A method and a kit for generating nucleic acid for target capture
The use of circ-oligos for hybridization and RCA amplification addresses inefficiencies in existing methods, enabling efficient and cost-effective nucleic acid capture, especially in high GC-rich regions, for targeted genome sequencing.
Patent Information
- Application Number
- PCT/IN2025/051311
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-01-01
- Filing Date
- 2025-08-22
- Publication Date
- 2026-07-09
AI Technical Summary
Existing nucleic acid capture methods for targeted genome sequencing face challenges such as high cost, low throughput, inefficiency in capturing high GC-rich regions, and PCR bias, leading to poor performance and low yield.
A method involving single-stranded circular oligonucleotides (circ-oligos) hybridizing with target oligonucleotides, followed by exonuclease treatment, bidirectional Rolling Circle Amplification (RCA), and restriction endonuclease digestion to generate biotinylated nucleic acids for target capture.
The method achieves efficient, cost-effective, and scalable generation of nucleic acids for targeted genome enrichment, particularly in high GC-rich regions, with high yield and reduced bias, suitable for next-generation sequencing workflows.
Smart Images

Figure IMGF000009_0001_TABLE 
Figure 00000019_0000 
Figure 00000020_0000
Abstract
Description
[0001] A METHOD AND A KIT FOR GENERATING NUCLEIC ACID FOR TARGET CAPTURE FIELD OF INVENTION
[0002] The present disclosure relates to the field of target capture sequencing. In particular, it relates to a method, a kit based on a circ-oligo sequence binding to at least one target oligonucleotide to generate a single-stranded circular DNA, followed by amplification means and biotinylation to obtain a target capture nucleic acid. The target probes of the invention have an application in the targeted sequencing of regions of interest instead of whole genome sequencing.
[0003] DEFINITIONS
[0004] As used in the present disclosure, the following terms are generally intended to have the meaning as set forth below, except to the extent that the context in which they are used indicates otherwise.
[0005] Circ-oligo refers to a synthetic oligonucleotide(s) (ODNs) which upon binding to synthetic motifs in the target oligonucleotide(s) result in a circular DNA strand(s) that undergo bidirectional amplification using forward and reverse primers using rolling circle amplification (RCA)
[0006] BACKGROUND OF THE INVENTION
[0007] The background information herein below relates to the present disclosure but is not necessarily prior art.
[0008] The nucleic acid capture methods use probes, such as DNA or RNA baits, to target specific nucleic acids for the targeted genome sequencing. This involves in-depth interrogation of the regions of interest that enable the detection of the sequence variants that are somatic or germline. Genome sequencing is typically highly multiplexed and thus has several hundred or even thousands of regions of interest. A reference may be made to “Dapprich, J., Ferriola, D., Mackiewicz, K. et al. BMC Genomics 17, 486 (2016)" for the target capture technologies, wherein the large DNA fragment enrichment and sequencing determines regional genomic variation of high complexity. In particular, “a gene panel” based target enrichment provides and thus has applications in diagnostic tests for various branches of genetics, research or clinical medicine, including oncology. Conventionally, the target enrichment is done by PCR or hybridizationbased genome capture. The latter are not susceptible to drawbacks of PCR-based methods, such as allelic skew, and are preferred over amplicon-based gene panels.
[0009] Hybridization capture-based enrichment may be done by a pool of biotin-tagged oligonucleotides. The latter are generated by column synthesis based on the solid-phase phosphoramidite chemistry. These are typically only single stranded and are low throughput methods which canbe expensive, especially when the pool size is large. A reference may be made to “Kosuri S, Church GM. Nat Methods. 2014; 11(5): 499-507” for large-scale de novo DNA synthesis: technologies and applications. Alternative references may also be made to ^LeProusl EM, Peck BJ, Spirin K, McCuen HB, Moore B, Namsaraev E, Caruthers MH. Nucleic Acids Res.2010 May; 38(8) : 2522-40” for the Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. The above-mentioned method includes microarray-based oligonucleotide synthesis, is proprietary, however provides lesser yield (i.e. low quantities) of individual oligonucleotides. Furthermore, these methods are error prone.
[0010] Another reference may be made to “EPl 885880B1” for a method for amplifying a DNA template using rolling circle amplification (RCA) by incorporating random or partially random primers. This is limited to amplification of DNA and has been described for cell free cloning using isothermal amplification techniques using phi-29 polymerase.
[0011] Still another reference may also be made to “US20230348955A1” called Circular Nucleic acid Enrichment Reagent, which employs a splint oligonucleotide to circularize the original template molecule by splint ligation to generate a circular template. This is followed by RCA using bidirectional primers and phi29 polymerase to generate 80-mer biotinylated baits for target capture. However, this method has the limitations of splint oligos, produces shorter length baits, has poor performance over higher GC regions and retains the original template oligonucleotide.
[0012] Also, the “ES2864531T3” refers to a single-stranded nucleic acid segment that is linked to the target genome and has a nucleotide sequence that undergoes RCA based on phi29. They also describe a second solid support binding where chimeric single- stranded nucleic acid constructs of the collection hybridized to a solid support surface. They also describe blocking and target oligos for incorporating sample identifiers for detecting mRNA, miRNA, IncRNA, copy number alterations and sequence abnormalities.
[0013] Also, the US10227632B2 refers to the RCA method for detection or analysis of nucleic acids. Thus, the circular nucleic acid enrichment reagent (CNER) method for bait synthesis based on the circularization of oligonucleotides using a splint olio and rolling circle amplification are known in the art. Also, the generation of T7 promoters and T7 RNA polymerase-basedbiotinylated RNA baits is known in prior art. However, the know methods results in PCR bias, skewed amplification, and poor performance over GC-rich regions. Moreover, the RNA baits have limitations of long-term storage.
[0014] Therefore, there is a need to develop efficient methods of generating nucleic acid for target capture.
[0015] OBJECTS OF THE INVENTION
[0016] Some of the objects of the present disclosure, which at least one embodiment herein satisfies, are as follows:
[0017] An object of the present disclosure is to ameliorate one or more problems of the prior art or to at least provide a useful alternative.
[0018] Another object of the present disclosure is to provide method of generating nucleic acid for target capture.
[0019] Still another object of the present disclosure is to provide method of generating of generating nucleic acid for targeted genome enrichment from single-stranded circular oligonucleotide (circ-oligo) by hybridization ligation and extension with target oligonucleotides, followed by exonuclease treatment to generate a single stranded circular DNA.
[0020] Still another object of the present disclosure is to provide method of generating nucleic acid by binding of the circ-oligo sequence, by hybridization ligation and extension with target oligonucleotides, followed by exonuclease treatment to generate a single stranded circular DNA for bidirectional amplification with the sense and antisense oligonucleotide and biotinylation for a double-stranded concatemer of linear sequence; and digestion of the double-stranded linear concatemer by the restriction endonucleases to obtain a target capture nucleic acid.
[0021] Yet another object of the present disclosure is to provide a method to generate baits over high GC-rich regions of the genome.
[0022] Yet another object of the present disclosure is to provide a kit comprising of one or more circular oligonucleotides (circ-oligos); and one or more target oligonucleotides comprising target region, and regions complimentary to circ-oligonucleotide binding regions for target capture.Other objects and advantages of the present disclosure will be more apparent from the following description, which is not intended to limit the scope of the present disclosure.
[0023] SUMMARY OF THE INVENTION
[0024] In an aspect of the present disclosure, there is provided a method of generating one or more nucleic acid for target capture, comprising the steps of: (a) selecting one or more single-stranded circular oligonucleotide (circ-oligo) comprising a primer binding region of 15-35 nucleotides; poly-dT regions flanking the primer binding region; and sequences complementary to template flanking regions; (b) phosphorylating the circ-oligo using T4 polynucleotide kinase; (c) hybridization and ligation of the circ-oligo to one or more target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises: two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-oligo; (d) extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment to generate one or more single stranded circular DNA, each having a copy of the target sequence; (e) bidirectional Rolling Circle Amplification (RCA) amplification of the one or more single stranded circular DNA with sense and antisense oligonucleotides, and biotin-labelled, and unlabelled nucleotide bases to obtain one or more double-stranded linear concatemer; and (f) digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain one or more target capture nucleic acid of at least 120bp.
[0025] In an aspect of the present disclosure, the one or more circular oligonucleotide (circ-oligo) is a single stranded nucleotide molecule.
[0026] In an aspect of the present disclosure, the circ-oligo has a sequence length of 50-300 nucleotides, said sequence comprising: poly-dT regions of 30-200 nucleotides.
[0027] In an aspect of the present disclosure, the circ-oligo stably hybridizes with the target oligonucleotide at 60-70°C.
[0028] In an aspect of the present disclosure, the circ-oligo sequence is selected from the group consisting of SEQ ID NO: 1, and SEQ ID NO: 2.In an aspect of the present disclosure, a first pair of sense and antisense oligonucleotides is SEQ ID NO: 3 and SEQ ID NO: 4 respectively; and a second pair of sense and antisense oligonucleotides is SEQ ID NO: 5 and SEQ ID NO: 6 respectively.
[0029] In an aspect of the present disclosure, the restriction enzyme recognition site is Notl.
[0030] In another aspect of the present disclosure, the enzyme for extension and ligation is selected from the group consisting of HemoKlentaq, Ampiligase, and combination thereof; and the reagents are selected from the group consisting of dNTP, DNA polymerase, Tris-HCl, MgCh, KC1, NAD, Triton-X 100, DMSO, Betaine, and combinations thereof.
[0031] In another aspect of the present disclosure, the enzyme for amplification of the single stranded circular DNA is TaqPolymerase and reagents PCR buffers, MgCh, deoxy nucleotide triphosphates (dNTPs), betaine, DMSO, and modified DNTP such as one or more of biotin-labelled adenine, cytosine, guanine, thymine, and uracil and a combination thereof.
[0032] In yet another aspect of the present disclosure, the exonuclease treatment comprises treatment with Exonuclease I or Exonuclease III to selectively remove linear DNA while preserving circular DNA templates.
[0033] In still another aspect of the present disclosure, the method of generating nucleic acid for target capture comprises the steps of: (a) selecting a circ-oligo having sequence as set forth in SEQ ID NO: 1; (b) phosphorylating the circ-oligo using T4 polynucleotide kinase; (c) hybridizing and ligating the circ-oligo to target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises: two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-oligo; (d) extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment with exonuclease I and III to generate one or more single stranded circular DNA, each having a copy of the target sequence; (e) bidirectional Rolling Circle Amplification (RCA) amplification of the single stranded circular DNA with sense and antisense oligonucleotides having sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 respectively, by, and biotin-labelled, and unlabelled nucleotide bases to obtain one or more double-stranded linear concatemerand (f) digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain target capture nucleic acid, wherein the method generates baits over high GC-rich regions of the genome.
[0034] In an aspect of the present disclosure, there is provide a kit for target capture consisting of: (a) one or more circular oligonucleotides (circ-oligo); (b) one or more target oligonucleotides comprising target region, and regions complimentary to circ-oligonucleotide binding regions; (c) primers for bidirectional amplification; (d) deoxytrinucleotide triphosphate mixtures including modified dNTPs; and (e) enzymes and buffers for phosphorylation, ligation and amplification reaction, exonuclease mediated digestion, DNA polymerases and restriction endonucleases.
[0035] In still another aspect of the present disclosure, the method and kit of generating nucleic acid for target capture is for use in oncology, hematology, inherited malignancies, germline disorders, microbiology, or prenatal diagnosis; and wherein said use comprises the use of the target capture nucleic acids as hybridization probes for enriching specific genomic regions in next-generation sequencing workflows.
[0036] BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWING
[0037] The method of the present disclosure will now be described with the help of the accompanying drawing, in which:
[0038] Figure 1 illustrates generation of single stranded circular DNA in accordance with the present invention;
[0039] Figure 2 illustrates double-stranded concatemer of DNA, and the target capture nucleic acid / probe (product) from a single stranded circular DNA in accordance with the present invention;
[0040] Figure 3 illustrates graphical representation of the read counts obtained for the probe in accordance with the present invention.
[0041] Figure 4 illustrates IGV plot of the NPM1 gene harboring a 4 bp insertion in a case of AML (Acute Myeloid Leukemia) in accordance with the present invention;
[0042] Figure 5 illustrates IGV plot in a case of AML in accordance with the present invention;and
[0043] Figure 6 illustrates the comparative the amplified PCR product. The lane on the left side of the image (lane 1) demonstrates the amplified PCR product prior to Notl digestion, and the lane on the right side of the gel (lane 3) indicates a 120 bp DNA fragment post Notl digestion. DETAILED DESCRIPTION
[0044] Embodiments, of the present disclosure, will now be described with reference to the accompanying drawing.
[0045] Embodiments are provided so as to thoroughly and fully convey the scope of the present disclosure to the person skilled in the art. Numerous details are set forth, relating to specific components, and methods, to provide a complete understanding of embodiments of the present disclosure. It will be apparent to the person skilled in the art that the details provided in the embodiments should not be construed to limit the scope of the present disclosure. In some embodiments, well-known processes, well- known apparatus structures, and well-known techniques are not described in detail.
[0046] The terminology used, in the present disclosure, is only for the purpose of explaining a particular embodiment and such terminology shall not be considered to limit the scope of the present disclosure. As used in the present disclosure, the forms "a,” "an," and "the" may be intended to include the plural forms as well, unless the context clearly suggests otherwise. The terms "comprises," "comprising," “including,” and “having,” are open ended transitional phrases and therefore specify the presence of stated features, integers, steps, operations, elements, modules, units and / or components, but do not forbid the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. The particular order of steps disclosed in the method and process of the present disclosures not to be construed as necessarily requiring their performance as described or illustrated. It is also to be understood that additional or alternative steps may be employed.
[0047] When an element is referred to as being "mounted on," “engaged to,” "connected to," or "coupled to" another element, it may be directly on, engaged, connected or coupled to the other element. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed elements.The terms first, second, third, etc., should not be construed to limit the scope of the present disclosure as the aforementioned terms may be only used to distinguish one element, component, region, layer or section from another component, region, layer or section. Terms such as first, second, third etc., when used herein do not imply a specific sequence or order unless clearly suggested by the present disclosure.
[0048] Terms such as “inner,” “outer,” "beneath," "below," "lower," "above," "upper," and the like, may be used in the present disclosure to describe relationships between different elements as depicted from the figures.
[0049] The present invention relates to a method of generating nucleic acid for target capture. The method comprises the steps of (a) selecting one or more single-stranded circular oligonucleotide (circ-oligo), wherein the circ-oligo comprises a primer binding region of 15-35 nucleotides; poly-dT regions flanking the primer binding region; and sequences complementary to target flanking regions; (b) phosphorylating the circ-oligo using T4 polynucleotide kinase; (c) hybridization and ligation of the circ-oligo to one or more target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-olio; (d) extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment to generate one or more single stranded circular DNA, each having a copy of the target sequence; (e) bidirectional Rolling Circle Amplification (RCA) of the one or more single stranded circular DNA with sense and antisense oligonucleotides, and biotin-labelled, and unlabeled nucleotide bases to obtain one or more double-stranded linear concatemer; and (f) digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain one or more target captures nucleic acid of at least 120bp.
[0050] In an embodiment, the circ-oligo is a single stranded molecule. In an embodiment, the circ-oligo has a sequence length in the range of 50-300 nucleotides. In an embodiment, the nucleotide sequence of the circ-oligo comprises poly-dT regions in the range of 30-200 nucleotides. In an embodiment, the circ-oligo sequence is selected from the group consisting of S E Q ID NO : 1 , an d S E Q ID NO : 2 . It is understood by a person skilled in the art that the scope of the circ-oligos of the present invention are not limited to circ-oligo having sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. Other sequences are also contemplated to be within the scope of the present invention.The sequence of SEQ ID NO: 1 and SEQ ID NO: 2 are provided herein below:
[0051]
[0052] In an embodiment, the target oligonucleotide comprises poly-dA regions complementary to the poly-dT regions of the circ-oligo. In an embodiment the target oligonucleotide comprises two or more restriction enzyme recognition sites flanking a target sequence. In an embodiment, the poly-dA regions flank the restriction enzyme recognition sites. In a preferred embodiment, the target oligonucleotide comprises a target sequence, two or more restriction enzyme recognition sequence flanking the target sequence, and poly-dA sequence complementary to the circ-oligo poly-dT sequence flanking the restriction enzyme recognition sequences.
[0053] In an exemplary embodiment, a sequence of the target oligonucleotide is AAAAAAAAAAA AAA AAAAAAAAAAAAAAAAGCGGCCGC. TEMPLATE. GCGGCCGC AA AAAAAAAAAAAAAAAAAAAAAAAAAAAA (Sequence 2A).
[0054] In accordance with the present disclosure, the circular oligonucleotide (circ-oligo) is a single stranded nucleotide molecule.
[0055] In an embodiment, the circ-oligo stably hybridizes with the target oligonucleotide at a temperature in the range of 60-70°C.
[0056] In an embodiment, the primers for the bidirectional Rolling Circle Amplification (RCA) of the one or more single stranded circular DNA comprising target sequence is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. In an embodiment, the forward primer is selected from the group consisting of SEQ ID NO: 3, and SEQ ID NO: 5. In an embodiment, the reverse primer is selected from the group consisting of SEQ ID NO: 4, and SEQ ID NO: 6. In an embodiment, the pair of forward and reverse primer is as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 respectively. In an embodiment, the pair of forward and reverse primer is as set forth in SEQ ID NO: 5 and SEQ ID NO: 6 respectively.The oligonucleotide sequence of SEQ ID NO: 3 is as set forth in GCGGCCGCATCCGACGGTAGTGT. The oligonucleotide sequence of SEQ ID NO: 4 is as set forth in GCGGCCGCATCGGGAAGCTGAAG. The oligonucleotide sequence of SEQ ID NO: 5 is as set forth in GCGGCCGCAGGCGACCCTAGGTTGTA. The oligonucleotide sequence of SEQ ID NO: 6 is as set forth in GCGGCCGCCTTCGGCTGCCAATGTT.
[0057] In an embodiment, the enzyme for extension and ligation is selected from the group consisting of HemoKlentaq, and Ampiligase, and combination thereof; and the reagents are selected from the group consisting of dNTP, DNA polymerase, Tris-Hcl, MgCh, KC1, NAD, Triton-X 100, DMSO, Betaine, and combination thereof.
[0058] In an embodiment, the enzyme for amplification of single stranded circular DNA is TaqPolym erase and reagents PCR buffers, MgCh, deoxy nucleotide triphosphates (dNTPs), betaine, DMSO, and modified DNTP such as one or more of biotin-labelled adenine, cytosine, guanine, thymine, uracil and combinations thereof.
[0059] In an embodiment, the circ-oligo undergoes phosphorylation with T4 polynucleotide kinase and hybridizes to the target oligonucleotides for the nucleic acid template.
[0060] In an embodiment, the biotinylation is by using biotin-labelled nucleotide bases selected from the group consisting of adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), and combinations thereof.
[0061] In an embodiment, the exonuclease treatment to selectively remove linear DNA while preserving circular DNA template is carried out using Exonuclease I, Exonuclease III, or both.
[0062] In an exemplary embodiment, there is provided a method of generating nucleic acid for target capture, comprising the steps of (a) selecting a circ-oligo having sequence as set forth in SEQ ID NO: 1; (b) phosphorylating the circ-oligo using T4 polynucleotide kinase; (c) hybridizing and ligating the circ-oligo to target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises: two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-oligo; (d) extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment with exonuclease I and III to generate one or more single stranded circular DNA, each having acopy of the target sequence; (e) bidirectional Rolling Circle Amplification (RCA) amplification of the single stranded circular DNA with sense and antisense oligonucleotides having sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 respectively, by, and biotin-labelled, and unlabelled nucleotide bases to obtain one or more double-stranded linear concatemer ; and (f) digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain target capture nucleic acid, wherein the method generates baits over high GC-rich regions of the genome.
[0063] The present invention also provides a kit for target capture, comprising: (a) one or more circular oligonucleotide (circ-oligo); (b) one or more target oligonucleotides comprising target region, and regions complimentary to circ-oligonucleotide binding regions; (c) primers for bidirectional amplification; (d) deoxytrinucleotide triphosphate mixtures including modified dNTPs; and (e) enzymes and buffers for phosphorylation, ligation and amplification reaction, exonuclease mediated digestion, DNA polymerases and restriction endonucleases.
[0064] The target probes of the present invention have an application in the targeted sequencing of regions of interest instead of whole genome sequencing. Targeted sequencing of gene(s) is an essential strategy in precision medicine where frequently occurring genetic alterations are sequenced. This enables high depth focused interrogation of regions of interest to detect sequence abnormalities; including mutations, fusions, and copy number alterations, as well as expression levels. The target capture nucleic acid in accordance with the present invention is capable of targeting the specific nucleic acid.
[0065] The method and kit described in the present invention is useful in oncology, hematology, inherited malignancies, germline disorders, microbiology, or prenatal diagnosis; and wherein said use comprises the use of the target capture nucleic acids as hybridization probes for enriching specific genomic regions in next-generation sequencing workflows.
[0066] The present disclosure is further described in light of the following experiments, which are set forth for illustration purposes only and not to be construed as limiting the scope of the disclosure. The oligonucleotide pool mentioned here is only indicative in nature and can range from tens to hundreds of thousands or more. The following experiments can be scaled up to industrial / commercial scale and the results obtained can be extrapolated to industrial scale.
[0067] EXPERIMENTS:
[0068] The experiment was based on designing a pool comprising 2652 oligonucleotides to capture SNV,indels, and other sequence variants including copy number alterations in 135 genes altered in myeloid malignancies. Each oligonucleotide in this pool contained circ-oligo binding regions and RE sites flanking the target sequence. This olio pool was used as a template to generate target capture nucleic acids.
[0069] Example 1: A method of generating nucleic acid for target capture using the circ-oligo having oligonucleotide sequence as set forth in SEQ ID NO: 1 and target oligonucleotides.
[0070] Oligonucleotide (circ-olio) with sequence as s et forth i n SEQ ID N 0 : 1 was phosphorylated using T4 DNA Ligase Reaction Buffer and T4 Polynucleotide Kinase (New England Biolabs, MA, USA), and hybridized for binding with the above-mentioned oligonucleotide pool with flanking sequences along with dNTPs (0.25 mM, New England Biolabs, MA, USA), Q5 polymerase (1U, New England Biolabs, MA, USA), high fidelity Q5 polymerase (1U, New England Biolabs, MA, USA), Ampiligase (0.5U, Epicentre, USA) along with MgCL, NAD, KC1, Triton-X, Tris- HC1 at 65 degrees for 24 hours, followed by treatment with Exonuclease I and Exonuclease III. Each of the generated single-stranded circular DNA strands contain a copy of the target sequence. Each of the generated circular DNA strands was bidirectionally amplified with primers having sequence as set forth in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) using taq polymerase (DXDT, Bangalore, India) and a mixture of dNTP, biotin- 11-dUTP and biotin- 11-d ATP (DXDT, Bangalore, India). (Figure 1 and 2).
[0071] The resulting double-stranded linear concatemer was digested by Notl enzyme (New England Biolabs, MA, USA) to obtain a plurality of 120-mer target capture nucleic acids.
[0072] The lane on the left side of the image (lane 1) demonstrates the amplified PCR product prior to Notl digestion, and the lane on the right side of the gel (lane 3) indicates a 120 bp DNA fragment post Notl digestion. (Fig. 6).
[0073] Example 2: Validation of the method of generating nucleic acid for target capture.
[0074] DNA was isolated from a reference HAPMAP control NA12878 and subjected to enzymatic fragmentation, end repair and A-Tailing followed by ligation to Illumina TruSeq adapters using a commercial kit (KAPAHyperPrep PCR-free Kit, Roche). Multiple (n=8) replicates of this library were pooled and hybridized to the target capture nucleic acid product (4ng total product used for capture using IDT Hybridization and Wash v2 Kit and X-gen Universal Blockers)described above for 65 degrees at 16 hours. Post-capture, the hybridized regions were enriched using streptavidin beads. (DynabeadsMyOne Streptavidin Tl, Invitrogen USA). Finally, the enriched product was amplified using Illumina P5 and P7 primers to generate sequencing-ready libraries.
[0075] The libraries were sequenced on a NextSeq 1000 (2x150, Pl flow cell) at approximately 5 million reads per sample. The sequencing data was processed as follows:
[0076] The fastq files were trimmed (trimmomatic) and mapped to the reference genome, hgl9 using bwa-mem2. The bam file was further processed using sam tools and GATK best practices (GATK v3.8) to generate a final bam file. Coverage for targeted regions of the genome was calculated using bedtools v2.
[0077] The results in Figure 3 demonstrate a 1395-fold median enrichment of the genome of interest.
[0078] Example 3A: IGV plot of the NPM1 gene harboring a 4 bp insertion in a case of AML (Acute Myeloid Leukemia)
[0079] A case of acute myeloid leukemia (AML), an aggressive blood cancer, was sequenced with the gene panel mentioned in examples 1 and 2 above. The sample was identified to harbor the NPM1-. pTrp288Val fs*12 (VAF: 19.4%), which is a canonical mutation in AML (Figure 4).
[0080] This was confirmed by orthogonal NGS testing using commercially available capture panel (IDT, Iowa, and USA)
[0081] Example 3B: IGV plot in a case of AML (Acute Myeloid Leukemia)
[0082] Another case of AML (34-year-old male, 64% blasts in bone marrow), was sequenced with the gene panel mentioned in examples 1 and 2 above. Upon analysis, the case showed the presence of a.U2AFF. p.Ser34Phe (Figure 4), VAF 35.6% and FLT3 internal tandem duplication: FZT3c.l807_1808ins CCCACGTTGATTTCAGAGAA TATGAATATGATCTCAAAT, VAF 20.3%.
[0083] The case in Example 3A was also confirmed by orthogonal NGS testing using commercially available capture panel (IDT, Iowa, USA). This case was diagnosed as AML, myelodysplasia related based upon the NGS abnormalities.The foregoing description of the embodiments has been provided for purposes of illustration and not intended to limit the scope of the present disclosure. Individual components of a particular embodiment are generally not limited to that particular embodiment, but, are interchangeable. Such variations are not to be regarded as a departure from the present disclosure, and all such modifications are considered to be within the scope of the present disclosure.
[0084] TECHNICAL ADVANCEMENTS
[0085] The present disclosure described herein above has several technical advantages including, but not limited to, the realization of method, i.e.:
[0086] • Cost effective;
[0087] • Scalable;
[0088] • Targeted capture of preselected genomic regions;
[0089] • Generates micrograms of genome capture nucleic acids for thousands of reactions;
[0090] • Generates biotinylated baits for targeted genome enrichment; and
[0091] Results in nucleic acid having 120 bp baits (as per industry standards).
[0092] The embodiments herein and the various features and advantageous details thereof are explained with reference to the non-limiting embodiments in the following description. Descriptions of well-known components and processing techniques are omitted so as to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
[0093] The foregoing description of the specific embodiments so fully reveals the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and / or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferredembodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.
[0094] The use of the expression “at least” or “at least one” suggests the use of one or more elements or ingredients or quantities, as the use may be in the embodiment of the disclosure to achieve one or more of the desired objects or results.
[0095] Any discussion of documents, acts, materials, devices, articles or the like that has been included in this specification is solely for the purpose of providing a context for the disclosure. It is not to be taken as an admission that any or all of these matters form a part of the prior art base or were common general knowledge in the field relevant to the disclosure as it existed anywhere before the priority date of this application.
[0096] The numerical values mentioned for the various physical parameters, dimensions or quantities are only approximations and it is envisaged that the values higher / lower than the numerical values assigned to the parameters, dimensions or quantities fall within the scope of the disclosure, unless there is a statement in the specification specific to the contrary.
[0097] While considerable emphasis has been placed herein on the components and component parts of the preferred embodiments, it will be appreciated that many embodiments can be made and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. These and other changes in the preferred embodiment as well as other embodiments of the disclosure will be apparent to those skilled in the art from the disclosure herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as a limitation.
Claims
I / We claim:
1. A method of generating one or more nucleic acid for target capture, comprising the steps of:a. selecting one or more single-stranded circular oligonucleotide (circ-oligo) comprising a primer binding region of 15-35 nucleotides; poly-dT regions flanking the primer binding region; and sequences complementary to target flanking regions;b. phosphorylating the circ-oligo using T4 polynucleotide kinase;c. hybridization and ligation of the circ-oligo to one or more target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises: two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-oligo;d. extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment to generate one or more single stranded circular DNA, each having a copy of the target sequence;e. bidirectional Rolling Circle Amplification (RCA) amplification of the one or more single stranded circular DNA with sense and antisense oligonucleotides, and biotin- labelled, and unlabelled nucleotide bases to obtain one or more double-stranded linear concatemer; andf. digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain one or more target capture nucleic acid of at least 120bp.
2. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the one or more circular oligonucleotide (circ-oligo) is a single stranded nucleotide.
3. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the circ-oligo has a sequence length of 50-300 nucleotides, said sequence comprising: poly-dT regions of 30-200 nucleotides.
4. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the circ-oligo stably hybridizes with the target oligonucleotide at 60-70°C.
5. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the circ-oligo sequence is selected from the group consisting of SEQ ID NO: 1, and SEQ ID NO: 2.
6. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein a first pair of sense and antisense oligonucleotides is SEQ ID NO: 3 and SEQ ID NO: 4 respectively; and a second pair of sense and antisense oligonucleotides is SEQ ID NO: 5 and SEQ ID NO: 6 respectively.
7. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the restriction enzyme recognition site is Notl.
8. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the enzyme for extension and ligation is selected from the group consisting of HemoKlentaq, Ampiligase, and combination thereof; and the reagents are selected from the group consisting of dNTP, DNA polymerase, Tris-HCl, MgCh, KC1, NAD, Triton-X 100, DMSO, Betaine, and combinations thereof.
9. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the enzyme for amplification of the single stranded circular DNA is TaqPolymerase and reagents PCR buffers, MgCh, deoxy nucleotide triphosphates (dNTPs), betaine, DMSO, and modified DNTP such as one or more of biotin-labelled adenine, cytosine, guanine, thymine, and uracil and a combination thereof.
10. The method of generating one or more nucleic acid for target capture as claimed in claim 1, wherein the exonuclease treatment comprises treatment with Exonuclease I or Exonuclease III to selectively remove linear DNA while preserving circular DNA templates.
11. The method of generating nucleic acid for target capture as claimed in claim 1 comprising the steps of:a. selecting a circ-oligo having sequence as set forth in SEQ ID NO: 1;b. phosphorylating the circ-oligo using T4 polynucleotide kinase;c. hybridizing and ligating the circ-oligo to target oligonucleotide under hybridizing conditions, wherein the target oligonucleotide comprises: two or more restriction enzyme recognition sites flanking a target sequence; poly-dA regions complementary to the poly-dT regions of the circ-oligo; target sequence of 30-120 nucleotides; and sequences complementary to the circ-oligo;d. extension of the hybridized and ligated circ-oligo with the one or more target oligonucleotide, followed by exonuclease treatment with exonuclease I and III to generate one or more single stranded circular DNA, each having a copy of the target sequence;e. bidirectional Rolling Circle Amplification (RCA) amplification of the single stranded circular DNA with sense and antisense oligonucleotides having sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 respectively, by, and biotin- labelled, and unlabelled nucleotide bases to obtain one or more double-stranded linear concatemer ; andf. digestion of the one or more double-stranded linear concatemer by restriction endonucleases to obtain target capture nucleic acid, wherein the method generates baits over high GC-rich regions of the genome.
12. A kit for target capture comprising:a. one or more circular oligonucleotides (circ-oligo);b. one or more target oligonucleotides comprising target region, and regions complimentary to circ-oligonucleotide binding regions;c. primers for bidirectional amplification;d. deoxytrinucleotide triphosphate mixtures including modified dNTPs; and e. enzymes and buffers for phosphorylation, ligation and amplification reaction, exonuclease mediated digestion, DNA polymerases and restriction endonucleases.
13. The method and kit of generating nucleic acid for target capture as claimed in any of the claims 1-12 for use in oncology, hematology, inherited malignancies, germline disorders, microbiology, or prenatal diagnosis; and wherein said use comprises the use of the target capture nucleic acids as hybridization probes for enriching specific genomic regions in next-generation sequencing workflows.