Novel mutations in ankrd11 and uses thereof

By using ANKRD11 gene mutant detection and a cell model with low p53 protein expression, the lack of scientific evidence for early diagnosis and individualized intervention of KBG syndrome was addressed, enabling the development of early screening and targeted therapy strategies for KBG syndrome.

CN122128316APending Publication Date: 2026-06-02QINGDAO WOMEN & CHILDREN HOSPITAL

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO WOMEN & CHILDREN HOSPITAL
Filing Date
2026-03-21
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively elucidate the pathogenic mechanism of ANKRD11 gene mutation and KBG syndrome, resulting in a lack of scientific basis for early diagnosis and individualized intervention of KBG syndrome, and insufficient development of targeted therapy strategies.

Method used

We provide ANKRD11 gene mutants and related detection reagents. We can detect ANKRD11 gene mutations using gene chips, primers, or probes, and construct a cell model with low p53 protein expression for screening individuals at risk of KBG syndrome and providing early diagnostic evidence.

Benefits of technology

This study broadened the pathogenic gene spectrum of KBG syndrome, enhanced our understanding of KBG syndrome, provided a basis for clinical screening and diagnosis, and supported the development of personalized interventions and targeted therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure REF-OBJ-1774058735239-000002
    Figure REF-OBJ-1774058735239-000002
  • Figure REF-OBJ-1774058735239-000003
    Figure REF-OBJ-1774058735239-000003
  • Figure REF-OBJ-1774058735239-000004
    Figure REF-OBJ-1774058735239-000004
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology, specifically disclosing novel mutations of ANKRD11 and their applications. The ANKRD11 gene mutation can be any of the following: a nucleic acid having a target fragment, wherein the target fragment has a G repeat at position 4708 compared to the wild-type ANKRD11 gene with sequence SEQ ID NO.1; or a polypeptide having the p.E1570Gfs*71 mutation compared to the wild-type protein encoded by the ANKRD11 gene with sequence SEQ ID NO.2. The invention also relates to the application of reagents for detecting the aforementioned ANKRD11 gene mutation in screening individuals at risk for KBG syndrome. This disclosure broadens the pathogenic gene spectrum of KBG syndrome, enhances the understanding of the disease, provides experience for clinical screening and diagnosis of the disease, and also provides a basis for prenatal diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to novel mutations of ANKRD11 and their applications. Background Technology

[0002] KBG syndrome (KBGS) is a rare autosomal dominant multisystemic developmental disorder. Its pathogenesis is closely related to the loss of function of the ANKRD11 gene (encoding ankyrin repeat domain protein 11, OMIM 611192). Various mutations in this gene, such as frameshift mutations, nonsense mutations, missense mutations, splice site mutations, and microdeletions involving the 16q24.3 region of chromosome 16, can all lead to abnormal ANKRD11 protein function, resulting in highly heterogeneous clinical manifestations. Its main clinical features include short stature, distinctive facial features, macrodontia, neurodevelopmental delay, skeletal abnormalities, and epilepsy.

[0003] To date, among the reported cases of KBG syndrome globally, the pathogenic genetic factors can be mainly divided into two categories. Approximately 78.0% of cases originate from sequence alterations in the ANKRD11 gene itself, specifically manifested as single-base mutations or small insertions / deletions; the remaining 22.0% of cases are related to microdeletions in the 16q24.3 chromosomal region containing this gene. It is noteworthy that the vast majority of these genetic variations are de novo, not inherited from parents. Statistical data shows that de novo variations account for approximately 81.9% of cases caused by single-gene mutations, and this proportion is as high as 75.0% in cases caused by chromosomal microdeletions. Further analysis of the specific types of gene mutations reveals that frameshift mutations are the most common type, accounting for approximately 65.2%, and these mutations often lead to severe loss of protein function. This is followed by nonsense mutations, accounting for approximately 27.3%, which also cause premature termination of protein synthesis. Other types of mutations, such as missense mutations, are relatively rare. Furthermore, studies such as "Insights into the ANKRD11 variants and short-stature phenotype through literature review and ClinVar database search" and "ANKRD11 binding tocohesin suggests a connection between KBG syndrome and Cornelia de Langesyndrome" further confirm that abnormal function of the ANKRD11 protein leads to KBG syndrome. In-depth analysis of ANKRD11 gene mutants not only helps elucidate the molecular pathogenesis of KBG syndrome but also provides crucial scientific evidence for early genetic diagnosis, genetic counseling, and personalized intervention for this disease. Simultaneously, functional studies based on ANKRD11 mutants can lay an important molecular foundation for developing targeted therapy strategies and screening specific drugs, possessing significant translational medical value and clinical application prospects. Summary of the Invention

[0004] To solve the above problems, the present invention adopts the following technical solution: First aspect of the present invention Provides an ANKRD11 gene mutant, wherein the ANKRD11 gene mutant is any one of the following: The nucleic acid has a target fragment, and the target fragment, compared with the wild-type ANKRD11 gene with the sequence SEQ ID NO.1, has a c.4708dup mutation at nucleotide G duplication (a duplication of one base) at nucleotide 4708; The polypeptide, compared with the wild-type protein encoded by the ANKRD11 gene with the sequence SEQ ID NO.2, has the p.E1570Gfs*71 mutation, which causes the amino acid at position 1570 of the encoded protein to change from glutamic acid to glycine, resulting in a complete change of the amino acid sequence from position 1570 onwards, and the appearance of a stop codon at position 1641.

[0005] Furthermore, the protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein.

[0006] Regarding the effects of ANKRD11 gene mutants on organisms or organs: ANKRD11 protein is an important nuclear transcriptional co-regulator. Gene mutations leading to haploinadequacy or inactivation of key functional domains result in functional abnormalities and induce diseases. Loss of ANKRD11 function weakens its interaction with chromatin regulatory complexes and histone deacetylases, disrupting chromatin structural stability and target gene transcriptional coordination. This molecular disorder reduces the expression of downstream key regulatory genes, impairs ribosome biosynthesis and protein translation efficiency, and affects cell growth and metabolic homeostasis. In terms of development, molecular and cellular abnormalities affect cell populations dependent on ANKRD11 function: impaired proliferation, differentiation, and migration of neural progenitor cells lead to abnormal brain structure, agenesis of the corpus callosum, and intellectual disability; dysplasia of craniofacial neural crest cells causes typical facial features; and impaired differentiation and growth of bone and tooth progenitor cells result in phenotypes such as skeletal developmental delay. Therefore, ANKRD11 dysfunction disrupts the chromatin regulatory network, causes disordered expression of key developmental genes, impairs the development of multiple lineages of cells, and ultimately leads to KBG syndrome, including clinical manifestations such as intellectual disability, distinctive facial features, skeletal abnormalities, and dental malformations.

[0007] It should be noted that the above comparison uses specific sites as examples, primarily to present the location of newly mutated sites and emphasize the presence of such mutations. It does not require other sites to be completely identical to the wild type. In short, any occurrence of a newly mutated mutation at a specific site compared to the wild-type sequence should be considered within the scope of this invention, regardless of the status of other sites.

[0008] Second aspect of the invention The application of reagents for detecting the aforementioned ANKRD11 gene mutation in the preparation of products for screening individuals at risk of KBG syndrome is provided.

[0009] Regarding the understanding of the risk population for KBG syndrome: The risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

[0010] The reagents used to detect the ANKRD11 gene mutant can be any one of gene chips, primers, or probes. By detecting the presence of the ANKRD11 gene mutant in a sample (e.g., peripheral blood), it can be determined whether the sample originated from a patient with KBG syndrome or a high-risk group (both formed and unformed fetuses are temporarily categorized as patients or high-risk groups). This is because when the tested population has the ANKRD11 gene mutant, they must have KBG syndrome or belong to a high-risk group. More specifically, the reagents used to detect the ANKRD11 gene mutant are at least at least one of probes and primers specifically targeting the ANKRD11 gene mutant, and other methods such as Sanger sequencing and NGS sequencing can also be used (all within the scope of the claims of this invention). The primers are typically primer pairs, with the forward primer being 5'GGTGCCTCAGCTTCTCCATT' and the reverse primer being 5'GCGTGCTCAAAGACAAGTCC3'.

[0011] The phenotypes of KBG syndrome include developmental delay and intellectual disability. The phenotypes of KBG syndrome can be determined by clinical diagnostic criteria, as long as the confirmatory criteria are met, it is not required to include all phenotypic features associated with KBG syndrome.

[0012] The test reagent is used to analyze whether the aforementioned ANKRD11 gene mutation is detected in peripheral blood samples. It can be directly analyzed by analyzing whether the aforementioned specific mutation is present in the peripheral blood samples of the tested population.

[0013] Third aspect of the invention This invention provides a method for constructing a cell model with low p53 protein expression; an overexpression plasmid of the c.4708dup mutant ANKRD11 is transfected into a tool cell line. This method offers a novel approach to obtaining a cell model with low p53 protein expression, which can be used as a research model for scientific purposes.

[0014] Regarding the choice of cell line, we selected HEK293 cells as the experimental model. For the transfection step, we specifically used the Lipofectamine™ 3000 transfection kit. The specific implementation methods for plasmid construction and transfection can be directly referenced and adopted from existing, well-established techniques in this field.

[0015] This disclosure broadens the pathogenic gene spectrum of KBG syndrome, clarifies that the c.4708dup mutation of the ANKRD11 gene is pathogenic to KBG syndrome, enhances the understanding of the link between the ANKRD11 gene and KBG syndrome, strengthens clinicians' understanding of the disease, provides experience for clinical screening and diagnosis of the above-mentioned diseases, and also provides a basis for prenatal diagnosis. Attached Figure Description

[0016] Figure 1 A schematic diagram of the pedigree of KBG patients; Figure 2 DR examination image of the proband; Figure 3 Sanger sequencing validation peak diagram of the c.4708dup mutation site in the ANKRD11 gene of the KBG proband and his parents; Figure 4 This is a diagram showing the expression of the c.4708dup mutant of the ANKRD11 gene and related p53 protein. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to specific research examples. However, it should not be construed that the scope of the present invention is limited to the following embodiments.

[0018] I. Research on pathogenic genes and mutation sites 1. Sample collection: The inventor collected a family history of KBG syndrome, such as Figure 1 As shown, □ represents a normal male, ○ represents a normal female, ■ represents a male with the disease, and ↗ represents the proband. All family members involved in this invention research signed informed consent forms. The inventors collected peripheral blood samples from patients and normal individuals within the aforementioned KBG syndrome families.

[0019] The proband was a 10-year-old male patient who had experienced growth retardation since childhood. Figure 2 As shown, a DR examination of the wrist joint was performed at the age of 2, and the results showed that the bone age was equivalent to that of a 1-year-old child. The current height measurement is at the third percentile of the height of children of the same sex and age, and no obvious intellectual abnormalities have been found. Imaging examination shows that the short spine in the thoracolumbar segment has an "S"-shaped curve centered on T9 and L3, suggesting the presence of scoliosis. The child has a distinctive facial appearance, characterized by wide-set eyes, large ears, wide eyebrows, and a long philtrum.

[0020] 2. Whole exome sequencing The inventors used the Roche KAPA HyperExome in conjunction with the MGI-DNB-T7 sequencing platform to perform whole-exome sequencing on the proband in this family. Target region coverage was >99.96%, the proportion of target region sites with a depth greater than 20× was >99.55%, and the average sequencing depth was approximately 175×.

[0021] 2.1 Sample Preparation Peripheral blood was collected from the proband and their parents in the aforementioned family, and peripheral blood DNA was extracted using the Qiagen Blood DNA minikit 1.2.1 kit (Qiagen, Germany). Quantification was performed using Qubit, ensuring that at least 2 μg of each DNA sample was used for whole-exome sequencing.

[0022] 2.2 Library construction and sequencing DNA samples were randomly fragmented into 150-200 bp fragments using an E220 Covaris instrument. Following the manufacturer's instructions, fragment sizes were selected using AMPure XP Beads, followed by end repair, phosphorylation, and α-tailing. BGISEQ-500 platform-specific adapters were ligated to the α-tail fragments, the ligated fragments were purified, and amplified by PCR. Finally, the fragments were cycled to generate single-stranded DNA circulars. After quantitative identification, the library was sequenced.

[0023] 3. Variant detection, annotation, and database comparison; sequencing results and analysis. Whole-genome sequencing was performed on the proband and their parents. Sequencing data were matched against the SPAST genome reference using the Burrows-Wheeler alignment tool and annotated using snpEff 3 and the dbSNP database. First, all identified variants were screened using the dbSNP database, ExAC, HapMap database, 1000 genomes, and a local database of 100 healthy Chinese adults. Variants with a MAF > 0.01 in healthy individuals were removed. Then, all filtered variants were compared with the OMIM and CGD databases to identify gene variants associated with the disease phenotype.

[0024] Whole-exome sequencing analysis was performed on the proband. This case underwent whole-exome sequencing and Sanger sequencing verification of specific variant sites, revealing a heterozygous variant c.4708dup in exon 9 of the ANRKD11 gene. This variant is a frameshift mutation with a G repeat at position 4708, resulting in a change from glutamic acid to glycine at amino acid position 1570 of the encoded protein. This leads to a complete alteration of the amino acid sequence from position 1570 onwards, and the presence of a stop codon at position 1641, prematurely terminating protein synthesis and affecting normal translation (p.E1570Gfs*71) (PVS1). This variant has no reported frequency in normal population gene databases (allele frequency (%): gnomAD:.) (PM2_PP); this variant is a de novo variant in this family (PS2_PP). Based on the aforementioned evidence, and in accordance with the ACMG (The American College of Medical Genetics and Genomics) variant classification guidelines, this variant has been further identified as a pathogenic variant (ACMG: PVS+2PP).

[0025] 4. Sanger sequencing verification The ANKRD11 gene was sequenced in patients and their parents (normal individuals) within the family. Based on the sequence determination results, whether the mutation was wild-type or mutant, the correlation between the c.4708dup heterozygous mutation of the ANKRD11 gene and KBG syndrome was verified. The specific methods and steps are as follows: 1) DNA extraction Genomic DNA was extracted from the peripheral blood of the proband and his / her parents for later use.

[0026] 2) Primer design and PCR reaction Referring to the human genome sequence database GRCh37.1 / ANKRD11, specific primers targeting the c.4708dup mutation site with the nucleotide sequence shown below were designed, as detailed in the table below.

[0027] The extracted DNA was used as a template to perform a PCR reaction with the above-mentioned specific primers according to conventional methods in the art, and the purified PCR product was sequenced.

[0028] The PCR amplification products obtained from the patient and their parents were sequenced for DNA. Based on the sequencing results, the ANKRD11 gene coding sequence of the above samples was compared. The results showed that the proband carried a heterozygous c.4708dup mutation, while the parents of the proband who showed normal behavior did not carry this mutation. Therefore, it was preliminarily determined that this mutation is the pathogenic site of KBG syndrome.

[0029] 3) Test kit A detection kit is prepared, comprising primers suitable for ANKRD11 gene mutants (compared to SEQ ID NO.1, the ANKRD11 gene mutant has a c.4708dup mutation), for screening biological samples susceptible to KBG syndrome, wherein these primers include the aforementioned ANKRD11 gene-specific primers.

[0030] The specific steps for screening biological samples susceptible to KBG syndrome using the above kit are as follows: extract DNA from the subject, use the extracted DNA as a template to perform PCR reaction with the above specific primers, purify the PCR product according to conventional methods in the field, sequence the purified product, and then observe whether the sequenced sequence has the c.4708dup mutation to effectively detect whether the subject is susceptible to KBG syndrome.

[0031] 5. In vitro experiments to verify protein expression levels: 1) Plasmid construction: Overexpression plasmids for wild-type and c.4708dup mutant ANKRD11 were constructed and provided by Sangon Biotech (Shanghai) Co., Ltd.

[0032] 2) Cell transfection: HEK293 cells were cultured in 1×DMEM basic solution with 10% fetal bovine serum and 1% ampicillin-streptomycin added. Transfection was performed using the Lipofectamine™ 3000 transfection kit according to the manufacturer's instructions.

[0033] 3) Protein extraction and Western blot: Cells were washed with PBS buffer and lysed using RIPA lysis buffer on ice for 5 minutes. The samples were sonicated and centrifuged at 10,000 × g for 10 minutes at 4°C, and the supernatant was collected. The samples were diluted with 5× loading buffer and heated at 98°C for 10 minutes. Protein samples were separated using a 4%–12% SDS-PAGE gel and protein electrophoresis system according to the manufacturer's instructions.

[0034] Experimental results are as follows Figure 4As shown, this mutation results in the production of a truncated protein, impairing its function and leading to abnormal function of the protein encoded by ANKRD11, further confirming its pathogenicity. Furthermore, this truncated protein causes a decrease in p53 protein expression levels. Previous studies have shown that ANKRD11 can activate the p53 signaling pathway, while the loss-of-function mutation in this study leads to the loss of ANKRD11 activity, thereby weakening its regulatory effect on p53 and ultimately causing downregulation of p53 expression. This molecular mechanism provides direct evidence for explaining the pathological process of KBG syndrome caused by this mutation.

[0035] II. Introduction and Application Cases of Mutants Here is a brief introduction to the clinical applications of this type of product. It can be used to analyze the obtained samples for testing. By analyzing whether the sample has specific mutations, it can determine whether the sample source has a certain disease or is a high-risk group, thus providing a reference for clinical diagnosis and treatment. In particular, it provides better guidance in preconception screening, and can screen for potential serious diseases in the fetus during pregnancy to provide accurate advice.

[0036] When applying it clinically, the general steps can be as follows: S1. Extract nucleic acid samples (samples can also be provided directly by the testing provider). There are no restrictions on the type of biological sample, as long as it can extract nucleic acid samples that reflect whether ANKRD11 has mutated. Suitable samples include human blood, skin, subcutaneous tissue, etc., with peripheral blood being preferred due to its ease of sampling and testing, and improved screening efficiency. "Nucleic acid sample" can be broadly understood as whole genome DNA, total RNA, etc. If RNA is used as the sample, an RNA sample (preferably mRNA) must be extracted, and cDNA samples obtained through reverse transcription.

[0037] S2. After obtaining the nucleic acid sample, analyze and determine the nucleic acid sequence. The method and equipment are not limited; sequencing can be used, including second-generation and third-generation sequencing technologies. Utilizing various sequencing devices and combining the latest technologies can improve detection sensitivity and accuracy, as well as increase detection and analysis efficiency and subsequent analysis precision. Determining the nucleic acid sequence also includes constructing a nucleic acid sequencing library and sequencing it. In a broad sense, "nucleic acid sequence" simply means containing the ANKRD11 coding sequence.

[0038] S3. After determining the nucleic acid sequence, compare it with the sequence of SEQ ID NO.1. If the c.4708dup mutation is present, it indicates that the biological sample is susceptible to KBG syndrome. This method also involves related kits and applications.

[0039] Therefore, the method for screening biological samples susceptible to KBG syndrome according to embodiments of the present invention can effectively screen such biological samples. The method and equipment for comparing nucleic acid sequences with SEQ ID NO.1 are not particularly limited, and any conventional software can be used. Unless otherwise specified, the embodiments employ conventional techniques in the art, and reference can be made to *Molecular Cloning: A Laboratory Manual*, 3rd edition, or related products. All reagents and products used are commercially available. Processes and methods not described in detail are conventional methods known in the art. The source, trade name, and composition of reagents used are indicated upon their first appearance, and subsequent descriptions of the same reagents are identical unless otherwise specified.

[0040] Those skilled in the art will appreciate that various modifications can be made to the above embodiments without departing from the overall spirit and concept of the present invention. For any aspects not detailed herein, reference can be made to the prior art. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. An ANKRD11 gene mutant, characterized in that, The ANKRD11 gene mutant is any of the following: Nucleic acid having a target fragment, and the target fragment having a c.4708dup mutation compared to the wild-type ANKRD11 gene with the sequence SEQ ID NO.1; The polypeptide, compared with the wild-type protein encoded by the ANKRD11 gene with the sequence SEQ ID NO.2, has the p.E1570Gfs*71 mutation.

2. The ANKRD11 gene mutant according to claim 1, characterized in that, The protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein.

3. The use of the reagent for detecting the ANKRD11 gene mutation in claim 1 in the preparation of products for screening individuals at risk of KBG syndrome.

4. The application according to claim 3; wherein, The reagent for detecting the ANKRD11 gene mutant in claim 1 is any one of a gene chip, primers, or probes.

5. The application according to claim 4; wherein, The primers are primer pairs: forward primer: 5'GGTGCCTCAGCTTCTCCATT', reverse primer: 5'GCGTGCTCAAAGACAAGTCC3'.

6. The application according to claim 4; wherein, The reagent is used to analyze the presence of the ANKRD11 gene mutant in peripheral blood samples as described in claim 1.

7. The application according to claim 3; wherein, The at-risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.

8. The application according to claim 7; wherein, Patients with KBG syndrome exhibit phenotypes including developmental delay and intellectual disability.

9. A method for constructing a cell model with low p53 protein expression; characterized in that, The overexpression plasmid of c.4708dup mutant ANKRD11 was transfected into the tool cell line.

10. The method for constructing a cell model with low p53 protein expression according to claim 9; characterized in that, The cell line used was HEK293; transfection was performed using the Lipofectamine™ 3000 transfection kit.