reduce energy production, and increase oxidative stress, thereby promoting cellular dysfunction and apoptosis. These two opposing processes of fusion and fission are controlled by evolutionarily conserved large GTPases belonging to the dynamin-related protein family. In mammalian cells, mitochondrial fusion is regulated by mitofusin-1 and -2 (MFN-1 / 2) and optic atrophy 1 (OPA1), while mitochondrial fission is controlled by dynamin-1 related proteins such as Drp1 and mitochondrial adapters like Fis1, Mff, and MIEF1.
[0009] Mitochondrial homeostasis is maintained through the process of autophagy. This autophagy process is called mitophagy. In mitochondria whose function is impaired by reactive oxygen species (ROS), a vicious cycle begins in which even more ROS are produced. Mitophagy limits the generation of ROS species, prevents the accumulation of mitochondrial DNA (mtDNA) mutations and the reduction of ATP production, and blocks apoptosis signaling and the activation of inflammasomes. It appears that the gradual decline of this type of selective phagocytosis over a lifetime leads to mitochondrial dysfunction and aging.
[0010] Failure of mitochondrial redox homeostasis and excessive free radical formation are closely associated with dysregulation of the Renin-Angiotensin System (RAS). Angiotensin-converting enzyme (ACE) is reported to play a crucial role in regulating oxidative stress, metabolism, and inflammation; in rodent experiments, increased mitochondrial ROS production and the induction of cardiomyopathy were observed upon the injection of Ang II. This suggests that the RAS can directly affect mitochondrial function. Dysregulation of the RAS exacerbates various acute and chronic diseases, such as atherosclerosis, renal disease, post-infarct myocardial damage, cerebral infarction, cardiac hypertrophy, and fibrosis; in particular, oxidative stress caused by increased intracellular reactive oxygen species is proposed as a major pathological mechanism for cardiovascular diseases, metabolic diseases, and neurodegenerative diseases.
[0011] Currently, ACE inhibitors are used as treatments for hypertension, but due to various side effects, there is a need to develop safer and more effective substances. Mitochondrial dysfunction is not a single symptom or disease but manifests in various phenotypes across different organs of the human body; while attempts are being made to develop disease-specific therapies associated with this, the development of precise targets or suitable therapeutic technologies remains insufficient. Therefore, the development of new approaches aimed at regulating RAS, reducing oxidative stress, and improving mitochondrial function is required for the prevention and treatment of diseases related to mitochondrial dysfunction. Meanwhile, antioxidant peptides are attracting attention for their ability to effectively eliminate reactive oxygen species (ROS) and block free radical-mediated reactions. These peptides have the advantages of low or no toxicity, are abundant in food sources, and possess diverse functions.
[0012] The Antioxidant Peptide Prediction System (AnOxPP) is an efficient tool for predicting the antioxidant activity of peptides using a BiLSTM neural network and the optimized amino acid descriptor SDPZ27. SDPZ27 interprets the significance of the four major characteristics of AnOxPs (stereochemistry, hydrophobicity, electronic properties, and hydrogen bonding contribution), thereby enabling AnOxPP to make accurate predictions. This technology is currently being actively researched due to its advantage of reducing laboratory research time.
[0013] The present invention aims to provide a composition comprising an antioxidant peptide that restores mitochondrial function and a method for preventing or treating mitochondrial disorders using the same.
[0014] Another objective of the present invention is to provide an antioxidant peptide composition that can be used for the prevention or treatment of various diseases, including cardiovascular disease, aging, type 2 diabetes and metabolic disease, and obesity caused by mitochondrial dysfunction.
[0015] Another objective of the present invention is to provide an antioxidant peptide and its uses that can improve mitochondrial function and prevent or treat related diseases by effectively removing reactive oxygen species (ROS) within mitochondria and reducing oxidative stress.
[0016]
[0017] The objectives of the present invention are not limited to those mentioned above, and other unmentioned objectives will be clearly understood by those skilled in the art from the description below.
[0018]
[0019] According to one aspect of the present invention for solving the above technical problem, a composition for the prevention or treatment of mitochondrial disorders is provided, comprising an antioxidant peptide that restores mitochondrial function:
[0020] KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1)
[0021] In the above general formula 1,
[0022] R1 is arginine (R), lysine (K), or glutamine (Q);
[0023] R2 is arginine (R) or glutamine (Q);
[0024] R3, R4, and R5 are each arginine (R) or lysine (K);
[0025] R6 is asparagine (N) or serine (S); and
[0026] R7 and R8 are lysine (K) or tyrosine (Y).
[0027]
[0028] The composition of the present invention can be used for the prevention or treatment of various diseases caused by mitochondrial dysfunction (cardiovascular disease, aging, type 2 diabetes, metabolic disease, obesity, skin disease, etc.).
[0029] In addition, the composition of the present invention includes an antioxidant peptide that can effectively remove reactive oxygen species (ROS) within mitochondria and reduce oxidative stress.
[0030] In addition, the composition of the present invention can prevent or treat related diseases by improving mitochondrial function.
[0031] According to another aspect of the present invention, a composition for the prevention or treatment of mitochondrial disorders may be provided, comprising an antioxidant peptide composed of an amino acid sequence of General Formula 1 that restores mitochondrial function.
[0032] According to another aspect of the present invention, a composition for the prevention, improvement, or treatment of mitochondrial disorders, including cardiovascular disease, aging, type 2 diabetes, metabolic disease, and obesity, may be provided, comprising an antioxidant peptide composed of an amino acid sequence of General Formula 1 that restores mitochondrial function.
[0033] Variant peptides having a different sequence from the amino acid sequence constituting them and one or more amino acid residues, as long as they can restore mitochondrial function and exhibit an antioxidant effect, may also be included in the category of antioxidant peptides provided in the present invention.
[0034] In general, amino acid exchanges in proteins and polypeptides that do not alter the overall activity of the molecule are known in the art. The most common exchanges are exchanges between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Additionally, peptides may be included in which the structural stability of the peptide against heat, pH, etc. is increased by mutations or modifications in the amino acid sequence.
[0035] For example, glutamine, an acidic amino acid located at position 3 of the peptide of SEQ ID NO. 1 provided in the present invention, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with lysine or arginine, which are basic amino acids; arginine, a basic amino acid located at position 4 or 5 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with glutamine, an acidic amino acid, or lysine, which is a basic amino acid; lysine, a basic amino acid located at position 6, 7, or 9 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with arginine, which is a basic amino acid, or tyrosine, which is an aromatic amino acid; and asparagine, an acidic amino acid located at position 8 of the peptide of SEQ ID NO. 1, can exhibit the same effect of the peptide provided in the present invention even if it is substituted with serine, which is a neutral amino acid; Even if tyrosine, an aromatic amino acid located at position 10 of the peptide of sequence number 1, is substituted with lysine, a basic amino acid, the effect of the peptide provided in the present invention can still be exhibited.
[0036] As such, since the acidic amino acid, basic amino acid, or aromatic amino acid constituting the antioxidant peptide of the present invention can be substituted with other acidic amino acid, basic amino acid, neutral amino acid, or aromatic amino acid, respectively, and still exhibit the same effect of the peptide provided by the present invention, it is obvious that variant peptides having a sequence different from the amino acid sequence constituting the peptide of the present invention and one or more amino acid residues are also included in the category of the peptide provided by the present invention.
[0037] In addition, the peptide of the present invention is included in the category of the peptide provided by the present invention, as it can exhibit the same effects as the peptide provided by the present invention even if it has a form in which any amino acid is added to its N-terminus or C-terminus. As one example, the peptide may have a form in which 1 to 300 amino acids are added to its N-terminus or C-terminus, as another example, the peptide may have a form in which 1 to 100 amino acids are added to its N-terminus or C-terminus, and as yet another example, the peptide may have a form in which 1 to 24 amino acids are added to its N-terminus or C-terminus.
[0038] In another aspect of the present invention, the present invention provides a polynucleotide encoding the peptide.
[0039] The above polynucleotide may be modified by substitution, deletion, insertion, or a combination thereof, of one or more bases. When preparing a nucleotide sequence by chemical synthesis, synthesis methods widely known in the art, such as the method described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988), may be used, and synthesis may be performed using the tryster, phosphite, phosphoramidite, and H-phosphate methods, PCR and other autoprimer methods, and methods for synthesizing oligonucleotides on solid supports. For example, the polynucleotide encoding the peptide of the present invention may include the base sequence of SEQ ID NO. 4.
[0040] In another aspect, the present invention provides an expression vector comprising the polynucleotide, a transformant comprising the expression vector, and a method for producing the peptide using the transformant.
[0041] The term "expression vector" in the present invention refers to a recombinant vector capable of expressing a target peptide in a target host cell, comprising a genetic construct that includes essential regulatory elements operably linked to enable the expression of a gene insert. The expression vector comprises expression regulatory elements such as a start codon, a stop codon, a promoter, and an operator, wherein the start codon and the stop codon are generally considered to be part of a nucleotide sequence encoding a polypeptide, must exhibit action in the individual when the genetic construct is administered, and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.
[0042] The term "operably linked" in this invention refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to influence the expression of the coding sequence. Operatory linkage with an expression vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes or the like generally known in the art.
[0043] Additionally, the expression vector may include a signal sequence for the release of the peptide to facilitate the separation of the peptide from the cell culture medium. A specific initiation signal may also be required for the efficient translation of the inserted nucleic acid sequence. These signals include an ATG start codon and adjacent sequences. In some cases, an exogenous translation regulatory signal that may include an ATG start codon must be provided. These exogenous translation regulatory signals and start codons may be from various natural and synthetic sources. Expression efficiency may be increased by the introduction of appropriate transcription or translation enhancing factors.
[0044] In addition, the expression vector may additionally include a protein tag that can be removed using an endopeptidase, optionally, to facilitate the detection of the peptide.
[0045] The term "tag" in the present invention refers to a molecule exhibiting quantifiable activity or characteristics, and may be a fluorescent molecule including a chemical fluorescent substance (fluoracer) such as fluorescein, a fluorescent protein (GFP), or a polypeptide fluorescent substance such as a related protein; or may be an epitope tag such as a Myc tag, a Flag tag, a histidine tag, a leucine tag, an IgG tag, or a streptavidin tag. In particular, when using an epitope tag, a peptide tag composed of at least 6 amino acid residues, and more preferably composed of 8 to 50 amino acid residues, may be used.
[0046] In the present invention, the expression vector may include a nucleotide sequence encoding an antioxidant peptide that provides the effect of restoring mitochondrial function according to the present invention described above. The vector used is not particularly limited to this, as long as it is capable of producing the peptide, but preferably may be plasmid DNA, phage DNA, etc., and more preferably may be a commercially developed plasmid (pUC18, pBAD, pIDTSAMRT-AMP, etc.), an E. coli-derived plasmid (pYG601BR322, pBR325, pUC118, pUC119, etc.), a Bacillus subtilis-derived plasmid (pUB110, pTP5, etc.), a yeast-derived plasmid (YEp13, YEp24, YCp50, etc.), phage DNA (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.), or an animal virus. The vectors may be retroviruses, adenoviruses, vaccinia viruses, etc., or insect virus vectors (baculoviruses, etc.). Since the protein expression levels and modifications of the above expression vectors vary depending on the host cell, it is desirable to select and use the host cell most suitable for the purpose.
[0047] The transformant provided in the present invention can be produced by introducing the expression vector provided in the present invention into a host and transforming it, and can be used to produce the peptide by expressing the polynucleotide contained in the expression vector. The transformation can be performed by various methods, and is not particularly limited thereto as long as the peptide can be produced, but methods such as the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing agent called DMSO (dimethyl sulfoxide) in the CaCl2 precipitation method, electroporation, calcium phosphate precipitation method, protoplasmic fusion method, stirring method using silicon carbide fibers, Agrobacterium-mediated transformation method, PEG-mediated transformation method, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation method may be used. In addition, the host used for the production of the above-mentioned transforming agent may also be bacterial cells such as Escherichia coli, Streptomyces, and Salmonella typhimurium, as long as it can produce the above-mentioned peptide, although it is not particularly limited thereto; yeast cells such as Saccharomyces cerevisiae and Schizoscaromyces pombe; fungal cells such as Pichia pastoris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO, COS, NSO, 293, and Bow melanoma cells; or plant cells.
[0048] The above-described transformant may also be used in a method for producing an antioxidant peptide of the present invention that provides an effect of restoring mitochondrial function. Specifically, the method for producing an antioxidant peptide of the present invention that provides an effect of restoring mitochondrial function may include: (a) a step of culturing the transformant to obtain a culture; and (b) a step of recovering the peptide of the present invention from the culture.
[0049] The term "culture" in the present invention refers to a method of growing microorganisms under appropriately artificially controlled environmental conditions. In the present invention, the method of culturing the transformant can be carried out using methods widely known in the art. Specifically, the culture is not particularly limited to methods that can be produced by expressing the antioxidant peptide of the present invention that provides the effect of restoring mitochondrial function, but can be carried out continuously in a batch process or a fed batch or repeated fed batch process.
[0050] The culture medium used for cultivation must satisfy the requirements of a specific strain in an appropriate manner under aerobic conditions, while controlling temperature, pH, etc., within a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources that can be used include mixed sugars of glucose and xylose as the primary carbon source, as well as sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture. Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products may be used. These nitrogen sources may be used alone or in combination. The medium may contain monopotassium phosphate, dipotassium phosphate, and corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be used as phosphorus. Additionally, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above materials.
[0051] In addition, suitable precursors may be used in the culture medium. The aforementioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner in a manner suitable for the culture process, but are not particularly limited thereto. The pH of the culture may be controlled by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner.
[0052] In addition, bubble formation can be suppressed using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain aerobic conditions. The temperature of the culture is typically 27°C to 37°C, preferably 30°C to 35°C. Culture is continued until the maximum amount of the peptide is obtained. For this purpose, it is usually achieved in 10 to 100 hours.
[0053] In addition, the step of recovering the peptide from the culture may be performed by methods known in the art. Specifically, the recovery method is not particularly limited to methods that can be used to recover the produced peptide, but preferably, methods such as centrifugation, filtration, extraction, spraying, drying, vaporization, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion) may be used.
[0054] The term "prevention" in the present invention refers to any act of inhibiting or delaying the occurrence of mitochondrial disorder by administering a pharmaceutical composition for the prevention or treatment of mitochondrial disorder containing the peptide of the present invention.
[0055] The term "treatment" in the present invention refers to any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for a mitochondrial disorder, thereby restoring mitochondrial function and thereby performing treatment for the mitochondrial disorder.
[0056]
[0057] *57 The pharmaceutical composition of the present invention may be prepared in the form of a pharmaceutical composition for treating mitochondrial disorders, which further comprises a suitable carrier (natural or non-natural carrier), excipient, or diluent that is conventionally used in the preparation of pharmaceutical compositions to the peptide. Specifically, the pharmaceutical composition may be formulated and used in the form of a sterile injectable solution that can be administered to a site where a mitochondrial disorder has been induced, according to a conventional method. In the present invention, carriers, excipients, and diluents that may be included in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, collagen, etc. When formulating, the composition may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. In particular, sterile aqueous solutions, non-aqueous solvents, suspending agents, emulsions, lyophilized preparations, suppositories, ointments (e.g., pulp relining agents, etc.) may be included. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cocoa oil, laurin oil, glycerogelatin, etc. may be used.
[0058] The content of the peptide included in the pharmaceutical composition of the present invention is not particularly limited thereto, but may be included in an amount of 0.0001 to 50 weight%, more preferably 0.01 to 20 weight% based on the total weight of the final composition.
[0059] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceuticalally effective amount" in this invention refers to an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention. The effective dose level may be determined based on factors including the severity of the disease, drug activity, the patient's age, weight, health, gender, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition of the present invention, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with known pharmaceutical compositions for treating mitochondrial disorders. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration.
[0060] The dosage of the pharmaceutical composition of the present invention may be determined by a person skilled in the art by taking into consideration the purpose of use, the severity of the disease, the patient's age, weight, gender, medical history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention may be administered at a dose of about 0.1 ng to about 100 mg / kg, preferably 1 ng to about 10 mg / kg per adult. The frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.
[0061] In another aspect, the present invention provides a method for treating a mitochondrial disorder, comprising the step of administering the above pharmaceutical composition in a pharmaceutically effective amount to an individual with a mitochondrial disorder.
[0062] The term "mitochondrial disorder disease" in this invention refers to a disease caused by mitochondrial dysfunction, and includes a diverse group of diseases such as cardiovascular disease, aging, type 2 diabetes, metabolic disease, and obesity.
[0063] The term "cardiovascular disease" in this invention refers to a disease of the heart and vascular system caused by mitochondrial dysfunction.
[0064] The term "type 2 diabetes" in the present invention refers to a metabolic disease in which insulin resistance occurs due to mitochondrial dysfunction, resulting in problems with blood sugar control.
[0065] The term "metabolic disease" in this invention refers to various metabolic disorders caused by dysfunction of mitochondrial energy metabolism.
[0066] The term "obesity" in this invention refers to a metabolic disease in which body fat is excessively accumulated due to impaired energy metabolism function of mitochondria.
[0067] The term “skin disease” in this invention refers to photoaging, dermatomyositis, cutaneous fibrosis, psoriasis, hyperpigmentation, atopic dermatitis, precancerous skin disease, alopecia, lupus dermatitis, or seborrheic keratosis.
[0068] The term “skin disease” in the present invention may more preferably mean photoaging, pigmentation, or precancerous skin condition.
[0069] The term “photoaging” in this invention refers to a condition in which mitochondrial dysfunction is induced by exposure to ultraviolet rays (UVA / UVB), and the activation of matrix metalloproteinases (MMP-1 / -3 / -9) is promoted by an increase in reactive oxygen species (ROS), thereby accelerating collagen degradation and skin wrinkle formation.
[0070] The term “Dermatomyositis” in the present invention refers to an autoimmune disease accompanied by skin rash and muscle weakness due to the oversecretion of inflammatory cytokines such as IL-6 and TNF-α in muscle and skin cells.
[0071] The term “Skin Fibrosis” in the present invention refers to a disease in which the TGF-β signaling pathway is activated by mitochondrial-derived ROS, leading to collagen overproduction and fibroblast senescence, resulting in damage to skin elasticity.
[0072] The term “Psoriasis” in the present invention refers to a chronic inflammatory disease in which IL-17 secretion increases due to Th17 cell activation by IL-23, leading to the overproliferation of keratinocytes and the formation of silvery-white scales on the skin.
[0073] The term “hyperpigmentation” in this invention refers to a disease in which tyrosinase enzyme activation is promoted due to a decline in mitochondrial function, resulting in irregular melanin deposition on the skin.
[0074] The term “Atopic Dermatitis” in this invention refers to a disease characterized by persistent skin dryness and itching, resulting from the excessive secretion of type II inflammatory cytokines such as IL-4 and IL-13 due to a skin barrier defect.
[0075] The term “Actinic Keratosis” in this invention refers to a disease in which genomic instability of keratinocytes increases due to chronic ultraviolet radiation damage, and p53 tumor suppressor gene mutations accumulate, leading to the development of precancerous lesions.
[0076] The term “Alopecia” in this invention refers to a disease in which ATP production decreases and the hair growth cycle is shortened due to dysfunction of the mitochondrial respiratory chain complex of hair follicle stem cells.
[0077] The term “Cutaneous Lupus” in this invention refers to an autoimmune disease in which the production of antinuclear antibodies (ANA) is promoted, resulting in photosensitive rashes or discoid lesions on the skin.
[0078] The term “Seborrheic Keratosis” in the present invention refers to a benign disease in which brown or black keratinized lesions are formed due to abnormal proliferation of keratinocytes and melanocytes during the skin aging process. The administration route of the pharmaceutical composition for treating mitochondrial disorders of the present invention may be any general route as long as it can reach the target tissue. The pharmaceutical composition of the present invention may be provided in any formulation suitable for topical application, as intended, but is not particularly limited thereto. For example, it may be administered orally, transdermally, intravenously, intramuscularly, or by subcutaneous injection. The pharmaceutical composition may be an injectable, a topical solution, a suspension, an emulsion, a gel, a patch, or a spray, but is not limited thereto. The above formulation can be easily prepared according to conventional methods in the field, and surfactants, excipients, wettable powders, emulsification promoters, suspending agents, salts or buffers for osmotic pressure control, coloring agents, spices, stabilizers, preservatives, preservatives, or other commonly used auxiliary agents may be appropriately used.
[0079] In another aspect, the present invention provides a quasi-drug composition for preventing or improving mitochondrial disorder diseases comprising the above peptide.
[0080] The term "improvement" in this invention refers to any action that at least reduces parameters related to the condition being treated, such as the degree of symptoms.
[0081] In the present invention, the improvement can be interpreted to mean any act of administering a pharmaceutical composition containing the peptide of the present invention as an active ingredient to an individual requiring treatment for a mitochondrial disorder, thereby restoring mitochondrial function and improving or benefiting the symptoms of the mitochondrial disorder.
[0082] The term "quasi-drug" in the present invention refers to articles used for the purpose of diagnosing, treating, improving, alleviating, managing, or preventing diseases of humans or animals, which have a milder effect than pharmaceuticals. For example, according to the Pharmaceutical Affairs Act, quasi-drugs are defined as articles excluding those used for pharmaceutical purposes. These include fiber and rubber products used for the treatment or prevention of diseases in humans and animals, items that have a mild or no direct effect on the human body and are not instruments or machines, and similar items, as well as disinfectants and insecticides for preventing infectious diseases.
[0083] In the present invention, the type or formulation of the quasi-drug composition containing the peptide is not particularly limited, but as an example, it may be a disinfectant cleanser for skin or hair, a skin or hair cleansing product, soap, shampoo, skin ointment, etc.
[0084] In another aspect, the present invention provides a health functional food composition for preventing or improving mitochondrial disorder diseases comprising the above peptide.
[0085] The term "food" in the present invention includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.
[0086] The above-mentioned functional food is synonymous with food for special health use (FosHU) and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to nutritional supply. Here, "functionality" means obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The food of the present invention can be manufactured by methods commonly used in the industry, and during such manufacturing, raw materials and ingredients commonly added in the industry may be added. Furthermore, the formulation of the food can be manufactured without restriction as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations. Unlike general pharmaceuticals, it has the advantage of being made from food ingredients and thus avoiding side effects that may occur with long-term use of pharmaceuticals. Additionally, due to its excellent portability, the food of the present invention can be consumed as an adjuvant to enhance the effects of preventing or improving mitochondrial disorders.
[0087] The aforementioned "health food" refers to a food that has active effects in maintaining or promoting health compared to general food, and "health supplement food" refers to a food intended for the purpose of supporting health. In some cases, the terms health functional food, health food, and health supplement food may be used interchangeably.
[0088] Specifically, the above-mentioned health functional food is a food prepared by adding the peptide of the present invention to food materials such as beverages, teas, spices, chewing gums, and confectionery, or by encapsulating, powdering, or suspension, and means that consuming it brings about specific health effects. Unlike general medicines, it has the advantage of not having side effects that may occur when taking medicine for a long period of time because it is made from food.
[0089] The food composition of the present invention can be consumed on a daily basis, and since a high effect can be expected for the prevention or improvement of mitochondrial disorders, it can be used very effectively.
[0090] The above food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited, and any carrier commonly used in the relevant technical field may be used.
[0091] In addition, the above food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, visual appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), and copper (Cu). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.
[0092] In addition, the above food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), etc.), coloring agents (tar dyes, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (sizing agents), coating agents, gum bases, antifoaming agents, solvents, and improvers. The above additives can be selected according to the type of food and used in appropriate amounts.
[0093] The peptide of the present invention may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient may be appropriately determined according to its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the food composition of the present invention may be added to the food or beverage in an amount of 50 parts by weight or less, specifically 20 parts by weight or less. However, when consumed over a long period for the purpose of health and hygiene, the content may be below the above range, and since there are no safety issues, the active ingredient may also be used in an amount greater than the above range.
[0094] As an example of the food composition of the present invention, it may be used as a health drink composition, in which case it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as taumatin and stevia extract; and synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrates may generally be about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the health drink composition of the present invention.
[0095] In addition to the above, the health drink composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. Furthermore, it may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health drink composition of the present invention.
[0096] The food composition of the present invention may be included in various weight percent as long as it can exhibit a preventive or improving effect on mitochondrial disorders, but specifically, the peptide of the present invention may be included in 0.00001 to 100 weight percent or 0.01 to 80 weight percent relative to the total weight of the food composition, but is not limited thereto.
[0097] Antioxidant peptides can provide protection against free radical-mediated diseases. Food-derived antioxidant peptides are considered potential competitors to synthetic antioxidants due to their safety, high activity, and abundant sources. Since laboratory experimental methods have limitations in effectively screening and clearly describing the structure-activity relationships of antioxidant peptides, establishing a reliable predictive platform is crucial.
[0098] Dongya Qin et al. developed AnOxPP, an antioxidant peptide prediction platform, using a BiLSTM (Bidirectional Long Short-Term Memory) neural network. The sequence characteristics of the peptides were converted into feature codes based on amino acid descriptors (AADs). The feature conversion capability of the combined AAD, optimized by a forward feature selection method, was more accurate than that of a single AAD. The model trained with the optimal descriptor SDPZ27 outperformed the existing predictor on two independent test sets (accuracies of 0.967 and 0.819, respectively).
[0099] SDPZ27-based AnOxPP learned four major structure-activity features of antioxidant peptides. Their importance is in the order of stereochemical properties > hydrophobic properties > electronic properties > hydrogen bonding contribution. AnOxPP is a useful tool for screening and designing peptide drugs.
[0100] AnOxPP showed an accuracy of 0.967, MCC of 0.935, sensitivity of 0.943, specificity of 0.991, and precision of 0.990 when predicting the independent test set, and achieved an accuracy of 0.819 when predicting the new antioxidant peptide dataset. This significantly surpasses the performance of AnOxPePred (accuracy of 0.583, MCC of 0.168, sensitivity of 0.570, specificity of 0.600, precision of 0.670 when predicting the independent test set, and accuracy of 0.611 when predicting the new dataset).
[0101] The SDPZ27-based BiLSTM model demonstrated superior training capability compared to the One-hot based CNN model, and AnOxPP showed better performance than AnOxPePred. The AnOxPP server (http: / www.cqudfbp.net / AnOxPP / index.jsp) was built based on the optimal BiLSTM model trained on SDPZ27. AnOxPP consists of six modules: Home, Pre-AnOxPs, Seq-Features, Pre-Libraries, Help, and Contact.
[0102]
[0103] The present invention may provide a composition comprising an antioxidant peptide that restores mitochondrial function and / or a method for preventing or treating mitochondrial disorders using the same.
[0104] The present invention may provide a composition comprising an antioxidant peptide that can be used for the prevention or treatment of various diseases, including cardiovascular disease, aging, type 2 diabetes and metabolic disease, and obesity caused by mitochondrial dysfunction.
[0105] The present invention can provide an antioxidant peptide and its uses that can improve mitochondrial function and prevent or treat related diseases by effectively removing reactive oxygen species (ROS) within mitochondria and reducing oxidative stress.
[0106]
[0107] The effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the description below.
[0108]
[0109] Figure 1 shows the results of microscopic evaluation and quantitative analysis of the effects of antioxidant peptides on reactive oxygen species (ROS) generation in LPS-treated human pulp cells using DCFDA fluorescence staining. (A) Control group, (B) Antioxidant peptide (SEQ No. 96), (C) LPS only, (D) LPS + SEQ No. 96 peptide, (E) LPS(24H) + SEQ No. 96 peptide, (F) Quantitative analysis of DCFDA staining intensity, ****P<0.0001, (G) Quantitative analysis of DCFDA, **P<0.01
[0110] Figure 2 shows the results of evaluating the effect of antioxidant peptides on the recovery of mitochondrial function damaged by LPS. Representative confocal microscope images of human periodontal ligament cells stained with MitoTracker-Red / DAPI to visualize mitochondria in human periodontal ligament cells treated with LPS, (A) control group, (B) group treated with SEQ No. 96 peptide alone, (C) group treated with LPS alone, (D) group treated with LPS + SEQ No. 96 peptide, and (E) group treated with LPS(24h) + SEQ No. 96 peptide; (F) average mitochondrial length (n = 20–25 images per group, ## P <0.01, *** P <0.001, **** P <0.0001); (G) results showing the quantification of fluorescence intensity in all images of each group.
[0111] Figure 3 shows the results of evaluating the effects of antioxidant peptides on mitochondrial fragmentation and fusion. Representative confocal microscopy images of human periodontal ligament cells stained with MitoTracker-Red / DAPI to visualize mitochondria in LPS-treated human periodontal ligament cells are shown, including (A) control group, (B) group treated with SEQ ID NO. 96 peptide alone, (C) group treated with LPS alone, (D) group treated with LPS + SEQ ID NO. 96 peptide, and (E) group treated with LPS(24h) + SEQ ID NO. 96 peptide. In each group, mitochondrial lengths were measured based on ≥5 μm, 2–5 μm, and ≤ 2 μm. The measured values are shown in Figure 3 (F). Additionally, (G) mitochondrial fragmentation represents the measured value for lengths of ≤ 2 μm or less.
[0112] Figure 4 reports that excessive NO generated from iNOS increases mitochondrial damage. Therefore, Figure 4 shows the results of confirming the expression of LPS-induced iNOS in (A) human-derived gingival fibroblasts and (B) human-derived periodontal ligament cells induced by LPS. Each group was analyzed by dividing them into (1) a control group, (2) a group treated with SEQ ID NO. 96 peptide alone, (3) a group treated with LPS alone, (4) LPS + SEQ ID NO. 96 peptide, and (5) a group treated with LPS (24h) + SEQ ID NO. 96 peptide.
[0113] Figure 5 shows that antioxidant peptides targeting mitochondrial fission and fusion factors alter mitochondrial respiration. The results show mitochondrial respiration measured by OCR over time in human periodontal ligament cells treated with the peptide SEQ No. 96 indicated 48 hours prior. Each group was analyzed by dividing them into (a) control group, (b) SEQ No. 96 peptide treatment group, (c) LPS peptide treatment group, and (d) LPS + SEQ No. 96 peptide treatment group. The first three measurement points represent basal mitochondrial respiration, the next three points after blocking the adenine nucleotide potential by adding oligomycin represent proton leakage-stimulated oxygen consumption, the next three points represent maximum mitochondrial oxygen consumption capacity when the mitochondrial inner membrane is separated by FCCP, and the last three points represent non-mitochondrial oxygen consumption when the mitochondrial respiration chain is inhibited by rotenone and antimycin A.
[0114] Figure 6 shows that the bioenergetics of human-derived periodontal ligament cells were evaluated using the Cell Mito Stress Kit with the Seahorse Flux Analyzer. Summary data calculated from the curve in Figure 5 is shown in Figure 6. Figure 6 (A) shows mitochondrial basal respiration, and Figure 6 (B) shows mitochondrial and glycolytic ATP production in human-derived periodontal ligament cells evaluated at real-time ATP rates using the Seahorse Flux Analyzer. Figure 6 (C) shows the results representing mitochondrial membrane potential. Each group was analyzed as (1) control group, (2) group treated with SEQ ID NO. 96 peptide alone, (3) group treated with LPS alone, (4) LPS + SEQ ID NO. 96 peptide, and (5) group treated with LPS (24h) + SEQ ID NO. 96 peptide.
[0115] Figure 7 shows the results of evaluating the effect of antioxidant peptides on mitochondrial fission and fusion protein expression in LPS-mediated mitochondrial morphological changes. For the evaluation, the groups were divided into (1) control group, (2) group treated with SEQ ID NO 96 peptide alone, (3) group treated with LPS alone, (4) group treated with LPS + SEQ ID NO 96 peptide, and (5) group treated with LPS (24h) + SEQ ID NO 96 peptide.
[0116] Figure 8 shows the cell size of H9c2 cardiomyoblasts after treating them with hydrogen peroxide to evaluate the effect of the peptide of the present invention on the treatment of cardiomyoblast hypertrophy. Each group represents a representative confocal microscope image showing fluorescent staining of actin maintaining the cytoskeleton after treatment with (A) the control group, (B) 10 μM hydrogen peroxide (H2O2), and (C) H2O2 + peptide SEQ ID NO. 96. The cell size of each group was measured using confocal microscope images (n=7–9 images).
[0117] Figure 9 shows the results of evaluating the effect of the peptide of the present invention on the recovery of mitochondrial function in cardiomyocytes damaged by hydrogen peroxide (H2O2, 10 μM). For each group, representative confocal microscopy images of human periodontal ligament cells stained with MitoTracker-Red / DAPI were examined to visualize mitochondria after treatment with (A) control, (B) hydrogen peroxide 10 μM (H2O2), and (C) H2O2 + peptide of sequence number 96.
[0118] Figure 10 shows the results of evaluating the effect of the peptide of the present invention (Sequence No. 96) on the expression of a superoxide dismutase protein, which is an enzyme that removes mitochondrial reactive oxygen species induced by reactive oxygen species.
[0119] Figure 11 shows the gene expression of (A) BECLIN1, (B) ATG3, and (C) ATG5, which are mitophagy marker genes that remove damaged mitochondria in human-derived gingival fibroblasts. Human-derived gingival fibroblasts treated with LPS were analyzed by (A) control, (B) group treated with SEQ ID NO. 96 peptide alone, (C) group treated with LPS alone, (D) LPS + SEQ ID NO. 96 peptide, and (E) LPS(24h) + SEQ ID NO. 96 peptide.
[0120] Figure 12 shows the gene expression of (A) BECLIN1, (B) ATG3, and (C) ATG5, which are mitophagy marker genes that remove damaged mitochondria in human-derived periodontal ligament cells. Human-derived periodontal ligament cells treated with LPS were analyzed by (A) control group, (B) group treated with SEQ ID NO. 96 peptide alone, (C) group treated with LPS alone, (D) LPS + SEQ ID NO. 96 peptide, and (E) LPS(24h) + SEQ ID NO. 96 peptide.
[0121] Figure 13 shows the results of analyzing the mitochondria of human skin fibroblasts after treating them with ultraviolet (UVA) light to evaluate the effect of antioxidant peptides on photoaging. (A) control group, (B) peptide treatment group (SEQ No. 96), (C) UVA treatment group, (D) UVA + peptide treatment group (SEQ No. 96), and (E) peptide pretreatment (24 hours) + UVA treatment group. To visualize changes in mitochondria after each treatment, the cells were stained with MitoTracker-Red, and human skin fibroblasts were identified using a confocal microscope.
[0122]
[0123] The objectives and effects of the present invention, and the technical configurations for achieving them, will become clear by referring to the embodiments described in detail below in conjunction with the accompanying drawings. In describing the present invention, if it is determined that a detailed description of known functions or configurations may unnecessarily obscure the essence of the invention, such detailed description will be omitted. Furthermore, the terms described below are defined with consideration of their function in the present invention, and these may vary depending on the intentions or practices of the user or operator.
[0124] However, the present invention is not limited to the embodiments disclosed below but may be implemented in various different forms. These embodiments are provided merely to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined only by the scope of the claims. Therefore, such definition should be based on the content throughout this specification.
[0125] The embodiments of the present invention will be described in detail below.
[0126]
[0127] The Antioxidant Peptide Prediction Tool (AnOxPP) was used as a tool to predict the antioxidant activity of peptides using a BiLSTM neural network and the optimized amino acid descriptor SDPZ27. The non-redundant code SDPZ27 is equipped to demonstrate efficient transformation of sequence characteristics and to interpret the importance of four critical characteristics of AnOxPs. The AnOxPP is defined as stereochemical characteristics > hydrophobic characteristics > electronic characteristics > hydrogen bonding contribution. By learning the major sequence / structural characteristics of AnOxPs transformed by SDPZ27, accurate predictions can be demonstrated. These predictions have the advantage of reducing laboratory research time and, as can be seen in the embodiments of the present invention below, were used for the screening of oxidative peptides capable of removing mitochondria-derived reactive oxygen species.
[0128]
[0129]
[0130] Example:
[0131]
[0132] 1. Synthesis of peptides
[0133]
[0134] The inventors synthesized a peptide (Sequence No. 1) exhibiting a tyrosinase activity-promoting effect by the 9-fluorenylmethyloxycarbonyl (Fmoc) method, and synthesized peptides of each group by substituting amino acids of the synthesized peptide (Tables 1 to 12).
[0135]
[0136] N-KYQRRKKNKY-C(Sequence No. 1)
[0137] First, the peptide of Group 1 was synthesized by substituting the peptide of SEQ ID NO. 1 or amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine (Table 1).
[0138] Sequence Number Amino Acid Sequence (NC) 12345678KYQRRKKNKYKYQRRKRNKYKYQRRRKNKYKYQRRRRNKYKYQRKKKNKYKYQRKRKNKYKYQRKKRNKYKYQRKRRNKY
[0139]
[0140] Next, the peptide of group 2 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, and substituting amino acid 8 with serine (Table 2).
[0141]
[0142] Sequence Number Amino Acid Sequence (NC) 910111213141516KYQRRKKSKYKYQRRKRSKYKYQRRRKSKYKYQRRRRSKYKYQRKKKSKYKYQRKRKSKYKYQRKKRSKYKYQRKRRSKY
[0143] Next, the peptide of group 3 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, and substituting amino acid 9 with tyrosine (Table 3).
[0144] Sequence Number Amino Acid Sequence (NC) 1718192021222324KYQRRKKNYKKYQRRKRNYKKYQRRRKNYKKYQRRRRNYKKYQRKKKNYKKYQRKRKNYKKYQRKKRNYKKYQRKRRNYK
[0145] Next, the peptide of group 4 was synthesized by substituting amino acids 5 through 7 of the peptide of SEQ ID NO. 1 with lysine or arginine, substituting amino acid 8 with serine, substituting amino acid 9 with tyrosine, and substituting amino acid 10 with lysine (Table 4).
[0146] Sequence Number Amino Acid Sequence (NC) 2526272829303132KYQRRKKSYKKYQRRKRSYKKYQRRRKSYKKYQRRRRSYKKYQRKKKSYKKYQRKRKSYKKYQRKKRSYKKYQRKRRSYK
[0147] Next, the peptide of group 5 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, and substituting the 5th to 7th amino acids with lysine or arginine (Table 5).
[0148] Sequence Number Amino Acid Sequence (NC) 3334353637383940KYRQRKKNKYKYRQRKRNKYKYRQRRKNKYKYRQRRRNKYKYRQKKKNKYKYRQKRKNKYKYRQKKRNKYKYRQKRRNKY
[0149] Next, the peptide of group 6 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, and substituting the 8th amino acid with serine (Table 6).
[0150] Sequence Number Amino Acid Sequence (NC) 4142434445464748KYRQRKKSKYKYRQRKRSKYKYRQRRKSKYKYRQRRRSKYKYRQKKKSKYKYRQKRKSKYKYRQKKRSKYKYRQKRRSKY
[0151] Next, the peptide of group 7 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 7).
[0152] Sequence Number Amino Acid Sequence (NC) 4950515253545556KYRQRKKNYKKYRQRKRNYKKYRQRRKNYKKYRQRRRNYKKYRQKKKNYKKYRQKRKNYKKYRQKKRNYKKYRQKRRNYK
[0153] Next, the peptide of group 8 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with arginine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 8th amino acid with serine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 8).
[0154] Sequence Number Amino Acid Sequence (NC) 5758596061626364KYRQRKKSYKKYRQRKRSYKKYRQRRKSYKKYRQRRRSYKKYRQKKKSYKKYRQKRKSYKKYRQKKRSYKKYRQKRRSYK
[0155] Next, the peptide of group 9 was synthesized by substituting amino acid 3 of the peptide of SEQ ID NO. 1 with lysine, amino acid 4 with glutamine, and amino acids 5 through 7 with lysine or arginine (Table 9).
[0156] Sequence Number Amino Acid Sequence (NC) 6566676869707172KYKQRKKNKYKYKQRKRNKYKYKQRRKNKYKYKQRRRNKYKYKQKKKNKYKYKQKRKNKYKYKQKKRNKYKYKQKRRNKY
[0157] Next, the peptide of group 10 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, and substituting the 8th amino acid with serine (Table 10).
[0158] Sequence Number Amino Acid Sequence (NC) 7374757677787980KYKQRKKSKYKYKQRKRSKYKYKQRRKSKYKYKQRRRSKYKYKQKKKSKYKYKQKRKSKYKYKQKKRSKYKYKQKRRSKY
[0159] Next, the peptide of group 11 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 11).
[0160] Sequence Number Amino Acid Sequence (NC) 8182838485868788KYKQRKKNYKKYKQRKRNYKKYKQRRKNYKKYKQRRRNYKKYKQKKNYKKYKQKRKNYKKYKQKKRNYKKYKQKRRNYK
[0161] Finally, the peptide of group 12 was synthesized by substituting the 3rd amino acid of the peptide of SEQ ID NO. 1 with lysine, substituting the 4th amino acid with glutamine, substituting the 5th to 7th amino acids with lysine or arginine, substituting the 8th amino acid with serine, substituting the 9th amino acid with tyrosine, and substituting the 10th amino acid with lysine (Table 12).
[0162] Sequence Number Amino Acid Sequence (NC) 8990919293949596KYKQRKKSYKKYKQRKRSYKKYKQRRKSYKKYKQRRRSYKKYKQKKKSYKKYKQKRKSYKKYKQKKRSYKKYKQKRRSYK
[0163]
[0164] 2. Silico analysis for predicting the antioxidant function of peptides
[0165]
[0166] The function of the peptide synthesized through Example 1 as an antioxidant peptide was predicted using the AnOxPP predictor (http: / www.cqudfbp.net / AnOxPP / index.jsp). As shown in Table 13, to predict mitochondrial antioxidant function, peptides with a score range of 0.5 or higher were predicted as antioxidant peptides.
[0167]
[0168] 항산화 (anti-oxidant peptide, AOP) 스크리닝서열번호SequencePre-Score1KYQRRKKNKY0.76362KYQRRKRNKY0.76473KYQRRRKNKY0.75324KYQRRRRNKY0.79705KYQRKKKNKY0.85486KYQRKRKNKY0.77797KYQRKKRNKY0.81808KYQRKRRNKY0.78569KYQRRKKSKY0.915610KYQRRKRSKY0.915211KYQRRRKSKY0.924912KYQRRRRSKY0.926113KYQRKKKSKY0.916014KYQRKRKSKY0.920815KYQRKKRSKY0.913516KYQRKRRSKY0.920317KYQRRKKNYK0.811718KYQRRKRNYK0.807619KYQRRRKNYK0.795820KYQRRRRNYK0.831821KYQRKKKNYK0.899622KYQRKRKNYK0.829023KYQRKKRNYK0.867724KYQRKRRNYK0.835725KYQRRKKSYK0.979726KYQRRKRSYK0.976627KYQRRRKSYK0.980428KYQRRRRSYK0.978829KYQRKKKSYK0.982030KYQRKRKSYK0.980731KYQRKKRSYK0.977832KYQRKRRSYK0.978233KYRQRKKNKY0.492834KYRQRKRNKY0.530935KYRQRRKNKY0.516436KYRQRRRNKY0.584237KYRQKKKNKY0.539438KYRQKRKNKY0.506539KYRQKKRNKY0.542140KYRQKRRNKY0.575241KYRQRKKSKY0.847542KYRQRKRSKY0.851443KYRQRRKSKY0.873244KYRQRRRSKY0.872945KYRQKKKSKY0.852946KYRQKRKSKY0.851447KYRQKKRSKY0.845748KYRQKRRSKY0.861249KYRQRKKNYK0.508150KYRQRKRNYK0.541951KYRQRRKNYK0.522252KYRQRRRNYK0.586753KYRQKKKNYK0.593054KYRQKRKNYK0.535955KYRQKKRNYK0.585356KYRQKRRNYK0.599557KYRQRKKSYK0.951358KYRQRKRSYK0.949959K YRQRRKSYK0.961860KYRQRRRSYK0.958661KYRQKKKSYK0.952962KYRQKRKSYK0.951863KYRQKKRSYK0.945564KYRQKRRS YK0.952765KYKQRKKNKY0.657466KYKQRKRNKY0.628167KYKQRRKNKY0.606868KYKQRRRNKY0.656669KYKQKKKNKY0.821 670KYKQKRNKY0.659071KYKQKKRNKY0.728772KYKQKRRNKY0.672173KYKQRKKSKY0.880074KYKQRKRSKY0.874575KYKQR RKSKY0.889576KYKQRRRSKY0.888577KYKQKKKSKY0.891378KYKQKRKSKY0.886179KYKQKKRSKY0.879880KYKQKRRSKY0. 885881KYKQRKKNYK0.682482KYKQRKRNYK0.663783KYKQRRKNYK0.637284KYKQRRRNYK0.691685KYKQKKKNYK0.868886KY KQKRKNYK0.698287KYKQKKRNYK0.771888KYKQKRRNYK0.721289KYKQRKKSYK0.967990KYKQRKRSYK0.962691KYKQRRKSY K0.970092KYKQRRRSYK0.967293KYKQKKKSYK0.974994KYKQKRKSYK0.968595KYKQKKRSYK0.965396KYKQKRRSYK0.9658.
[0169] As described above, to identify mitochondrial antioxidant peptides, peptides with an antioxidant peptide analysis Pre Score range of 0.500 or higher via AnOxPP analysis were selected. Subsequently, for the efficacy evaluation in vitro as mitochondrial antioxidant peptides, peptide SEQ ID No. 96 was used.
[0170]
[0171] 3. Isolation and culture of human-derived gingival fibroblasts and periodontal ligament cells
[0172]
[0173] Human gingival fibroblasts and periodontal ligament cells were isolated from the gingival tissue and periodontal ligament tissue of wisdom teeth of 10 adults (ages 18-22) at Seoul National University Dental Hospital.
[0174] Specifically, all experiments were conducted after obtaining approval from the hospital's Institutional Review Board and consent from the patients. Gingival tissue and periodontal ligament tissue attached to the roots of wisdom teeth were separated, finely sliced on both sides, placed in 60 mm dishes, covered with coverslips, and cultured in α-MEM / 10% FBS medium.
[0175] To establish a cell model that induces mitochondrial damage by inducing reactive oxygen species in vitro, cells were treated with lipopolysaccharide (LPS) isolated from Porphyromonas gingivalis or LPS isolated from E. coli at a concentration of 1 μg / ml.
[0176] A peptide was treated at a concentration of 100 μg / ml to evaluate the efficacy of removing reactive oxygen species generated in mitochondria.
[0177] Each cell was washed with α-MEM / 10% FBS medium and cultured in the same medium at 2.5 x 10⁻¹⁰ 5 Cells were cultured in a 60 mm culture dish at a rate of cells / mL.
[0178]
[0179] The next day, the culture medium was exchanged, and the experiment was performed under the following conditions.
[0180] - Negative control group
[0181] - LPS alone treatment group (induced mitochondrial damage)
[0182] - SEQ ID No. 96 peptide single treatment group
[0183] - LPS treatment group + SEQ ID NO. 96 peptide treatment group (Verification of mitochondrial damage prevention effect)
[0184] - Group treated with SEQ ID NO. 96 peptide after 24 hours of LPS pretreatment (Verification of mitochondrial function recovery and mitochondrial antioxidant effects)
[0185]
[0186] Cardiac myoblast cell line (H9c2) was purchased from the Korean Cell Line Bank and cultured in a medium containing DMEM (Gibco), 10% Fetal Bovine Serum (Gibco), and 1% Penicillin-Streptomycin (Gibco) at 37°C in a 5% CO2 incubator.
[0187]
[0188] To induce mitochondrial injury in H9c2 cell line cells, 2x10 H9c2 cells were placed in a 6-well plate. 4 After inoculating the cells, they were treated with 10 μM / mL of hydrogen peroxide (H2O2) for 10 minutes, and then the test was performed under the following conditions.
[0189] - Negative control group
[0190] - H2O2-only treatment group (induced mitochondrial damage)
[0191] - H2O2 treatment group + SEQ ID NO. 96 peptide treatment group (Verification of mitochondrial damage prevention effect)
[0192]
[0193] 4. Assessment of Reactive Oxygen Species Levels
[0194]
[0195] Human periodontal ligament cells or cardiomyoblast H9c2 cells were inoculated into 6-well plates the day before the experiment. After administering LPS (1 µg / ml), H2O2 (1 µM / ml), and the novel peptide alone or simultaneously, the cells were cultured at 37°C for 24 hours.
[0196] Cells from each group were stained with DCFDA (10 μM; Molecular Probes) and MitoTracker Red (25 nM; Molecular Probes) for 30 minutes under dark conditions at 37ºC.
[0197] Both DCFDA and mitotracker fluorescence were visualized on a Zeiss LSM and then evaluated using the provided analysis program or ImageJ freeware.
[0198]
[0199] 192 For in-cell ROS measurement, 60,000 cells / cm² in black (for plate reader) and clear (for microscope) 96-well plates 2 Dispensed at a density of and cultured for 48 hours under the above conditions.
[0200] After washing three times with 1x PBS, the cells were cultured in 1x PBS with 10 μM 2',7'-dichlorofluorescin diacetate (DCFDA, Cat. No. D6883, Sigma-Aldrich) for 30 minutes in the dark at 37°C.
[0201] After incubation, unreacted DCFDA was washed three times with 1x PBS. After the final wash, fluorescence was analyzed at 485 nm / 535 nm using a multi-functional plate reader Infinite 200 Pro M Nano Plex (Tecan, Mannedorf, Switzerland).
[0202]
[0203] 5. Immunofluorescence microscopy and image analysis
[0204]
[0205] For the study of mitochondrial morphology, human-derived periodontal ligament cells or cardiomyoblast H9c2 cells were cultured on chamber-type coverslip slides (Ibidi), treated under the above conditions, and then stained with 200 nM MitoTracker Red CMX-Ros (Thermo Fisher Scientific) at 37°C for 30 minutes.
[0206] Then, the cells were fixed in 4% paraformaldehyde diluted in culture medium at 37°C for 15 minutes, and the cell nuclei were stained with DAPI (4',6-diamidino-2-phenylindole) solution (Thermo Fisher Scientific) diluted 1:10,000 in 1 × PBS.
[0207] Confocal imaging was performed on fixed cells, and mitochondrial length was quantified using the Imaris Filament Tracer module.
[0208]
[0209] 6. Analysis of Mitochondrial Respiration
[0210]
[0211] Evaluation of mitochondrial and glycolysis functions was performed using the Seahorse XFp Cell Mito Stress Test Kit (Agilent Technologies) and Seahorse XFp Real-Time ATP Rate Assay Kit (Agilent Technologies) according to the manufacturer's instructions, using the Seahorse XFp Analyzer (Agilent Technologies, Santa Clara, CA, USA).
[0212] In summary, 100,000 human-derived periodontal ligament cells per well in an Agilent Seahorse XFp plate 2Cells were inoculated at a density of [value] and stored in a complete culture medium (see Example 1) in an incubator for 14 to 16 hours. One hour before measurement, the medium was replaced with Seahorse XF assay medium supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, and 10 mM glucose, and the cells were incubated in a non-CO2 incubator.
[0213] Immediately before measurement, the medium was replaced with a new analytical medium containing the same supplement, and then the substances of each group were treated. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were normalized to the total cellular protein content determined directly in the plate by the Bradford assay immediately after each experiment was performed.
[0214] Optical density after reaction with Bradford reagent (Cat. No. B6916, Merck) was evaluated using a multi-functional plate reader Infinite 200 Pro M Nano Plex (Tecan, Mannedorf, Switzerland). The analyzed data was generated using Wave software (Agilent Technologies), and graphic images of the summary data were generated using SigmaPlot vs.13 (Systat Software, Slough, UK).
[0215]
[0216] 7. Real-time PCR analysis
[0217]
[0218] Total RNA from human periodontal ligament cells was isolated using the TRIzol reagent. cDNA was synthesized using 2 μg of total RNA, 1 μl of reverse transcriptase, and 0.5 μg of oligo (dT).
[0219] Synthesized cDNA of human-derived gingival fibroblasts and periodontal ligament cells was used in real-time polymerase chain reaction using the primers in Table 1.
[0220] Real-time polymerase chain reaction was performed using SYBR GREEN PCR Master Mix (Takara, Japan) on an ABI PRISM 7500 sequence detection system (Applied Biosystems).
[0221] The real-time polymerase chain reaction was carried out under conditions of 94°C, 1 min; 95°C, 15 sec - 60°C, 34 sec for 40 cycles.
[0222] The results were evaluated using the comparative cycle threshold (CT) method.
[0223]
[0224] Nucleotide Sequences of Real-Time PCR PrimersGenePrimer (5'-3')SEQ ID NOSforwardCAGCGGGATGACTTTCCAA97reverseAGAACTTGCATTGATGGTGACTGTTT98hBeclinforwardCAAGAT CCTGGACCGTGTACA99reverseTGGCACTTTCTGTGGACATCA100hAtg3forwardTCACA CACAGGTATTACAGG101reverseTCACCGCCAGCATCAG102hAtg5forwardGGGAAGCAGAACCATACTATTTG103reverseAAATGTACTGTGATGTTCCAAGG104hGAPDHforwardCCATGGAGAAGGCTGGGG105reverseCAAAGTTCTCATGGATGACC106
[0225] 8. Western Analysis.
[0226]
[0227] To isolate the protein, the cells were washed with PBS and collected by centrifuging at 1,000 xg for 5 minutes at low temperature.
[0228] After removing the supernatant, the pellet was dissolved in lysis buffer (100 mM Tris, pH 7.4, 350 mM NaCl, 10% glycerol, 1% Nonidet P-40, 1 mM EDTA, 1 mM dithiothreitol, 1x protease inhibitor (Sigma-Aldrich, St. Louis, MO, USA)) and reacted on ice for 15 minutes. Cell debris was removed by centrifugation at 16,000 xg for 15 minutes at low temperature, and only the supernatant was collected.
[0229] Approximately 30 μg of protein was separated by electrophoresis and transferred to a PVDF membrane. The membrane was blocked with 5% nonfat dry milk in PBS (PBS-T) containing 0.1% Tween 20, washed with PBS-T, and then reacted with anti-Mfn1, OPA1, pDRP1(s616), and SOD1 antibodies at a 1:1000 ratio.
[0230] After washing, the membrane was reacted with anti-rabbit IgG conjugated horseradish peroxidase (1:5000) (Santa Cruz Biotechnology) for one hour, and then the bands were checked using an enhanced chemiluminescence system (Amersham Biosciences).
[0231]
[0232] 9. Statistical Analysis
[0233]
[0234] All experimental data were expressed as the difference between the mean and standard deviation (mean-standard deviation). The significance of the results for each group was determined by one-way analysis of variance using SPSS 26, and a P-value of less than 0.05 was considered statistically significant.
[0235]
[0236]
[0237] Experimental Example:
[0238]
[0239] 1. Effect of the peptide of the present invention on the production of reactive oxygen species (ROS) in human periodontal ligament cells
[0240]
[0241] DCFDA analysis was performed to confirm the antioxidant effect of the selected peptides. As a result of evaluating intracellular hydroxyl, peroxyl, and other ROS through DCFDA analysis, it was found that reactive oxygen species significantly increased in human periodontal ligament cells upon LPS treatment (Fig. 1, C). On the other hand, compared to the control group (Fig. 1, A), the reactive oxygen species were reduced similarly to the control group in the group treated with peptide SEQ No. 96 alone (Fig. 1, B) or simultaneously with LPS (Fig. 1, D), and the group treated with peptide SEQ No. 96 after inducing reactive oxygen species with LPS for 24 hours (Fig. 1, E).
[0242] Similarly, when evaluating cell fluorescence intensity in DCFDA fluorescence images, the group treated with LPS showed approximately 70% higher DCF fluorescence intensity than the other group (Fig. 1, F), and the DCF analysis measured in cells showed the same results (Fig. 1, G).
[0243]
[0244] 2. Effect of the peptide of the present invention on LPS-induced mitochondrial fragmentation in human periodontal ligament cells
[0245]
[0246] LPS mediated by TLR2 / 4 signaling can regulate inflammatory responses both in vivo and in vitro by altering mitochondrial dynamics (fusion vs. cleavage).
[0247]
[0248] Based on this, to characterize LPS-induced mitochondrial morphological changes in human periodontal ligament cells, LPS (1 μg / ml) was administered to human periodontal ligament cells pretreated with MitoTracker, and mitochondrial morphological changes were monitored using a confocal microscope.
[0249]
[0250] As can be seen in the AE of Fig. 1 and the AE of Fig. 2, cells stimulated with LPS for 24 hours exhibited characteristics of mitochondrial fission and fusion based on mitochondrial length / fragmented (≤ 2 μm), tubular (2-5 μm), and elongated (≥5 μm) phenotypes (Fig. 1, F, G; Fig. 2, F, G). In human periodontal ligament cells stimulated with LPS, the total number of fragmented mitochondrial structures increased, while the number of elongated mitochondria decreased.
[0251] In addition, mitochondrial length was significantly reduced in human periodontal ligament cells treated with LPS. On the other hand, in human periodontal ligament cells treated with the peptide (sequence number 96), elongated and branched mitochondria increased, which was observed to block LPS-induced mitochondrial morphological changes.
[0252] These results show that the peptide of the present invention is essential for converting LPS-induced mitochondrial morphology in human-derived periodontal ligament cells from fission to fusion (Figs. 1 to 2).
[0253] Figure 3 shows the results of evaluating the effects of antioxidant peptides on mitochondrial fragmentation and fusion. Representative confocal microscopy images of human periodontal ligament cells stained with MitoTracker-Red / DAPI to visualize mitochondria in LPS-treated human periodontal ligament cells are shown, including (A) control group, (B) group treated with SEQ ID NO. 96 peptide alone, (C) group treated with LPS alone, (D) group treated with LPS + SEQ ID NO. 96 peptide, and (E) group treated with LPS(24h) + SEQ ID NO. 96 peptide. In each group, mitochondrial lengths were measured based on ≥5 μm, 2–5 μm, and ≤ 2 μm. The measured values are shown in Figure 3 (F). Additionally, (G) mitochondrial fragmentation represents the measured value for lengths of ≤ 2 μm or less.
[0254] Referring to Figure 3, the morphology of mitochondria in the group treated with SEQ ID NO 96 peptide alone (B) was maintained similarly compared to the control group (A). Severe mitochondrial fragmentation was observed in the group treated with LPS alone (C), which was confirmed by a significant increase in the proportion of mitochondria with a length of 2 μm or less in Graph F. Mitochondrial fragmentation was significantly reduced in the group treated with LPS and SEQ ID NO 96 peptide simultaneously (D) and in the group treated with SEQ ID NO 96 peptide 24 hours after LPS treatment (E).
[0255] Referring to Figure 3F, the mitochondrial length distribution in each experimental group can be observed. The analysis was conducted by dividing mitochondrial length into three ranges: ≥5 μm (bottom white), 2–5 μm (middle gray), and ≤2 μm (top black). The control group (Ctrl) and the group treated with SEQ ID NO. 96 peptide alone (SCPT) showed a normal length distribution, with a high proportion of long mitochondria greater than 5 μm. In contrast, in the LPS-treated group, the proportion of short mitochondria less than 2 μm increased significantly, while the proportion of long mitochondria greater than 5 μm decreased significantly.
[0256] In the group treated simultaneously with LPS and peptide number 96 (LPS+SCPT) and the group treated with peptide number 96 24 hours after LPS treatment (LPS(24h)+SCPT(12h)), the proportion of short mitochondria of 2 μm or less decreased and the proportion of normal-length mitochondria tended to recover compared to the group treated with LPS alone.
[0257] Quantitative analysis results (G) show that the proportion of fragmented mitochondria significantly increased in the LPS-treated group, but this fragmentation was effectively inhibited upon treatment with SEQ ID NO. 96 peptide. In particular, mitochondrial fragmentation was significantly reduced in both simultaneous and sequential treatments of LPS and peptide, which showed a statistically significant difference.
[0258]
[0259] 3. Effect of the peptide of the present invention on the regulation of LPS-induced iNOS expression in human periodontal ligament cells
[0260]
[0261] Mitochondria perform the important function of producing energy in cells to sustain life, but they can also have adverse effects on cells by generating harmful reactive oxygen species (ROS) in the process.
[0262]
[0263] Harmful reactive oxygen species (ROS) damage DNA and various proteins, causing cell loss and becoming a cause of various diseases. In particular, the primary mechanism of mitochondrial dysfunction occurs through mitochondrial DNA (mtDNA) mutations, and mtDNA damage is largely attributed to ROS. Furthermore, excessive NO generated from iNOS is reported to increase mitochondrial damage.
[0264]
[0265] Such mitochondrial dysfunction increases the expression of the iNOS gene and NO production. To evaluate the effect of peptide SEQ No. 96 on iNOS gene expression, iNOS gene expression was investigated after treatment with peptide SEQ No. 96 at a concentration of 10 µg / ml. The expression of the inflammatory factor iNOS gene was measured in gingival fibroblasts or periodontal ligament cells under the following conditions.
[0266]
[0267] - Negative control group
[0268] - LPS alone treatment group (inflammation induction)
[0269] - Group treated alone with peptide SEQ No. 96
[0270] - LPS-treated group + SEQ ID NO. 96-treated group
[0271] - LPS 24-hour pretreatment + SEQ ID No. 96 peptide treatment group
[0272]
[0273] To confirm the effect of the peptide of the present invention on LPS-induced iNOS gene expression, iNOS gene expression was measured after treatment with the peptide (SEQ No. 96) under the above experimental conditions. In the group treated with LPS alone, iNOS gene expression was observed to increase by more than 2-fold in gingival fibroblasts (Fig. 4, A) and by more than 4-fold in periodontal ligament cells (Fig. 4, B). However, in the group treated with the peptide alone, iNOS gene expression was observed to decrease by about 2-fold. It was confirmed that the group treated with LPS and the peptide together inhibited iNOS gene expression similarly to the group treated with the peptide alone.
[0274] In addition, the inhibitory effect on iNOS gene expression was confirmed by pre-treating with LPS for 24 hours and then treating with the following peptide. As a result, it was confirmed that even when the following peptide was applied after pre-treating with LPS for 24 hours, iNOS gene expression was significantly reduced, similar to other experimental groups (Fig. 4).
[0275] Therefore, it has been confirmed that the peptide of the present invention can inhibit mitochondrial reactive oxygen species (ROS) by inhibiting NO production in mitochondria through the inhibition of iNOS gene expression, or can also exhibit the effect of treating mitochondrial damage caused by NO production.
[0276]
[0277] 4. Effect of the peptide of the present invention on changes in mitochondrial respiration through the regulation of mitochondrial fusion and fission factors
[0278]
[0279] Since changes in mitochondrial morphology are associated with changes in function, we next investigated whether novel peptides of mitochondrial fusion and cleavage factors alter mitochondrial functional parameters (Figs. 5 to 6).
[0280]
[0281] Changes in mitochondrial morphology are also associated with changes in mitochondrial membrane potential, an essential component of oxidative phosphorylation (OXPHOS)-dependent ATP production. To measure mitochondrial respiration, human periodontal ligament cells were treated with 10 μg of peptide SEQ No. 96 for 48 hours, and oxygen consumption was analyzed using a Seahorse XFe24 Analyzer. We found that while basal oxygen consumption decreased due to LPS, mitochondrial basal respiration returned to normal when treated with peptide SEQ No. 96 alone or concurrently with LPS (Fig. 6, A). The decrease in basal respiration caused by LPS implies that mitochondrial function was impaired. Furthermore, activated mitochondria generate ATP through cellular energy metabolism. Periodontal ligament cells treated with LPS showed a significant decrease in ATP production. On the other hand, when peptide SEQ No. 96 was treated alone or simultaneously with LPS, mitochondrial ATP production was restored to normal (Fig. 6, B). In addition, when examining whether the changes in mitochondrial function caused by peptide SEQ No. 96 were due to changes in total mitochondrial content or membrane potential, it was found that the amount of protons involved in membrane potential was reduced by LPS, but the mitochondrial membrane potential was restored to normal when peptide SEQ No. 96 was treated alone or simultaneously with LPS (Fig. 6, C).
[0282]
[0283] 5. Effects of the peptide of the present invention on the regulation of mitochondrial fusion and fission factors
[0284]
[0285] After confirming the efficacy of the peptide in LPS-mediated mitochondrial morphological changes, the novel peptide was subsequently identified as a factor (Mfn1, OPA1, Drp1) in mitochondrial fission and fusion.
[0286] The expression of Mfn1 and OPA1, factors involved in mitochondrial fusion, was reduced by LPS, but it was confirmed that expression was restored to normal when treated with SEQ ID NO. 96 peptide alone or simultaneously with LPS (Fig. 7A, Fig. 7B, C).
[0287] On the other hand, DRP1 phosphorylation / dephosphorylation at Ser616 is known to mediate mitochondrial fission. In human periodontal ligament cells, LPS stimulation increased phosphorylation of DRP1 protein at Ser616 (Fig. 7A, Fig. 7D).
[0288]
[0289] 6. Effect of the peptide of the present invention on hypertrophy of cardiomyocytes induced by hydrogen peroxide (H2O2, 10 μM)
[0290]
[0291] Cardiomyoblasts can induce hypertrophy of the cardiomyocardium due to excessive stress or reactive oxygen species. Cardiomyoblast line H9c2 cells were treated with hydrogen peroxide, and then the cell size of the H9c2 cells was measured. An increase in reactive oxygen species in cardiomyoblasts led to increased hypertrophy of the cardiomyoblasts (Fig. 8 B, D), but it was confirmed that the group treated with peptide SEQ No. 96 recovered to a size similar to normal cells or prevented hypertrophy (Fig. 8 C, D).
[0292]
[0293] 7. Effect of the peptide of the present invention on the recovery of mitochondrial function in cardiomyocytes damaged by hydrogen peroxide (H2O2, 10 μM)
[0294]
[0295] To characterize hydrogen peroxide-induced mitochondrial morphological changes in myocardial blast cells, MitoTracker was used, followed by monitoring the mitochondrial morphological changes using a confocal microscope. As shown in Figure 9B), cells stimulated with hydrogen peroxide for 24 hours exhibited characteristics of mitochondrial division (fragmentation).
[0296] On the other hand, an increase in elongated and branched mitochondria was observed in H9c2 cardiomyoblast cells treated with the novel peptide SEQ No. 96 (Fig. 9, C). In addition, protein expression of superoxide dismutase (SOD1), which removes mitochondrial reactive oxygen species, was reduced by hydrogen peroxide, but it was confirmed to increase or recover in the group treated with peptide SEQ No. 96 (Fig. 10).
[0297] These results suggest that the novel peptide could be used as a therapeutic or preventive agent for cardiomyopathy induced by hypertrophy of cardiomyocytes by inhibiting the hypertrophy of cardiomyocytes through mitochondrial antioxidant activity.
[0298]
[0299] 8. Effects of the peptide of the present invention, which regulates mitochondrial fusion and division, on mitophagy
[0300]
[0301] In previous studies, it has been known that mitochondria play a role in regulating mitophagy levels, which affects intracellular mitochondrial content, and that mitophagy influences mitochondrial function as a major intracellular pathway for the removal of damaged mitochondria.
[0302] The expression of mitophagy marker genes that remove damaged mitochondria in human-derived gingival fibroblasts and periodontal ligament cells was investigated. Figure 12 shows the expression of (A) BECLIN1, (B) ATG3, and (C) ATG5 genes, which are mitophagy marker genes that remove damaged mitochondria in human-derived periodontal ligament cells.
[0303] It has been previously reported that mitophagy gene expression increases in periodontal ligament cells of patients with periodontitis. Referring to Figure 12, the expression of these genes increased in the group treated with LPS in the present invention compared to the control group, but higher expression of these marker genes was observed in the groups treated with SEQ ID NO. 96 peptide alone, LPS + SEQ ID NO. 96 peptide, or LPS(24h) + SEQ ID NO. 96 peptide than in the group treated with LPS alone.
[0304]
[0305] 9. Effect of the peptide of the present invention on the recovery of mitochondrial function in damaged human skin fibroblasts
[0306]
[0307] (1) Cell culture and preparation
[0308] Human skin fibroblast cell lines were cultured in Dulbecco's modified Eagle medium (DMEM; Gibco, Waltham, MA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS; Gibco, Waltham, MA, USA) and penicillin-streptomycin (Gibco, Waltham, MA, USA) at 37 °C in a 5% CO2 atmosphere.
[0309]
[0310] (2) UV irradiation
[0311] 1 x 10 human skin fibroblast cell line 4After inoculating cells / well and incubating overnight, the medium in the wells with attached human skin fibroblasts was replaced with 1X PBS. The cultured cells were irradiated once with UVA. The irradiation intensity, time, and distance were each set to 50 mJ / cm². 2 , 50-60 s and 25 mm. After that, a culture medium containing the peptide of the present invention (SEQ No. 96) was treated to human skin fibroblast cell lines, and after 24 hours, the cells treated with UVA were observed and analyzed by confocal microscopy through mitochondrial staining.
[0312]
[0313] (3) Confirmation of changes in mitochondrial morphology
[0314] To characterize mitochondrial morphological changes in human skin fibroblasts induced by ultraviolet (UVA) radiation, the cells were stained with MitoTracker and then monitored using a confocal microscope.
[0315] Figure 13 shows the results of analyzing the mitochondria of human skin fibroblasts after treating them with ultraviolet (UVA) light to evaluate the effect of antioxidant peptides on photoaging ((A) control group, (B) SEQ ID NO. 96 peptide treatment group, (C) UVA treatment group, (D) UVA + SEQ ID NO. 96 peptide treatment group, (E) SEQ ID NO. 96 peptide pretreatment (24 hours) + UVA treatment group).
[0316] As can be seen in Fig. 13 (C), cells stimulated by ultraviolet (UVA) irradiation exhibited characteristics of mitochondrial division (fragmentation). On the other hand, as can be seen in Fig. 13 (D) and (E), an increase in elongated and branched mitochondria was observed in human skin fibroblasts treated with the peptide of the present invention (SEQ No. 96). These results confirmed that the peptide of the present invention increases mitochondria in response to skin aging or functional impairment of skin cells caused by mitochondrial damage induced by ultraviolet (UVA) irradiation stimulation.
[0317] Therefore, it can be understood that the peptide of the present invention can provide a therapeutic or preventive effect against skin aging and skin diseases by restoring the mitochondrial function of skin fibroblasts through the antioxidant activity of mitochondria.
[0318]
[0319] The present specification and drawings disclose preferred embodiments of the present invention. Although specific terms have been used, they are used merely in a general sense to facilitate the explanation of the technical content of the present invention and to aid in understanding the invention, and are not intended to limit the scope of the present invention. It is obvious to those skilled in the art that, in addition to the embodiments disclosed herein, other variations based on the technical concept of the present invention are possible.
Claims
1. A composition for the prevention, improvement, or treatment of mitochondrial disorders comprising a peptide composed of the amino acid sequence of General Formula 1 below: KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1) In the above general formula 1, R1 is arginine (R), lysine (K), or glutamine (Q); R2 is arginine (R) or glutamine (Q); R3, R4, and R5 are each arginine (R) or lysine (K); R6 is asparagine (N) or serine (S); and R7 and R8 are lysine (K) or tyrosine (Y).
2. In Paragraph 1, A composition characterized in that the above peptide is an amino acid sequence of any one of SEQ ID NOs 1 to 96.
3. A polynucleotide encoding the peptide of claim 1.
4. An expression vector comprising the polynucleotide of claim 3.
5. In Paragraph 1, The above composition is characterized by comprising a polypeptide in which the peptides are repeatedly linked.
6. In Paragraph 1, The above composition is characterized by further comprising a pharmaceutically acceptable carrier, excipient, or diluent.
7. In Paragraph 1, A quasi-drug composition for the prevention or improvement of mitochondrial disorder, characterized in that the above-mentioned mitochondrial disorder is any one of cardiovascular disease, type 2 diabetes, obesity, and skin disease.
8. A quasi-drug composition for the prevention or improvement of mitochondrial disorders, comprising a peptide composed of the amino acid sequence of General Formula 1 below: KY-R1-R2-R3-R4-R5-R6-R7-R8(General Formula 1) In the above general formula 1, R1 is arginine (R), lysine (K), or glutamine (Q); R2 is arginine (R) or glutamine (Q); R3, R4, and R5 are each arginine (R) or lysine (K); R6 is asparagine (N) or serine (S); and R7 and R8 are lysine (K) or tyrosine (Y).
9. A method of preventing, improving, or treating mitochondrial disorders by administering the composition of claim 1 to an individual other than a human.