Method for improving accuracy of genetic information detection

By employing multicopy amplification and nucleotide transformation methods, the problems of sequencing errors and loss of methylation information have been solved, improving the accuracy of genetic information detection. In particular, in DNA methylation detection, accurate identification of original and modified bases and acquisition of genomic methylation information have been achieved.

WO2026144199A1PCT designated stage Publication Date: 2026-07-09MGI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/116238
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-02
Filing Date
2025-08-21
Publication Date
2026-07-09

AI Technical Summary

Technical Problem

In existing technologies, sequencing errors can interfere with the interpretation of nucleic acid information, especially in the detection of mutations in somatic cell nucleic acid sequences, such as tumor-related sites, where the accuracy is low. Furthermore, whole-genome methylation sequencing (WGBS) suffers from the problem of methylation information loss.

Method used

By amplifying multiple copies of the nucleic acid to be tested, a double-stranded linker with a double-stranded structure is used to link the nucleic acid to be tested, and a chain displacement reaction is performed by polymerase to generate a polynucleotide molecule containing multiple copies. Combined with specific nucleotide transformation, a methylated library is formed.

Benefits of technology

It effectively corrects sequencing errors, improves detection accuracy, preserves original sequences and modification information, overcomes the problem of methylation information loss in WGBS, and enables accurate detection of unmodified or modified bases to obtain whole-genome methylation information.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025116238_09072026_PF_FP_ABST
    Figure CN2025116238_09072026_PF_FP_ABST
Patent Text Reader

Abstract

A method based on multi-copy generation, multi-copy detection and multi-copy sequencing and used for improving the accuracy of genetic detection.
Need to check novelty before this filing date? Find Prior Art

Description

Methods to improve the accuracy of genetic information testing

[0001] Cross-referencing related applications

[0002] This application is based on and claims priority to PCT application No. PCT / CN2025 / 070241, filed on January 2, 2025, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application relates to the field of molecular sequencing technology, specifically to a method for improving the accuracy of genetic information detection based on multicopy sequencing. Background Technology

[0004] Sequencing, a popular tool in recent years, has been widely used to analyze various life processes. However, in conventional sequencing, limitations of sequencing instruments and the instability of chemical reactions can lead to the random introduction of sequencing errors, including base insertions, deletions, substitutions, or mismatches. These random errors interfere with the interpretation of nucleic acid information, especially nucleic acid sequence variations occurring in somatic cells, such as mutations at tumor-related sites.

[0005] Epigenetics plays an increasingly important role in explaining the regulation of various life activities in organisms. In the absence of changes in the DNA sequence, genetic information related to traits is preserved and passed on to offspring through pathways such as DNA methylation and chromatin conformational changes. Whole Genome Bisulfite Sequencing (WGBS) is the most commonly used method for studying DNA methylation. It can cover all methylation sites within the genome, thus obtaining a relatively comprehensive methylation map. However, WGBS also faces many challenges, such as its heavy reliance on the completion status of the whole genome sequencing of the species being analyzed; the extreme changes in GC content in the genome after converting unmethylated cytosine (C) to uracil (U), resulting in significant amplification and sequencing bias in subsequent amplification; and the reduction in genome complexity after base conversion, making effective alignment to the reference genome difficult, even with increased sequencing depth, leading to the loss of DNA methylation information.

[0006] Therefore, there is an urgent need to propose a method to improve the accuracy of genetic and epigenetic detection, especially DNA methylation modification detection. Summary of the Invention

[0007] The first aspect of this application provides a method for multicopy amplification of a nucleic acid to be tested, comprising: a) providing a first polynucleotide molecule, the first polynucleotide molecule comprising the nucleic acid to be tested having a double-stranded structure and a first double-stranded header, the first double-stranded header being connected to two ends of the nucleic acid to be tested, the double strands of the first double-stranded header being at least partially complementary, the first polynucleotide molecule having a cyclic double-stranded structure, wherein each of the double strands of the first polynucleotide molecule contains a nick or gap; b) contacting a polymerase and dNTPs with the first polynucleotide molecule, the polymerase performing an extension reaction based on the nick or gap, using the first polynucleotide molecule as a template, to perform a strand substitution reaction on the first polynucleotide molecule, thereby forming a second polynucleotide molecule, the second polynucleotide molecule comprising one or more copies of the first double-stranded header and the nucleic acid to be tested.

[0008] In some embodiments, the first dual-linker includes one or more restriction enzyme sites and / or modified nucleotides. In some embodiments, the restriction enzyme sites include endonuclease cleavage sites, preferably restriction endonuclease cleavage sites, and modified bases. In some embodiments, the restriction enzyme sites are selected from ribonucleotides (e.g., uracil) and modified purine bases (e.g., 7,8-dihydro-8-oxoguanine).

[0009] In some embodiments, the first dual-link header comprises one or more modified nucleotides. In some embodiments, the modification of the modified nucleotide in the first dual-link header is selected from phosphorylation modification, dephosphorylation modification, fluorescence modification, or affinity group modification, etc.

[0010] In some embodiments, the method further includes: a1) linking the first double-stranded head to the two ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor exhibiting a circular double-stranded structure; a2) performing enzymatic digestion on the enzyme cleavage site based on the first polynucleotide precursor to provide the notch or gap, thereby obtaining the first polynucleotide molecule.

[0011] In some embodiments, the method further includes: a1) linking the first double-stranded head to the two ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor exhibiting a linear double-stranded structure; a2) performing enzymatic digestion on the enzyme cleavage site based on the first polynucleotide precursor to provide the notch or gap; a3) obtaining the first polynucleotide molecule based on the cyclization of the enzyme digestion product in step a2).

[0012] In some embodiments, the digestion enzymes include endonucleases and base-specific digestion enzymes, optionally UDG / UNG, RnaseH, 8-oxoguanine DNA glycosylase (Ogg1) & AP-endonuclease 1 (APE1) or N-methylpurine DNA glycosylase (MPG) & AP-endonuclease 1 (APE1).

[0013] In some embodiments, the first double-linked header comprises two or more polynucleotide chains, wherein each polynucleotide chain is partially complementary to at least one other polynucleotide chain to form a double-stranded structure. The method specifically includes: x. providing the notch or gap from the unconnected ends between the two or more polynucleotide chains; or y. linking the first double-linked header to both ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor exhibiting a cyclic double-stranded structure or a linear double-stranded structure; and cleaving the first polynucleotide precursor at an enzyme cleavage site to provide the notch or gap.

[0014] In some embodiments, the first double-linked head consists of a first double-linked head A and a first double-linked head B, which are respectively linked to the two ends of the nucleic acid to be tested to form the first polynucleotide precursor, which exhibits a linear double-stranded structure. The method specifically includes: performing a first enzyme digestion on a first enzyme cleavage site based on the first polynucleotide precursor to provide the notch or gap; based on the first enzyme digestion or a further second enzyme digestion, exposing at least partially complementary terminal sequences of the first double-linked head A and the first double-linked head B, thereby cyclizing the enzyme digestion product of the first polynucleotide precursor based on the complementary terminal sequences to obtain the first polynucleotide molecule, wherein a second enzyme digestion is performed on a second enzyme cleavage site based on the first polynucleotide precursor, and the first enzyme cleavage site and the second enzyme cleavage site are different.

[0015] In some embodiments, the first dual-link header further includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence.

[0016] In some embodiments, the method further includes: c) performing an end-repair A reaction based on the second polynucleotide molecule to provide a second double-linked head to the second polynucleotide molecule, and repeating steps a)-b) to obtain a third polynucleotide molecule, the third polynucleotide molecule comprising the first double-linked head, the second double-linked head, and four copies of the nucleic acid to be tested.

[0017] In some embodiments, the method further includes: d) performing an end-repair and A-addition reaction based on the third polynucleotide molecule to provide a third double-linked header to the third polynucleotide molecule, and repeating steps a)-b) to obtain a fourth polynucleotide molecule, the fourth polynucleotide molecule comprising the first double-linked header, the second double-linked header, the third double-linked header and eight copies of the nucleic acid to be tested, to achieve multi-copy amplification of the nucleic acid to be tested, wherein the first double-linked header, the second double-linked header and the third double-linked header are the same or different.

[0018] In some embodiments, the nucleic acid to be tested is double-stranded DNA, double-stranded RNA, or a DNA-RNA hybrid.

[0019] In some embodiments, based on the fact that the nucleic acid to be tested is a double-stranded RNA or a DNA-RNA hybrid, the method further includes: converting the RNA strand in the double-stranded RNA or DNA-RNA hybrid into a DNA strand, optionally by reverse transcription or template conversion. In some embodiments, the nucleic acid to be tested further comprises modified nucleotides and / or non-natural nucleotides.

[0020] The second aspect of this application provides a method for constructing a nucleic acid library based on multicopy amplification, comprising: 1) performing multicopy amplification on the nucleic acid to be tested according to the method for multicopy amplification of the nucleic acid to be tested as described in any embodiment of the first aspect of this application, thereby obtaining amplification products of two or more copies of the nucleic acid to be tested; 2) constructing a library from the amplification products of two or more copies of the nucleic acid to be tested, thereby obtaining a nucleic acid library.

[0021] In some embodiments, the library construction further includes one or more of the following: further amplification of double or more copies of the amplified product of the nucleic acid to be tested, end repair and sequencing adapter sequence ligation, and product purification after each step.

[0022] A third aspect of this application provides a method for constructing a library for detecting polynucleotide methylation, comprising: 1) providing a first polynucleotide molecule, the first polynucleotide molecule comprising the target nucleic acid having a double-stranded structure and a first double-stranded header, the first double-stranded header being connected to two ends of the target nucleic acid, the double strands of the first double-stranded header being at least partially complementary, the first polynucleotide molecule exhibiting a cyclic double-stranded structure, wherein both double strands of the first polynucleotide molecule contain nicks or gaps; 2) contacting a polymerase and dNTPs with the first polynucleotide molecule, the polymerase performing methylation based on the nicks or gaps, using the first polynucleotide molecule as a template. An extension reaction is performed to perform chain substitution on the first polynucleotide molecule to form a second polynucleotide molecule, the second polynucleotide molecule containing one or more copies of the first double-linked head and the nucleic acid to be tested, wherein the dNTPs used include: i) dATP, dTTP, dGTP and dCTP; or ii) one or more of dATP, dTTP, dGTP and dCTP are modified nucleotides, and the rest are unmodified nucleotides; 3) the second polynucleotide molecule is subjected to nucleotide conversion to obtain the methylated library, wherein one or more modified or unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides.

[0023] In some embodiments, one or more unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides.

[0024] In some embodiments, the modified nucleotides include 1mC, 4mC, m2C, 5mC, 5hmC, 5fC, 5caC, 1mA, 3mA, 7mA, 6mA, 9mA, 6-DMA, HAP, AHAP, m2A, 1mG, 3mG, 7mG, m6G, CEG, diHT, 1mT, 3mT, 5fU, 5caU, and / or 5hmU. In some embodiments, the modified nucleotides include 5mC, 5hmC, 5fC, and / or 5caC.

[0025] In some embodiments, the unmodified nucleotide C in the second polynucleotide molecule is converted into a specific nucleotide U.

[0026] In some embodiments, in step 2), the dNTPs used include: modified nucleotide dCTP and unmodified nucleotides dATP, dTTP and dGTP, wherein based on the fact that the second polynucleotide molecule contains the original copy and the newly generated copy of the nucleic acid to be tested, step 3) specifically includes: converting the unmodified nucleotide C in the original copy of the nucleic acid to be tested into a specific nucleotide U, while keeping the modified nucleotide C in the original copy and the newly generated copy of the nucleic acid to be tested as C.

[0027] In some embodiments, nucleotide conversion of the second polynucleotide molecule includes: using chemical or biological methods to convert one or more modified or unmodified nucleotides in the amplification product into one or more specific nucleotides. In some embodiments, the chemical method includes: bisulfite, bisulfite, disulfite, or bisulfite, wherein the bisulfite is optionally sodium bisulfite or ammonium bisulfite, and the biological method includes: enzyme treatment, wherein the enzyme treatment includes deaminase treatment or oxidase treatment.

[0028] In some embodiments, the method further includes: pretreating the polynucleotide to obtain the nucleic acid to be tested, wherein the pretreating includes: end repair of the polynucleotide. In some embodiments, the pretreating further includes one or more of fragmentation, purification, and amplification.

[0029] In some embodiments, the method further includes: enriching the library according to the target molecule to obtain a library enriched with the target molecule as the target library.

[0030] In some embodiments, the enrichment is performed by PCR amplification or probe capture, the probes including nucleic acid sequence probes, biotin-labeled probes, or protein probes.

[0031] In some embodiments, the first dual-linker includes one or more restriction enzyme sites and / or modified nucleotides. In some embodiments, the restriction enzyme sites include endonuclease cleavage sites, preferably restriction endonuclease cleavage sites, and modified bases. In some embodiments, the restriction enzyme sites are selected from ribonucleotides (e.g., uracil) and modified purine bases (e.g., 7,8-dihydro-8-oxoguanine).

[0032] In some embodiments, the first dual-link header comprises one or more modified nucleotides. In some embodiments, the modification of the modified nucleotide in the first dual-link header is selected from phosphorylation modification, dephosphorylation modification, fluorescence modification, or affinity group modification, etc.

[0033] In some embodiments, the first dual-link header further includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence.

[0034] In some embodiments, the first double-linked header comprises two or more polynucleotide chains, each of which is partially complementary to at least one of the other polynucleotide chains to form a double-stranded structure.

[0035] In some embodiments, the method further includes introducing a sequencing adapter sequence into the 3' and / or 5' end of the second polynucleotide molecule to obtain the methylated library.

[0036] The fourth aspect of this application provides a kit comprising: (i) a first double-linked header comprising two or more polynucleotide chains, each of the polynucleotide chains being partially complementary to at least one of the other polynucleotide chains to form a double-stranded structure, the first double-linked header further comprising: one or more enzyme cleavage sites or modified nucleotides and optional sample tags, molecular tags and / or sequencing primer binding sequences; (ii) an enzyme, including ligases, polymerases and optional endonucleases; and (iii) dNTPs, including: a) dATP, dTTP, dGTP and dCTP; or b) one or more of dATP, dTTP, dGTP and dCTP being modified nucleotides and the remainder being unmodified nucleotides.

[0037] In some embodiments, the kit further includes: (iv) a second double-linker and optionally a third double-linker and / or a sequencing adapter sequence, wherein, optionally, the restriction site of the first double-linker in a1) is uracil, wherein the first double-linker, the second double-linker and the third double-linker are the same or different.

[0038] In some embodiments, the kit further includes: (iv) a conversion reagent, including a chemical conversion reagent or a biological conversion reagent, wherein the chemical conversion reagent includes: bisulfite, bisulfite, bisulfite or bisulfite, and the biological conversion reagent includes deaminase or oxidase.

[0039] In some embodiments, the modified nucleotides in step (iii) include 5mC, 5hmC, 5fC and / or 5caC.

[0040] A fifth aspect of this application provides a library for detecting polynucleotide methylation modifications, comprising: a second polynucleotide molecule, the second polynucleotide molecule including a first double-linker and one or more copies of a nucleic acid to be tested, wherein the one or more copies of the nucleic acid to be tested include an original copy of the nucleic acid to be tested and one or more newly generated copies, wherein one or more modified or unmodified nucleotides in the original copy and the newly generated copies of the nucleic acid to be tested are converted into specific nucleotides. In some embodiments, the unmodified nucleotide C in the original copy of the nucleic acid to be tested is converted into a specific nucleotide U, while the modified nucleotide C in the original copy and the newly generated copies of the nucleic acid to be tested remains C.

[0041] In some embodiments, the library further includes a sequencing adapter sequence, which is contained in the first dual-linker and / or introduced separately into the second polynucleotide molecule.

[0042] In some embodiments, the library further includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence, each of which is independently contained in the first dual-linker and / or introduced individually into the second polynucleotide molecule.

[0043] The sixth aspect of this application provides a method for characterizing polynucleotides, comprising:

[0044] The nucleic acid library obtained by the method for constructing a nucleic acid library based on multicopy amplification according to any embodiment of the second aspect of this application is sequenced to obtain sequencing data of the nucleic acid; and the sequencing data is analyzed to characterize the polynucleotide.

[0045] In some embodiments, the polynucleotide is a genomic sequence, and the characterization is whole-genome sequencing or genome-targeted sequencing.

[0046] A seventh aspect of this application provides a method for characterizing polynucleotide methylation modifications, comprising: sequencing a methylation library obtained by a method for constructing a polynucleotide methylation detection library according to any embodiment of the third aspect of this application to obtain sequencing data of the polynucleotides; and analyzing the sequencing data to characterize the polynucleotide methylation modifications.

[0047] In some embodiments, the multicopy amplification product of the polynucleotide in the library is a double-copy amplification product. The method includes: comparing the newly generated copy in the double-copy amplification product with the original copy to determine the modified nucleotide in the polynucleotide; and determining the position of the modified nucleotide in the genome according to the position of the original copy or the newly generated copy in the genome to obtain the nucleotide modification status in the genome.

[0048] In some embodiments, unmodified nucleotides in the double-copy amplification product are converted into specific nucleotides by transformation, and the dNTPs used in the amplification are modified dATP, dTTP, dGTP, and / or dCTP corresponding to the type of modified nucleotide. Then, for the same position: if the nucleotides in the original copy in the sequencing data are inconsistent with the nucleotides in the newly generated copy, and the nucleotide type involved is the type of nucleotide converted into the specific nucleotide, then the nucleotide at that position is identified as an unmodified nucleotide; if the nucleotides in the original copy in the sequencing data are consistent with the nucleotides in the newly generated copy, and the nucleotide type involved is the type of nucleotide converted into the specific nucleotide, then the nucleotide at that position is identified as a modified nucleotide.

[0049] In some embodiments, if the modified nucleotides in the double-copy amplification product are converted into specific nucleotides by conversion, and the dNTPs used in the amplification are unmodified dNTPs, then for the same position: if the nucleotides in the original copy in the sequencing data are consistent with the nucleotides in the newly generated copy, and the type of nucleotide involved in the conversion to the specific nucleotide is involved, then the nucleotide at that position is identified as an unmodified nucleotide; if the nucleotides in the original copy in the sequencing data are inconsistent with the nucleotides in the newly generated copy, and the type of nucleotide involved in the conversion to the specific nucleotide is involved, then the nucleotide at that position is identified as a modified nucleotide.

[0050] In some embodiments, the unmodified nucleotide C in the double-copy amplification product is converted into a specific nucleotide U by conversion, and the dNTPs used in the amplification are 5m-dCTP and dATP, dTTP, and dGTP corresponding to the modified nucleotide type 5mC. Then, for the same position: if the nucleotide in the original copy in the sequencing data is inconsistent with the nucleotide in the newly generated copy, and involves the conversion of the nucleotide type to the specific nucleotide, then the nucleotide at that position is identified as unmodified nucleotide C; if the nucleotide in the original copy in the sequencing data is consistent with the nucleotide in the newly generated copy, and involves the conversion of the nucleotide type C to the specific nucleotide U, then the nucleotide at that position is identified as modified nucleotide 5mC.

[0051] In some embodiments, the modified nucleotide C in the double-copy amplification product is converted into a specific nucleotide U by conversion, and the dNTPs used in the amplification are dCTP, dATP, dTTP, and dGTP corresponding to the unmodified nucleotide type. Then, for the same position: if the nucleotide in the original copy in the sequencing data is inconsistent with the nucleotide in the newly generated copy, and involves the nucleotide type that is converted into the specific nucleotide, then the nucleotide at that position is identified as the modified nucleotide 5mC; if the nucleotide in the original copy in the sequencing data is consistent with the nucleotide in the newly generated copy, and involves the nucleotide type C that is converted into the specific nucleotide U, then the nucleotide at that position is identified as the unmodified nucleotide C.

[0052] The eighth aspect of this application describes the use of the kits as described in any of the embodiments of the fourth aspect of this application in multicopy amplification of polynucleotides, library construction, polynucleotide characterization, detection of nucleotide modifications and / or detection of rare mutations or tumor screening.

[0053] The ninth aspect of this application proposes the use of libraries as described in any embodiment of the fifth aspect of this application in polynucleotide characterization, nucleotide modification detection, and / or detection of rare mutations or tumor screening. In some embodiments, the nucleotide modification detection includes DNA methylation modification detection.

[0054] The technical solution of this application achieves the following technical effects:

[0055] The method proposed in this application generates tandem double-copy molecules of the template sequence based on strand substitution. Library construction and sequencing of these tandem double-copy molecules effectively correct sequencing errors during the detection process, significantly improving sequencing accuracy. Furthermore, when applied to epigenetic detection, such as DNA methylation detection, compared to traditional WGBS, by introducing unmodified and / or modified bases into the newly generated copy and comparing it with the original copy sequence, the original sequence and modification information can be effectively preserved. This overcomes the methylation information loss problem in WGBS, enabling accurate detection of unmodified and / or modified bases in the original copy (i.e., the template sequence). Further, based on the detected modification information, the location of the modified bases on the genome is determined by comparing the unconverted copy with a reference sequence, thereby accurately obtaining whole-genome methylation information. Attached Figure Description

[0056] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0057] Figure 1 is a flowchart of a method for multi-copy amplification of nucleic acid to be tested according to an embodiment of this application;

[0058] Figure 2 is a flowchart of a method for multi-copy amplification of nucleic acid to be tested according to another embodiment of this application;

[0059] Figure 3 is an example of an optional dual-link header structure according to an embodiment of this application;

[0060] Figure 4 is a flowchart of the method for constructing a library of nucleic acid to be tested based on multicopy amplification according to an embodiment of this application;

[0061] Figure 5 illustrates the multi-copy amplification and transformation of the target molecule according to an embodiment of this application;

[0062] Figure 6 shows the distribution of sequencing primer binding sites according to embodiments of this application;

[0063] Figure 7 illustrates the identification of true mutations based on mutual correction between dual-copy amplification products according to an embodiment of this application;

[0064] Figure 8 illustrates the base conversion in the double-copy amplification product during the construction of the methylated library according to an embodiment of this application;

[0065] Figure 9 is a schematic diagram of the method for constructing genetic and epigenetic detection libraries based on the multicopy amplification method proposed in the embodiments of this application;

[0066] Figure 10 illustrates a method for constructing a genetic and epigenetic detection library based on a multicopy amplification method according to an embodiment of this application;

[0067] Figure 11 illustrates a method for constructing a targeted genetics and epigenetic detection library based on a multicopy amplification method according to an embodiment of this application;

[0068] Figure 12 illustrates fragment size detection in the constructed library according to an embodiment of this application;

[0069] Figure 13 shows a comparison of sequencing error rates for libraries constructed according to conventional methods and methods of this application, based on embodiments of this application.

[0070] Figure 14 shows the detection results of multiple targets in targeted methylation according to an embodiment of this application;

[0071] Figure 15 illustrates the detection of genome-level modification information according to an embodiment of this application;

[0072] Figure 16 is a flowchart of the method for constructing a library of nucleic acid to be tested according to an embodiment of this application based on multicopy amplification. Detailed Implementation

[0073] The present invention will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the invention and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0074] This application is based on the inventor's following understanding:

[0075] Among related technologies, whole-genome bisulfite sequencing (WGBS) is the most commonly used method for studying DNA methylation in biological epigenetics. However, it has encountered many challenges in sequencing, such as being highly dependent on the completion status of whole-genome sequencing of the species to be analyzed, the extreme changes in GC content of the genome after converting unmethylated cytosine (C) to uracil (U) causing great amplification and sequencing bias in subsequent amplification, and the reduction in genome complexity after base conversion, making it difficult to effectively align to the reference genome. Even increasing the sequencing depth cannot solve this problem, resulting in the loss of DNA methylation information.

[0076] Furthermore, combining WGBS with high-throughput sequencing requires a massive amount of data, resulting in extremely high detection costs. Target region capture sequencing can effectively solve this problem. Target region capture sequencing is broadly divided into two types: one is capture technology based on multiplex PCR, and the other is capture sequencing technology based on hybridization. Both use multiple primers or probes to capture the gene region of interest in a single step, and then combine it with high-throughput sequencing technology to obtain the sequence information of the target region. However, current methylation-based multiplex PCR faces significant challenges in primer design. The reduced library complexity after bisulfite treatment increases the difficulty of primer design, reduces specificity, and easily forms primer dimers, thus severely limiting the primer multiplicity. For probe capture technology, the current mainstream strategy is to capture the target region first and then treat it with sulfite, or to treat it with sulfite first and then capture the target region. However, both strategies have certain drawbacks. For example, the strategy of capturing first and then treating is extremely challenging for low initial sample volumes. On the other hand, the strategy of treating first and then capturing requires designing special probes for DNA after sulfite treatment. The design process needs to traverse the methylated or unmethylated states of cytosine, which is expensive. Furthermore, due to the design of too many variable probes, the capture specificity of the probes is greatly reduced.

[0077] Based on this, the inventors, through numerous experiments and tests, developed a method for multi-copy amplification of nucleic acids to be tested, and proposed applications based on this method such as genome sequencing or DNA methylation detection. Furthermore, this application also proposes a double-linker for characterizing modified polynucleotides. Based on the special structure of this linker, it can be effectively used in the multi-copy amplification method and DNA methylation detection proposed in this application. The method and linker proposed in this application generate tandem double-copy molecules based on strand substitution, and library construction and sequencing of these tandem double-copy molecules can effectively correct sequencing errors during the detection process, greatly improving sequencing accuracy. In addition, when applying this method to epigenetic detection, such as DNA methylation detection, by introducing unmodified and / or modified bases into the newly generated copy and comparing it with the original copy sequence, the problem of methylation information loss in WGBS can be effectively overcome, achieving accurate detection of unmodified and / or modified bases in the original copy (i.e., template sequence). Further, based on the detected modification information, by comparing the unconverted copy with the reference sequence, the position of the modified bases on the genome can be determined, thereby accurately obtaining whole-genome methylation information.

[0078] The first aspect of this application provides a method for multi-copy amplification of nucleic acid to be tested, comprising:

[0079] a) Provides a first polynucleotide molecule comprising the test nucleic acid having a double-stranded structure and a first double-stranded connector, the first double-stranded connector being attached to both ends of the test nucleic acid, the double strands of the first double-stranded connector being at least partially complementary, the first polynucleotide molecule having a cyclic double-stranded structure, wherein each double strand of the first polynucleotide molecule contains a nick or gap; and

[0080] b) Contact the polymerase and dNTPs with the first polynucleotide molecule, wherein the polymerase performs an extension reaction based on the notch or gap, using the first polynucleotide molecule as a template, to perform chain substitution on the first polynucleotide molecule, thereby forming a second polynucleotide molecule, the second polynucleotide molecule containing the first double-linked head and one or more copies of the nucleic acid to be tested.

[0081] In this application embodiment, "polymerase" refers to any suitable polymerase that can be used in the method, such as phi29, Bst, Klenow, etc. A polymerase is an enzyme that synthesizes polynucleotides by adding a continuous nucleotide to the 3' end to generate complementary polynucleotides. The polymerase is preferably a strand displacement polymerase, which has strand displacement activity but not exonuclease activity. A strand displacement polymerase can displace a polynucleotide that hybridizes with the template polynucleotide, which is copied as the strand displacement polymerase moves along the template polynucleotide. In this application embodiment, polynucleotides are amplified by providing free dNTPs to the polymerase. Buffers suitable for polynucleotide amplification are known in the art.

[0082] In the embodiments of this application, "ligase" refers to DNA ligase and / or RNA ligase, which can ligate phosphodiester bonds between nucleotides, thereby catalyzing the ligation of a single nucleotide to a polynucleotide fragment and / or the ligation between polynucleotide fragments, wherein the polynucleotide fragment has sticky ends or blunt ends. Suitable buffer solutions and reaction conditions for polynucleotide ligation are known in the art.

[0083] In the embodiments of this application, "target molecule" and "nucleic acid to be tested" refer to the polynucleotide to be amplified, which can be single-stranded or double-stranded, preferably double-stranded, such as double-stranded DNA, double-stranded RNA, and / or DNA-RNA hybrid molecules. The target molecule can be of any length. For example, the length of the target molecule can be at least 10, at least 50, at least 70, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides or nucleotide pairs. The length of the target molecule can be up to about 1,000 or more nucleotides or nucleotide pairs, 5,000 or more nucleotides or nucleotide pairs, 10,000 or more nucleotides or nucleotide pairs, 100,000 or more nucleotides or nucleotide pairs, or 500,000 or more nucleotides or nucleotide pairs, or 1,000,000 or more nucleotides or nucleotide pairs, or 10,000,000 or more nucleotides or nucleotide pairs. The target molecule is preferably about 30 to about 100,000 nucleotides in length, such as about 50 to about 50,000 nucleotides, or about 70 to about 10,000 nucleotides. In some embodiments, the target molecule is in a double-stranded state with exposed ends, which can be linked to a first double-stranded header for multicopy amplification.

[0084] In this application, a "double-link head" refers to a polynucleotide molecule having at least partially complementary double-stranded or double-stranded structures. In some embodiments, the two strands of the double-link head are at least complementary or partially complementary at their 3' ends, so that when linked to the target molecule, they provide a double-stranded or double-stranded structure. In some embodiments, the double-link head comprises two or more polynucleotide chains, wherein each polynucleotide chain is at least partially complementary to another polynucleotide chain to form a double-stranded structure. In some specific embodiments, the double-link head may consist of double-link head A and / or double-link head B connected to both ends of the nucleic acid to be tested, wherein double-link head A and / or double-link head B themselves expose 3' end protrusions, or expose 3' end protrusions after enzymatic digestion, and these protrusions are at least partially complementary to each other so that when linked to the polynucleotide molecule, they present a cyclic double-stranded structure. In some embodiments, both ends of the double-link head are connected to the nucleic acid to be tested. In this application, "at least partially complementary" means that the two polynucleotide chains contain partially complementary sequences, or that the two polynucleotide chains are completely complementary.

[0085] In some specific embodiments, a gap or notch can be provided to the first polynucleotide molecule by providing a double-linked header with a specific structure. In some embodiments, the double-linked header may comprise two or more polynucleotide chains, wherein one polynucleotide chain is at least partially complementary to another polynucleotide chain to form a double-linked header with a double-stranded structure. Figure 2 illustrates a double-stranded header according to one embodiment of this application, which consists of four polynucleotide chains, wherein the 3' end of the first polynucleotide chain and the 5' end of the second polynucleotide chain provide a first complementary portion, the 3' end of the second polynucleotide chain and the 3' end of the third polynucleotide chain provide a second complementary portion, and the 5' end of the third polynucleotide chain and the 3' end of the fourth polynucleotide chain provide a third complementary portion, wherein the break is provided by the unconnected 5' end of the first polynucleotide chain and the 3' end of the third polynucleotide chain, and the unconnected 3' end of the second polynucleotide chain and the 5' end of the fourth polynucleotide chain. Optionally, the target molecule can be linked between a first double-stranded exposed end formed by the 3' end of the first polynucleotide chain and the 5' end of the second polynucleotide chain, and a second double-stranded exposed end formed by the 5' end of the third polynucleotide chain and the 3' end of the fourth polynucleotide chain. In some embodiments, the double-stranded header may comprise the four polynucleotide chains shown in SEQ ID NO: 1-4. Understandably, by specially designing the dual-linker head, it can contain many functional sequences that can be used for ligation, strand substitution, and subsequent product enrichment, library construction, and sequencing, thereby greatly simplifying experimental operations. Amplification reactions based on this dual-linker head can effectively obtain double or multiple copies of the target molecule amplification product, effectively improving sequencing accuracy.

[0086] In this embodiment, the dual-link header may contain functional sequences that can be used for sequencing, such as one or more of the following: tag sequences, such as molecular tags for labeling single-molecule sources and sample tags for labeling sample sources (e.g., single-cell sources); modified nucleotides, such as fluorescent modifications for detection and biotin modifications for affinity purification; and sequencing primer-binding sequences for binding with sequencing primers. In some embodiments, the dual-link header may contain one, two, or more sequencing primer-binding sequences.

[0087] In this embodiment, each strand of the dual-link head may further include an enzyme cleavage site for providing an exposed breakpoint (i.e., a notch and / or nick) to the polymerase during amplification; exposing at least partially complementary end sequences to each other in the dual-link heads (e.g., dual-link heads A and B), thereby circularizing the enzyme digestion product based on these complementary end sequences; and / or, after amplification, optionally cleaving the dual-link head contained in the multicopy product to remove the dual-link head or provide other operational possibilities for the multicopy product. In some embodiments, the enzyme cleavage site may include an endonuclease cleavage site, preferably a restriction endonuclease cleavage site, and a modified base. In some embodiments, the enzyme cleavage site is selected from ribonucleotides (e.g., uracil) and modified purine bases (e.g., 7,8-dihydro-8-oxoguanine). Furthermore, the dual-link heads in this embodiment may also include other functional sequences as needed, and this application does not limit their inclusion.

[0088] In this embodiment, a breakpoint is provided in the linker between the double-linked head and the nucleic acid to be tested (i.e., the first polynucleotide molecule), thereby providing a reaction recognition site for a polymerase with strand displacement activity. Based on this breakpoint, strand displacement occurs under the action of the polymerase, forming a second polynucleotide molecule containing two or more copies of the nucleic acid to be tested. In some embodiments, an enzyme cleavage site is provided in the double strand of the double-linked head and / or the double strand of the nucleic acid to be tested, and the breakpoint is provided in the first polynucleotide molecule based on the cleavage of the corresponding enzyme. In other embodiments, the breakpoint is provided in the first polynucleotide molecule by a specially designed double-linked head. Accordingly, in some embodiments, the breakpoint may occur at the junction of the first double-linked head, the nucleic acid to be tested, and / or the connection between the first double-linked head and the nucleic acid to be tested, for example, between the 5' end of the first and second strands and the 3' end of the double strand of the double-linked head.

[0089] In some specific embodiments, one or more ribonucleotide cleavage sites (NTPs) can be introduced into the 3' end, preferably the 3' end, of the double-stranded twin-link head, and cleaved by the corresponding RNase H enzyme to create one or more nicks at the ribonucleotide positions, providing an initiation nick for subsequent polymerase reactions. In other embodiments, other modified bases or restriction endonuclease recognition sequences (e.g., other glycosidic bonds or restriction endonuclease recognition sites) can be provided in the twin-link head to create breaks through other endonucleases for recognition by strand substitution polymerases. In some specific embodiments, the cleaving enzymes performing the digestion can include endonucleases and modified base-specific cleaving enzymes, such as UDG / UNG, RNase H, 8-oxoguanine DNA glycosylase (Ogg1) & AP-endonuclease 1 (APE1) or N-methylpurine DNA glycosylase (MPG) & AP-endonuclease 1 (APE1). It is understood that the specific design of the first twin-link head provides a feasible basis for simple and efficient multicopy tandem repeat amplification.

[0090] In this embodiment, a template for strand substitution is provided by providing a circular or quasi-circular double-linked connector and a linker (i.e., a first polynucleotide molecule) for the nucleic acid to be tested. In some embodiments, a template with a circular or quasi-circular double-stranded structure can be provided for strand substitution by separately ligating the two ends of the nucleic acid to be tested (e.g., double-linked connectors A and B, which, after being linked to the test molecule, form a first polynucleotide precursor, which exhibits a linear double-stranded structure), and by achieving circularization based on the complementary sequences between double-linked connectors A and B. In some embodiments, circularization can be achieved by exposing partially complementary terminal sequences of double-linked connectors A and B through a first enzyme digestion; simultaneously, based on this first enzyme digestion, since the terminal sequences of double-linked connectors A and B are not completely complementary, polymerase recognition can be performed based on the breakpoints caused by the incomplete complementarity between them, thereby performing strand substitution. In other embodiments, the first enzyme digestion can expose the fully complementary terminal sequences of the dual-linker A and B to achieve circularization; then, the circularized product is cleaved by a second enzyme digestion to provide a break point, wherein the first and second enzyme digestion sites are different, and the order of the first and second enzyme digestion can be interchanged. In some embodiments, both the first and second enzyme digestion sites are included in the dual-linker.

[0091] In this embodiment, a closed circular precursor (i.e., a first polynucleotide precursor, which presents a circular double-stranded structure) can be provided by directly linking a circular or quasi-circular double-linked head to both ends of the nucleic acid to be tested. Then, the first polynucleotide precursor is cleaved with enzymes, and the cleavage sites contained in the double-linked head provide recognizable breakpoints for polymerase. In other embodiments, after linking the circular or quasi-circular double-linked head to both ends of the nucleic acid to be tested to provide a closed circular precursor (i.e., a first polynucleotide precursor, which presents a circular double-stranded structure), the breakpoints are provided based on the unconnected ends between two or more polynucleotide chains in the quasi-circular double-linked head for direct chain substitution. In some embodiments, the quasi-circular double-linked head may contain one or more modified nucleotides, such as phosphorylated, dephosphorylated, fluorescently modified, or affinity-modified nucleotides.

[0092] In the embodiments of this application, the nucleic acid to be tested and the dual-linker can be specially designed to present specific ends to achieve the connection between the two. For example, complementary sticky ends can be provided for the nucleic acid to be tested and the dual-linker, or blunt ends can be provided for both to achieve the connection between the blunt ends and / or sticky ends. These can be achieved based on conventional operations in the art, such as end repair, etc., and this application does not limit them.

[0093] In this embodiment, the method further includes: c) performing an end-repair and A-addition reaction based on the second polynucleotide molecule to provide a second double-linked head to the second polynucleotide molecule, and repeating steps a)-b) to obtain a third polynucleotide molecule, wherein the third polynucleotide molecule contains the first double-linked head, the second double-linked head, and four copies of the nucleic acid to be tested. In some embodiments, the method further includes: d) performing an end-repair and A-addition reaction based on the third polynucleotide molecule to provide a third double-linked head to the third polynucleotide molecule, and repeating steps a)-b) to obtain a fourth polynucleotide molecule, wherein the fourth polynucleotide molecule contains eight copies of the first double-linked head, the second double-linked head, the third double-linked head, and the nucleic acid to be tested, to achieve multi-copy amplification of the nucleic acid to be tested. In some embodiments, the first double-linked head, the second double-linked head, and the third double-linked head may be the same or different. It is understandable that by simultaneously or successively providing the same or different first double-linked head, second double-linked head, third double-linked head, ... Nth double-linked head, etc., and repeating strand substitution in the reaction system, double, four, eight or more copies of the target molecule can be obtained as amplification products. Based on the mutual correction between the multi-copy results of these amplification products, the sequencing accuracy can be improved to a greater extent.

[0094] Figure 1 shows a flowchart of the method for multi-copy amplification of the nucleic acid to be tested according to an embodiment of this application. As shown in Figure 1, firstly, a first polynucleotide molecule is obtained by providing a double-linked header to the nucleic acid to be tested, connecting the two, and providing a breakpoint. The breakpoint is located at the junction of the two strands. Based on this breakpoint, the first polynucleotide molecule can be divided into a 3' end overlap region (i.e., the double-linked header portion) and a 5' end overlap region (i.e., the nucleic acid to be tested portion). Then, a polymerase with strand displacement activity recognizes the breakpoint between the two strands and starts from the 3' end of the first strand (positive strand) of the nucleic acid to be tested, using the second strand (negative strand) of the target molecule as a template, according to the principle of reverse complementarity, sequentially adding dNTPs and / or specifically modified dNTPs to synthesize a new copy of the nucleic acid to be tested. Similarly, the second strand (negative strand) of the nucleic acid to be tested is used in the same way to finally generate a linear double-copy amplification product of the nucleic acid to be tested. In this linear double-copy amplification product, the original copy of the nucleic acid to be tested and the newly generated copy are located at both ends, connected by a double-linked header. It is understood that sequencing of the double-copy or multi-copy products obtained by the method proposed in the embodiments of this application can effectively correct sequencing errors in the detection process and greatly improve sequencing accuracy.

[0095] In this application, the dual-link head can have various structures. Figure 3 shows some dual-link heads according to embodiments of this application. As shown in Figure 3, the ends of the dual-link head can be blunt ends and / or sticky ends to connect with the ends of the analyte molecule. For example, the 3' end can be a sticky end with a prominent single base T, which can be complementary to the sticky end A of the analyte molecule for connection. In some embodiments, the two strands of the dual-link head are at least partially complementary or completely complementary. For example, in the case of partial complementarity, it can have a free hanging tail, a bubbling structure, etc. In some embodiments, the dual-link head can have two or more polynucleotide chains, for example, it can be composed of dual-link head A and B, wherein a sequence complementary to dual-link head B can be provided at the end of one strand of dual-link head A, thereby enabling "dual-link head A - analyte nucleic acid - dual-link head B" to be circularized based on the complementary sequence. In this embodiment, the complementary sequence can be directly provided at the ends of the double linker A and B, or by setting an enzyme cleavage site at the ends of one or both of the double linker A and B, so as to expose the complementary sequence through enzyme cleavage to achieve circularization (as shown in Figure 4).

[0096] As shown in Figure 3, the dual-link header in this embodiment may contain one or more restriction enzyme sites, such as restriction enzyme sites that expose the complementary ends and / or restriction enzyme sites that provide breakpoints. In some embodiments, the one or more restriction enzyme sites include endonuclease recognition sites and / or modified bases. In this embodiment, these restriction enzyme sites may be the same, partially the same, or different. The dual-link header in this embodiment may also contain functional sequences that can be used for sequencing, such as one or more of the following: tag sequences, such as molecular tags for labeling single-molecule sources and sample tags for labeling sample sources (e.g., single-cell sources); modified nucleotides, such as fluorescent modifications for detection, biotin modifications for affinity purification, etc.; and sequencing primer-binding sequences for binding with sequencing primers. In some embodiments, the dual-link header may contain one, two, or more sequencing primer-binding sequences.

[0097] Besides using methods such as enzyme digestion to provide the break in the first polynucleotide molecule, the break can also be provided based on the special structure of the double-linked head. Figure 2 is a flowchart of a method for multi-copy amplification of the nucleic acid to be tested according to another embodiment of this application. As shown in Figure 2, the double-linked head contains four polynucleotide chains, wherein the four polynucleotide chains have complementary portions in sequence to form a double-stranded structure; the nucleic acid to be tested can be inserted and linked between the two ends provided by the four polynucleotide chains, thereby forming a first polynucleotide molecule with a ring-like structure, wherein the break is provided by the ends of the raised, unconnected polynucleotide chains for polymerase recognition and strand substitution reaction. It is understood that by specially designing the double-linked head, it can contain many functional sequences that can be used for ligation, strand substitution, and subsequent product enrichment, library construction, and sequencing, thereby greatly simplifying experimental operations. The amplification reaction based on the double-linked head can effectively obtain double or multiple copies of the nucleic acid to be tested amplified, effectively improving sequencing accuracy.

[0098] In this embodiment, the nucleic acid to be tested can be double-stranded DNA, double-stranded RNA, or a DNA-RNA hybrid. In some embodiments, based on the fact that the nucleic acid to be tested is a double-stranded RNA or a DNA-RNA hybrid, the method further includes: converting the RNA chain in the double-stranded RNA or DNA-RNA hybrid into a DNA chain, optionally by reverse transcription or template conversion. In some embodiments, the nucleic acid to be tested may also contain modified nucleotides and / or non-natural nucleotides.

[0099] The second aspect of this application provides a method for constructing a nucleic acid library based on multicopy amplification, comprising: 1) performing multicopy amplification on the nucleic acid to be tested according to the method for multicopy amplification of the nucleic acid to be tested as described in any embodiment of the first aspect of this application, thereby obtaining amplification products of two or more copies of the nucleic acid to be tested; and 2) constructing a library from the amplification products of two or more copies of the nucleic acid to be tested to obtain a nucleic acid library. In some embodiments, the library construction further includes one or more of the following: further amplification of the amplification products of two or more copies of the nucleic acid to be tested, end repair and ligation of sequencing adapter sequences, and purification of the products after each step. It is understood that conventional library construction steps, such as ligation of universal sequencing adapters, can be performed on the multicopy products amplified by the method proposed in the embodiments of this application, and this application does not limit this.

[0100] In this embodiment, based on the fact that the first dual-linker head contains functional sequences that can be used for sequencing, such as tag sequences, modified nucleotides, enzyme cleavage sites, and / or first sequencing primer binding sequences, the obtained double-copy or multi-copy amplification products can be directly used as libraries for sequencing. In other embodiments, based on the fact that the dual-linker head does not contain partially functional sequences that can be used for sequencing, the obtained double-copy or multi-copy amplification products can be subjected to adapter ligation (the adapter sequence may contain a third sequencing primer binding sequence and an optional fourth sequencing primer binding sequence), product amplification, purification, etc., to obtain a nucleic acid library. In some embodiments, the adapter sequence can be a second-generation sequencing adapter sequence, such as the second-generation sequencing adapter sequences used in the Illumina sequencing platform, the Ion Torrent sequencing platform, or the MGI sequencing platform; preferably, the second-generation sequencing adapter sequence is the P5 and P7 end adapter of the Illumina sequencing platform, the P1 and A adapter or the P1 and X adapter of the Ion Torrent sequencing platform, or the linear adapter and the bubbly adapter of the MGI sequencing platform; more preferably, the second-generation sequencing adapter sequence is the P5 and P7 end adapter of the Illumina sequencing platform. In addition, multi-copy amplification products can be further processed to suit the needs of different types of sequencing platforms, and this application does not intend to limit this.

[0101] In this embodiment, the method further includes: preprocessing the nucleic acid to be tested, wherein the preprocessing includes: end repair of the nucleic acid to be tested. In some embodiments, the preprocessing further includes one or more of fragmentation, purification, and amplification.

[0102] In this embodiment, the nucleic acid to be tested is DNA, RNA, or a DNA-RNA hybrid. If the nucleic acid is RNA, the method further includes: reverse transcription using the nucleic acid to be tested as a template to obtain a DNA-RNA hybrid molecule; and library construction based on the DNA-RNA hybrid molecule. In some embodiments, if the nucleic acid to be tested is RNA, the method further includes: template conversion and optional double-strand synthesis of the DNA-RNA hybrid molecule. Specifically, when constructing a library for RNA, random primers or oligodT can be used, with dNTPs as substrates, and reverse transcription catalyzed by polymerase to obtain cDNA-RNA hybrid molecules. In some embodiments, the obtained cDNA-RNA hybrid molecule can also undergo template conversion and double-strand synthesis to obtain a double-stranded DNA molecule, and subsequent ligation and substitution will continue in the form of a double-stranded DNA molecule. The reaction conditions for reverse transcription, template conversion, and double-strand synthesis are known in the art.

[0103] The third aspect of this application provides a method for constructing a modified nucleic acid library based on multicopy amplification, comprising: performing multicopy amplification on the nucleic acid to be tested according to the method for multicopy amplification of the nucleic acid to be tested as described in any embodiment of the first aspect of this application, thereby obtaining amplification products of two or more copies of the nucleic acid to be tested, wherein the dNTPs used include: i) dATP, dTTP, dGTP and dCTP; or ii) one or more of dATP, dTTP, dGTP and dCTP are modified nucleotides, and the rest are unmodified nucleotides; and converting the amplification products of the nucleic acid to be tested to obtain the modified nucleic acid library, wherein the modified nucleotides or unmodified nucleotides in the amplification products are converted into one or more specific nucleotides.

[0104] In this embodiment, copies of the nucleic acid to be tested are synthesized using four conventional unmodified dNTPs or one or more modified nucleotides (such as 5m-dCTP / dATP / dTTP / dGTP, 5hm-dCTP / dATP / dTTP / dGTP, or 6mA-dATP / dCTP / dTTP / dGTP, etc.). In some embodiments, the types of modified nucleotides that can be used can be one or more of the following: 1mC, 4mC, m2C, 5mC, 5hmC, 5fC, 5caC, 1mA, 3mA, 7mA, 6mA, 9mA, 6-DMA, HAP, AHAP, m2A, 1mG, 3mG, 7mG, m6G, CEG, diHT, 1mT, 3mT, 5fU, 5caU, and 5hmU, etc. In some embodiments, the types of modified nucleotides that can be used can be 5mC, 5hmC, 5fC, and / or 5caC. In some embodiments, the types of modified nucleotides that can be used may be DNA methylation modifications, such as 5mC and / or 5hmC. It is understood that the embodiments of this application synthesize new copies of the nucleic acid to be tested by using or without modified nucleotides. Through transformation, the modified or unmodified nucleotides in the original nucleic acid to be tested can be differentiated from the corresponding nucleotides in the newly synthesized copy. Therefore, by comparing the two, the nucleotide modification status in the original copy can be determined, greatly improving the detection accuracy and efficiency of modified nucleotides in epigenetic detection.

[0105] In this application embodiment, modified or unmodified nucleotides in the amplification product can be converted into one or more specific nucleotides using chemical or biological methods. In some embodiments, the chemical method includes treatment with bisulfite (such as sodium bisulfite), bisulfite, bisulfite, or ammonium salt (such as ammonium bisulfite), and the biological method includes enzyme treatment, including deaminase treatment or oxidase treatment. In this application embodiment, converting modified or unmodified nucleotides in multi-copy amplification products into specific nucleotides facilitates comparison between multiple copies and identification of nucleotide modifications, thereby greatly improving the accuracy and efficiency of modified nucleotide detection in epigenetic testing.

[0106] In this application, specific nucleotides may include U or T. That is, in some embodiments, certain unmodified nucleotides (e.g., C) can be converted into U, while modified nucleotides C will not be converted. This application achieves this by converting specific nucleotides, thereby creating differences in corresponding nucleotides between multiple copies. By comparing these differences, the nucleotide modifications in the original copy can be determined, greatly improving the accuracy and efficiency of detecting modified nucleotides in epigenetic testing.

[0107] Figure 5 illustrates a method for multi-copy amplification and transformation of the nucleic acid to be tested according to an embodiment of this application. As shown in Figure 5, based on a certain nucleotide type in the original copy, replication can be performed using conventional dNTPs (i.e., the unmodified base "●" in the newly generated copy shown in Figure 5) or dNTPs containing a certain modified base (i.e., the modified base "×" in the newly generated copy shown in Figure 5), resulting in a DNA product with two copies. The newly generated copy contains either all unmodified bases or all modified bases (i.e., all unmodified bases "●" or modified bases "×"), while the original copy contains both unmodified bases "●" and modified bases "×". The unmodified bases "●" or modified bases "×" can be transformed, and the transformed bases are represented by "■". As shown in Figure 5, the unmodified base "●" or modified base "×" in the original copy will be transformed with the base in the new copy. Therefore, by tracing back and comparing the base types in two or more copies, the nucleotide modification status in the original copy can be determined, which greatly improves the detection accuracy and efficiency of modified nucleotides in epigenetic detection.

[0108] It is understood that by designing a double-linked head and selecting the type of modified or unmodified nucleotides used for transformation, the sequences in the double-linked head or the constructed library used for amplification, enrichment, and / or sequencing can be protected from being affected by transformation, thereby ensuring the accuracy of the modification detection method proposed in the embodiments of this application.

[0109] In this embodiment, the method further includes: enriching the modified nucleic acid library according to the target molecule to obtain a modified nucleic acid library enriched with the target molecule as the target library. In some embodiments, the enrichment is performed by PCR amplification or probe capture. In some embodiments, the probe includes a nucleic acid sequence probe, a biotin-labeled probe, or a protein probe. It is understood that, compared with conventional techniques, the method proposed in this embodiment can retain the original sequence information after the transformation of multi-copy products by using unconverted bases when synthesizing new copies. Therefore, specific primers and probes can be designed based on the original sequence, thereby solving the problem in related technologies where the design of primers and probes is difficult due to the low complexity of the transformed sequence, and greatly improving the enrichment accuracy of target molecules in targeted sequencing.

[0110] The fourth aspect of this application also proposes a method for constructing a library for detecting polynucleotide methylation modifications, comprising: 1) providing a first polynucleotide molecule, the first polynucleotide molecule comprising the test nucleic acid having a double-stranded structure and a first double-stranded header, the first double-stranded header being linked to two ends of the test nucleic acid, the double strands of the first double-stranded header being at least partially complementary, the first polynucleotide molecule exhibiting a cyclic double-stranded structure, wherein both double strands of the first polynucleotide molecule contain nicks or gaps; and 2) contacting a polymerase and dNTPs with the first polynucleotide molecule, the polymerase, based on the nicks or gaps, using the first polynucleotide molecule as a model... The plate undergoes an extension reaction to perform a chain substitution on the first polynucleotide molecule, thereby forming a second polynucleotide molecule, the second polynucleotide molecule containing one or more copies of the first double-linked head and the nucleic acid to be tested; and 3) the second polynucleotide molecule is subjected to nucleotide conversion to obtain the methylated library, wherein the dNTPs used include: i) dATP, dTTP, dGTP, and dCTP; or ii) one or more of dATP, dTTP, dGTP, and dCTP are modified nucleotides, and the remainder are unmodified nucleotides, wherein one or more modified or unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides. In some embodiments, one or more unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides.

[0111] Specifically, copies of the nucleic acid to be tested are synthesized using four conventional unmodified dNTPs or 5m-dCTP / dATP / dTTP / dGTP, and the amplification product of the nucleic acid is transformed to obtain the nucleic acid library for detecting DNA methylation modification. The unmodified nucleotide C in the amplification product is converted to a specific nucleotide U, while the modified nucleotide C remains C. It is understood that this embodiment synthesizes new copies of the nucleic acid to be tested (i.e., newly generated copies) using or without modified nucleotide C. Transformation allows for differences between the modified nucleotide 5mC or unmodified nucleotide C in the original nucleic acid to be tested (i.e., the original copy) and the corresponding nucleotide in the newly synthesized copy. By comparing the two, the DNA methylation modification status in the original copy can be determined, thereby greatly improving the detection accuracy and efficiency of modified nucleotides in epigenetic detection.

[0112] In some embodiments, if the modified nucleotides in the multicopy amplification product are transformed, the dNTP used for the synthesis of the new copy is preferably the corresponding unmodified dNTP; if the unmodified nucleotides in the multicopy amplification product are transformed, the dNTP used for the synthesis of the new copy is preferably the corresponding modified dNTP, so that the modification sites between the original copy and the newly generated copy in the transformed multicopy amplification product are differentiated, thereby accurately identifying sequence modification information by comparing the sequencing information of the two; at the same time, since the untransformed copy (original copy or newly generated copy) can be accurately located on the genome, its modification status on the genome can be obtained with high accuracy based on the identified modification information.

[0113] This application also proposes a method for characterizing polynucleotides, comprising: sequencing a nucleic acid library obtained by the method for constructing a nucleic acid library based on multicopy amplification according to any one of the embodiments of this application to obtain sequencing data of the nucleic acid; and analyzing the sequencing data to characterize the polynucleotides. In some embodiments, the polynucleotides are genomic sequences, and the characterization is whole-genome sequencing or genome-targeted sequencing, etc.

[0114] In this embodiment, based on the fact that the multi-copy amplification products of the nucleic acids in the nucleic acid library are double-copy amplification products, the analysis of the sequencing data includes: aligning the sequencing sequences of the double-copy amplification products according to nucleotide positions; identifying the identical nucleotides at the same position in the sequencing sequences of the double-copy amplification products as the nucleotide at that position; and identifying the nucleotide with the higher quality value at the same position in the sequencing sequences of the double-copy amplification products as the nucleotide at that position, or recording the nucleotide at that position as N, and optionally setting its quality value to "33". It is understood that by mutually correcting the multi-copy sequencing data, more accurate sequencing results can be obtained, thereby greatly improving the accuracy of sequencing.

[0115] In some embodiments, base positions can be determined and aligned based on the base consistency between the sequencing sequences of the double-copy amplification products; in other embodiments, base positions can be determined and aligned by comparing the sequencing sequences of the double-copy amplification products to a reference sequence.

[0116] In some embodiments, the method further includes: recording the mass value corresponding to the determined bases based on the determined nucleotides at each position; optionally, the mass value Qm is calculated using the formula: Q1 = -10log 10 (e1), Q2 = -10log 10 (e2) Qm=-10log 10 (e1*e2)

[0117] Where e is the estimated base error detection rate, Q1 is the quality value of the base at this position in one copy of the double-copy sequencing data, and Q2 is the quality value of the base at this position in the other copy of the double-copy sequencing data.

[0118] In this embodiment of the application, the method further includes: converting the determined base quality values ​​at each position into ASCII (American Standard Code for Information Interchange) codes, and optionally writing them into a fastq file. It is understood that the determined bases and their quality values ​​can also be converted into other formats, such as binary, quaternary, decimal, octal, hexadecimal, etc., and can be written into various types of data record files; this application does not impose any limitations on this.

[0119] In this embodiment, since both the dual-linker head and the additional adapter sequence contain sequencing primer binding sequences, different sequencing primer pairs can be used to sequence the original copy and the newly generated copy separately to distinguish the sequencing results of the original copy and the newly generated copy. The two are then compared subsequently for mutual verification and correction, as shown in Figure 6. It is understood that sequencing both ends of the original strand and the newly generated strand using different sequencing primers and comparing the sequencing results can effectively correct potential amplification or sequencing errors in library preparation and sequencing, thereby greatly improving sequencing accuracy.

[0120] This application also proposes a method for characterizing polynucleotide methylation modifications, comprising: sequencing a methylated library obtained by the method for constructing a library for detecting polynucleotide methylation modifications according to any of the above embodiments of this application to obtain sequencing data of the polynucleotide; and analyzing the sequencing data to characterize the polynucleotide methylation modifications.

[0121] In this embodiment of the application, the method specifically includes: sequencing the modified nucleic acid library to obtain sequencing data containing the polynucleotide sequences and nucleotide modifications in the modified nucleic acid library; and analyzing the sequencing data to characterize the nucleotide modifications in the polynucleotides.

[0122] In some embodiments, the method is based on the fact that the multicopy amplification product of the nucleic acid in the modified nucleic acid library is a double-copy amplification product. The method includes: comparing the newly generated copy (i.e., the synthetic copy) in the double-copy amplification product with the original copy to determine the modified nucleotide in the polynucleotide; and determining the position of the modified nucleotide in the genome according to the position of the original copy or the newly generated copy in the genome to obtain the nucleotide modification status in the genome.

[0123] In some embodiments, if the modified or unmodified nucleotides in the double-copy amplification product are converted into specific nucleotides by transformation, and the dNTPs used in the double-copy amplification are unmodified or modified dNTPs, then for the same position: if the nucleotides in the original copy in the sequencing data are consistent with the nucleotides in the newly generated copy, and the type of nucleotide involved in the conversion to the specific nucleotide is involved, then the nucleotide at that position is determined to be an unmodified or modified nucleotide; if the nucleotides in the original copy in the sequencing data are inconsistent with the nucleotides in the newly generated copy, and the type of nucleotide involved in the conversion to the specific nucleotide is involved, then the nucleotide at that position is determined to be a modified or unmodified nucleotide.

[0124] In some embodiments, if the modified nucleotides in the multicopy amplification product are transformed, the dNTPs used for synthesizing new copies are preferably the corresponding unmodified dNTPs; if the unmodified nucleotides in the multicopy amplification product are transformed, the dNTPs used for synthesizing new copies are preferably the corresponding modified dNTPs, so that there is a site difference between the original copy and the newly generated copy in the transformed multicopy amplification product, thereby accurately identifying sequence modification information by comparing the sequencing information of the two. Further, based on the obtained modification site, the location of the modification site on the genome is obtained by comparing the untransformed copy (original copy or newly generated copy) with the genome, thereby accurately obtaining genomic methylation information.

[0125] In other embodiments, unmodified nucleotides in the double-copy amplification product are converted into specific nucleotides through transformation, and the dNTPs used in the double-copy amplification are modified dATP, dTTP, dGTP, and / or dCTP corresponding to the type of modified nucleotide. Then, for the same position: if the nucleotides in the original copy in the sequencing data are inconsistent with the nucleotides in the newly generated copy, and involve the type of nucleotide to be converted into the specific nucleotide, then the nucleotide at that position is identified as an unmodified nucleotide; if the nucleotides in the original copy in the sequencing data are consistent with the nucleotides in the newly generated copy, and involve the type of nucleotide to be converted into the specific nucleotide, then the nucleotide at that position is identified as a modified nucleotide. Further, based on the obtained modified nucleotides, the position of the modified site on the genome is obtained by comparing the newly generated copy with the genome, thereby accurately obtaining genomic methylation information.

[0126] In other embodiments, the modified nucleotides in the double-copy amplification product are converted into specific nucleotides through transformation, and the dNTPs used in the double-copy amplification are unmodified dNTPs. Then, for the same position: if the nucleotides in the original copy in the sequencing data are identical to those in the newly generated copy, the nucleotide at that position is identified as an unmodified nucleotide; if the nucleotides in the original copy in the sequencing data are inconsistent with those in the newly generated copy, the nucleotide at that position is identified as a modified nucleotide. Further, based on the obtained modified nucleotides, the location of the modified site on the genome is obtained by comparing the newly generated copy with the genome, thereby accurately obtaining genomic methylation information.

[0127] In other embodiments, the modified nucleotides in the double-copy amplification product are converted into specific nucleotides by transformation, and the dNTPs used in the double-copy amplification are modified dATP, dTTP, dGTP, and / or dCTP corresponding to the type of modified nucleotide. Then, for the same position: if the nucleotides in the original copy in the sequencing data are inconsistent with the nucleotides in the newly generated copy, and the nucleotide type involved is converted into the specific nucleotide, then the nucleotide at that position is determined to be an unmodified nucleotide; if the nucleotides in the original copy in the sequencing data are consistent with the nucleotides in the newly generated copy, and the nucleotide type involved is converted into the specific nucleotide, then the nucleotide at that position is determined to be a modified nucleotide.

[0128] The transformation-based nucleic acid modification detection method proposed in this application involves adding unmodified or modified bases for chain substitution, resulting in a newly generated copy containing unmodified or modified bases. The unmodified or modified bases are then transformed, and by combining the transformation information from the original copy and the newly generated copy, accurate information about the unmodified or modified bases in the original copy can be obtained. Simultaneously, since the original copy or newly generated copy does not involve transformation and thus presents its original sequence information, the untransformed original copy or newly generated copy can be accurately aligned to the genome, thereby mapping the obtained modified bases to the genome and obtaining the modification information at that position at the genome level (Figure 15).

[0129] This application also proposes a method for characterizing DNA methylation modification, comprising: sequencing a nucleic acid library obtained by the method for constructing a nucleic acid library for detecting DNA methylation modification based on multicopy amplification according to any one of the above embodiments of this application to obtain sequencing data of the nucleic acid; and analyzing the sequencing data to characterize the DNA methylation modification of the polynucleotide.

[0130] In this embodiment of the application, the multicopy amplification product of the nucleic acid in the nucleic acid library is a double-copy amplification product. The method further includes: comparing the newly generated copy in the double-copy amplification product with the original copy to determine the DNA methylation modification status in the polynucleotide.

[0131] In some embodiments, as shown in FIG8, the unmodified nucleotide C in the double-copy amplification product is converted into a specific nucleotide U by conversion, and the dNTPs used in the double-copy amplification are 5m-dCTP and dATP, dTTP, and dGTP corresponding to the modified nucleotide type 5mC. Then, for the same position: if the nucleotide in the original copy in the sequencing data is inconsistent with the nucleotide in the newly generated copy, the nucleotide at that position is determined to be the unmodified nucleotide C; if the nucleotide in the original copy in the sequencing data is consistent with the nucleotide in the newly generated copy, and involves the conversion of nucleotide type C to the specific nucleotide U, the nucleotide at that position is determined to be the modified nucleotide 5mC.

[0132] Understandably, by using or not using modified nucleotide C to synthesize new copies of the target molecule, transformation can create differences between the modified nucleotide 5mC or unmodified nucleotide C in the original target molecule and the corresponding nucleotides in the newly synthesized copy. Therefore, by comparing the two, the DNA methylation modification status in the original copy can be determined. Furthermore, by using modified or unmodified nucleotides during the synthesis of the new copy, the newly generated copy strand does not undergo nucleotide transformation during subsequent transformations, preserving the original genomic information and improving the efficiency of genome alignment. This allows for the accurate location of each modified base at the genomic level, thereby greatly improving the detection accuracy and efficiency of modified nucleotides in epigenetic detection. Simultaneously, bases not involved in transformation correspond to two / more copies of information. Correction using this two / more copy information can effectively avoid nucleotide errors introduced during library construction and sequencing due to sequence synthesis (as shown in Figure 7).

[0133] This application also proposes a method for constructing genetic and epigenetic detection libraries based on a multicopy amplification method. Figure 9 shows a schematic diagram of the method for constructing genetic and epigenetic detection libraries based on a multicopy amplification method proposed in this application. As shown in Figure 9, genetic and epigenetic detection libraries can be constructed based on a double-linked header containing multiple polynucleotide chains (as shown in Figure 2, referred to here as a "quadruple primer adapter"). Specifically, cell-free DNA (cfDNA) or fragmented DNA is ligated to the quadruple primer adapter to form a circular structure; a polymerase with substitution activity recognizes the unligated ends in the quadruple primer adapter as gaps, mediates DNA extension starting from the 3' end of the template strand under 5mC dNTP mix conditions, and copies out a DNA sequence consistent with the template strand sequence information. All cytosine in the newly generated strand is methylated. Therefore, when the amplification product is converted by methyltransferase or treated with sulfite, the unmethylated C in the original strand is converted to U, preserving the DNA methylation information, while all methylated C in the newly generated strand remains unchanged, preserving the DNA information. This amplification product can be used for subsequent multiplex PCR amplification, methylation capture, and high-throughput library construction and sequencing.

[0134] Figure 10 illustrates a method for targeted detection of genetic and epigenetic information using multiplex PCR amplification based on strand substitution products according to an embodiment of this application. The method further includes: circularization using a quadruple adapter or a specific adapter; obtaining a double-stranded linear product containing the original copy and the newly generated copy through strand substitution; targeted amplification of the double-stranded linear product using multiple pairs of specific primers; and library construction of the targeted amplification product, for example, by adding sequencing adapter sequences.

[0135] Figure 11 illustrates a method for targeted detection of genetic and epigenetic information using probe capture based on strand substitution products according to an embodiment of this application. Based on the method shown in Figure 9, the method further includes: circularization via a tetrad adapter or a special adapter; obtaining a double-stranded linear product containing the original copy and the newly generated copy through strand substitution; and enriching and purifying the double-stranded linear product using a captureable probe (e.g., a magnetic probe or a biotin-labeled probe). Optionally, the probe may be complementary to a sequence containing the target molecule that has not undergone nucleotide transformation to achieve the enrichment and purification.

[0136] It is understood that the embodiments of this application utilize specially designed dual-linker or quadruple-linker primers to amplify target molecules in double or multiple copies. This allows for the simple and rapid construction of detection libraries suitable for genetics and epigenetics. By enriching and sequencing these detection libraries, polynucleotide sequences and their epigenetic (e.g., DNA methylation) modifications can be characterized efficiently and accurately. Primers are designed for both the original and newly generated copies, effectively avoiding the primer dimer problem and PCR multiplicity limitations caused by template complexity reduction due to transformation in related technologies. In the embodiments of this application, new copies are synthesized using dNTPs that will not be transformed, and probes are designed for these newly generated copies (i.e., those containing the original sequence information). This simplifies probe design, reduces the number of probe types, and significantly lowers probe design costs.

[0137] This application also proposes a library constructed according to the method described in any of the above embodiments, such as a methylated library. In some embodiments, the methylated library may contain a second polynucleotide molecule, the second polynucleotide molecule containing a first double-linked header and one or more copies of the nucleic acid to be tested, the one or more copies of the nucleic acid to be tested containing an original copy of the nucleic acid to be tested and one or more newly generated copies, wherein one or more modified nucleotides or unmodified nucleotides, preferably unmodified nucleotides, in the original copy and newly generated copies of the nucleic acid to be tested are converted into a specific nucleotide. In some embodiments, the unmodified nucleotide C in the original copy and newly generated copies of the nucleic acid to be tested is converted into a specific nucleotide U.

[0138] In this embodiment, the library further includes a sequencing adapter sequence, which is contained in the first dual-linker header and / or introduced separately into the second polynucleotide molecule. In some embodiments, the library also includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence, which are each independently contained in the first dual-linker header and / or introduced separately into the second polynucleotide molecule.

[0139] This application also proposes a kit comprising: (i) a first double-linked header, the first double-linked header comprising two or more polynucleotide chains, each of the polynucleotide chains being partially complementary to at least one of the other polynucleotide chains to form a double-stranded structure, the first double-linked header further comprising: one or more restriction enzyme sites or modified nucleotides, and optional sample tag, molecular tag and / or sequencing primer binding sequence; (ii) an enzyme, including a ligase, a polymerase and optional endonuclease; and (iii) dNTPs, including: a) dATP, dTTP, dGTP and dCTP; or b) one or more of dATP, dTTP, dGTP and dCTP being modified nucleotides, and the remainder being unmodified nucleotides. In some embodiments, the restriction enzyme site of the first double-linked header in a1) is uracil.

[0140] In some embodiments, the modified nucleotides include 1mC, 4mC, m2C, 5mC, 5hmC, 5fC, 5caC, 1mA, 3mA, 7mA, 6mA, 9mA, 6-DMA, HAP, AHAP, m2A, 1mG, 3mG, 7mG, m6G, CEG, diHT, 1mT, 3mT, 5fU, 5caU, and / or 5hmU.

[0141] In some embodiments, the kit further includes: (iv) a second double-linked header and optionally a third double-linked header and / or a sequencing adapter sequence, the sequencing adapter sequence optionally comprising a third sequencing primer-binding sequence and optionally a fourth sequencing primer-binding sequence, wherein the first double-linked header contains a functional sequence usable for sequencing, the functional sequence comprising one or more of the following: a tag sequence, a modified nucleotide, an enzyme cleavage site, and a first sequencing primer-binding sequence. In some embodiments, the first double-linked header further comprises a second sequencing primer-binding sequence, wherein the first double-linked header, the second double-linked header, and the third double-linked header may be the same or different.

[0142] This application also proposes a kit comprising: (i) a first double-linked header, wherein the double strands of the first double-linked header are at least partially complementary, and the double strands of the first double-linked header are capable of providing breaks respectively; (ii) an enzyme, including a ligase, a polymerase, and optionally an endonuclease and / or a transposase; (iii) dNTPs, including dATP, dTTP, dGTP, and 5-methylated dCTP (5mC), 5-hydroxymethylated dCTP (5hmC), 5-formylated dCTP (5fC), or 5-carboxylated dCTP (5caC); and (iv) a transformation reagent, including a chemical transformation reagent or a biological transformation reagent, wherein the chemical transformation reagent includes bisulfite, bisulfite, bisulfite, or bisulfite, etc., and the biological transformation reagent includes deaminase or oxidase, etc., wherein the first double-linked header contains a functional sequence that can be used for sequencing, the functional sequence including one or more of the following: a tag sequence, a modified nucleotide, an enzyme cleavage site, and a first sequencing primer binding sequence. In some embodiments, the first dual-linker header further includes a second sequencing primer binding sequence. In some embodiments, the distribution of the first to fourth sequencing primer binding sequences may be as shown in Figure 6.

[0143] In some embodiments, the first double-linked header comprises two or more polynucleotide chains, each of which is partially complementary to at least one other polynucleotide chain to form a double-stranded structure. In some embodiments, the first double-linked header comprises four polynucleotide chains, optionally as shown in SEQ ID NO: 1-4.

[0144] This application also proposes a method for methylation sequencing of whole-genome DNA or cell-free DNA (cfDNA) derived from bodily fluids, comprising: constructing a methylation library based on whole-genome DNA or cell-free DNA derived from bodily fluids, according to the method for constructing a library for detecting polynucleotide methylation modifications described in any of the above embodiments; and sequencing the methylation library. In some embodiments, the methylation modification includes 5mC. It is understood that, based on the high accuracy and high sensitivity of the methylation sequencing method proposed in this application, it is particularly suitable for micro-volume whole-genome DNA methylation sequencing technology (Micro DNA-WGBS) or micro-volume cfDNA genome methylation sequencing (cfDNA-BS).

[0145] This application also proposes a targeted methylation sequencing method (e.g., Target-BS / LHC-BS / Capture-BS), comprising: amplifying a target region sequence using targeted primers; constructing a methylation library based on the amplified target region sequence according to the method for constructing a library for detecting polynucleotide methylation modifications described in any of the above embodiments; and sequencing the methylation library. It is understood that the targeted primers can be designed according to specific target regions, and this application does not impose any limitations on this.

[0146] This application also proposes a method for sequencing exon region methylation, comprising: capturing exon region sequences; constructing a methylation library based on the captured exon region sequences, according to the method for constructing a library for detecting polynucleotide methylation modifications described in any of the above embodiments; and sequencing the methylation library. In some embodiments, the method further comprises amplifying the exon region sequences.

[0147] In other embodiments, the methods proposed in this application can also be used for simplified genome methylation sequencing (RRBS / dRRBS / XRBS), single-cell methylation sequencing (sc-RBS), precise DNA methylation / hydroxymethylation sequencing (oxBS-seq), (hydroxy)methylated DNA immunoprecipitation sequencing ((h)MeDIP-seq / 5hmC-Seal), etc.

[0148] This application also proposes the application of the kits described in any of the above embodiments in multicopy amplification of polynucleotides, library construction, polynucleotide characterization and / or detection of nucleotide modifications.

[0149] This application also proposes the application of the kit according to any of the foregoing embodiments in the detection of genetic and / or epigenetic information. In some embodiments, the epigenetic information includes DNA methylation modifications.

[0150] This application also proposes the use of the kit according to any of the above embodiments in the detection of rare mutations or tumor screening.

[0151] It should be noted that the explanations and descriptions of the embodiments of the method for multi-copy amplification of nucleic acids to be tested in this application are also applicable to the methods proposed in the embodiments of this application for nucleic acid library construction, modified nucleic acid library construction, construction of nucleic acid libraries for detecting DNA methylation modifications, and their corresponding methods for characterizing polynucleotides and / or their modifications, kits, and their applications in multi-copy amplification of polynucleotides, library construction, polynucleotide characterization and / or nucleotide modification detection, in genetic and / or epigenetic information detection, and in the detection of rare mutations or tumor screening. They also achieve the same beneficial effects as the method for multi-copy amplification of nucleic acids to be tested, which will not be elaborated here.

[0152] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0153] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0154] Example 1

[0155] This embodiment uses double-stranded DNA to perform multicopy amplification to construct a double-copy library of the target molecule, and then sequences the double-copy library.

[0156] Specifically, take 1 μg of Lambda DNA (Thermo Biotech Qubit). TM The dsDNA quantification kit (catalog number Q32851, component Standard 2) was used, and libraries were prepared according to the methods described in the embodiments of this application and conventional methods, respectively. The libraries were sequenced on an MGISEQ-2000 sequencer (sequencing type PE100, sequencing depth 100×), and then data analysis was performed to evaluate the accuracy of the sequencing results. The conventional method for library preparation and sequencing strictly followed Hieff's procedures. The method described in this application is illustrated in Figure 4, and the specific steps are as follows: The method flowchart proposed in this embodiment is shown in Figure 4.

[0157] 1.1 DNA fragmentation

[0158] Lambda DNA was fragmented using a Covaris sonic fragmentation instrument, with the main band being approximately 300 bp.

[0159] 1.2 End repair and A addition

[0160] Based on fragmented DNA, end repair was performed using rTaq-mediated methods, adding an A base to the 3' end of the double-stranded sequence. The specific reaction system and conditions are as follows:

[0161] Table 1. End-of-phase repair and A-addition reaction system

[0162] The above reaction system was placed on a PCR instrument and reacted at 37°C for 20 min, followed by 65°C for 15 min. After the reaction was complete, the product was purified using 1.0×AMPure magnetic beads (Beckman), and finally the purified product was dissolved in 18 μl of elution buffer (Beckman).

[0163] 1.3 Connector Connection

[0164] The purified end-repair products obtained in section 1.2 were subjected to linker ligation. The ligation system and reaction conditions are as follows:

[0165] Table 2 Joint Connection Reaction System

[0166] *The adapter was obtained by mixing and annealing 100 μM adapter 1 sequence-F and 100 μM adapter 1 sequence-R (the specific sequences are shown in Table 7, which are equivalent to double linker A and double linker B) in equal volumes. Both contain nucleotide U, which is cleaved by the USER enzyme in the reaction system to expose complementary sequences of double linkers A and B for subsequent circularization.

[0167] The above reaction system was placed in a PCR instrument and reacted at 25°C for 15 min to obtain the ligation product. After the reaction, the DNA was purified using 1.0×AMPure magnetic beads (Beckman). Finally, the purified product was dissolved in 50 μl of elution buffer (Beckman), and the DNA was incubated at 65°C for 10 min before proceeding to the next step of the reaction.

[0168] 1.4 Cycling and Digestion

[0169] The purified product from step 1.3 was cyclized to produce double-stranded circular DNA with a break point (i.e., the break point is provided by the unconnected ends between the double-stranded strands A and B). The specific cyclization system and reaction conditions are as follows:

[0170] Table 3

[0171] The above reaction system was placed on a Thermomixer (Eppendorf) and reacted at 25°C for 4 hours. Then, 2 μL of linear digestive enzyme Exonuclease V (NEB) was added, and the reaction was carried out at 37°C for 30 minutes to digest the non-cyclic linear molecules in the reaction system. After digestion, the digestion product was purified using 1.0×AMPure magnetic beads (Beckman), and finally, the purified product was dissolved in 45 μL of elution buffer (Beckman).

[0172] 1.5 chain replacement

[0173] The double-stranded circular DNA with breaks obtained in step 1.4 was subjected to a strand displacement reaction by polymerase to obtain a double-copy amplification product of the template molecule. The specific strand displacement system and reaction conditions are as follows:

[0174] Table 4

[0175] The reaction system shown in Table 4 was placed on a PCR instrument and reacted at 37°C for 30 minutes. After the reaction was completed, the product was purified using 1.0×AMPure magnetic beads (Beckman). Finally, the purified product was dissolved in 22 μl of elution buffer (Beckman).

[0176] 1.6 Connector Connection

[0177] The sequencing adapters of the double-copy amplification products obtained in section 1.5 were ligated to obtain a double-copy amplification library. The ligation system and reaction conditions are shown below:

[0178] Table 5

[0179] Table 6

[0180] After the reaction was complete, the amplification product was purified using 0.5×AMPure magnetic beads (Beckman), and finally the purified product was dissolved in 22 μl of elution buffer (Beckman).

[0181] 1.7 Sequencing

[0182] The library obtained in section 1.6 was prepared using DNB and subjected to high-throughput sequencing on the DNBSEQ sequencing platform. The sequencing platform was MGISEQ-2000, and the sequencing reagent used was the PE100 kit (MGISEQ-2000RS High-Throughput Sequencing Kit (PE100), catalog number 1000012536). The error rate was calculated after sequencing. During the sequencing process, the sequencing primers in the PE100 kit were replaced with sequencing primers 1A and 2A (see Table 7). Second-strand generation was not performed during the sequencing process.

[0183] Table 7

[0184] Where “U” stands for uracil; the wavy underline indicates the sample tag sequence; and phos- indicates phosphorylation modification.

[0185] 1.8 Data Analysis

[0186] The sequencing data of the library constructed by conventional methods was aligned to the reference genome Hg19 using BWA (https: / / github.com / lh3 / bwa.git), and the bases and proportions that were inconsistent with the reference genome were counted.

[0187] The sequencing data of the library constructed by the method proposed in this application embodiment are processed as follows: The double-copy sequencing sequences are aligned according to base consistency; for the same position, if the sequencing results of the two copies are inconsistent, it is marked as an N base, and the ASCII code corresponding to the quality value is changed to "!"; if they are consistent, the base information is retained and the quality value is modified. Then, BWA software is used to compare with the reference genome, and the inconsistent bases and their proportions are counted to obtain the library construction and sequencing accuracy of the method proposed in this application embodiment. In this embodiment, erroneous bases are defined as: bases inconsistent with the sequencing results and the reference genome, and the sequencing error rate is: the proportion of erroneous bases to the total bases.

[0188] Figure 13 shows a comparison of sequencing error rates for libraries constructed according to the conventional method and the method of this application, based on this embodiment. As can be seen from Figure 13, the library constructed using the multi-copy amplification method proposed in this embodiment can reduce the overall sequencing error rate by two orders of magnitude (0.17% vs. 0.0012%) through correction between two copies. This suggests that the multi-copy amplification method proposed in this embodiment can effectively improve sequencing accuracy, and thus can be used in the detection of rare mutations, low-frequency mutations, tumor-related site mutations, and other conditions requiring high sensitivity and accuracy.

[0189] Example 2

[0190] This embodiment uses double-stranded DNA to perform multicopy amplification to construct a double-copy library for simultaneous detection of DNA genome and methylome, and then sequences the double-copy library.

[0191] Specifically, 1 μg of NA12878 gDNA (CORIELL INSTITUTE, NA12878) was taken, and DNA methylation libraries were prepared according to the methods proposed in the embodiments of this application and conventional methods, respectively. The libraries were sequenced on an MGISEQ-2000 sequencer (sequencing type PE100, sequencing depth 30×), and then data analysis was performed to evaluate the accuracy of DNA methylation detection. The conventional method for DNA methylation library preparation and sequencing was strictly performed according to the instructions of the whole-genome methylation library preparation kit (MGI, catalog number 940-001529-00). A schematic flowchart of the method proposed in the embodiments of this application is shown in Figure 16, and the specific steps are as follows.

[0192] 2.1 DNA fragmentation

[0193] gDNA was fragmented using a Covaris sonic fragmentation instrument, with the main band around 200 bp.

[0194] 2.2 End repair and A addition

[0195] Refer to step 1.2 of Example 1.

[0196] 2.3 Connector Connection

[0197] Referring to step 1.3 of Example 1, the purified end-repair product obtained in 2.2 was ligated with a linker. The linker used was obtained by mixing and annealing 100 μM linker 2 sequence-F and 100 μM linker 2 sequence-R (equivalent to double linker A and double linker B) in equal volumes. Both contain nucleotide U, which is cleaved by the USER enzyme in the reaction system to expose complementary sequences of double linkers A and B for cyclization.

[0198] Connector 2 sequence-F: TACGC / ideoxyU / TCA / rC / ACCTAAGGTCGCCGGT / i5MedC / / i5MedC / GA / i5MedC / TTCGACGACGCGAGGCCCTCACGACCGT (SEQ ID NO: 11)

[0199] Connector 2 sequence-R: phos-CGGTCGTGAGGCCGGCGACCTTAGGTGTGAAGCGTACGCT (SEQ ID NO: 12)

[0200] 2.4 Cycling and Digestion

[0201] Referring to step 1.4 of Example 1, the sticky ends exposed after cutting in the adapter are complementary to each other, and the purified product in step 2.3 is ligated into a loop by T4 DNA ligase.

[0202] Table 8

[0203] The reaction system shown in Table 8 was placed on a PCR instrument and reacted at 37°C for 1 h. After the reaction was completed, the product was purified using 1.2×AMPure magnetic beads (Beckman). Finally, the purified product was dissolved in 41 μl of elution buffer (Beckman).

[0204] 2.5 Linear Digestion

[0205] Linear DNA is digested using digestive enzymes, while circular DNA or gapped double-stranded DNA is retained. The specific digestion reaction system is shown in Table 9 below.

[0206] Table 9

[0207] The reaction system shown in Table 9 was placed on a PCR instrument and reacted at 37°C for 30 minutes. After the reaction was completed, the product was purified using 1.2×AMPure magnetic beads (Beckman). Finally, the purified product was dissolved in 22 μl of elution buffer (Beckman).

[0208] 2.6 Enzyme digestion and strand displacement

[0209] The double-stranded circular DNA obtained in step 2.5 was digested by polymerase to provide a recognizable break for the polymerase. The specific digestion system and reaction system are as follows.

[0210] Table 10

[0211] The reaction system shown in Table 10 was placed on a PCR instrument and reacted at 37°C for 30 minutes. After the reaction, the product was purified using 1.5×AMPure magnetic beads (Beckman), and finally dissolved in 42 μl of elution buffer (Beckman). The purified product was then subjected to a chain displacement reaction, using unmodified dATP / dTTP / dGTP and methylated 5m-dCTP. The specific chain displacement system and reaction conditions are as follows:

[0212] Table 11

[0213] Place the reaction system shown in Table 11 on a PCR instrument and react at 60℃ for 30 minutes. After the reaction is complete, purify the product using 1.5×AMPure magnetic beads (Beckman). Finally, dissolve the purified product in 22 μl of elution buffer (Beckman).

[0214] 2.6 Enzymatic Conversion

[0215] The product was converted using an enzymatic conversion kit. The Enzymatic Methyl-seq Conversion Module (catalog number NEB#E7125S / L) converts unmethylated C to U, while methylated C (i.e., 5mC) remains unchanged. The detailed procedure was strictly followed according to the kit's instructions. Finally, the converted product was dissolved in 20 μL of TE buffer.

[0216] 2.7 PCR Amplification

[0217] The double-copy amplification product obtained in section 2.6 was subjected to PCR amplification to obtain a double-copy amplification library. The amplification system and reaction conditions are shown below:

[0218] Table 12

[0219] Forward primer 2: phos-GAACGACATGGCTACGATCCGACTTTGATGATGTGAGG (SEQ ID NO: 13)

[0220] Reverse primer 2: TGTGAGCCAAGGAGTTGATCGGACCTATTGTCTTCCTAAGACCGCTTGGCCTCCGACTTCGACGACGCG (SEQ ID NO: 14)

[0221] 2.8 Sequencing

[0222] The methylated library was sequenced according to step 1.7 of Example 1, except that the sequencing primers in the PE100 kit were replaced with sequencing primer 1B and sequencing primer 2B.

[0223] Sequencing primer 1B: GAACGACATGGCTACGATCCGACTT (SEQ ID NO: 15)

[0224] Sequencing primer 2B: TTGTCTTACCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 16)

[0225] 2.9 Data Analysis

[0226] Sequencing data obtained by conventional methods and sequencing data obtained according to the method of this embodiment were statistically analyzed. BS-MAP (https: / / doi.org / 10.1186 / 1471-2105-10-232) was used to compare and statistically analyze the sequencing data obtained by conventional methods. For the sequencing data obtained by the method of this embodiment, the two copies of sequencing data were first merged (the merging rules are referred to section 1.8 of Embodiment 1). After obtaining the merged fastq file, it was compared using BWA software to statistically analyze information such as genome coverage. Then, the accurate methylation information of the corresponding genome position was obtained by merging the information in the read IDs in the fastq file.

[0227] Table 13 shows the DNA methylation sequencing data and related statistics of the method according to the embodiments of this application and the conventional WGBS method. As shown in Table 13, compared with the conventional method, the method of the embodiments of this application can significantly improve the methylation detection rate (99.50% vs 85.20%), cover more CpG sites, exhibiting higher coverage, and significantly improve data utilization. Furthermore, it can simultaneously obtain genomic data, i.e., achieve simultaneous detection of genetics and epigenetics.

[0228] Table 13

[0229] Example 3

[0230] In this embodiment, the adapter shown in Figure 2 is used as the dual linker, and the whole genome methylation library is constructed and sequenced according to the multicopy amplification method proposed in the embodiments of this application.

[0231] Specifically, 50 ng of NA12878 gDNA (Coriell Institute) was used to prepare whole-genome methylation libraries according to the methods proposed in this application and conventional methods. The libraries were sequenced on an MGISEQ-2000 sequencer (PE100 sequencing type, 30× sequencing depth), and the data were then analyzed to evaluate the accuracy of the sequencing results. The library preparation and sequencing using the conventional method were strictly performed according to the manufacturer's instructions. A schematic flowchart of the method proposed in this application is shown in Figure 10, and the specific steps are as follows.

[0232] 3.1 Preparation of tetrad primer adapters

[0233] Four types of methylated primers (sequences shown in SEQ ID NO: 1-4) were dissolved in low TE buffer and 100 mM NaCl to a final concentration of 100 μM, then diluted to 10 μM. Equal nmol volumes of the solutions were then mixed and heated at 95 °C for 3 minutes, slowly cooled to 25 °C, and incubated at room temperature for 12 hours to anneal the primers, thus preparing methylated tetrad primer adapters. The methylated tetrad primer adapters were stored at -20 °C until use.

[0234] The methylation linker sequence is:

[0235] Connector 1: 5'CTTCCAGTACGTCAGCAGTTNNNNNNNNNNNNNNNNNNT-3' (SEQ ID NO: 1);

[0236] Linker 2: 5'-5Phos-NNNNNNNNNNNNNNNNNNNAAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGGCTAGACTCTGACGTGTTGATCCTCGAAGC-3' (SEQ ID NO: 2)

[0237] Connector 3: 5'-GCATGGCGACCTTATCAGNNNNNNNNNNNNNNNNNNT-3' (SEQ ID NO: 3)

[0238] Connector 4: 5' / 5Phos / NNNNNNNNNNNNNNNNNNNAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAGCTTCGAGGATCAACACGTCAGAGTCTAGC-3' (SEQ ID NO: 4)

[0239] The C bases in the sequences of linkers 1, 2, 3, and 4 were all protected by methylation, and the N bases were the sample tag sequences.

[0240] 3.2 DNA Fragmentation

[0241] gDNA was fragmented using a Covaris sonic fragmentation instrument, with the following specific parameters.

[0242] Table 14

[0243] After interruption, the 200bp fragment of the main band was recovered and purified using AMPure magnetic beads according to the instructions for subsequent reactions.

[0244] 3.3 End repair and A addition

[0245] Based on fragmented DNA, the end repair / dA tail addition module (NEB#E7546) from NEB was used to repair the ends of the DNA, and an A base was added to the 3' end of the double-stranded sequence. The specific reaction system and reaction conditions are as follows:

[0246] Table 15

[0247] Place the above reaction system on a PCR instrument and proceed as follows: 20℃ for 30 minutes; 65℃ for 30 minutes; maintain at 4℃.

[0248] 3.4 Connector Connection

[0249] The terminal repair products obtained in section 3.3 were ligated using a quadruple primer-linker combination. The ligation system and reaction conditions are as follows:

[0250] Table 16

[0251] The above reaction system was placed in a PCR instrument and reacted at 25°C for 1 h to obtain the ligation product. After the reaction was completed, the product was purified using 1.0×AMPure magnetic beads (Beckman), and finally the purified product was dissolved in 25 μl of elution buffer (Beckman).

[0252] 3.5 Chain replacement extension

[0253] The double-stranded circular DNA with breaks obtained in step 3.4 was subjected to a strand displacement reaction by polymerase to obtain a double-copy amplification product of the template molecule. The specific strand displacement system and reaction conditions are as follows:

[0254] Table 17

[0255] The reaction system shown in Table 17 was placed on a PCR instrument and reacted at 30°C for 20 minutes to obtain the ligation product. After the reaction was completed, the product was purified using 1.0×AMPure magnetic beads (Beckman). Finally, the purified product was dissolved in 30 μl ddH2O.

[0256] 3.6 Enzymatic Conversion

[0257] The product was converted using an enzymatic conversion kit. The Enzymatic Methyl-seq Conversion Module (catalog number NEB#E7125S / L) converts unmethylated C to U, while methylated C (i.e., 5mC) remains unchanged. The detailed procedure was strictly followed according to the kit's instructions. Finally, the converted product was dissolved in 20 μL of elution buffer.

[0258] 3.7 PCR Amplification

[0259] The double-copy amplification product obtained in 3.6 was subjected to PCR amplification to obtain a double-copy amplification library. The amplification system and reaction conditions are shown below:

[0260] Table 18

[0261] The sequence of universal primer 1 is: 5Phos / CTCTCAGTACGTCAGCAG (SEQ ID NO: 17);

[0262] The sequence of universal primer 2 is: GCATGGCGACCTTATCAG (SEQ ID NO: 18).

[0263] Table 19

[0264] After the reaction was complete, the amplification product was purified using 1.0×AMPure magnetic beads (Beckman), and finally the purified product was dissolved in 22 μl of elution buffer (Beckman).

[0265] 3.8 Document Quality Inspection

[0266] The size and content of the inserted fragments in the library were detected using the Bioanalyzer analysis system (Agilent, Santa Clara, USA), and the specific results are shown in Figure 12. As can be seen from Figure 12, the fragment sizes of the DNA methylated library obtained by the method in this embodiment are between 300-1500 bp, and the fragments are concentrated and suitable for sequencing.

[0267] 3.9 Sequencing

[0268] The quality-checked library was sequenced on the MGISEQ-2000 sequencing platform. The sequencing reagent used was the PE100 kit (MGISEQ-2000RS high-throughput sequencing kit (PE100), catalog number 1000012536).

[0269] 3.10 Data Analysis

[0270] Sequencing data of libraries constructed by the method proposed in this application and libraries constructed by the traditional WGBS method were statistically analyzed, and the results are shown in Table 20 and Figure 13:

[0271] Table 20

[0272] As shown in Table 20, compared to traditional WGBS library construction, the double-stranded multicopy amplification method based on quadruple primer adapters proposed in this application provides a larger amount of data available for alignment with higher coverage, thus effectively detecting methylation modifications (even at lower coverage). Simultaneously, in strand substitution, a copy of the original sequence information is retained during methylation, thus balancing the extreme bias of sulfite on template treatment. This effectively improves the amplification bias of methylated libraries on CpG islands during subsequent PCR; and it is equivalent to simultaneously preparing WGBS and WGS libraries in a single library construction. Furthermore, for certain C / T and G / A type SNPs, the method in this application can accurately distinguish between C / T and G / A, and differentiate between methylated and unmethylated C bases, thereby greatly improving detection accuracy.

[0273] Example 4

[0274] This embodiment uses the adapter shown in Figure 3a as a dual-linkage head, and constructs and sequences a targeted methylation library according to the multi-copy amplification method proposed in this application embodiment. The specific process is shown in Figure 10.

[0275] Specifically, 50 ng of NA12878 gDNA (CORIELL INSTITUTE, NA12878) was taken, and a whole-genome methylation library was prepared according to the method proposed in the embodiments of this application. Primers were designed for 10 methylation sites, with the forward primer designed upstream of the original copy target site and the reverse primer designed downstream of the newly generated copy target site. Then, multiplex PCR was performed on the mixture of methylated DNA and original DNA after enzyme transformation using multiplex primers. The specific steps are as follows.

[0276] 4.1 Preliminary library construction and enzymatic transformation

[0277] See steps 2.1-2.6 of Example 1.

[0278] 4.2 PCR amplification

[0279] The double-copy amplification product obtained in 4.1 was subjected to PCR amplification to obtain a double-copy amplification library. The amplification system 19 and reaction conditions are shown below:

[0280] Table 21

[0281] The specific primer pool sequences are shown in Table 22.

[0282] Table 22

[0283] Table 23 Reaction Conditions

[0284] After the reaction was complete, the amplification product was purified using 1.0×AMPure magnetic beads (Beckman), and finally the purified product was dissolved in 22 μl of elution buffer (Beckman).

[0285] 4.3 Library quality control and sequencing

[0286] The quality-tested libraries were subjected to high-throughput sequencing, with the quality-testing steps and sequencing methods being the same as those in Example 1.

[0287] 4.4 Data Analysis

[0288] The sequencing data of the libraries constructed by the method proposed in the embodiments of this application were statistically analyzed, and the results are shown in Table 24 and Figure 14:

[0289] Table 24

[0290] As shown in Table 24, the method proposed in this embodiment achieves a good target hit rate of 95.4%, indicating that the method of this embodiment achieves specific and efficient amplification, thereby greatly improving the capture efficiency and data utilization. Furthermore, as shown in Figure 14, the amplification depth of each target site is uniform, indicating that the method of this embodiment greatly improves the amplification bias for amplification regions, enhancing the uniformity of whole-genome coverage, and thus enabling high-accuracy detection of genetic and methylation modifications.

[0291] Example 5

[0292] In this embodiment, the double-stranded primer adapter shown in Figure 16 is used as the double-link head, and the exon region methylation library is constructed and sequenced according to the multicopy amplification method proposed in the embodiment of this application. The specific process is shown in Figure 11.

[0293] Specifically, 50 ng of NA12878 gDNA (CORIELL INSTITUTE, NA12878) was taken and a whole-genome methylation library was prepared according to the method proposed in the embodiments of this application. Then, hybridization capture was performed using the MGI exon capture kit (MBI Easy Exon Capture V4 probe, reagent catalog number 1000007745). The captured library was then sequenced on an MGISEQ-2000 sequencer, sequencing type PE100. Data analysis was then performed, including data utilization, alignment rate, coverage, and other performance metrics. The specific steps are as follows.

[0294] 5.1 Preliminary library construction, enzymatic transformation and PCR

[0295] See steps 2.1-2.7 of Example 3.

[0296] 5.2 Exon Capture

[0297] Based on the concentration of the purified amplified product in section 5.1, take 1000 ng of the amplified product and use an exon capture kit to perform hybridization capture (MGIeasy exon capture V4 probe, reagent catalog number 1000007745). The detailed steps are strictly followed according to the instructions of the exon capture kit.

[0298] 5.3 Washing

[0299] Unless otherwise specified, all reagents used below are included in the above exon capture kit.

[0300] 5.3.1 Prepare M-280 magnetic beads, wash the magnetic beads twice with Binding Buffer, and resuspend the washed magnetic beads with 200μL Binding Buffer.

[0301] 5.3.2 Use the magnetic beads from 5.3.1 to hybridize and adsorb the hybridized captured exon library. Finally, resuspend the magnetic beads in 44 μL of NF water and transfer all resuspended samples (including magnetic beads) to a new PCR tube.

[0302] 5.4 Post-PCR

[0303] 5.4.1 Prepare the PCR reaction solution after hybridization on ice, as shown in Table 25:

[0304] Table 25

[0305] Universal primer 3: phos-GAACGACATGGCTACGAT (SEQ ID NO: 29)

[0306] Universal primer 4: TGTGAGCCAAGGAGTTGATCGGAC (SEQ ID NO: 30)

[0307] 5.4.2 Mix the prepared PCR reaction solution with the sample containing magnetic beads from step 5.3.2, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0308] 5.4.3 Place the reaction system on a PCR instrument and perform post-hybridization PCR under the following conditions:

[0309] Table 26

[0310] 5.5 Library quality control and sequencing

[0311] The quality-tested libraries were subjected to high-throughput sequencing, with the quality-testing steps and sequencing methods being the same as steps 3.8-3.9 in Example 3.

[0312] 5.6 Data Analysis

[0313] The sequencing data of the libraries constructed by the method proposed in the embodiments of this application were statistically analyzed, and the results are shown in Table 27:

[0314] Table 27

[0315] As shown in Table 27, the statistical values ​​between the two sample replicates are close, indicating that the capture library construction method proposed in this application has strong stability. Furthermore, taking the data from Sample 1 as an example, by comparing the sequence retaining methylation information with the sequence retaining the original DNA information in the sequencing data (comparison rate 81.1%), and then statistically analyzing the data falling into exon regions and flanking regions after alignment (50.1%), and statistically analyzing the average depth of the target region (100×) and 20× coverage (96.4%), it can be seen that the method of this application can effectively achieve exon region capture and methylation detection.

[0316] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0317] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

A method for multi-copy amplification of nucleic acid to be tested, comprising: a) Provide a first polynucleotide molecule comprising the nucleic acid to be tested having a double-stranded structure and a first double-stranded connector, the first double-stranded connector being connected to the two ends of the nucleic acid to be tested, the double strands of the first double-stranded connector being at least partially complementary, the first polynucleotide molecule having a cyclic double-stranded structure, wherein each of the double strands of the first polynucleotide molecule has a nick or gap. b) Contact the polymerase and dNTPs with the first polynucleotide molecule, wherein the polymerase performs an extension reaction based on the notch or gap, using the first polynucleotide molecule as a template, to perform chain substitution on the first polynucleotide molecule, thereby forming a second polynucleotide molecule, the second polynucleotide molecule containing the first double-linked head and one or more copies of the nucleic acid to be tested. According to the method of claim 1, the first double-linked head comprises one or more restriction enzyme sites and / or modified nucleotides. Optionally, the enzyme cleavage site includes an endonuclease cleavage site, preferably a restriction endonuclease cleavage site, and a modified base. Optionally, the cleavage site is selected from ribonucleotides (e.g., uracil) and modified purine bases (e.g., 7,8-dihydro-8-oxoguanine). Optionally, the modification in the modified nucleotide in the first dual-link head is selected from phosphorylation modification, dephosphorylation modification, fluorescence modification, or affinity group modification. The method according to claim 2 further includes: a1) Connect the first double-stranded head to the two ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor having a cyclic double-stranded structure; a2) Based on the first polynucleotide molecule precursor, the enzyme cleavage site is cleaved to provide the notch or gap, thereby obtaining the first polynucleotide molecule. The method according to claim 2 further includes: a1) Connect the first double-stranded connector to the two ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor exhibiting a linear double-stranded structure; a2) The enzyme cleavage site is cleaved based on the first polynucleotide precursor to provide the notch or gap; a3) Based on the cyclization of the enzyme digestion product in step a2), the first polynucleotide molecule is obtained. Optionally, the digestion enzymes used to perform the digestion include endonucleases and base-specific digestion enzymes, optionally UDG / UNG, RnaseH, 8-oxoguanine DNA glycosylase (Ogg1) & AP-endonuclease 1 (APE1) or N-methylpurine DNA glycosylase (MPG) & AP-endonuclease 1 (APE1). According to the method of claim 1, wherein the first double-linked head comprises two or more polynucleotide chains, wherein each polynucleotide chain is at least partially complementary to another polynucleotide chain to form a double-stranded structure, the method specifically comprising: x. The notch or gap is provided by the unconnected ends between the two or more polynucleotide chains; or y. Connect the first double-linked head to both ends of the nucleic acid to be tested to obtain a first polynucleotide precursor, the first polynucleotide precursor having a circular double-stranded structure or a linear double-stranded structure; and perform enzyme digestion on the enzyme cleavage site based on the first polynucleotide precursor to provide the notch or gap. According to the method of claim 5, the first double-linked head is composed of a first double-linked head A and a first double-linked head B, and the first double-linked head A and the first double-linked head B are respectively connected to the two ends of the nucleic acid to be tested to form the first polynucleotide precursor, the first polynucleotide precursor exhibiting a linear double-stranded structure. The method specifically includes: The first enzyme cleavage is performed on the first enzyme cleavage site based on the first polynucleotide precursor to provide the notch or gap; Based on the first enzyme digestion or a further second enzyme digestion, the first double-linker A and the first double-linker B are exposed to at least partially complementary terminal sequences, thereby cyclizing the enzyme digestion product of the first polynucleotide molecule precursor based on the complementary terminal sequences to obtain the first polynucleotide molecule. The second enzyme digestion is performed on the second enzyme site based on the first polynucleotide precursor, and the first enzyme site is different from the second enzyme site. The method according to any one of claims 1 to 6, wherein the first dual-link head further comprises a sample tag, a molecular tag, and / or a sequencing primer binding sequence. The method according to any one of claims 1 to 7 further comprises: c) Based on the second polynucleotide molecule, perform an end-repair and A-addition reaction to provide a second double-linker to the second polynucleotide molecule, and repeat steps a)-b) to obtain a third polynucleotide molecule, wherein the third polynucleotide molecule contains the first double-linker, the second double-linker, and four copies of the nucleic acid to be tested. Optionally, the method further includes: d) performing an end-repair and A-addition reaction based on the third polynucleotide molecule to provide a third double-linker to the third polynucleotide molecule, and repeating steps a)-b) to obtain a fourth polynucleotide molecule, the fourth polynucleotide molecule containing the first double-linker, the second double-linker, the third double-linker, and eight copies of the nucleic acid to be tested, to achieve multi-copy amplification of the nucleic acid to be tested. The first dual-link header, the second dual-link header, and the third dual-link header may be the same or different. The method according to any one of claims 1 to 8, wherein the nucleic acid to be tested is double-stranded DNA, double-stranded RNA, or a DNA-RNA hybrid. Optionally, based on the fact that the nucleic acid to be tested is a double-stranded RNA or a DNA-RNA hybrid, the method further includes: The RNA strand in the double-stranded RNA or DNA-RNA hybrid is converted into a DNA strand, optionally by reverse transcription or template conversion. Optionally, the nucleic acid to be tested may further comprise modified nucleotides and / or non-natural nucleotides. A method for constructing a nucleic acid library based on multicopy amplification includes: 1) The nucleic acid to be tested is amplified in multiple copies according to the method for multi-copy amplification of the nucleic acid to be tested as described in any one of claims 1 to 9, thereby obtaining amplification products of two or more copies of the nucleic acid to be tested; 2) Construct a library from the amplification products of two or more copies of the nucleic acid to be tested to obtain a nucleic acid library. Optionally, the library construction may further include one or more of the following: further amplification of the double or more copies of the amplification product of the nucleic acid to be tested, end repair and sequencing adapter sequence ligation, and product purification after each step. A method for constructing a library for detecting polynucleotide methylation, comprising: 1) Provide a first polynucleotide molecule, the first polynucleotide molecule comprising the nucleic acid to be tested having a double-stranded structure and a first double-stranded connector, the first double-stranded connector being connected to the two ends of the nucleic acid to be tested, the double strands of the first double-stranded connector being at least partially complementary, the first polynucleotide molecule having a cyclic double-stranded structure, wherein both double strands of the first polynucleotide molecule have notches or gaps. 2) The polymerase and dNTPs are brought into contact with the first polynucleotide molecule. The polymerase performs an extension reaction based on the notch or gap, using the first polynucleotide molecule as a template, to perform chain substitution on the first polynucleotide molecule, thereby forming a second polynucleotide molecule. The second polynucleotide molecule contains one or more copies of the first double-linked head and the nucleic acid to be tested. The dNTPs used include: i) dATP, dTTP, dGTP, and dCTP; or ii) one or more of dATP, dTTP, dGTP, and dCTP are modified nucleotides, and the rest are unmodified nucleotides. 3) The second polynucleotide molecule is subjected to nucleotide conversion to obtain the methylated library, wherein one or more modified or unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides. Optionally, one or more unmodified nucleotides in the second polynucleotide molecule are converted into one or more specific nucleotides. According to the method of claim 11, the modified nucleotides include 1mC, 4mC, m2C, 5mC, 5hmC, 5fC, 5caC, 1mA, 3mA, 7mA, 6mA, 9mA, 6-DMA, HAP, AHAP, m2A, 1mG, 3mG, 7mG, m6G, CEG, diHT, 1mT, 3mT, 5fU, 5caU, and / or 5hmU. Optionally, the modified nucleotides include 5mC, 5hmC, 5fC, and / or 5caC. Optionally, the unmodified nucleotide C in the second polynucleotide molecule is converted into a specific nucleotide U. According to the method of claim 11 or 12, wherein in step 2), the dNTPs used comprise: Modified nucleotides dCTP and unmodified nucleotides dATP, dTTP, and dGTP, wherein the second polynucleotide molecule contains both the original copy and the newly generated copy of the nucleic acid to be tested, step 3) specifically includes: The unmodified nucleotide C in the original copy of the nucleic acid to be tested is converted into a specific nucleotide U, while the modified nucleotide C in both the original copy and the newly generated copy of the nucleic acid to be tested remains C. The method according to any one of claims 11 to 13, wherein nucleotide conversion of the second polynucleotide molecule comprises: One or more modified or unmodified nucleotides in the amplification product are converted into one or more specific nucleotides using chemical or biological methods. Optionally, the chemical method includes: using bisulfite, disulfite, bisulfite, or bisulfite, wherein the bisulfite may optionally be sodium bisulfite or ammonium bisulfite. The biological method includes: enzyme treatment, wherein the enzyme treatment includes deaminase treatment or oxidase treatment. Optionally, the method further includes: pretreating the polynucleotide to obtain the nucleic acid to be tested, wherein the pretreating includes: End repair of the polynucleotide was performed. Optionally, the preprocessing may further include one or more of fragmentation, purification, and amplification. The method according to any one of claims 11 to 14 further comprises: Based on the target molecule, the library is enriched to obtain a library enriched with the target molecule, which is then used as the target library. Alternatively, the enrichment can be performed by PCR amplification or probe capture. The probes include nucleic acid sequence probes, biotin-labeled probes, or protein probes. The method according to any one of claims 11 to 15, wherein the first double-linked head comprises one or more restriction enzyme sites and / or modified nucleotides, Optionally, the enzyme cleavage site includes an endonuclease cleavage site, preferably a restriction endonuclease cleavage site, and a modified base. Optionally, the cleavage site is selected from ribonucleotides (e.g., uracil) and modified purine bases (e.g., 7,8-dihydro-8-oxoguanine). Optionally, the first dual-link header further includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence. Optionally, the modification in the modified nucleotide in the first dual-link head is selected from phosphorylation modification, dephosphorylation modification, fluorescence modification, or affinity group modification. The method according to any one of claims 11 to 16, wherein the first double-linked head comprises two or more polynucleotide chains, each of the polynucleotide chains being at least partially complementary to another polynucleotide chain to form a double-stranded structure. The method according to any one of claims 11 to 17 further comprises: A sequencing adapter sequence is introduced into the 3' and / or 5' end of the second polynucleotide molecule to obtain the methylated library. A reagent kit comprising: (i) A first double-linked header comprising two or more polynucleotide chains, each of the polynucleotide chains being partially complementary to the other polynucleotide chain to form a double-stranded structure, the first double-linked header further comprising: one or more restriction enzyme sites or modified nucleotides, and optional sample tag, molecular tag and / or sequencing primer binding sequence. (ii) Enzymes, including ligases, polymerases and optional endonucleases; (iii) dNTPs, including: a) dATP, dTTP, dGTP, and dCTP; or b) one or more of dATP, dTTP, dGTP, and dCTP are modified nucleotides, and the rest are unmodified nucleotides. Optionally, the kit further includes: (iv) A second double-linked header and an optional third double-linked header and / or sequencing adapter sequence, Optionally, in a1), the restriction enzyme site of the first double-linked head is uracil. The first dual-link header, the second dual-link header, and the third dual-link header may be the same or different. The kit according to claim 19 further comprises: (iv) A conversion reagent, including a chemical conversion reagent or a biological conversion reagent, wherein the chemical conversion reagent includes: bisulfite, bisulfite, bisulfite, or bisulfite, and the biological conversion reagent includes a deaminase or an oxidase. Optionally, the modified nucleotides in step (iii) include 5mC, 5hmC, 5fC and / or 5caC. A library for detecting polynucleotide methylation modifications, comprising: A second polynucleotide molecule, comprising a first double-linked header and one or more copies of the nucleic acid to be tested, wherein the one or more copies of the nucleic acid to be tested comprise an original copy and one or more newly generated copies, wherein one or more modified or unmodified nucleotides in the original copy and the newly generated copies of the nucleic acid to be tested are converted into specific nucleotides. Optionally, the unmodified nucleotide C in the original copy of the nucleic acid to be tested is converted into a specific nucleotide U, while the modified nucleotide C in the original copy and the newly generated copy of the nucleic acid to be tested remains C. The library of claim 21, further comprising a sequencing adapter sequence, the sequencing adapter sequence being contained in the first dual-linker and / or introduced separately into the second polynucleotide molecule. Optionally, the library further includes a sample tag, a molecular tag, and / or a sequencing primer binding sequence, wherein the sample tag, molecular tag, and / or sequencing primer binding sequence are each independently contained in the first double-linker and / or introduced individually into the second polynucleotide molecule. A method for characterizing polynucleotides, comprising: The nucleic acid library obtained by the method for constructing a nucleic acid library based on multiple copy amplification according to claim 10 is sequenced to obtain sequencing data of the nucleic acid; and The sequencing data were analyzed to characterize the polynucleotides. Optionally, the polynucleotide is a genome sequence, and the characterization is whole-genome sequencing or genome-targeted sequencing. A method for characterizing polynucleotide methylation modifications includes: The methylated library obtained by the method for constructing a polynucleotide methylation library according to any one of claims 11 to 18 is sequenced to obtain sequencing data of the polynucleotide; The sequencing data were analyzed to characterize the polynucleotide methylation modification. The method according to claim 24, wherein the multicopy amplification product based on the polynucleotide in the library is a double-copy amplification product, the method comprising: The newly generated copy in the double-copy amplification product is compared with the original copy to determine the modified nucleotide in the polynucleotide; and Based on the location of the original copy or newly generated copy in the genome, the location of the modified nucleotide on the genome is determined to obtain the nucleotide modification status on the genome. According to the method of claim 25, wherein the unmodified nucleotide in the double-copy amplification product is converted into a specific nucleotide by conversion, and the dNTP used in the amplification is a modified dATP, dTTP, dGTP, and / or dCTP corresponding to the type of modified nucleotide, then for the same position: Based on the fact that the nucleotides in the original copy of the sequencing data are inconsistent with the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotides, the nucleotide at that position is determined to be an unmodified nucleotide. Based on the fact that the nucleotides in the original copy of the sequencing data are identical to the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotide type, the nucleotide at that position is identified as a modified nucleotide. According to the method of claim 25, wherein the modified nucleotide in the double-copy amplification product is converted into a specific nucleotide by conversion, and the dNTPs used in the amplification are unmodified dNTPs, then for the same position: Based on the fact that the nucleotides in the original copy of the sequencing data are identical to the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotide type, the nucleotide at that position is determined to be an unmodified nucleotide. Based on the fact that the nucleotides in the original copy of the sequencing data are inconsistent with the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotide type, the nucleotide at that position is identified as a modified nucleotide. According to the method of claim 25, wherein the unmodified nucleotide C in the double-copy amplification product is converted to a specific nucleotide U by conversion, and the dNTPs used in the amplification are 5m-dCTP and dATP, dTTP, dGTP corresponding to the modified nucleotide type 5mC, then for the same position: Based on the fact that the nucleotides in the original copy of the sequencing data are inconsistent with the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotide type, the nucleotide at that position is identified as unmodified nucleotide C. Based on the fact that the nucleotides in the original copy of the sequencing data are identical to the nucleotides in the newly generated copy, and that they involve nucleotide type C that is converted into the specific nucleotide U, the nucleotide at that position is identified as the modified nucleotide 5mC. According to the method of claim 25, wherein the modified nucleotide C in the double-copy amplification product is converted to a specific nucleotide U by conversion, and the dNTPs used in the amplification are dCTP and dATP, dTTP, dGTP corresponding to the type of unmodified nucleotide, then for the same position: Based on the fact that the nucleotides in the original copy of the sequencing data are inconsistent with the nucleotides in the newly generated copy, and that the nucleotides involved are converted into the specific nucleotides, the nucleotide at that position is identified as the modified nucleotide 5mC. Based on the fact that the nucleotides in the original copy of the sequencing data are identical to the nucleotides in the newly generated copy, and that they involve nucleotide type C that is converted into the specific nucleotide U, the nucleotide at that position is identified as an unmodified nucleotide C. The kit according to claim 19 or 20 is used in the multicopy amplification, library construction, multinucleotide characterization, nucleotide modification detection, and / or detection of rare mutations or tumor screening of polynucleotides; or the library according to claim 21 or 22 is used in the multinucleotide characterization, nucleotide modification detection, and / or detection of rare mutations or tumor screening of polynucleotides. Optionally, the nucleotide modification detection includes DNA methylation modification detection.