Methods of functional vascularization of pancreatic islets and beta-cell organoids
Coculturing pancreatic islets with ETV2-expressing R-VECs in a defined extracellular matrix forms stable vascular networks, addressing the inefficiencies of mature endothelial cells and improving islet functionality and survival.
Patent Information
- Application Number
- AU2020299624
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-07-03
- Filing Date
- 2020-07-02
- Publication Date
- 2026-07-09
- Estimated Expiration
- 2040-07-02
AI Technical Summary
Existing methods fail to efficiently vascularize pancreatic islets in vitro using mature adult endothelial cells, leading to poor survival and functionality of islet cells due to the inability of these cells to form durable, long-lasting vessels and interact effectively with islet-specific niches.
Coculturing pancreatic islets with reprogrammed vascular endothelial cells (R-VECs) expressing the ETV2 transcription factor, using a defined extracellular matrix composed of laminin, entactin, and collagen IV, to generate stable and functional three-dimensional vascular networks without pericytes or cumbersome scaffolds.
The method results in the formation of durable vascular networks within pancreatic islets, enhancing insulin secretion and islet functionality, with the vascularized islets remaining functional for extended periods both in vitro and in vivo.
Smart Images

Figure 00000001_0000 
Figure 00000094_0000 
Figure 00000094_0001
Abstract
Description
[0080] An aspect of this disclosure is directed to methods of vascularizing a pancreatic islet comprising coculturing the pancreatic islet with an endothelial cell which comprises an exogenous nucleic acid encoding an ETV2 transcription factor and wherein the ETV2 is expressed in the endothelial cell, thereby generating a vascularized pancreatic islet.
[0081] In some embodiments, the pancreatic islet is surgically isolated from a person. In some embodiments, the pancreatic islet is isolated from a healthy donor. In some embodiments, the pancreatic islet is isolated from a subject in need. In some embodiments, the pancreatic islet is obtained from a commercial source. In some embodiments, pancreatic islets are isolated from cadavers (e.g., cadavers genetically matched to a recipient).
[0082] In some embodiments, the pancreatic islets used in the coculturing are not decellularized, i.e., the pancreatic islets still retain existing tissue structure and differentiated, insulin-producing P cells. In some embodiments, the pancreatic islets comprise at least an extracellular matrix and P cells that produce insulin. In some embodiments, pancreatic islets comprise cells from cell types other than P cells (e.g., alpha cells that produce glucagon, pancreatic polypeptide (PP) cells that produce pancreatic polypeptide, epsilon cells that produce ghrelin, and delta cells that produce somatostatin).
[0083] According to the present method, a pancreatic islet is co-cultured with an endothelial cell comprising an exogenous nucleic acid encoding an ETV2 transcription factor, wherein the ETV2 is expressed in the endothelial cell.
[0084] In some embodiments, the endothelial cell is a vascular endothelial cell comprising an exogenous nucleic acid encoding an ETV2 transcription factor, wherein the ETV2 is expressed in the endothelial cell - such a vascular endothelial cell is also referred to as a reprogrammed / reset vascular endothelial cell or "R-VEC."
[0085] The expression "an endothelial cell" is understood to include a population of endothelial cells. In some embodiments, a population of endothelial cells is a substantially pure population of endothelial cells. In some embodiments, a substantially pure population of endothelial cells refers to a population with at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or a higher percentage of the cells in the population being endothelial cells, e.g., endothelial cells having the same origin (e.g., vascular endothelial cells) and reprogrammed to express an ETV2 transcription factor.
[0086] In some embodiments, the cocultured endothelial cell is at a starting concentration of at least 3 million cells / ml, at least 3.5 million cells / ml, at least 4 million cells / ml, at least 4.5 million cells / ml, at least 5 million cells / ml, at least 5.5 million cells / ml, at least 6 million cells / ml, at least 6.5 million cells / ml, or at least 7 million cells / ml. In a specific embodiment, the endothelial cell is at a starting concentration of about 5 million cells / ml.
[0087] In some embodiments, the coculturing is carried out in a medium supplemented with molecules, such as basic FGF (FGF-2) and heparin. In some embodiments, the medium comprises between about 5 ng / ml and about 20 ng / ml FGF2. In some embodiments, the medium comprises about 5 ng / ml, about 10 ng / ml, about 15 ng / ml, or about 20 ng / ml FGF2. In a specific embodiment, medium comprises about 10 ng / ml FGF-2. In some embodiments, the medium comprises between about 20 pg / ml and about 200 pg / ml heparin. In some embodiments, the medium comprises about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 45 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 125 pg / ml, about 150 pg / ml, 175 about pg / ml, or about 200 pg / ml heparin. In a specific embodiment, medium comprises about 100 pg / ml heparin.
[0088] In some embodiments, the coculturing is carried out in a medium further supplemented with molecules in addition to FGF-2 and / or heparin, such as human serum albumin (between 0.05% and 2%, e.g., about 0.05%, about 0.1%, about 0.5%, about 1%, about 1.5%, or about 2%), human transferring (between 5 pg / ml and 20 pg / ml, e.g., about 5 pg / ml, about 10 pg / ml, about 15 pg / ml, or about 20 pg / ml), ethanolamine (between 20 pM and 100 pM, e.g., about 20 pM, about 30 pM, about 40 pM, about 50 pM, about 60 pM, about 70 pM, about 80 pM, about 90 pM, or about 100 pM), phosphoethanolamine (between 20 pM and 100 pM, e.g., about 20 pM, about 30 pM, about 40 pM, about 50 pM, about 60 pM, about 70 pM, about 80 pM, about 90 pM, or about 100 pM), sodium selenite (between 3 pg / ml and 10 pg / ml, e.g., about 3 pg / ml, about 3.5 pg / ml, about 3.5 pg / ml, about 4 pg / ml, about 4.5 pg / ml, about 5 pg / ml, about 5.5 pg / ml, about 6 pg / ml, about 6.5 pg / ml, about 7 pg / ml, about 7.5 pg / ml, about 8 pg / ml, about 8.5 pg / ml, about 9 pg / ml, about 9.5 pg / ml, or about 10 pg / ml), glucose (between 2 mM and 10 mM, e.g., about 2 mM, about 2,5 mM, about 3 mM, about 3.5 mM, about 4 mM, about 4.5 mM, about 5 mM, about 5.5 mM, about 6 mM, about 6.5 mM, about 7 mM, about 7.5 mM, about 8 mM, about 8.5 mM, about 9 mM, about 9.5 mM, or about 10 mM), Triiodothyronine (T3) (between 0.3 ng / mL and 1 ng / mL, e.g., about 0.3 ng / mL, about 0.4 ng / mL, about 0.5 ng / mL, about 0.6 ng / mL, about 0.65 ng / mL, about 0.7 ng / mL, about 0.8 ng / mL, about 0.9 ng / mL, about 1 ng / mL), Prolactin (PRL) (between 10 ng / mL and 30 ng / mL, e.g., about 10 ng / mL, about 15 ng / mL, about 20 ng / mL, about 23 ng / mL, about 25 ng / mL, about 28 ng / mL, about 30 ng / mL), IGF-I (between 1 ng / mL and 10 ng / mL, e.g., about 1 ng / mL, about 2 ng / mL, about 3 ng / mL, about 4 ng / mL, about 5 ng / mL, about 6 ng / mL, about 7 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL) or a combination thereof. In a specific embodiment, the medium comprises 10 ng / ml FGF-2, 100 pg / ml heparin, 0.1% human serum albumin, lOpg / ml human transferrin, 50pM Ethanolamine, 50pM Phosphoethanolamine, 6.7pg / ml sodium selenite, 5.5mM glucose, 0.65 ng / mL Triiodothyronine (T3), 23 ng / mL Prolactin (PRL), and 5 ng / mL IGF-I.
[0089] In some embodiments, the co-culturing is carried out on a matrix. In fact, the present disclosure identifies essential extracellular matrix components, i.e., laminin, entactin and collagen IV, which when used to culture reprogrammed endothelial cells results in the formation of stable and functional three-dimensional artificial vessels in vitro and in vivo without the use of pericytes, perfusion and cumbersome scaffolds. Therefore, in certain embodiments, the matrix is composed of extracellular matrix components, such as laminin, entactin and / or collagen.
[0090] In some embodiments, a matrix for use coculturing can include laminin and entactin at a combined concentration of at least about 5 mg / mL. As laminin and entactin can bind to each other and form a complex, a matrix for use in the present methods can include a complex of laminin and entactin. For example, the matrix can include at least about 5 mg / mL of a complex of laminin and entactin. In an exemplary embodiment, the coculturing is carried out on a matrix including laminin and entactin at a combined concentration of at least 5 mg / mL, at least 6 mg / mL, at least 7 mg / mL, at least 8 mg / mL, at least 9 mg / mL, at least 10 mg / mL, at least 11 mg / mL, at least 12 mg / mL, at least 13 mg / mL, at least 14 mg / mL or at least 15 mg / mL. In specific embodiments, the matrix used in the present methods is composed of a combination of laminin, entactin and collagen IV (L.E.C.). For example, the coculturing can be carried out on a matrix containing at least 5 mg / mL of laminin and entactin, and at least 0.2 mg / mL collagen IV to form long-lasting, functional three-dimensional artificial blood vessels. In some embodiments, the L.E.C. matrix combination comprises at least 0.2 mg / mL, at least 0.3 mg / mL, at least 0.4 mg / mL, at least 0.5 mg / mL, at least 0.6 mg / mL, at least 0.7 mg / mL, at least 0.8 mg / mL, at least 0.9 mg / mL, or at least 1 mg / mL collagen IV. In a specific embodiment, the L.E.C. matrix is composed of between a combined concentration 9 mg / mL and 13 mg / mL of laminin and entactin, and between 0.2 mg / mL and 0.5 mg / mL of collagen IV. In a specific embodiment, the L.E.C. matrix is composed of laminin and entactin at a combined concentration of about 11 mg / mL and about 0.2 mg / mL collagen IV.
[0091] In some embodiments, the coculturing of the pancreatic islet and the endothelial cell is performed in a bioreactor or a microfluidic device. In some embodiments, the microfluidic device is capable of transporting human blood or other specialized media, solutions, chemicals or biopharmaceutical drugs or reagents. In some embodiments, the coculturing of the pancreatic islet and the endothelial cell is performed in a 3D gel. There is no requirement for any specific manner by which the islet and the EC cell are combined or mixed. The mixture of islet-EC can self-assemble into a 3D structure, i.e., the vascularized islet.
[0092] In some embodiments, the coculturing is carried out for at least 1-4 weeks. In some embodiments, the coculturing is done for at least 3-4 weeks. In some embodiments, the coculturing is done for at least 1 week, at least 2 weeks, at least 3 weeks, at least 24 days, at least 4 weeks, at least 32 days, at least 5 weeks, at least 38 days, at least 6 weeks, at least 45 days, at least 7 weeks, at least 52 days, at least 8 weeks, but not more than 4 months or not more than 3 months. In some embodiments, the coculturing is performed for about 3 weeks, about 24 days, about 4 weeks, about 32 days, about 5 weeks, about 38 days, about 6 weeks, about 45 days, about 7 weeks, about 52 days, or about 8 weeks.
[0093] In some embodiments, the pancreatic islet and the endothelial cell are cocultured for an additional period of time under conditions wherein the endothelial cell does not express the ETV2 transcription factor. In some embodiments, the pancreatic islet and the endothelial cell are cocultured for an additional period of time under conditions wherein the expression of the ETV2 transcription factor in the endothelial cell is transient or reduced (turned down). In some embodiments, the additional period of time is at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, but not more than 18 days, not more than 16 days or not more than 14 days.
[0094] In some embodiments, the pancreatic islet and the endothelial cell can be cocultured until sufficient islet vascularization has been achieved. The extent of vascularization can be assessed by various means. In some embodiments, vascularization is measured by the fold increase in the amount of glucose-stimulated insulin secretion. In some embodiments, vascularization is considered to be sufficient when a vascularized islet produces at least 2 folds, at least 3 folds, at least 4 folds, at least 5 folds more insulin in response to glucose as compared to an islet that has not been vascularized (e.g., an islet that was not cocultured with any endothelial cell, or an islet that was cocultured with a wild type endothelial cell that does not express an exogenous nucleic acid encoding the ETV2 transcription factor). In some embodiments, increase in glucose-stimulated insulin secretion in a pancreatic islet is measured by incubating the islet with low glucose (e.g., between about 1 mM and about 4 mM) to determine the basal insulin secretion, and then incubating the islet with high glucose (about 16.7 mM) to determine the stimulated insulin secretion. In some embodiments, the extent of vascularization is determined based on visual assessment, for example, as the vascularization progresses, tubular structures representing blood vessels are observed. In some embodiments, the vascularization is measured by the increase in vessel area. In some embodiments, vascularization is considered to be sufficient when the vessel area in a vascularized islet reaches at least at least 4%, 5%, at least 6%, at least 7%, at least 8%, at least 9% or at least 10% of a total area of the islet under examination. Vascularized Pancreatic Islet
[0095] In some embodiments, the vascularized pancreatic islets of the present disclosure comprise regular islet structure and vasculature formed by the endothelial cells expressing an exogenous nucleic acid encoding the ETV2 transcription factor.
[0096] In some embodiments, the vascularization comprises the formation of an artery, a vein, a capillary, an arteriole, a venule, lymphatic vessels, or a combination thereof, within the pancreatic islet. In some embodiments, a vascularized pancreatic islet includes a network, a 2dimensional or 3-dimensional network, of vascular vessles formed by the endothelial cells ("arborization of the pancreatic islet").
[0097] In some embodiments, the vascularized pancreatic islet comprises P-cells and vasculature (blood vessels, e.g., arteries, veins) that allows delivery of nutrients to the pancreatic islet and that allows removal of the insulin produced by the pancreatic islet. In some embodiments, the vascularized pancreatic islet is functional in glucose sensing and insulin production in tissue culture (in vitro) or when administered to a host (in vivo). In some embodiments, the vasculature formed within a vascularized pancreatic islet in vitro is capable of connecting with host vessels in vivo and / or promoting further vascularization of the pancreatic islet in vivo. In some embodiments, the vascularized pancreatic islet can stay functional in glucose sensing and insulin production in vivo for an extended period of time. As used in, the phrase "extended period of time" refers to at least 2 weeks, at least 3 weeks, at least a month, at least 6 weeks, at least 2 months, at least 10 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 monhts or at least a year. Methods of Forming Vascularized fl-cell Organoids
[0098] An aspect of this disclosure is directed to methods of making a vascularized P-cell organoid comprising coculturing P-cells with an endothelial cell which comprises an exogenous nucleic acid encoding an ETV2 transcription factor, wherein the ETV2 is expressed in the endothelial cell, thereby generating a vascularized P-cell organoid.
[0099] As used herein, the term "P-cell organoid" refers to man-made composition of cells made up entirely, or almost entirely (> 90%) of P-cells. In some embodiments, intact pancreatic islets undergo enzymatic digestion to generate single cell suspension of the various endocrine cells present within the islets, which predominantly compose of P-cells. Replating of single suspension cells results in re-assembly into P-cells organoids that could be used for further studies, including therapeutic vascularization or implantation (Zhou Q, and Melton DA. Nature-, 557(7705):351-8, (2018)). In some embodiments, the P-cell organoids comprise P-cells derived from stem cells or induced Pluripotent Cell (iPS) cells (Zhou Q, and Melton DA. Nature-, 557(7705):351-8 (2018); Hebrok M. Cold Spring Harb Perspect Med; 2(6):a007674 (2012); both incorporated herein by reference). In some embodiments, the P-cell organoids comprise P cells derived from direct conversion of fibroblasts (Zhou Q, and Melton DA. Nature; 557(7705):351-8, (2018)). In some embodiments, the P-cell organoids comprise P cells isolated from adult subjects (Zhou Q, and Melton DA. Nature; 557(7705):351-8 (2018)).
[00100] In some embodiments, the P-cell organoid is made from P-cells obtained from the pancreas of a subject (a healthy donor, a subject in need, or cadavers). In some embodiments, P-cells are obtained from cadavers genetically matched to a recipient.
[00101] In some embodiments, the endothelial cell is a vascular endothelial cell comprising an exogenous nucleic acid encoding an ETV2 transcription factor wherein the ETV2 is expressed in the endothelial cell; for example, a reprogrammed / reset vascular endothelial cell (R-VEC).
[00102] In some embodiments, the colcultured endothelial cell is at a starting concentration of at least 3 million cells / ml, at least 3.5 million cells / ml, at least 4 million cells / ml, at least 4.5 million cells / ml, at least 5 million cells / ml, at least 5.5 million cells / ml, at least 6 million cells / ml, at least 6.5 million cells / ml, or at least 7 million cells / ml. In a specific embodiment, the endothelial cell is at a starting concentration of about 5 million cells / ml.
[00103] In some embodiments, the coculturing is carried out in a medium supplemented with molecules, such as basic FGF (FGF-2), and heparin. In some embodiments, the medium comprises between about 5 ng / ml and about 20 ng / ml FGF2. In some embodiments, the medium comprises about 5 ng / ml, about 10 ng / ml, about 15 ng / ml, or about 20 ng / ml FGF2. In a specific embodiment, medium comprises about 10 ng / ml FGF-2. In some embodiments, the medium comprises between about 20 pg / ml and 200 pg / ml about heparin. In some embodiments, the medium comprises about 20 pg / ml, about 30 pg / ml, about 40 pg / ml, about 45 pg / ml, about 50 pg / ml, about 60 pg / ml, about 70 pg / ml, about 80 pg / ml, about 90 pg / ml, about 100 pg / ml, about 110 pg / ml, about 125 pg / ml, about 150 pg / ml, 175 about pg / ml, or about 200 pg / ml heparin. In a specific embodiment, medium comprises about 100 pg / ml heparin.
[00104] In some embodiments, the coculturing is carried out in a medium further supplemented with molecules additional to FGF-2 and / or heparin, such as human serum albumin (between 0.05% and 2%, e.g., about 0.05%, about 0.1%, about 0.5%, about 1%, about 1.5%, or about 2%), human transferring (between 5 pg / ml and 20 pg / ml, e.g., about 5 pg / ml, about 10 pg / ml, about 15 pg / ml, or about 20 pg / ml), ethanolamine (between 20 pM and 100 pM, e.g., about 20 pM, about 30 pM, about 40 pM, about 50 pM, about 60 pM, about 70 pM, about 80 pM, about 90 pM, or about 100 pM), phosphoethanolamine (between 20 pM and 100 pM, e.g., about 20 pM, about 30 pM, about 40 pM, about 50 pM, about 60 pM, about 70 pM, about 80 pM, about 90 pM, or about 100 pM), sodium selenite (between 3 pg / ml and 10 pg / ml, e.g., about 3 pg / ml, about 3.5 pg / ml, about 3.5 pg / ml, about 4 pg / ml, about 4.5 pg / ml, about 5 pg / ml, about 5.5 pg / ml, about 6 pg / ml, about 6.5 pg / ml, about 7 pg / ml, about 7.5 pg / ml, about 8 pg / ml, about 8.5 pg / ml, about 9 pg / ml, about 9.5 pg / ml, or about 10 pg / ml), glucose (between 2 mM and 10 mM, e.g., about 2 mM, about 2,5 mM, about 3 mM, about 3.5 mM, about 4 mM, about 4.5 mM, about 5 mM, about 5.5 mM, about 6 mM, about 6.5 mM, about 7 mM, about 7.5 mM, about 8 mM, about 8.5 mM, about 9 mM, about 9.5 mM, or about 10 mM), Triiodothyronine (T3) (between 0.3 ng / mL and 1 ng / mL, e.g., about 0.3 ng / mL, about 0.4 ng / mL, about 0.5 ng / mL, about 0.6 ng / mL, about 0.65 ng / mL, about 0.7 ng / mL, about 0.8 ng / mL, about 0.9 ng / mL, about 1 ng / mL), Prolactin (PRL) (between 10 ng / mL and 30 ng / mL, e.g., about 10 ng / mL, about 15 ng / mL, about 20 ng / mL, about 23 ng / mL, about 25 ng / mL, about 28 ng / mL, about 30 ng / mL), IGF-I (between 1 ng / mL and 10 ng / mL, e.g., about 1 ng / mL, about 2 ng / mL, about 3 ng / mL, about 4 ng / mL, about 5 ng / mL, about 6 ng / mL, about 7 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL) or a combination thereof. In a specific embodiment, the medium comprises 10 ng / ml FGF-2, 100 pg / ml heparin, 0.1% human serum albumin, lOpg / ml human transferrin, 50pM Ethanolamine, 50pM Phosphoethanolamine, 6.7pg / ml sodium selenite, 5.5mM glucose, 0.65 ng / mL Triiodothyronine (T3), 23 ng / mL Prolactin (PRL), and 5 ng / mL IGF-I.
[00105] In some embodiments, the co-culturing is carried out on a matrix. The present disclosure identifies essential extracellular matrix components, i.e., laminin, entactin and collagen IV, which when used to culture reprogrammed endothelial cells results in the formation of stable and functional three-dimensional artificial vessels in vitro and in vivo without the use of pericytes, perfusion and cumbersome scaffolds. Therefore, in certain embodiments, the matrix is composed of extracellular matrix components, such as laminin, entactin and / or collagen.
[00106] In some embodiments, a matrix for use coculturing can include laminin and entactin at a combined concentration of at least about 5 mg / mL. As laminin and entactin can bind to each other and form a complex, a matrix for use in the present methods can include a complex of laminin and entactin. For example, the matrix can include at least 5 mg / mL of a complex of laminin and entactin. In an exemplary embodiment, the coculturing is carried out on a matrix including laminin and entactin at a combined concentration of at least 5 mg / mL, at least 6 mg / mL, at least 7 mg / mL, at least 8 mg / mL, at least 9 mg / mL, at least 10 mg / mL, at least 11 mg / mL, at least 12 mg / mL, at least 13 mg / mL, at least 14 mg / mL or at least 15 mg / mL. In specific embodiments, the matrix used in the present methods is composed of a combination of laminin, entactin and collagen IV (L.E.C.). For example, the coculturing can be carried out on a matrix containing at least about 5 mg / mL of laminin and entactin, and at least about 0.2 mg / mL collagen IV to form long-lasting, functional three-dimensional artificial blood vessels. In some embodiments, the L.E.C. matrix combination comprises at least 0.2 mg / mL, at least 0.3 mg / mL, at least 0.4 mg / mL, at least 0.5 mg / mL, at least 0.6 mg / mL, at least 0.7 mg / mL, at least 0.8 mg / mL, at least 0.9 mg / mL, or at least 1 mg / mL collagen IV. In a specific embodiment, the L.E.C. matrix is composed of between a combined concentration 9 mg / mL and 13 mg / mL of laminin and entactin, and between 0.2 mg / mL and 0.5 mg / mL of collagen IV. In a specific embodiment, the L.E.C. matrix is composed of laminin and entactin at a combined concentration of about 11 mg / mL and about 0.2 mg / mL collagen IV.
[00107] In some embodiments, the coculturing of the P-cells and the endothelial cell is performed in a bioreactor or a microfluidic device. In some embodiments, the microfluidic device is capable of transporting human blood or other specialized media, solutions, chemicals or biopharmaceutical drugs or reagents. In some embodiments, the coculturing of the P-cells and the endothelial cell is performed in a 3D gel. There is no requirement for any specific manner by which the P-cells and the EC cell are combined or mixed. The mixture of P-cells -EC can selfassemble into a 3D structure, i.e., the vascularized the P-cell organoid. See, also, Zhou Q, and Melton DA. Nature', 557(7705):351-8 (2018); Hebrok M. Cold Spring Harb Perspect Med', 2(6):a007674 (2012), incorporated herein by reference.
[00108] In some embodiments, the coculturing is done for at least 1 week, at least 10 days, at least 2 weeks, at least 18 days, at least 3 weeks, at least 24 days, at least 4 weeks, at least 32 days, at least 5 weeks, at least 38 days, at least 6 weeks, at least 45 days, at least 7 weeks, at least 52 days, at least 8 weeks, but not more than 4 months or not more than 3 months. In some embodiments, the coculturing is performed for about 3 weeks, about 24 days, about 4 weeks, about 32 days, about 5 weeks, about 38 days, about 6 weeks, about 45 days, about 7 weeks, about 52 days, or about 8 weeks.
[00109] In some embodiments, the P-cells and the endothelial cell can be cocultured for an additional period of time under conditions wherein the endothelial cell does not express the ETV2 transcription factor. In some embodiments, the P-cells and the endothelial cell are cocultured for an additional period of time under conditions wherein the expression of the ETV2 transcription factor in the endothelial cell is transient or reduced (turned down). In some embodiments, the additional period of time is at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, but no more than 18 days, not more than 16 days, or not more than 14 days.
[00110] In some embodiments, the P-cells and the endothelial cell are cocultured until a P-cell organoid with sufficient vascularization is achieved. In some embodiments, sufficient vascularization is measured by the fold increase in the amount of glucose-stimulated insulin secretion. In some embodiments, a vascularized P-cell organoid produces at least 2 folds, at least 3 folds, at least 4 folds, at least 5 folds more insulin in response to glucose as compared to a P-cell organoid that have not been vascularized (e.g., a P-cell organoid that was not cocultured with any other endothelial cell or a P-cell organoid cocultured with a wild type endothelial cell that does not express an exogenous nucleic acid encoding the ETV2 transcription factor). In some embodiments, increase in glucose-stimulated insulin secretion of a P-cell organoid is measured by incubating the organoid with low glucose (e.g., between about 1 mM and about 4 mM) to determine the basal insulin secretion, and then incubating the organoid with high glucose (about 16.7 mM) to determine the stimulated insulin secretion. Vascularized fl-cell organoid
[00111] In some embodiments, the vascularized P-cell organoids of the present disclosure comprise P-cells and vasculature formed by the endothelial cells expressing an exogenous nucleic acid encoding the ETV2 transcription factor. In some embodiments, the vascularization comprises the formation of an artery, a vein, a capillary, an arteriole, a venule, lymphatic vessels, or a combination thereof, within the pancreatic islet. In some embodiments, a vascularized P-cell organoid includes a network, a 2-dimensional or 3-dimensional network, of vascular vessles formed by the endothelial cells (“arborization of the P-cell organoid”).
[00112] In some embodiments, the vascularized P-cell organoid comprises P-cells and vasculature (blood vessels, e.g., arteries, veins) that allows delivery of nutrients to the pancreatic islet and that allows removal of the insulin produced by the pancreatic islet. In some embodiments, the vascularized P-cell organoid is functional in glucose sensing and insulin production in tissue culture (in vitro) or when administered to a host (in vivo). In some embodiments, the vasculature formed within a vascularized P-cell organoid in vitro is capable of connecting with host vessels in vivo and / or promoting further vascularization of the P-cell organoid in vivo. In some embodiments, the vascularized P-cell organoid can stay functional in glucose sensing and insulin production in vivo for an extended period of time. As used in, the phrase "extended period of time" refers to at least 2 weeks, at least 3 weeks, at least a month, at least 6 weeks, at least 2 months, at least 10 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 monhts or at least a year. Methods for Treating a Subject in Need by Administering Vascularized Pancreatic Islets
[00113] In another aspect, the disclosure is directed to a method of treating a subject in need comprising administering to the subject in need a vascularized pancreatic islet as described hereinabove. By “treating” it is meant to ameliorate or eliminate the severity of the symptoms (e.g., symtoms of diabetes), or reduce the risk or delay the onset of developing the disease (e.g., diabetes).
[00114] In some embodiments, the pancreatic islet is autologous to the recipient subject. In some embodiments, the pancreatic islet is allogeneic to the recipient subject; in some such embodiments, the pancreatic islet is genetically matched to the recipient subject.
[00115] In some embodiments, the administration of the vascularized pancreatic islet is achieved by subcutaneous transplantation, direct injection into endocrine organs, liver or other relevant organs. In some embodiments, the administration of the vascularized pancreatic islet is achieved by surgical or catheter implantation. In some embodiments, the administration of the vascularized pancreatic islet is achieved by infusion through an intravascular route.
[00116] In some aspects, the administered vascularized pancreatic islet is functional in vivo. As used herein, the term "functional" refers to an islet that can sense changes in blood sugar and release insulin into bloodstream in response to an increase in blood glucose levels to result in normoglycemia (normal blood glucose levels). In some embodiments, the vasculature formed within a vascularized pancreatic islet in vitro connects with host vessels in vivo and / or promoting further vascularization of the islet in vivo. In some embodiments, the administered vascularized pancreatic islet remains engrafted and functional for at least 2 weeks, at least 3 weeks, at least a month, at least 6 weeks, at least 2 months, at least 10 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 monhts or at least a year. Methods for Treating a Subject in Need by Administering Vascularized P-cell organoids
[00117] In another aspect, the disclosure is directed to a method of treating a subject in needs comprising administering to the subject in need a vascularized P-cell organoid as described hereinabove.
[00118] In some embodiments, the P-cells used in the present methods to make vascularized P-cell organoids are autologous to the recipient subject. In some embodiments, the P-cells are allogeneic to the recipient subject; in some such embodiments, the P-cells are genetically matched to the recipient subject.
[00119] In some embodiments, the administration of the vascularized P-cell organoid is achieved by subcutaneous transplantation, direct injection into endocrine organs, liver or other relevant organs. In some embodiments, the administration of the vascularized P-cell organoid is achieved by surgical or catheter implantation. In some embodiments, the administration of the vascularized P-cell organoid is achieved by infusion through an intravascular route.
[00120] In some aspects, the administered vascularized P-cell organoid is functional in vivo. As used herein, the term "functional" refers to P-cell organoid that can sense changes in blood sugar and release insulin into bloodstream in response to an increase in blood glucose levels to result in normoglycemia (normal blood glucose levels). In some embodiments, the vasculature formed within a vascularized pancreatic islet in vitro connects with host vessels in vivo and / or promoting further vascularization of the P-cell organoid in vivo. In some embodiments, the administered vascularized P-cell organoid remains engrafted and functional for at least 2 weeks, at least 3 weeks, at least a month, at least 6 weeks, at least 2 months, at least 10 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 monhts or at least a year.
[00121] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.
[00122] The present methods are further supported and illustrated by the following non-limiting examples. EXAMPLES Example 1
[00123] Previous reports have studied co-culture of ECs with P cells (Kao DI et al., Stem cell repor / s;4(2):181-9, (2015); Rutter GA et al., Biochem J;466(2):203-18, (2015); Nikolova G et al., Dev CeZZ; 10(3):397-405, (2006); Lammert E et al., Meeh Dev, 120(1):59-64, (2003)). However, these studies used generic adult ECs, and attempts to vascularize purified whole islets in vitro were not successful, with the majority of the P-cells within the islets dying. This suboptimal outcome is likely due to the use of generic mature adult human ECs, which lack the capacity to establish long-lasting islet-specific EC niche. In addition, adult human non-islet ECs lack the potential to arborize or interact with purified human islet cells, to sustain their survival and functionality. This in vitro deficiency of generic ECs could lead to a more profound impaired function of the islets as these adult ECs do not form durable long-lasting vessels that can anastomose to the pre-existing vessels. To generate a malleable endothelial vascular niche in vitro from the adult ECs is a major challenge in that mature adult ECs, because autologous or genetically matched adipose ECs, lack the capacity to establish long-lasting lumenized capillaries. Moreover, these ECs fail to adapt to various organotypic niches, such as intra-islet that are introduced into. R-VECs could also establish interconnected vascular network within a large volume 15 microliters of microfluidic devices that can transport full compliment of human peripheral blood containing innate and immune cells. This will enable assessment of autoimmunity to islet cells as well.
[00124] The inventors have discovered that introducing the transcription factor ETV2 into adult human autologous or genetically matched allogeneic ECs converts these ECs into adaptable durable reprogrammed, or reset ECs (R-VECs) for tissue-specific organogenesis. The inventors have shown in three-dimensional (3D) cultures of reprogrammed or reset vascular ECs (R-VECs) in defined extracellular matrix (composed of Laminin, entactin, Collagen, LEC) can readily vascularize commercially procured human islets. Employing these malleable R-VECs, the inventors also show that interaction of R-VECs improve their insulin secretion by the P-cells in response to glucose elevation.
[00125] In short, the inventors have developed a technology to manufacture adult human adaptable, durable and hemodynamic ally ECs that can vascularize human islets with high efficiency. This was enabled by the transient expression of the embryonic restricted ETS-transcription factor ETV2 along with defined extracellular matrix, molecularly and structurally "reset" adult human tissue-specific mature ECs to adaptable vascular ECs (R-VECs). As Matrigel cannot be used in patients, the inventors identified the minimum components of extracellular matrix, Laminin-Entactin-CollagenIV (LEC) that enable long-lasting tubulogenesis of R-VECs and encapsulation with islets for transplantation.
[00126] These malleable and durable as well as adaptable R-VECs are capable of remodeling into long-lasting functional compliant as well as perfusable vascular network that last for more than 8 weeks. Importantly, during 3D co-culture, R-VECs efficiently arborized human islet during 3D co-culture microfluidic devices in about a week, when CTRL-ECs had little interaction with human islets. By examining the islet function as glucose stimulated insulin secretion (GSIS), the inventors found that R-VECs not only physically interact with islet cells but also actively improve islet function, with beneficial effects lasting for at least 2 weeks. In the large volume microfluidic devices, R-VEC vascularized human islet could sense glucose and produce insulin at the outlet. This enables assessing and augmenting the functionality of the procured islets as well as set the stage for implantation in vivo for treatment of diabetes. Example 2: ETV2 enables self-assembly of ECs into long-lasting, stable patterned human vessels in vitro
[00127] Mature post-natal and adult human ECs organize into nascent vascular networks in Matrigel in vitro or in vivo, yet these vessels are not stable, lack a sustainable large pore lumen in vitro, have limited remodeling potential, and regress within a few days. In addition, organ-on-chip or vascular scaffolding approaches often require separation by layer(s) of semipermeable synthetic biomaterials impairing intimate physical cell-cell interaction between EC and non-vascular cells, thereby impeding cell-contact dependent co-adaptive EC remodeling (Huh, D. et al., Science 328, 1662-1668, (2010); Blundell, C. et al., Lab Chip 16, 3065-3073, (2016)). Moreover, mature naive ECs fail to self-assemble into extended vascular networks in large perfusion microfluidic chambers, limiting their vascular plexus volume to approximately 2 microliters (Chen, M. B. et al., Nat Protoc 12, 865-880, (2017); Campisi, M. et al., Biomaterials 180, 117-129, (2018); Phan, D. T. T. et al., Lab Chip 17, 511-520, (2017)). The inventors hypothesized that enforced re-expression of ETV2 in mature human ECs will enable these cells to develop durability and patterning plasticity to form 3D vessels, as well as acquire enhanced cellular affinity and adaptability for non-vascular cells in vitro and in vivo.
[00128] Indeed, ETV2 expressing human ECs (Reset-VECs, R-VECs) transitioned into 3D vessels through three stages (FIG. 1A). At the first induction stage (days 1-14), ETV2 upregulates vasculogenic and tubulogenic factors. During the 2nd remodeling stage (days 14-21) rd the R-VECs self-assemble into organized geometrically patterned lumenized vessels. At the 3 stabilization stage, R-VECs are no longer motile or proliferative and transition into durable and adaptable vessels. In contrast, naive human ECs were unable to transition through these stages to form durable vessels, even when different standard medium formulations (e.g., Stem Span, EGM2 or EC media) were used.
[00129] Human umbilical vein EC (HUVECs) expressing ETV2 showed a 50 fold increase in vessel area formation over 8 weeks (FIGS. 1B-1C). This capacity for ETV2 to induce R-VECs was not restricted to HUVECs. All tissue-specific adult human mature EC populations isolated from adipose, cardiac, aortic, and dermal tissues (purified from human subjects ages 4 to 50+) transduced with ETV2, gave rise to R-VECs with consistently durable branched vascular networks (FIGS. ID-IE). The inventors were able to maintain patterned R-VEC vessels in vitro for over 16 weeks (FIG. IF). Proper lumen formation is required for functional 3D vessels. Confocal microscopy indicated that R-VECs formed continuous uninterrupted network of vessels. These capillary-like large bore tubes manifested proper polarization with podocalyxin expressed on the apical side and laminin on the basal side (FIG. 1G).
[00130] Atomic force microscopy (AFM) is an ideal tool to assess the structural stiffness of the R-VECs. Both stage 1 induction adult adipose ECs and HUVECs transduced with ETV2 were less stiff than the control non-ETV2 transduced cells, a property that is necessary for lumen formation during vasculogenesis. Furthermore, although smooth muscle cells are not essential for R-VEC lumen formation, these perivascular cells can be readily recruited to the R-VEC generated vessels, when introduced during the stabilization stage. Therefore, R-VECs selforganize into vessels that phenocopy the 3D structure of lumenized capillaries.
[00131] As EC proliferation can modulate the degree of lumen formation, the inventors also measured cell proliferation over time by EdU labeling. When grown in flat two dimensional (2D) cultures, control and stage 1 induction phase ETV2-transduced ECs proliferated at similar rates. During the stage 2 remodeling phase, control ECs underwent proliferation at a faster rate than R-VECs. At the stage 3 stabilization phase, R-VECs reached homeostasis and EC turnover was much lower than in 2D cultures.
[00132] To determine whether the capacity of ETV2 transduced human ECs to spontaneously self-assemble into lumenized tubes is a common attribute of other ETS-family of transcription factors, the inventors transduced human ECs with another ETS transcription factor, ETS1, that plays a major role in capillary development. Moreover, to examine whether ETV2 primarily confers vascular functions by increasing the survival of ECs, the inventors transduced mature human ECs with constitutively active myristoylated-AKTl (myrAKT1). Neither ETS1 nor myrAKT1 activation drove the generation of durable vessels as ETV2 did. Thus, ETV2 uniquely confers adult human ECs with the capacity to self-assemble into durable patterned large bore vessels without the constraints of artificial scaffolds, pericyte coverage, or enforced shear stress.
[00133] The inventors set to resolve whether ETV2 expression levels influenced the efficient generation of lumenized vessels. R-VEC single cell clones at stage 1 induction phase were isolated by FACS and mRNA abundance measured by qRT-PCR. The inventors divided the clones into low-ETV2, mid-ETV2 and high-ETV2 expression patterns based on ETV2 mRNA levels during the stage 1 induction phase. ETV2 RNA levels tightly correlated with ETV2 protein levels. The clones with mid-ETV2 levels gave rise to vessels of significantly higher density and stability. Next, the inventors quantified the ETV2 mRNA and protein levels over time in heterogeneous non-clonal generated R-VECs. ETV2 protein levels peaked during the stage 2 remodeling phase. Subsequently, ETV2 protein levels were downregulated by over 90% during the stage 3 stabilization phase, as compared to the stage 1 induction phase. ETV2 protein levels were restored by six-fold in the presence of a proteasome inhibitor (MG132), indicating post-translational modifications, such as ubiquitination, play a role in downregulating ETV2 protein levels over time. Thus, ETV2 induces R-VEC formation, but only low levels of ETV2 were detected once the vessels were stabilized. This observation raised the notion that transient ETV2 expression might be sufficient to initiate and sustain lumenized R-VECs.
[00134] To test this possibility, the inventors used a reverse tet-transactivator (rtTA)-doxycycline (dox) inducible system, where the presence of doxycycline induces ETV2 expression (hereafter referred to as iR-VECs). The inducible system was tested to be efficiently turned off, with both ETV2 mRNA and protein levels successfully downregulated upon doxycycline removal. ETV2 was expressed for two weeks by doxycycline supplementation during the stage 1 induction and iR-VEC cells were then allowed to form networks during vessel formation assay. Next, doxycycline was removed at different time points: day 0 (onset of stage 2 remodeling phase), 1 week after the initiation of stage 2 remodeling phase, or 4 weeks after the initiation of stage 2 remodeling phase. Notably, ETV2 expression was required for only a minimum of 1 week after the start of the stage 2 remodeling stage, to enable the formation of lumenized stage 3 stable vessels, and was dispensable thereafter. Indeed, iR-VECs sustain their vascular stability even after ETV2 is shut down as shown by both vessel quantification and electron microscopy. Example 3: R-VECs form vessels in a defined matrix of Laminin, Entactin, CollagenIV (L.E.C)
[00135] Current approaches for in vitro vascular patterning and organoid formation require the use of a crude preparation of extracellular matrix, such as Matrigel. Matrigel contains numerous digested matrix components rendering it difficult to isolate factors regulating durable vessel formation or their interaction with organoid cellular components. By screening numerous combinations of vascular extracellular matrices, the inventors identified a stoichiometrically defined matrix of Laminin, Entactin, and CollagenIV (L.E.C) that is sufficient for the selfassembly of stable lumenized ETV2-driven vessels similar to those formed when using Matrigel. Notably, control naive human ECs did not form stable vessel networks on L.E.C. R-VEC vessels generated on both L.E.C and Matrigel showed similar durable vessel area and branching to 8 weeks (FIG. 1H). Electron microscopy revealed that stage 3 R-VECs formed vessels with open patent lumens and tight junctions on both L.E.C. and Matrigel (FIG. II). A neutralizing antibody against the integrin ITG^l abrogated vessel formation in L.E.C, indicating that interaction of integrins expressed on R-VECs with the L.E.C matrix is important for tube formation. Employing defined matrix components could facilitate identification of the perivascular interactions with adhesion molecules and chemokines that regulate tubulogenesis. Example 4: R-VECs self-organize into stable lumenized and perfusable vessels in large volume microfluidic devices that sustain hemodynamic laminar flow of whole human peripheral blood.
[00136] Perfusion capacity and the ability of R-VEC vessels to sustain laminar flow were tested Q by seeding the cells in a 3x1x1 millimeter microfluidic device with a volume of 3 microliters (FIG. 1J). Within 3 to 5 days, R-VECs organized and self-assembled into lumenized vessels while control cells failed to generate vessels (FIG. IK). Once a vessel network was fully established, by day 6, the inventors cycled mCherry-labeled beads (4pm) through the inlet and the R-VEC vessels enabled the flow of the beads into the outlet channel of the device. The inventors did not observe flow of beads across the channels with control non-ETV2 transduced ECs (FIG. IK).
[00137] In anticipation of accommodating relatively large organoids and tissue explants, such as pancreatic islets or epithelial and tumor organoids, the inventors designed a microfluidic device Q with a larger perfusion chamber size of 5x3x1 millimeters (15 microliters total volume), capable of accommodating >60,000 stage 1 R-VECs within a fibrin gel matrix. After 1 to 3 days of implantation into the device, R-VECs self-assembled into continuous and extensive multilayered and patterned vascular plexus spanning >3 millimeters connecting the inlet channel to the outlet channel of the device (FIG. IL).
[00138] Notably, the R-VEC vessels self-organized into hemodynamic ally stable vessels enabling the transit of heparinized whole human peripheral blood, (freshly obtained through phlebotomy), containing the full complement of white and red blood cells as well as platelets and intact plasma (FIG. IM). During perfusion of whole blood cells, R-VEC capillary network remained patent and manifested minimal leakiness to RBC, platelets and WBC allowing the homogenous flow of blood from inlet to the outlet of the microfluidic chamber. Thus, R-VECs self-assemble into a continuous capillary network capable of sustaining hemodynamic ally microfluidic perfusion in large volume vascular chamber without the requirement for perivascular support, the limiting confines of artificial scaffolds or supraphysiological use of angiogenic growth factors. Example 5: R-VEC vessels form stable long-lasting functional vessels in in vivo plug implants
[00139] To assess whether R-VECs could sustain functional patterned vessels in vivo, SCID-beige mice were implanted subcutaneously with mCherry or GFP-labeled control human ECs or R-VECs suspended in L.E.C matrix. One to five months post implantation, the degree of vessel persistence of R-VEC or human adipose R-VEC, and anastomosis to the pre-existing murine circulation was assessed by anti-human VEcadherin (VEcad) antibody intravital staining (FIG. 2A-2C). R-VEC loaded plugs were visibly more vascularized than control non-ETV2 cell plugs (FIG. 2B). Both whole mount confocal pictures and post sectioning of the plugs, revealed much higher vessel lumen area, organization and patterning in the R-VEC implanted plugs as compared to control non-ETV2 EC plugs (FIG. 2C-2D). Human vessel area was significantly higher in R-VEC plugs than control EC plugs at all time-points (n=3 mice / group per time point) (FIG. 2D).
[00140] In addition, intravital injection of mice with an antibody directed to human VEcad showed that R-VEC vessels anastomose to the Endomucin+ mouse vasculature, establishing mosaic perfused vessels throughout the plug (FIG. 2E). R-VEC vessels were invested by mouse perivascular supporting cells as revealed by post-staining with anti-mouse smooth muscle and pericyte specific antibodies (FIG. 2F). Differential smooth muscle coverage in vivo indicated vessel hierarchy in R-VEC vessels, with larger arterioles covered with a thicker layer of smooth muscle cells and less coverage in smaller capillaries (FIG. 2F). Consistent with in vitro experiments, iR-VECs also assembled into stable vessels in L.E.C, and one week of doxycycline in vivo was sufficient to retain vascular stability (representative images of n=3-4 mice / group) (FIG. 2G-2H). R-VEC and iR-VEC vessels in in vivo plugs were also shown to be non leaky and patent when injected intravenously with dextran (MW 70 kDa). As a control, the inventors also transduced human naive ECs with K-RAS that form prototypical leaky and disorganized tumorlike vessels. In sharp contrast to R-VECs, K-RAS transduced human ECs formed vessels reminiscent of hemangiomas, manifesting leakiness and a disorganized structure.
[00141] To rule out the possibility that ETV2 could instigate the emergence of hemangiomas, metastatic or vascular malformations, the inventors implanted R-VECs in immunocompromised SCID-Beige mice for 10 months and analyzed the plugs and organs of the mice for any evidence of tumors or metastatic lesions. R-VEC plugs retrieved 10 months post implantation did not manifest aberrant growth over time and appeared normal, while also retaining R-VEC perfused localized and well organized vessel structures. No hemangiomas or tumors were observed in R-VEC plugs at 10 months by H&E and Masson stainings, in contrast to K-RAS plugs which formed aberrant and disorganized structures. No tumors, metastatic lesions or abnormalities were present in any of the other examined organs of mice that were implanted with R-VEC s for 10 months.
[00142] The H&E sections from R-VEC, myrAktl, K-RAS and ETS1 plugs were impartially assessed for any potential malignant features. R-VEC vessels were assessed to establish normal vascularized and patterned capillary structures. By contrast, myrAktl ECs were noted to have formed engorged and disorganized vessels, representing a capillary hemangioma. K-RAS ECs appear to have formed typical hemangiomas, with the features of sarcomatoid tumors. ETS1-transduced ECs were assessed to have linear capillary structures, but that lack a lumen. Therefore, R-VECs form durable structurally normal and anastomosed vessels without vascular anomalies or tumors in the interrogated time period of 10 months. Example 6: ETV2 mediates vessel formation through chromatin remodeling and transcriptional regulation
[00143] Next, to uncover the mechanism by which ETV2 expression induces long-lasting patterned lumenized vessel formation, the inventors performed RNA sequencing (RNA-seq) analysis of human naive ECs without and with ETV2 transduction at the stage 1 induction phase (n=4) (FIGS. 3A-3B). Gene ontology (GO) analyses revealed upregulation of genes in pathways regulating angiogenesis, positive regulation of GTPase activity, extracellular matrix organization and response to mechanical stimulus (FIGS. 3A-3B). During the stage 1 induction phase, R-VECs maintain their vascular identity by sustaining the expression of EC specific markers, including VEcad, CD31 (PECAM1) and VEGFR2 (KDR). Upon ETV2 induction, a group of 490 genes was differentially expressed among various tissue-specific adult human EC, including cardiac, dermal, aortic and adipose-derived R-VECs.
[00144] The inventors performed ETV2 chromatin immunoprecipitation (ChIP) sequencing (ChlP-seq) analysis on R-VECs during the stage 1 induction phase. The inventors also performed ChlP-seq analysis of transcription activation-associated trimethylation on histone H3 lysine 4 (K4me3), acetylation on histone H3 lysine 27 (K27ac) and transcription repression-associated trimethylation on histone H3 lysine 27 (K27me3) on both R-VECs and control ECs (CTRL-ECs) (FIGS. 3B-3C). ChlP-seq analysis revealed binding of ETV2 to promoters of several differentially expressed genes in R-VECs, and to the promoters of genes in numerous pro-tubulogenesis pathways that are silenced in mature ECs (FIGS. 3B-3C). Therefore, ETV2 resets the chromatin and transcriptome of mature ECs with direct re-activation of tubulogenesis and angiogenesis genes during the induction phase in R-VECs. Example 7: Rapl activation is essential for ETV2-mediated tube formation in R-VECs
[00145] A cluster of genes involved in the activation of the small GTPase Rapl, was robustly upregulated in stage 1 induction R-VECs as shown by GO analysis (FIG. 3A-3B). Upon ETV2 induction, three GEFs (RASGRP2, RASGRP3, RAPGEF5) and RASIP1, were also significantly upregulated (FIG. 3D). ChlP-seq and ChlP-qPCR analyses confirmed direct binding of ETV2 to promoters of RASGRP3 and RASIP1, and subsequent increase in K4me3 and K27ac at these genes (FIG. 3C). Western Blot analysis confirmed that levels of RASGRP3 correlate with levels of ETV2 in R-VECs. R-VECs also express higher levels of the RASGRP3 protein, when compared to control, ETS1 transduced, or myrAKTl-transduced ECs.
[00146] Rapl activation has been shown to be crucial for lumen formation in development for both aorta and vascular plexus formation47’53’54. Similar differentially expressed genes in the Rapl pathway, were found in other adult human tissue-specific ECs upon ETV2 overexpression, as well as in ETV2 positive FACS sorted ECs isolated from ETV2-venus reporter mouse embryos at Embryonic stage of 9.5 (E9.5). A pull down of active Rapl-GTP during the stage 1 induction phase, showed a higher level of active Rapl-GTP in R-VECs compared to naive ECs (n=5) (FIG. 3E-3F). Vessel formation was significantly reduced and no lumen was present following treatment with Rapl inhibitor GGTI298 (FIG. 3G-3H). Likewise, knockdown of RASGRP3 by shRNA resulted in significant disruption of R-VEC mediated vessel formation (FIG. 3I-3J). Therefore, ETV2 potentiates vessel and lumen formation in part through upregulation of Rap 1 GEFs. d Example 8: R-VECs undergo a stage-specific transcriptional expression pattern
[00147] In addition to the aforementioned genes turned on during the R-VECs stage 1 induction phase, R-VECs undergo a dynamic transcriptional expression as they transition from 2D cultures to 3D vessels in the induction-remodeling-stabilization stages (FIG. 3K). Notably, as the R-VEC vessels reached their final stable patterning they acquire transcriptional signatures similar to freshly isolated ECs, when compared to in vitro cultured ECs. In the stage 3 stabilization phase, R-VECs upregulate genes involved in mechanosensing (PIEZO2, KLF2, and KLF4) and EC remodeling (ATES') that are lost upon culture of mature ECs in vitro (FIG. 3K), therefore 3D stable R-VEC vessels at stage 3 behave similarly to physiological vessels in vivo. This was further confirmed by isolating R-VECs from in vivo plugs and comparing their transcriptome to freshly isolated HUVECs and R-VEC stage 3 stable vessels. Notably, stage 3 differentially expressed genes in 3D vessels, such as PIEZO2, KLF2 and KLF4 were found to already be bound and epigenetically primed for expression by ETV2 during stage 1 induction. Thus, ETV2 resets the chromatin purview of mature ECs during the induction phase into a configuration that is pro-tubulogenic and potentially more reminiscent of generic ECs that could be reset in response to extrinsic signals. This is borne out in studies in which R-VECs are challenged to respond to various microenvironmental cues for remodeling and tubulogenesis as described in the following sections. Example 9: R-VECs vascularize decellularized tissue scaffolds
[00148] Great progress has been made towards decellularizing organs into extracellular matrix scaffolds that can be recellularized and transplanted into patients. During the decellularization procedure, osmotic pressure and detergent can remove the cellular matter in a variety of tissues leaving sheaths of matrix intact that support parenchymal tissue as well as stroma, small capillaries and larger vascular structures. Despite recent advances in this technology, the generation of long-lasting functional vessels, especially the small caliber capillaries, for the vascularization of decellularized scaffolds has been challenging. Specifically, while large caliber vessels in the decellularized scaffolds could be colonized with ECs, it is difficult to arborize the smaller capillary size vessels, which are crucial for cell survival and functional specialization.
[00149] To address this issue, the inventors introduced stage 1 induction generated R-VECs in a decellularized intestinal model where they were able to re-establish the vasculature in a decellularized rat intestine bioreactor ex vivo (FIG. 4A-4G). Notably, R-VECs profusely populated the small capillaries of the decellularized intestine (FIG. 4D). Staining with a CD31 antibody, revealed a much higher vascular coating when using R-VECs or iR-VECs compared to non-ETV2 transduced ECs (CTRL-ECs) (FIG. 4E-4G) (n=3 scaffolds per condition). Notably, as compared to CTRL-ECs that transiently coated larger caliber vessels, R-VECs and iR-VECs colonized the narrow small capillaries evenly throughout the decellularized scaffolds.
[00150] After 1 week ex vivo culture, the re-vascularized intestinal explants were implanted in the omentum of immunocompromised mice. R-VEC vascularized scaffolds retained their patency and anastomosed to the mouse vasculature as shown by intravital anti-human VEcad staining at both 1 and 4 weeks (FIGS. 4H-4I). Quantification of the frequency of human ECs, revealed that R-VEC vessels persisted at a significantly higher rate in vivo than CTRL-ECs through a 4 week time point, and this persistence was in part due to their integrity and lower rate of apoptosis (FIG. 4J-4K). Example 10: Physiological R-VEC vascularization of human pancreatic islet explants
[00151] R-VECs, but not CTRL-ECs, also arborize human pancreatic islet explants procured from cadaveric samples obtained from commercial sources (FIGS. 5A-5E). Intact pancreatic islets (200 islets / experiment), 4 days post procurement, were co-cultured with R-VECs (250,000 cells) or CTRL-ECs (250,000 cells) in large 50 microliter Matrigel static domes. Notably, stage 2 R-VECs rapidly arborized pancreatic islets within 24 hours of co-culture and this arborization extended to at least two weeks (FIG. 5A). The functionality of the human islets was investigated through the glucose stimulated insulin secretion (GSIS) test two weeks after 25 islets were cultured alone, or co-cultured with CTRL-EC or R-VEC (n=3 independent deceased subjects) (FIG. 5B). Insulin response upon high glucose stimulation was significantly higher when islets were co-cultured with R-VECs, than in the other conditions. Interacting vessel area with human islets was also quantified to be higher in R-VEC co-cultures compared to CTRL-EC, with R-VEC vessels sprouting deeply into the human islets (FIGS. 5C-5E).
[00152] As native pancreatic islets in vivo are abundantly vascularized to perform glucose sensing and insulin secretion activities, the inventors embarked upon assessing whether R-VECs could enable physiological perfusion of the pancreatic islet explants in vitro. Current available devices are often limited by a height of up 150 microns, which would render implantation of islets with average diameter size of 250 micron impractical. Other Organ-on-Chip devices contain artificial membranes separating the endothelial cells from other cell types, which significantly hinder their physical interaction and crosstalk. To this end, the inventors employed Q the large size chamber of 5x3x1 millimeter (volume 15 microliters) micro fluidic device described in FIG. 1 J, allowing us to accommodate more than >40 intact human pancreatic islets, intermingled with 60,000 R-VECs. The ability to accommodate and vascularize these relatively bulky islets in large volume microfluidic devices is essential to monitor and quantify their physiological functionality, and was enabled by the R-VECs capability to self-assemble into continuous and lumenized vascular networks (FIG. 5F).
[00153] On average, within one to three days of co-implantation of R-VECs with human pancreatic islets, the majority of the islets in the microfluidic device were arborized with R-VECs (FIGS. 5G-5H). To assess the hemodynamic stability of the vessels co-opting the islets, the inventors infused undiluted heparinized complete whole human peripheral blood, (obtained from a fresh phlebotomy), as described in FIG. IM, through the inlet of the microfluidic device (FIGS. 5F-5G). Throughout the device, hematopoietic cells could be observed crisscrossing R-VEC vessels that arborized or delved deep into human islets. This was in stark contrast to lack of perfusion of fluorescently labeled blood cells in the devices, which were implanted with islets alone (without ECs) or with islets with CTRL-EC (FIGS. 5G-5I). In addition, intravital injection of fluorescent-conjugated antibody to VE-cadherin through the inlet of the microfluidic device demonstrated that almost all of the vessels vascularizing the EpCAM+Insulin+ islets were perfusable and capable of transporting blood and fluids (FIGS. 5J-5K). Thus, R-VEC vessels can not only self-organize into an extensive continuous hemodynamically stable network, but also co-op and vascularize intact islets.
[00154] Next, to demonstrate that R-VEC vessels are capable of physiological vascularization of the islets, the inventors performed a glucose stimulation test by infusion of glucose through the inlet of the microfluidic vascular chamber (FIG. 5L). Human islets co-cultured with R-VECs properly detected and responded to high levels of glucose by secreting insulin, as measured at the outlet at 9 and 24 minutes (n=3 independent deceased subjects) (FIG. 5M). On average, the inventors detected a 7-fold increase in the production of insulin upon glucose stimulation (FIG. 5M-5N). Those microfluidic chambers containing human islets alone or islets with CTRL-ECs showed very low insulin production at the outlet, indicating that there is minimal functional vascularization or interstitial convection transfer of fluid (FIGS. 5M-5N). Thus, ETV2 enables ECs to physiologically perfuse islet explants forming cross-interactive vascular plexus sustaining the functionality of the human insulin-producing beta cells. Example 11: R-VECs efficiently arborize tissue-specific organoids
[00155] The inventors also interrogated the potential of R-VECs to arborize mouse and human normal or malignant epithelial organoid cultures with the goal of developing physiological organogenesis and disease models. This approach will also enable to uncover the potential tissue- and tumor- specific adaptive responses of R-VECs. Human normal colon organoids established from patient biopsies, were mixed with either CTRL-ECs or stage 1 induction phase R-VECs in 6 mm diameter static matrix domes, establishing a total volume of 50 microliters. R-VECs were able to remodel into highly organized interconnected vessels and associated with colon epithelial cells throughout the 50 microliter matrix dome, while CTRL-ECs were unable to form stable vessels in the presence of the organoids (FIGS. 6A-6C). At day 8, human colon organoids had a significantly higher frequency of EdU+ proliferating cells and an increase in number and size when co-cultured with R-VECs than with CTRL-EC or without ECs (FIGS. 6D-6F).
[00156] Human colon organoids were also stained for goblet cells by MUC2 and there was a decrease in staining intensity of individual organoids co-cultured with R-VEC compared to organoids co-cultured with CTRL-EC or alone. There was no significant difference by qRT-PCR of various differentiation and stem and progenitor markers in the human colon organoids cultured across all three co-culture conditions (n=5 independent experiments). However, qRT- PCR revealed a trend towards Ngn3 upregulation and decrease of MUC2 levels upon co-culture with R-VECs indicating a tipping of the balance and trend towards an endocrine progenitor fate, rather than goblet cell differentiation of the human colon organoids. Thus, R-VECs, most likely through the release of paracrine factors, sustain the proliferation and integrity of the human normal colon organoids, while overall maintaining their differentiation state potential.
[00157] Vessel area was significantly higher in R-VEC wells compared to CTRL-EC and direct interaction of both R-VECs and CTRL-ECs with human normal colon organoids in L.E.C. was further assessed in a time-lapse movie through multi-zonal confocal microscopy (FIG. 6F). The intimate interaction between the R-VEC vessels with each organoid was followed over 72 hours in 3D 150 pm z-stacks. To compare CTRL-ECs to R-VECs co-cultures, the inventors performed a projection of z-stack confocal images and quantified the extent of interacting vessel networks with organoids, by a custom MATLAB code written to track the area of vessel networks that were recruited and interacted with the organoids over time (FIG. 6H). R-VECs were quantified to cover a significant larger surface area of epithelial cells, co-opting organoids in a web of interconnected vascular networks. The inventors also demonstrated that R-VECs avidly seek out and arborize mouse small intestinal organoids. Vessel area and number of endothelial sprouts interacting with the organoids were significantly higher when using R-VECs compared to CTRL-ECs.
[00158] Next, the inventors explored the potential of R-VECs to physiologically vascularize human colon organoids in a large volume 15 microliter microfluidic device (FIGS. 6L6J). The inventors found that R-VECs self-assembled into an interconnected multi-layered vessel network that spanned the entire 15 microliter volume of the microfluidic device, while intimately interacting with the colon organoids. The patency and perfusibility of the R-VEC vessels in coculture with the colon organoids was demonstrated by injection of fluorescently-labeled VEcad antibody in the inlet of the device, which was able to stain the whole vessel network throughout the device. Lumen patency was further confirmed by flowing fluorescently labeled microbeads (FIGS. 6I-6J). Example 12: R-VECs avidly co-opt and adapt to tumor organoids
[00159] Endothelial cells recruited to tumor vascular beds often form structurally and functionally abnormal capillaries. In turn, corrupted tumor ECs supply aberrant factors that promote tumor growth. To determine whether R-VECs can acquire maladapted features of tumor vessels, the inventors co-cultured stage 1 induction R-VECs with patient-derived colorectal tumor organoids (FIG. 7A-7C). Within 24 hours, R-VECs migrated and arborized the tumor organoids. Over eight days, all organoids were arborized with dense populations of R-VEC vessels, while CTRL-ECs were unable to do so (FIG. 7A). Staining for the epithelial marker EpCAM, revealed the intimate cell-cell interactions between the tumor colon organoid cells and the R-VECs (FIGS. 7B-7C). Quantification of tumor cells showed a significantly higher percentage of EdU+ proliferating tumor cells in the R-VEC co-cultures (FIG. 7D).
[00160] The dynamic interaction of CTRL-ECs and R-VECs with tumor organoids in 3D matrices, in both Matrigel and laminin-entactin-collagen IV (L.E.C) matrix, was assessed through multi-zonal confocal microscopy, performing live cell imaging of 150 pm z-stack movies over 78 hours. Using the z-projection images and a custom MATLAB code, the inventors quantified the area of interconnected vessel networks that co-opted the tumor organoids for both CTRL-ECs and R-VECs. Similar to normal colon organoids, the interaction of R-VECs with colon tumoroids was significantly higher than that of CTRL-EC in both Matrigel and the L.E.C matrix (FIG. 7E). The vessel area was also higher in the R-VEC cocultures as compared to naive non-ETV2 transduced co-culture wells (FIG. 7F). Other patient derived-tumor organoids, including triple negative breast tumors, yielded similar results.
[00161] Next, the inventors assessed whether R-VECs could sustain humanized tumor vascularization in vivo, stage 1 induction mCherry-labeled R-VECs or CTRL-ECs were comingled with colon-tumor organoids (GFP-labeled) and implanted subcutaneously in SCID-Beige mice and sacrificed after 5 months. R-VECs, unlike CTRL-EC, persisted and sustained their vascular network patterning and vascularization within the growing tumor colon organoids (FIGS. 7G-7I). R-VECs anastomosed to the mouse circulation, establishing mosaic vessels with the Endomucin+ painted mouse ECs (FIG. 7G). The vessel coverage of the tumor mass by human ECs, was augmented in the presence of R-VECs compared to those co-mingled with CTRL-EC (FIG. 71). Therefore, R-VECs are empowered with adaptive capacity to respond to signals from tumoroids and instructively arborize tumor organoids both in vitro and in vivo. This approach could allow for deciphering the mechanism by which tumor ECs acquire their aberrant tumor vasculature features. Example 13: Single cell transcriptomics reveals differential adaptability of R-VEC to crosstalk with normal or tumor organoids
[00162] Study of the cross-talk between ECs and organoids has so far been cumbersome due to limited vascular integrity of CTRL-EC in 3D cultures. To this end, the inventors embarked upon harnessing the potential of large numbers of R-VECs to sustain their 3D vascular integrity over time, and assessed their capacity to respond to the microenvironmental signals, when in coculture with various normal and malignant organoids. Indeed, the reciprocal responsive and adaptive remodeling of the R-VECs with organoids observed in FIG. 6 and FIG. 7, indicates intimate cross-communication among these cell types. To investigate the molecular profile of this interaction, the inventors performed transcriptomic analyses on the 3D co-cultures of R-VECs with normal or malignant colon and alterations in the RNA expression profile were compared to R-VECs cultured alone in 3D matrix.
[00163] After 7 days of co-culture, the whole population of R-VECs cultured alone and those co-cultured with accompanying normal or malignant colon cells were isolated and subjected to single cell RNA-sequencing (scRNA-seq) using 10X Chromium platform (FIG. 8A-8H). Endothelial and epithelial cell clusters were identified in the merged samples. The ECs were identified by focusing on single cells expressing vascular specific markers, VEcadherin (CDH5), CD31 (PECAM1) and VEGFR2 (KDR) and the epithelial cells were identified by the expression of the epithelial markers EpCAM, CDH1 and KRT19.
[00164] In the endothelial cell fraction, those R-VECs co-cultured with malignant or normal organoids, as compared to R-VECs alone, manifested significant changes in their clustering patterns and gene expression (FIGS. 8B-8E). R-VECs that interacted with normal colon epithelial cells were enriched in ECs expressing organotypic EC markers such as PLVAP and TFF3 (cluster 5) (Augustin, H. G. & Koh, G. Y., Science 357, doi:10.1126 / science.aal2379, (2017); Blundell, C. et al., Lab Chip 16, 3065-3073, (2016)) (FIGS. 8D-8E). By contrast, R- VECs that arborized colon tumoroids were enriched in clusters of cells that upregulated factors that have been previously shown to be expressed by prototypical tumor ECs, such as ID1, JUNB and ADAMTS4 (cluster 8), while genes responsible for junctional integrity, such as Claudin-5 (cluster 5, cluster 7) were selected against (Lyden, D. et al., Nature 401, 670, (2019)) (FIGS. 8F-81). Thus, R-VECs respond to extrinsic microenvironmental stimuli by turning on defined sets of genes. Of note, these experiments could not be performed with naive human ECs as these cells do not sustain their arborization of the organoids beyond a few days, and as such their cross-talk with organoids could not be assessed. By the same token, epithelial cells themselves displayed changes in their molecular profile reflecting their interactions with R-VECs. Notably, in response to association with R-VECs, cells with markers linked with poorer prognosis and higher metastasis, including higher levels of MSLN (Li, S. et al. in J Cancer Vol. 8, 1355-1361 (2017)), and lower levels of MT1G, MT1X and MT2A (Si, M. & Lang, J., J Hematol Oncol Vol. 11, (2018)) were selected for, in colon tumor cells co-cultured with R-VECs. Example 14: Islet / R-VECs established adequate blood supply in the subcutaneous space
[00165] The pre-vascularized islets were prepared by co-culturing islets with R-VECs in a 40 pL droplet of 3D matrix. As shown in FIG. 9A, only R-VECs, but not HUVECs, self-assembled into connected vascular net. Five droplets of such pre-vascularized islets were then inserted into the subcutaneous space on the back of a SCID-beige mouse. The graft was examined 1 month later. While nothing could be found in mice received islet / HUVECs, the engrafted islet / R-VECs resulted in a plug with adequate blood supply (FIG. 9B). Sectioning and staining the plug revealed subcutaneous islets with insulin-i- cells that were vascularized with blood vessels formed by R-VECs (FIG. 9C). Example 15: Subcutaneous transplantation reduced body weight lost and reverse hyperglycemia
[00166] The inventors next induced diabetes in SCID-beige mice by i.p. injection of streptozotocin (STZ). Development of diabetes was confirmed by non-fasting blood glucose higher than 300 mg / dl for 3 sequential days. Once diabetes is developed, the general symptoms are loss of body weight, increased blood glucose, and reduced plasma insulin. To treat the mice, the inventors transplanted the cell-carrying matrix to the subcutaneous space on the back. Each mouse received 5 droplets of the cell-carrying matrix. Each droplet was 40 pL and contains ~ 200 islets only, co-culture with HUVECs, or with R-VECs (FIG. 9A). Thus, each mouse received approximately 1000 human islets. As expected, subcutaneous transplantation of islet alone barely ameliorated the hyperglycemia.
[00167] Meanwhile, islet / R-VEC quickly reduced the blood glucose starting from the 1st week after transplantation and stably controlled the blood glucose around 200 mg / dl for the rest of the observation period for at least 12 weeks (FIG. 10A). Such results suggest that R-VECs quickly adapted to the subcutaneous environment and maintained a long-lasting vascular niche to support the function and / or survival of the engrafted human islets. Notably, islet / HUVEC explants dramatically reduced blood glucose only at week 4, and the blood glucose levels rebound to >300 mg / dl in about 2 weeks later. Accordingly, the body weight of the mice received islet-only or islet / HUVEC remained abnormally low at all the time; and the body weight of islet / R-VEC mice went back to normal range at week 4 and gradually increased thereafter (FIG. 10B).
[00168] To further verify that the amelioration was indeed contributed by the engraftment of pre-vascularized islets, the inventors further examined the presence of human insulin in the serum. The mice were first fasted for 6 hours and then received i.p. injection of a high dose of glucose. After 20 minutes of glucose challenging, serum was obtained and examined for human insulin. As shown in FIG. 10C, substantial level of human insulin was detected in islet / R-VEC mice, much lower in islet / HUVEC samples, and almost none in islet-only samples. Interesting, in all groups, the inventors found peaks of human insulin level at week 4, which is consistent exactly with the observations that islet / R-VEC mice started to re-gain body weight at week 4 and the islet / HUVEC mouse has a temporary euglycemia at week 4. Here, the inventors set forth cogent evidence that human islets pre-vascularized by R-VECs survive and function in a physiological manner to reverse hyperglycemia in STZ induced diabetic mice. It is also intriguing to further interrogate the dynamic adaption processes of islet / R-VEC graft in the subcutaneous space. Example 16
[00169] Mature adult human ECs lack the capacity to establish and sustain long-lasting lumenized vessels in a defined matrix in vitro or in vivo in mice beyond a few days or weeks. Adult derived ECs are also resistant to proper self-assembly into stable long-lasting vessels, unable to interact instructively with normal or tumor organoids or pancreatic islets, and sparsely colonize the inner surface of decellularized scaffolds. These suboptimal functions could be due to poor cellular adaptability and the impliable state of mature human endothelium. Here, the inventors show that re-introduction of the ETV2 transcription factor-silenced during fetal development- back into adult human ECs can induce a ‘molecular reset’, to endow these mature, tissue-specific ECs with primitive-like vasculogenic, tubulogenic and adaptability potential. R-VECs have unique durable large-volume tubulogenic potential capable of self-organizing into the 3D lumenized vascular networks that maintain their geometric patterning, lumen stability and frequency of the branching hubs, both in vitro and in vivo for 5 to 10 months. R-VECs selforganize into vessels that could transport whole human heparinized peripheral blood and support physiological vascularization of human pancreatic islets and colon organoids. Notably, the R-VECs that were implanted in the L.E.C matrices in the mice for over five months, sustained their capacity to anastomose to the mouse circulation, while maintaining their capillary network patterning. The inventors show that mice with R-VEC plugs did not form tumor or metastatic lesions even 10 months post implantation. These attributes of R-VECs to establish long-lasting stable vessels and to facilitate vascularization of organoids, pancreatic islets or decellularized tissues, will enable to capitalize on the potential of R-VECs for uncovering vascular heterogeneity and set the stage for organ repair.
[00170] The mechanism by which R-VECs acquire these vascular malleable features is mediated through balanced activation of numerous vasculogenic, morphogenic and angiogenic factors that are extinguished in mature tissue-specific adult human ECs. Most likely, reactivation of ETV2 turns on silenced vascular programs that augment tubulogenesis and selfassembly attributes of the mature ECs, without the constraint of a pre-fabricated scaffold, requirement of enforced perfusion and pericyte investment. This notion is supported by the molecular profiling of the R-VECs that reveals the induction of numerous signaling pathways that are primarily expressed in the primitive vascular plexus. Similar to aortic development and primary vessel formation in the yolk sac, which develop by vasculogenesis. R-VECs activate the Rapl pathway through several Rapl-GEFs and the RAS IP 1 effector to allow lumen formation in flow- and pericyte- independent, cell-autonomous manner. By reviving vasculogenesis pathways, ETV2 resets the vascular epigenetic memory to an early plastic stage to render R-VECs more receptive to microenvironmental cues relayed from normal parenchyma or malignant tissue.
[00171] R-VECs accelerate arborization of organoids and pancreatic islet explants, in 50 microliter static matrix domes, and physiological vascularization of these organoids and islets in large-volume 15 microliter microfluidic devices. In both models, the robust potential of R-VECs to self-assemble into multi-layered interconnected vasculature, without dependency on forced patterning by pre-fabricated scaffolds, allows R-VECs the cellular freedom to instructively interact with various epithelial and tumor cells without the constraints of synthetic barriers. Within these static matrix domes, R-VEC capillary networks support maintenance and expansion of the various mature and immature epithelial cells within human organoids, and sustain insulin release in human pancreatic islet cells.
[00172] The inventors observed modest GSIS response when islets were cultured alone or with CTRL-ECs, while R-VEC co-culture significantly increased GSIS in static Matrigel domes and in perfusable microfluidic devices. The mechanisms underlying the beneficial effects of R-VECs in islet co-cultures may involve the depositing of extracellular matrix proteins, such as Laminins and likely islet-specific angiocrine factors that are yet to be elucidated. The inventors showed that the intimate association of the R-VEC vascular network with the organoids augments the proliferation and size of the epithelial and tumor organoids as shown by EdU staining. Thus, R-VECs serve as a prototypical vascular niche that support the growth and choreograph the proper morphogenesis of normal colon organoids. On the other hand, R-VECs co-opted by colon tumor organoids in vitro and in vivo establish patterned, but less organized vascular networks. Studying the two way cross-talk between R-VECs and epithelial cells could facilitate uncovering signals that specify normal and tumor vascular heterogeneity.
[00173] Current approaches to generating vascular conduits for delivery of oxygen and nutrients require culturing ECs in pre-fabricated scaffolds, restrictive biomaterials, enforced perfusion and inclusion of perivascular cells (Zhang, B. et al., Nat Mater 15, 669-678, (2016); Kim, S. et al., Lab Chip 13, 1489-1500, (2013); Wang, X. et al., Lab Chip 16, 282-290, (2016)). While these microenvironmental interventions bring the vascularized organoids closer to recreating the in vivo conditions, they also pose significant technical hurdles and limit the affordability and technical feasibility of constructing vascularized organoids for in vitro or for therapeutic in vivo use. Indeed, because of suboptimal vascular network self-assembly, naive human ECs can only establish small perfusable chambers of up 2 micro liters (Chen, M. B. et al., Nat Protoc 12, 865880, (2017); Campisi, M. et al., Biomaterials 180, 117-129, (2018); Phan, D. T. T. et al., Lab Chip 17, 511-520, (2017)), often with vessels with small bore lumens preventing the flow of human hematopoietic cells. Furthermore, in most cases, these primitive vessels are separated from organoids or other cell types by synthetic porous barriers, thereby limiting cross-talk between the blood vessels and other cells (Huh, D. et al., Science 328, 1662-1668, (2010); Blundell, C. et al., Lab Chip 16, 3065-3073, (2016)). By contrast, R-VECs readily self-organize into a patterned perfusable continuous capillary network within large chambers with a 15 microliters capacity enabling physiological vascularization of colon organoids and pancreatic islets. Importantly, as shown in Figures 5-7 and Movies 2-4, R-VECs have the cellular liberty to readily inter-mingle and interact with organoids and pancreatic islet explants.
[00174] The present disclosure provides evidence that R-VECs self-organize into hemodynamically stable patterned vessels that can physiologically vascularize pancreatic islets and organoids. Most importantly, given the capacity of R-VECs to form unprecedented extensive interconnected vascular webs within large volume microfluidic chambers, allowed the inventors to accommodate larger-sized organoids and islets some of which measure 250 microns in diameter. Current devices in use by other groups have on average limited chamber height of up to 150 microns, which could undermine the study of large islets and organoids. For the first time, the inventors demonstrate that R-VEC are capable of forming stable vessels with lumenal and hemodynamic integrity allowing for perfusion of heparinized whole human peripheral blood that compose of full complement of platelets, RBC and WBC cells, as well as unperturbed plasma. Furthermore, the inventors showed that R-VECs can promote physiological vascularization as infusion of high glucose induces the production of insulin by the pancreatic islets, detectable in the outflow tract of the perfused chambers. Perfusable R-VECs can also vascularize colon organoids, sustaining the frequency of the number of cocultured organoids. Control non-ETV2 transduced human ECs, fail to sustain tubulogenic vessels and fail to promote physiological vascularization of the islets or organoid cultures. Thus, R-VECs represent structurally adaptable ECs that have the resilience to physiologically interact and cross-talk with tissue-specific cells.
[00175] It is plausible that as compared to implanting organoids alone, in vivo inoculation of R-VEC arborized organoid modules may augment engraftment and anastomosis to the pre-existing vessels. The two way cross-talk of R-VECs with the organoids also sets up the stage to determine how ECs might acquire tissue-specific and tumor-specific heterogeneity. In this vein, utilizing single cell transcriptomics analyses (scRNA-seq) and epigenetic profiling, the inventors were able to uncover the malleability of R-VECs in response to co-culturing with normal or tumor organoids. Tumor epithelial cells were also found to upregulate several markers associated with poorer outcome when arborized by R-VECs. This finding renders this co-culture platform suitable for more physiological and relevant drug screening for resistant tumor phenotypes. Tumor or normal organoids are traditionally generated and propagated using Matrigel matrix. The uncertainty of the various digested matrix components variably present in Matrigel obfuscates mechanistic studies to decipher the adhesion molecules and chemokines that enable the self-assembly of organoids. Here, the inventors show that defined L.E.C matrix, in part through interaction with integrins, such as pi integrin, is sufficient to not only permit cointegration of vascular plexus with epithelial and tumor organoids, but also to perform targeted mechanistic studies.
[00176] The main impetus for employing ETV2 in our studies was the uniqueness of this ETS transcription factor that is only transiently expressed during embryonic development and only turned on in stressed adult ECs. The physiological significance of this ephemeral expression of ETV2 is under scrutiny, but it may point to its important function as a pioneer factor that needs to be expressed in a short interval to exert its potent pro-vasculogenic effects. The inventors' finding that even during lentiviral-ETV2 constitutive enforced expression, stage 3 stable 3D vessels composed of ECs that express low and decreased ETV2 levels, is attestation to the complex regulation of ETV2 expression in vascular cells. Indeed, the inventors show that ubiquitination might play a role in silencing of the ETV2.
[00177] In summary, the generation of R-VECs in a defined extracellular matrix, serves as an interrogable model system to uncover the complex 3D cellular interactions of hemodynamically stable and resilient tissue-specific ECs with non-vascular cells. Example 17: Static co-culture with R-VECs improved the function of Stem Cell-derived p cells (SC-P cells) as evidenced by augmentation of glucose stimulated insulin secretion (GSIS).
[00178] The inventors obtained pluripotent-derived SC-P cells and cultured them in 3D matrix by themselves, with generic human umbilical vein ECs (HUVECs), or with R-VECs (HUVECs transduced transiently with ETV2). In all 3 groups, SC-P continued to differentiate in the 3D matrix and formed small sized spheroids (indicated with yellow arrow heads in FIG. 11A left panels). Possibly resulting from fusion of small islet spheroids, cell clusters with sizes of regular islets (100 - 200 pm) were also observed in all 3 groups (FIG. 11A left panels). As expected, only when co-cultured with R-VECs, the islet-like cell clusters were vascularized by ECs (EGFP+ cells in FIG. 11A right panels). After 2 weeks of 3D culture, SC-P cells’ function was examined with glucose-stimulated insulin secretion (GSIS) assay. Each sample was first incubated with low glucose (2 mM) to determine the basal insulin secretion, and then incubated with high glucose (16.7 mM) to determine the stimulated insulin secretion. The GSIS folds were calculated as dividing the stimulated insulin levels by the basal insulin level. Consistent with the inventors' hypothesis, SC-p / R-VECs samples showed significantly higher folds of insulin secretion than SC-P only or SC-p / HUVECs samples (FIG. 1 IB). Notably, neither basal nor stimulated insulin levels of SC-p / R-VECs were significantly different than the other 2 groups. Rather, the higher folds in SC-p / R-VECs were the results of modest decrease of basal insulin and modest increase of stimulated insulin levels, which, as discussed above, is the best scenario that could be expected as the functional maturation of SC-P cells. Example 18: Materials and Methods Cell culture of endothelial cells (ECs)
[00179] The approval for procuring discarded left-over human umbilical vein endothelial cells (HUVEC) and human adipose tissue ECs were obtained through Weill Cornell Medicine investigational review board. The ECs were isolated in lab as previously described using collagenase-based digestion approach (Baudin, B. et al., Nature Protocols 2, 481, (2007)). The cells were then grown in tissue culture dishes coated with 0.2% gelatin in complete EC media. Media is composed of 400 ml of M199, 100 ml heat inactivated FBS, 7.5 ml Hepes, 5 ml antibiotics (Thermo Fisher, 15070063), 5 ml glutamax (Thermo Fisher, 35050061), 5 ml of lipid mixture (Thermo Fisher, 11905031), and bottle of endothelial cell growth supplement (Alpha Aesar, J64516-MF). The cells were transduced with lenti PGK-ETV2 or an empty lenti vector at P1 / P2. In some instances, the cells were also labeled by using PGK-mCherry or PGK-GFP lenti-virus. The cells were split 1:2 using accutase and passaged on gelatinized plates. As needed, cells in 2D (induction stage) were frozen down to be used in future experiments. All comparisons for all assays and co-cultures were done using the same parental endothelial cell line with and without ETV2. Overall, HUVECs from more than 10 different isolations were used for the experiments. Cells used for tube formation assays were of passage 5-10.
[00180] Human adipose-derived ECs were isolated by mechanical fragmentation followed by collagenase digestion for 30 minutes. After plating the crude population of cells on the plastic dish and expansion for 5 to 7 days, the cells were then sorted to purify VEcadherin+CD31+ ECs and expanded as described above. Human adipose ECs were cultured in the same media described above for HUVECs. At least three different isolations of adipose ECs were used in our experiments. Microvascular cardiac (PromoCell, C12286), aortic (PromoCell, C12272), and microvascular dermal (PromoCell, C12265) ECs were acquired from Promocell and cultured in EC growth medium MV (PromoCell, C22020). Lentiviral transduction of ECs
[00181] Endothelial cells were transduced with ETV2 lenti-particles or empty vector lenti-particles. ETV2 cDNA [NM_014209.3] was introduced into the pCCL-PGK lentivirus vector [Genecopeia]. For purposes of ChIP analysis, a triple Flag-tag was subcloned in the ETV2 construct at the amino terminus (Ginsberg, M. et al., Cell 151, 559-575, (2012)). After 1 week of transduction, ECs were collected for mRNA isolation and qPCR analysis. The relative ETV2 RNA unit was determined by calculating the ratio between the mRNA level of expression of ETV2 over the level of expression of GAPDH (Primers found in the Table 1).
[00182] Table 1: Primers Genes Application Primers RASGRP3 (Promoter 2 NM_0011394 88) ChlP-qPCR GTGATCCTCTCTCTTGCCGT (SEQ ID NO: 1) ATGTGTTTGCGTGTGTGTGT (SEQ ID NO: 2) RASIP1 ChlP-qPCR GGAGATCTGGGTAGGGTTGG (SEQ ID NO: 3) GAGGGAGGAAGGGCAGAAAA (SEQ ID NO: 4) DLL4 ChlP-qPCR CCCTCCCCAGATTTCCTTGT (SEQ ID NO: 5) GGAGACTGGTGAGAGCCTTT (SEQ ID NO: 6) IGFBP2 ChlP-qPCR GAAGTCCTCGCGAACTGAAC (SEQ ID NO: 7) GCACTCTTCTGGCCTGACTA (SEQ ID NO: 8) COL4al ChlP-qPCR GGTACAAAGGGCAAACGTGT (SEQ ID NO: 9) CTCCTCATCACTCACTGCCT (SEQ ID NO: 10) CHR9 (non specific region) ChlP-qPCR GTAACCCACTTTCTCCACATATCTC (SEQ ID NO: 11) TGCTCAGGCTAGTATCCAATTCC (SEQ ID NO: 12) ETV2 qPCR GGGCTTGAAGGAGCCAAATTA (SEQ ID NO: 13) CAGGGATGAGCTTGTACCTTTC (SEQ ID NO: 14) GAPDH qPCR GGAGCGAGATCCCTCCAAAAT (SEQ ID NO: 15) GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 16) EPHB2 qPCR CTTCGAGGCCGTTGAGAAT (SEQ ID NO: 17) TTGATGGGACAGTGGGTACA (SEQ ID NO: 18) HOPX qPCR GCCTTTCCGAGGAGGAGAC (SEQ ID NO: 19) TCTGTGACGGATCTGCACTC (SEQ ID NO: 20) TPH1 qPCR CCTTAAAGAATGAAGTTGGAGGA (SEQ ID NO: 21) TTTTTGATTTTCGGGACTCG (SEQ ID NO: 22) KRT20 qPCR TTGAAGAGCTGCGAAGTCAG (SEQ ID NO: 23) GAAGTCCTCAGCAGCCAGTT (SEQ ID NO: 24) MUC2 qPCR TGTAGGCATCGCTCTTCTCA (SEQ ID NO: 25) GAGTCCATCCTGCTGACCAT (SEQ ID NO: 26) BMI1 qPCR GCTGGTCTCCAGGTAACGAA (SEQ ID NO: 27) AATCCCCACCTGATGTGTGT (SEQ ID NO: 28) Vill qPCR CCAAAGGCCTGAGTGAAATC (SEQ ID NO: 29) AACCTCAGTTCTGGGCCTCT (SEQ ID NO: 30) NGN3 qPCR AGTTGGCACTGAGCAAGC (SEQ ID NO: 31) AGTGCCGAGTTGAGGTTG (SEQ ID NO: 32) CHGA qPCR AAAGTGTGTCGGAGATGACCTCAA (SEQ ID NO: 33) TCCCTGTGAACAGCCCTATGAATAA (SEQ ID NO: 34) LGR5 qPCR CTTCTAATAGGTTGTAAGACA (SEQ ID NO: 35) ATCTCATCTCTTCCTCAAA (SEQ ID NO: 36)
[00183] Cells with relative ETV2 RNA unit within the range of 40-100 were used for all experiments unless otherwise indicated in the text. An MOI of 3 gave us relative expression levels of 60-80 as calculated by mRNA expression. MOI was calculated by converting particles of P24 to IFU and then to MOI based on cell number (kit: Katara, 632200). MOI of 3 was also found to be adequate for Cardiac and Aortic ECs. An MOI of 6 was instead required for adipose and dermal ECs. Polybrene at 2 pg / ml was utilized for all of the transductions. ETS1, myrAKT, mCherry, GFP, were also introduced into the pCCL-PGK lentivirus vector and an MOI of 3 was used for all transductions.
[00184] For inducible expression of ETV2, ECs were transduced with doxycycline inducible ETV2 lenti-vimses (pLV[Exp]-Puro-TRE>hETV2 [NM_014209.3], VectorBuilder VB170514-1062dfs and pLV[Exp]-Neo-CMV>tTS / rtTA_M2, VectorBuilder VB160419-1020mes) where presence of doxycycline turns on ETV2 expression. Post 1 week doxycycline induction of ETV2, cells were collected to determine the relative ETV2 mRNA unit. Cells with relative ETV2 RNA unit within 40-100 were used for all experiments. An MOI of 50 was required for the inducible ETV2 lentiviral particles and tTA lentiviral particles. Lentivirus production
[00185] All lentiviral plasmids were prepared with a DNA Midiprep kit (Qiagen, 12145). Viruses were packaged in 293T cells by co-transduction with 2nd- or 3rd-generation of packaging plasmids. Culture media were collected 48hrs post transduction and virus particles concentrated using a Lenti-X concentrator (Katara, 631232), resuspended in PBS without magnesium (Coming, 21040CV), and stored at -80°C in small aliquots. Virus titers were determined with a Lenti-X p24 titer kit (Katara, 632200). Tube formation assays
[00186] 24 well plates were coated with 300 pl of Matrigel (Corning) for 30 min in the incubator. Meanwhile, cells with or without ETV2 were accutased and counted. Cells were then resuspended in StemSpan (Stem Cell Technologies) supplemented with 10% knock out serum (Thermo Fisher, 10828028) and cytokines: lOng / ml FGF (Peprotech, 1000-18B), lOng / ml IGF1 (Peprotech, 100-11), 20ng / ml EGF (Peprotech, AF-100-15), 20 ng / ml SCF (Peprotech, 300-07), 10 ng / ml IL6 (Peprotech, 200-06). 100,000 cells either with or without ETV2 were then dispersed in each well in 1 ml of media. Cultures were placed in a 37°C incubator with 5% oxygen for the remainder of the experiments. Media was changed every other day, by replacing 750 pl with fresh media. Care was taken to not disrupt the tubes during all media changes. For several occasions, a mixture of defined matrices comprised of Laminin, Entactin mixture (Coming, 354259) and Collagen IV (Corning, 354245) (L.E.C) was used in place of Matrigel as indicated in the text. The inventors combined these defined matrices at different ratios between Laminin, Entactin and Collagen IV and ultimately found the most effective combination of these gel mixtures for tube formation assays, which was comprised of 200 pl of (Concentrations slightly vary for each lot #, always diluted to 16.5mg / ml in PBS first) Laminin, Entactin and 100 pl of Collagen IV (Concentrations slightly vary for each lot#, first diluted to 0.6 mg / ml in PBS) mixed together on ice and stored at 4°C overnight before usage. Final concentration of Laminin, Entactin mixture (11 mg / ml) and Collagen IV (0.2 mg / ml). Volume of L.E.C was increased as needed, as long as the ratios / final concentrations were maintained. Vessel area was measured over a course of 24 hrs to 12 weeks for stage 2 Remodeling and stage 3 Stabilization phases. For the smooth muscle experiments, 2000 mCherry labeled human aortic smooth muscle cells were added to stage 3 GFP labeled R-VEC vessels on Matrigel, and then imaged 1 week after. Human aortic smooth muscle cells were purchased from Promocell (C-12533). EVOS inverted microscope was used to capture images in their different / randomized places in each well for each condition and time point with a 4x objective. All the images were then analyzed for lumenized vessel area using ImageJ to trace vessel area. The same procedure was used for cells transduced with ETS1 or myrAKTl transduced ECs. Tube formation assay in different media formulations
[00187] Endothelial cells were accutased and plated on Matrigel at 100,000 cells / well of 24 well plate as described above. To assess the tube formation assays of ETV2 ECs vs Control ECs, the inventors compared their capabilities to form tubular network in 3 different medium formulations. Medium formulation 1 is the serum-free medium containing StemSpan supplemented with knockout serum and cytokines. Medium formulation 2 is a commercialized EC growth medium (PromoCell, C22111). Medium formulation 3 is a complete EC medium with serum that was used to maintain and propagate ECs. Media were changed every other day. Images were acquired at different time points. ImageJ was utilized to measure the vessel areas over time. Immunofluorescent staining of tubes in vitro
[00188] At 8 to 12 weeks all media was removed from the wells. The tubes were washed once with PBS and fixed for 30 min in 4% PFA at room temperature. Then they were washed again with PBS and put in blocking buffer (containing 0.1% Triton-X) for 1 hr at room temperature. The tubes were then stained with antibodies against Laminin (R&D), Collagen IV (Abeam) and / or podocalyxin (R&D) overnight at 4°C. The next day, the tubes were washed again in PBS, incubated for 3 hrs with secondary antibodies, and counterstained with DAPI (Sigma, 0.5pg / ml). All images were obtained through confocal microscope Zeiss 710. For proliferation studies, a 16 hour pulse of EdU (Click-iT EdU kit, Thermofisher scientific C10337) was used for all three stages of vessel formation and then the cells stained as described above. Electron microscopy
[00189] Tissues were washed with serum-free media or PBS then fixed with a modified Karmovsky's fix of 2.5% glutaraldehyde, 4% parafomaldehyde and 0.02% picric acid in 0.1M sodium cacodylate buffer at pH 7.2. Following a secondary fixation in 1% osmium tetroxide, 1.5% potassium ferricyanide samples were dehydrated through a graded ethanol series, and embedded in an Epon analog resin. Ultrathin sections were cut using a Diatome diamond knife (Diatome, USA, Hatfield, PA) on a Leica Ultracut S ultramicrotome (Leica, Vienna, Austria). Sections were collected on copper grids and further contrasted with lead and viewed on a JEM 1400 electron microscope (JEOL, USA, Inc., Peabody, MA) operated at 100 kV. Images were Recorded with a Veleta 2K x2K digital camera (Olympus-SIS, Germany). AFM Measurements
[00190] AFM was used to examine the stiffness of HUVECs, as well as for adult human adipose ECs. Brightfield images of cells, for determination of location of stiffness measurements, were acquired using an inverted microscope (Zeiss Axio Observer Zl) as the AFM base (20x 0.8 NA objective). An MFP-3D-BIO Atomic Force Microscope (Asylum Research) was used to collect force maps. A 5 pm borosilicate glass beaded probe (Novascan) with a nominal spring constant of 0.12 N / m was used for all measurements. Each force map sampled a 60 pm x 60 pm region, in a 20 x 20 grid of force curves (400 force curves total) under fluid conditions which covered an area of 360 pm . The trigged point was set to 2 nN with an approach velocity of 5 pm / sec. The force-indentation curves were fit to the Hertz model for spherical tips utilizing the Asylum Research Software to determine the Young’s modulus, with an assumed Poisson’s ratio value of 0.45 for the sample. Force maps of stiffness along with individual stiffness values for each measured point were then exported from the Asylum Research Software for further analysis. A custom-made MATLAB (MathWorks) script was written to correctly analyze the data for the stiffness of the cells and filter measurements such that only data 1 pm from the glass bottom dish was analyzed (to remove any substrate effect from the measurements). Bead flow movie to interrogate perfusion of CTRL-EC vs R-VEC vessels in microfluidic devices
[00191] Devices were fabricated as previously described (Nguyen, D. H. et al., Proc Natl Acad Sci USA 110, 6712-6717, (2013)). Briefly, each device was comprised of two layers of poly(dimethylsiloxane) (PDMS; Sylgard 184; Dow-Coming), which were cast from silicon wafer masters. The devices were plasma-treated with plasma etcher (Plasma Etch) and subsequently treated with (3-Glycidyloxypropyl) trimethoxysilane (Sigma, 440167) overnight. Prior to usage, the devices were washed with MiliQ H2O overnight. A mixture of 3 million / ml ETV2 HUVECs or control HUVECs in 2.5mg / ml bovine Fibrinogen (Sigma) and 3U / ml bovine thrombin (Sigma) was injected into the devices with two 400pm acupuncture needles (Hwato). After the cell and gel mixture polymerized, the acupuncture needles were pulled out leaving two hollow channels. HUVECs were seeded into the hollow channels to form two parent vessels on the next day. The devices were placed on a platform rocker for the entire experiment (Benchmark). Cells were cultured in endothelial cell growth medium 2 (PromoCell, C22111) and refreshed daily until day 6. On day 6, the devices were connected to a syringe pump (Harvard Apparatus) and 4pm red fluorescent microspheres (Invitrogen) were injected into one of the parent vessels in each device at 50pL / min. Timelapse of fluorescent beads flowing in the devices was captured at 50 ms interval with Nikon Eclipse TiE (Nikon) equipped with an Andor Zyla sCMOS 5.5MP camera (Andor). Time-lapse images of fluorescent beads were stacked together and overlaid with EC vessels using ImageJ. Rapl pull down and Western Blots
[00192] A 10 cm plate of either HUVECs or ETV2-tranduced HUVECs (flat-2D induction stage) were used for the active Rapl assay (Cell Signaling, 8818S) according to the manufacturer’s guidelines for the kit. Briefly, the cells were washed once with PBS and then starved for three hours in M199 medium with 0.5%BSA. The cells were then scraped in the lysis buffer for the kit and resuspended at 1 mg / ml. A fraction was saved as input and the rest of the cells were used for Rapl-GTP. Positive and negative controls, as well as a beads only control, were performed according to the manufacturers guidelines. Proteins were solved on 5-15% gradient Tris-glycine SDS-PAGE and semi-dry transferred to nitrocellulose membranes. The membranes were then blocked in 5% milk in PBST and incubated in the provided Rapl (1:1000) antibody, GAPDH and / or ETV2 antibody for 48 hours. After 48 hours, the membranes were washed 3x for 5 min and incubated in HRP conjugated secondary antibody. Finally, upon secondary washings, the membrane was blotted in ECL and chemiluminescent signals captured with a digital camera (Kindle Biosciences) and images of proteins bands were taken for densitometric quantification using ImageJ. RNA and protein collection from endothelial tubes
[00193] At indicated time points, tubes of ECs from tube formation assays were collected for RNA sequencing and Western blotting. Before the cells were collected, media was completely removed from the well. 0.5ml of 2mg / ml Dispase (Sigma) was added into the well to dissociate the endothelial tubes for 45 mins at 37°C. Dissociated cells were washed once in PBS and subsequently collected for either mRNA or protein isolation. In several occasions, dissociated endothelial cells from tubes were pooled from multiple wells of the same endothelial cell line to allow sufficient isolation of mRNA and protein for downstream analysis. Western immunoblot
[00194] Cells were lysed into IX SDS loading buffer (50 mM Tris-HCl pH 6.8, 5% betamercaptoethanol, 2% SDS, 0.01% bromophenol blue, 10% glycerol) followed by sonication (Bioruptor, 2X 30 seconds at high setting). Proteins were solved on 5-15% gradient Tris-glycine SDS-PAGE and semi-dry transferred to nitrocellulose membranes. The following primary antibodies were used at indicated dilutions: Rapl (CST, #2399, 1:1,000); RASGRP3 (CST, #3334, 1:1,000), GAPDH (CST, #5174, 1:10,000); AKT (CST, 34685, 1:5,000); p-S473-Akt (CST, #4060, 1:2,000); ETS1 (CST, #14069, 1,000); and ETV2 (Abeam, abl81847, 1:1,000). HRP-conjugated secondary antibodies and the ECL Prime Western Blotting System (GE Healthcare, RPN2232) were then used. Chemiluminescent signals were captured with a digital camera (Kindle Biosciences) and images of protein bands taken for quantification using ImageJ. Rapl inhibition experiment
[00195] Tube formation assays for endothelial cells with or without ETV2 were set up in 24 wells as described above. The next day, Rapl inhibitor (GGTL298, Tocris) resuspended in DMSO was added to the wells at a 1:1000 dilution at the final concentration of lOpM, while the same amount of DMSO was added to the control wells. The inhibitor and media were changed every other day for 4 weeks. Images were obtained and calculated as described above at 1 week and 4 week time points. RASGRP3 knockdown experiments
[00196] shERWOOD-UltramiR RASGRP3 shRNA lentiviral constructs (in pZIP-TRE3G) were purchased from TransOMIC Technologies. The clone# and targeted RASGRP3 sequences are as follow: ULTRA-3265848, AAGGGCAGAAGTCATCACAAA (SEQ ID NO: 39);ULTRA-3265850, CCTTGGAGTACACTTGAAAGA (SEQ ID NO: 40). The control shRNA (ULTRANT, ATGCTTTGCATACTTCTGCCT (SEQ ID NO: 41)) targets a fly luciferase RNA sequence. Lentivirus was prepared as described above, using 2nd generation packaging plasmids. R-VECs (stage 1) were transduced with either shRNA virus or control shRNA virus (MOI=3). Doxycycline was added at day 1 of remodeling stage (stage 2) and media with doxycycline was replaced every other day for 4 weeks. Images were obtained as calculated and described above at 2 and 4 week time points. To confirm RASGRP3 knockdown, doxycycline was added in stage 1 R-VEC cells for 1 week and then the cells were collected for Western Blot analysis. pi inhibition experiment
[00197] A 300uL of pre-mixed defined matrices containing Laminin, Entactin, CollagenIV (L.E.C) was pipetted into a well of 24 well plate and let cure in a 37°C incubator for 30mins. R-VECs were accutased and plated directly on L.E.C at a density of 100,000 cells / well in StemSpan medium (Stemcell Technologies) supplemented with knock out serum and cytokines (lOng / ml FGF, lOng / ml IGF1, 20ng / ml EGF, 20 ng / ml SCF 10 ng / ml IL6) (Peprotech). Immediately, an azide-free neutralization antibody for pi integrin (EMD Millipore, MABT409) was added into the culture medium at Ipg / ml concentration. Culture was maintained in a 37°C incubator with 5% oxygen, and medium was refreshed every 2 days. Vessel area was quantified using Image J. Proteasome inhibition experiment
[00198] R-VEC vessels were prepared on Matrigel as described above. At stabilization stage (4 weeks), R-VEC tubes were treated with either 20pM of MG132 (Selleck Chemicals) or DMSO for 6hrs. The media was removed and the wells were washed once with PBS. R-VEC tubes were then incubated in a solution of 2mg / ml Dispase (Sigma) for 45mins at 37°C to dissociate the tubes. 20pM of MG132 (Selleck Chemicals) or DMSO was continuously provided during the dissociation period. Dissociated cells were collected and further processed for Western blotting as described above. In vivo experiments
[00199] HUVECs and adipose derived human endothelial cells that were transduced with an empty vector or ETV2, and labeled with GFP or mCherry (2 million cells / plug) were injected subcutaneously in male or female 8-12 week old SCID-beige mice (Taconic). The cells were first resuspended in PBS (50 pl) and then mixed with Matrigel (Coming, 356237) or L.E.C. mixture as described above to a final volume of 350 pl. The gels were also supplied with FGF2 (10ng / ml)(Peprotech, 1000-18B), VEGF-A (20ng / ml) (Peprotech, 100-20), and heparin (lOOpg / ml) (Sigma H3149-100KU). Each mouse R-VECeived two plugs: one with control cells and the other with cells transduced with ETV2. Mice implanted with were injected retro-orbitally with anti-human VEcad (clone BV9- Biolegend) conjugated to Alexa-647 (25 pg in 100 pl of PBS) or 70kDa fluorescently labeled lysine fixable dextran (ThermoFisher) and sacrificed 8 min post injection. Whole mount images were taken direct ly on the confocal microscope Zeiss 710 using a well containing a coverslip bottom. The plugs were fixed in 4% PFA overnight and then dehydrated in ethanol or put in sucrose for further immunostaining. The dehydrated plugs were sent to Histoserv Inc. for further processing, sectioning and H&E, Picrosirus, or Masson staining. The sections were processed for immunostaining as described below. For experiments with HUVECs transduced with ETS1, myrAKT1, k-RAS, cells were injected in mice with Matrigel. Plugs were harvested at 1 month and processed with the same procedure. Immunostaining of sections
[00200] OCT frozen sections (20 pm), previously fixed in 4% PFA and treated in sucrose, were washed once with PBS. Then the slides were incubated in blocking buffer (0.1% Triton-X, 5% normal donkey serum, 0.1% BSA), for 30 minutes at room temperature and overnight in primary antibodies at 4°C in blocking buffer. For thicker sections (50 pm) tissues were blocked overnight in blocking buffer 4°C (0.3% Triton-X, 5% normal donkey serum, 0.1% BSA) and then for two days in primary antibody in blocking buffer at 4°C (0.3% Triton-X, 5% normal donkey serum, 0.1% BSA). The next day, the slides were washed 3x for 10 min at room temperature and then incubated for three hours in fluorescently conjugated secondary antibodies (1:1000). Finally, the slides were washed 3 x for lOmin and counter stained with DAPI. The sections were mounted on coverslips. Zeiss 710 confocal or Zeiss Cell Observer confocal spinning disk microscope (Zeiss) were utilized to acquire images. For stroma staining, a mouse anti-PDGFRp antibody (1:500, Biolegend) or a anti-mouse SMA (1:200, Abeam) were used. Pericyte coverage was quantified as signal of PDGFRP antibody staining over the signal of the fluorescently labeled human endothelial cells (GFP) using the threshold function in ImageJ. Mouse endothelial cells were counterstained with mouse anti-endomucin antibody (1:100, Satna Cruz). (Several images were taken from sections from different layers of each plug. At least 12 pictures (4 / mouse) from different slides were taken for each condition and time point. Images were processed using ImageJ and the percentage of vessel area over the area of each image field was quantified by using the threshold feature in ImageJ. Intestinal Tissue Harvesting and Decellularization
[00201] Intestines were harvested from Sprague Dawley rats ranging 250-350g in weight. Briefly, under aseptic conditions a midline laparotomy was performed and the intestine exposed. A 5cm long intestine segment was isolated, preserving the mesenteric artery and the mesenteric vein that perfuse the isolated segment. Both vessels were cannulated with a 26G cannula, intestinal lumen was cannulated using 1 / 4" barbed connectors. The isolated segments were decellularized providing perfusion through vasculature and lumen at Iml / min using a peristaltic pump (iPump). Decellularization process consisted of milliQ water for 24h, sodium deoxycholate (Sigma) for 4h and DNAse I (Sigma) for 3h. Decellularized intestines were sterilized with gamma radiation before use. Bioreactor culture
[00202] Decellularized intestine were seeded either with 5 million GFP+ETV2+ human endothelial cells or with 5 million GFP+ Control-endothelial cells (CTRL-ECs). Cells were seeded through the mesenteric artery and mesenteric vein. Seeded intestines were mounted inside a custom made bioreactor under sterile conditions. After 24h, perfusion was started through the mesenteric artery at Iml / min using a peristaltic pump (iPump). Cells were grown in M199 / EBSS (HyClone, SH302503.01) supplemented with 20% Heat inactivated FBS, 1% Pen-Strep, 1.5 % HEPES (Coming 25-060-C1), 1% Glutamax (Gibco 35050-061), 1% Lipid mixture (Gibco 11905-031), 1% Heparin (Sigma H3149-100KU) and 15ug / ml Endothelial Cell Growth Supplement (Merck 324845) for the first 5 days, then cells were grown for 2 days in Stem Span (Stemcell Technologies) supplemented with 10% knock out serum (Thermo 10828028), 1% Pen-Strep, 1% Glutatamax, lOng / ml FGF (Peprotech 1000 18B), 20 ng / ml EGF (Invitrogen PHG0311), lOng / ml IGF2 (Peprotech 100-12), 20ng / ml SCF (Peprotech 300-07) and lOng / ml IL6 (Peprotech 200-06). After 7 days, re-endothelialized intestines were harvested under sterile conditions and segments 5x7 mm were excised for heterotopic implantation. Remaining intestinal tissue was then fixed in 4% paraformaldehyde, mounted and prepared for imaging by fluorescent microscopy. To assess patency of the vessels, some re-endothelialized intestines were perfused with fluorescently-labeled LDL. Heterotopic graft implantation
[00203] Animals used for these studies were maintained, and the experiments performed, in accordance with the UK Animals (Scientific Procedures) Act 1986 and approved by the University College London Biological Services Ethical Review Process (PPL 70 / 7622). Animal husbandry at UCL Biological Services was in accordance with the UK Home Office Certificate of Designation. NOD-SCID-gamma (NSG) mice, aged between 8 and 12 weeks, were anaesthetized with a 2-5% isoflurane-oxygen gas mix for induction and maintenance. Buprenorphine 0.1 mg / Kg was administered at the induction for analgesia. Under aseptic conditions a midline laparotomy was performed. The stomach was externalized from the incision and the omentum stretched from the great curvature. A segment of the engineered intestine was then enveloped in the omentum, using 8 / 0 Prolene suture to secure the closure of the omental wrap. The stomach and the omentum were placed back in the abdomen and the laparotomy closed using 6 / 0 Vicryil suture. Animals were allowed to normally eat and drink immediately after surgery and no further medications were administered during the postoperative periods. After 1 week or 4 weeks mice were intravenously injected with fluorescently-labeled anti-VEcad (BV9 Biolegend) or fluorescently-labeled Isolectin, then euthanized. Grafts were retrieved together with the omental envelope and fixed in 4% paraformaldehyde, mounted and prepared for imaging by fluorescent microscopy. Analysis of vascular parameters for decellularized intestine experiments
[00204] Quantification of in-vitro endothelial revascularization was performed on an area of 5x5 lOx fields of view. Images were processed using ImageJ by setting a threshold and quantifying the area covered by CD31 signal with respect to the intestine area. In-vivo quantification of cells positive for GFP and VEcadherin was performed on images acquired with a confocal microscope (Zeiss LSM710) evaluating an area of 3x3 20x fields of view. Evaluation of vascular parameter was performed using Angiotool software (National Cancer Institute). Quantification of proliferating cells and apoptotic cells in decellularized scaffolds
[00205] Explanted intestinal grafts were fixed in 4% PFA, embedded in OCT and sectioned. Sections were stained for Cleaved-Caspase3 (Cell Signaling, 9661S) and for Ki67 (Abeam, AB 15580). Blocking solution consisting of PBS + / + with 10% donkey serum was added on the scaffolds for 1 hours prior the staining. Primary antibodies were incubated overnight at 4°C in blocking solution with the addition of 0.5% Tx. Cleaved-Caspase3 antibody was used at 1:100 concentration, Ki67 antibody at 1:200. Primary antibody buffer was washed 3 times with PBT + / + before secondary antibody was added. Secondary antibody for donkey anti-mouse or rabbit (Alexa Fluor 547 or 647; Life Tech) was used at a dilution of 1:500 in blocking solution with 0.5% Triton X-100 and incubated at room temperature for 1 hours. Secondary antibody buffer was washed off with PBT + / + 3 times and mounting containing DAPI was added before applying a cover slip. Images acquired with a confocal microscope (Zeiss LSM710) evaluating 3 fields of view per animal, 425.10 pm x 425.10 pm in size and counting the ratio between human VEcadherin (injected intra-vitally before sacrifice) and Cleaved-Caspase3 or Ki67 positive cells. Isolation of ECs from ETV2 reporter mice
[00206] ETV2-Venus reporter mice were a kind gift of Dr. Valerie Kouskoff (Wareing, S. et al., Dev Dyn 241, 1454-1464, (2012)). Briefly, embryos were isolated at E9.5 from pooled litters of ETV2-Venus reporter mice. For each independent biological replicate, five litters of mice at E9.5 were pooled together. All embryos were accutased for 20 min at 37°C and then triturated several times with a pipette. The cells were post-stained for anti mouse CD31 and anti mouse CD45 antibodies, and then sorted as either ETV2Venus+, CD31+, CD45' or as CD31+, CD45' (ARIAII, BD). Cells were sorted straight into Trizol-LS and RNA further purified using Qiagen RNA-easy isolation kit. Movie set up for HUVECs cultured in 3D matrices in different medium formulations
[00207] Control HUVECs and R-VECs were embedded inside L.E.C at 5 million cells / ml. Gels were polymerized on glass-bottom culture dishes at 37°C incubator for 15mins. Subsequently, either a commercialized endothelial cell medium (PromoCell, C-22111) or serum-free medium containing StemSpan supplemented with knockout serum and cytokines was added into the cell culture. Medium was also supplemented with Trolox, Vitamin E analog (6-hydroxy-2,5,7,8-tetramethylchroman-2-Carboxylic Acid) (Sigma) at lOOpM to enable long-term imaging. Culture was mounted on temperature- and gas-controlled chamber for live cell imaging. Time lapse movies were acquired with a Zeiss Cell Observer confocal spinning disk microscope (Zeiss) equipped with a Photometries Evolve 512 EMCCD camera at an interval of 40mins over 3days. Media was refreshed every 2 days. Isolation and culture of mouse small intestine organoids
[00208] Mouse small intestine organoids were isolated as previously described (O'Rourke, K. P. et al., Bio Protoc 6 (2016)). 15 cm of the proximal small intestine was removed and flushed with cold PBS. After opening longitudinally, it was washed in cold PBS until the supernatant was clear. The intestine was then cut into 5 mm pieces and placed into 10 ml cold 5mM EDTA-PBS and vigorously resuspended using a 10ml pipette. The supernatant was aspirated and replaced with 10ml EDTA and placed at 4°C on a benchtop roller for 10 minutes. This was then repeated for a second time for 30 minutes. The supernatant was aspirated and then 10ml of cold PBS was added to the intestine and resuspended with a 10ml pipette. After collecting this 10ml fraction of PBS containing crypts, this was repeated and each successive fraction was collected and examined underneath the microscope for the presence of intact intestinal crypts and lack of villi. The 10ml fraction was then mixed with 10ml DMEM Basal Media (Advanced DMEM F / 12 containing Pen / Strep, Glutamine, HEPES (lOmM), ImM N-Acetylcysteine (Sigma Aldrich A9165-SG)) containing 10 U / ml DNAse I (Roche, 04716728001), and filtered through a 100pm filter into a BSA (1%) coated tube. It was then filtered through a 70pm filter into a BSA (1%) coated tube and spun at 1200 RPM for 3 minutes. The supernatant was aspirated and the cell pellet mixed with 5ml Basal Media containing 5% FBS and centrifuged at 200 g for 5 minutes. The purified crypts were then resuspended in basal media and mixed 1:10 with Growth Factor Reduced Matrigel (Coming, 354230). 40pl of the resuspension was plated in a 48 well plate and allowed to polymerize. Organoid growth media (Basal Media containing 40 ng / mL EGF (Invitrogen PMG8043), lOOng / ml Noggin (Peprotech 250-38), and 500 ng / mL R-spondin (R&D Systems, 3474-RS-050) was then laid on top of the Matrigel. In some experiments, small intestinal organoid growth media was made R-spondin 1 from conditioned media, collected from HEK293 cell lines expressing recombinant R-spondin 1 (kindly provided by Calvin Kuo). Maintenance of mouse small intestine organoids
[00209] Media was changed on organoids every two days and they were passaged 1:4 every 5-7 days. To passage, the growth media was removed and the Matrigel was resuspended in cold PBS and transferred to a 15ml falcon tube. The organoids were mechanically disassociated using a plOOO or a p200 pipette and pipetting 50-100 times. 7 ml of cold PBS was added to the tube and pipetted 20 times to fully wash the cells. The cells were then centrifuged at 1000 RPM for 5 minutes and the supernatant was aspirated. They were then resuspended in GFR Matrigel and replated as above. For freezing, after spinning the cells were resuspended in Basal Media containing 10% FBS and 10% DMSO and stored in liquid nitrogen indefinitely. Mouse small intestine organoid co-culture and staining
[00210] Mouse small intestine organoids were co-cultured for 4-7 days either alone, or with CTRL-EC, or R-VEC and 5 million cell / ml of Matrigel final concentration. Organoids were mechanically dissociated as described above and mixed with the endothelial cells, spun down and resuspended in GFR Matrigel. The mixture was then dispersed in 30pl droplets in 8-well chamber slides (Lab-Tek II, 154534) or in 50pl droplets in Nunc IVF 4-well dish (Thermo Scientific, cat# 144444). Media compromised of mouse small intestinal media as described above (EGF 40ng / ml, Noggin 50 ng / ml, R-Spondinl conditioned media (10%) + FGF-2 (lOng / ml) (Peprotech, 1000-18B) and heparin (lOOpg / ml) (Sigma H3149-100KU). Vessel area was quantified by the threshold function in ImageJ and individual sprouts in contact with the mouse small intestine organoids were counted and reported as vessel sprouts / organoids. Organoids were stained as previously described (O'Rourke, K. P. et al., Bio Protoc 6 (2016)). Where indicated, 10 pM EdU was added to the growth media for 6 hours before fixing. The growth media was removed and the cells were fixed in 4% PFA for 20 minutes. They were then permeabilized in 0.5% Triton for 20 minutes and blocked in IF Buffer (PBS, 0.2% Triton, 0.05% Tween, 1% BSA) for 1 hour or immediately processed for EdU staining performed according to direct ions provided with the Click-iT Edu Imaging Kit (Invitrogen C10340). For immunofluorescent staining, cells were incubated in primary antibodies overnight in IF buffer: anti-KRT20 (1:200, Cell Signaling Technologies, #13063). They were then washed 3 times with PBS 0.1% Tween. Secondary antibodies (1:1000, same reagents as above) were incubated for 3 hours. The solution was removed and DAPI in PBS was added for 5 minutes and washed twice with PBS 0.1% Tween. The chambers were then removed and cover slips were mounted using Prolong Gold antifade medium (Invitrogen P36930). Human normal colon and tumor organoid isolation and culture
[00211] Isolation of human colonic crypts and adenomas; culture and maintenance of organoid cultures were performed as previously described (Sugimoto, S. & Sato, T., Methods Mol Biol 1612, 97-105, (2017)). Normal and adenoma tissues were collected from colonic resections according to protocols approved by Weill Cornell Medicine Institutional Review Board. Briefly, human colonic mucosa samples were obtained by trimming surgically resected specimens. The underlying muscle layer was removed using fine scissors under a stereomicroscope leaving the mucosa, which was cut into 5-mm pieces on a Petri dish, placed into a 15-ml centrifuge tube containing 10 ml of cold DPBS and washed 3 times. 10-ml of cold DPBS supplemented with 2.5 mM EDTA was added to the tube and incubated for Ihr room temp with gentle shaking. Isolated crypts were mixed with Matrigel (Corning, 354230), dispensed in the center of each well of a 6 well plate using a 200-pl pipette and placed at 37 °C for 10 min to solidify the Matrigel.
[00212] Normal colon organoids were also procured from Jason Spence’s laboratory at University of Michigan and were previously described in Tsai et al, 2018 (Tsai, Y. H. et al., Cell Mol Gastroenterol Hepatol 6, 218-222, (2018)) (specifically lines 87 and 89). Normal colon organoids were passaged 1:3 every 7 days by mechanical dissociation (pipetting) and grown in 12 well low attachment plates in 30pl Matrigel droplets. Normal colon organoids were cultured in media comprised of Advanced DMEM / F12, Pen / Strep, 4mM glutamax, 1% HEPES, primocin (lOOpg / ml), 50% L-WRN (Wnt3a, R-spondin, Noggin) conditioned media, N2, B27 without vitamin A, N-acetylcysteine (ImM), human recombinant EGF (50ng / ml), Y-27632 (lOpM), A-83-01 (500nM), SB202190 (lOpM). The L-WRN conditioned medium was generated by using L-WRN cells (ATCC CRL-3276). Following the protocol from Jason Spence’s laboratory at University of Michigan, the inventors collected the L-WRN conditioned media for 4 days. Conditioned media was pooled, sterile-filtered and frozen into aliquots until usage.
[00213] Human tumor organoids were procured through the Institute for Precision Medicine at Weill Cornell Medicine. Tumor colon organoids were split 1:3 every 7 days by digesting in TrypLE Select (Thermofisher) supplemented with lOpM Y27632 (Tocris Bioscience). Colon tumor organoids were maintained in media comprised of Advanced DMEM / F12, l%Pen / Strep, 1% glutamax, 1% HEPES, R-spondinl conditioned media (5%) N-acetylcysteine (1.25mM), human Recombinant EGF (50ng / ml), human Recombinant FGF-10 (20ng / ml), FGF-2 (1 ng / ml), Y-27632 (lOpM), A-83-01 (500nM), SB202190 (lOpM), Nicotinamide (lOmM), PGE2 (IpM), NRG (10 ng / ml), Human Gastrinl (lOnM) and propagated in GFR Matrigel. Normal and tumor human organoid co-cultures with endothelial cells
[00214] R-VEC or control CTRL-EC (at a final concentration of 5 million cells / ml) were mixed with normal colon or patient-derived tumor organoids, spun down and resuspended in Matrigel (Coming, 354230) or L.E.C mixture as described above. The cells were then dispersed in 30-70 pl Matrigel (or L.E.C) droplets in 8-well chamber slides (Lab-Tek II, 154534) or Nunc IVF 4-well dish (Thermo Scientific, cat# 144444) cultured in the respective organoid media with the addition of FGF-2 (lOng / ml) (Peprotech, 1000-18B) and heparin (lOOpg / ml) (Sigma H3149-100KU). Media was changed every other day. A 16 hour EdU pulse was used for normal colon organoids and a 4.5 hour pulse of EdU was used for all tumor organoid co-culture experiments (Click-iT EdU kit, Invitrogen C10340). The co-cultures were maintained in 37°C incubator with 20% oxygen. Triple negative breast cancer organoids were also procured from the Institute of Precision Medicine at Weill Cornell Medicine; media for maintenance and co-culture was the same as for colon tumor organoids described above (minus the presence of Gastrin). Normal and tumor colon organoids were stained similarly to mouse small intestinal organoid co-cultures. Antibodies against human EpCAM (Biolegend) and VEcad (R&D) were incubated overnight, followed by secondary antibody staining. The staining with MUC2 antibody (Santa Cruz) was modified to allow for 48 hours of primary antibody incubation and each wash was extended to 3x - 20 min each to eliminate potential background.
[00215] For single cell sequencing, co-cultures were maintained for 7 days. To collect cells in co-culture for single cell sequencing, medium was removed from the culture and the organoid- endothelial cell droplets were incubated in 2mg / ml of Dispase (Sigma) for Ihr at 37°C with shaking. The cells were then spun down and incubated for an additional 15 min at 37 °C in accutase. At this point the endothelial cells were mostly released from the co-cultures and collected by filtering through a 40pm mesh. The rest of the undigested cells (mainly organoid clusters) were further dissociated into single cells by incubating with TryplE for an additional 30 mins at 37°C until the cells were completely separated as single cells. This two-step digestion allowed for increased viability and efficient dissociation of both endothelial cells and organoids. Both the first and the second fraction were further processed for single cell analysis. Single cells were collected and filtered through a 35pm nylon mesh and processed for single cell sequencing.
[00216] For qPCR experiments, co-cultures were maintained for 7 days in Matrigel. To collect cells and dissociate organoids in co-cultures, the inventors incubated the Matrigel droplets with TrypLE-Express enzyme (Thermo Fisher Scientific, 3ml / 50pl Matrigel droplet) for 45mins at 37°C with vigorous shaking. The dissociated cells were then washed twice, once with organoid culture medium and once with MACs buffer. Dissociated cells were resuspended in lOOpL of MACS buffer and anti-human CD31 (Biolegend, lOpg / ml) was used to stain for endothelial cells for 30mins on ice. Cell suspension was washed with MACS buffer and resuspended in MACS buffer with DAPI (Ipg / ml). Subsequently, cells were sorted to collect for the DAPI CD31 population. Accurus PicoPure RNA isolation kit (ThermoFisher) was used to isolate RNA from the collected cells.
[00217] For in vivo experiments, 500,000 GFP labeled tumor colon organoids, dissociated to single cells for 10 min with TryplE, were mixed with 2 million mCherry labeled CTRL-EC or R-VECs and implanted subcutaneously in NSG mice. The tumors were retrieved 5 months post implantation. Quantifying interacting vessels with patient derived normal and tumor colon organoids documented in serial confocal movies
[00218] Tumor and normal colon organoids were stained with CellTracker (Invitrogen, C34565) per instruction manual by the manufacturer. Tumor and normal colon organoids were embedded inside Matrigel or L.E.C with either CTRL-ECs or R-VECs at 5million cells / ml. A mixture of gel and cells was pipetted onto glass-bottom dish and polymerized inside 37°C incubator for 15mins. The culture was then fed with organoid medium supplemented with lOng / ml bFGF (Peprotech), and lOOpg / ml Heparin (Sigma H3149-100KU). To enable long-term imaging, 6-hydroxy-2,5,7,8-tetramethylchroman-2-Carboxylic Acid (Sigma), as an antioxidant, was also added into the medium at lOOpM. Immediately, the culture was mounted onto a temperature-and gas-controlled chamber. Time lapse movies were acquired with a Zeiss Cell Observer confocal spinning disk microscope (Zeiss) equipped with a Photometries Evolve 512 EMCCD camera at an interval of 40mins over 3-4 days. Media was refreshed every two days.
[00219] To quantify the vessels interacting with normal and tumor colon organoids, Z-projection images of time lapse movies from several time points were obtained using ImageJ. Custom MATLAB codes were written to quantify the interacting vessel areas with all individual organoids. Briefly, the code was used to manually trace the perimeter of all vessels where endothelial cells were wrapping and tapping the organoids. The area of the manually traced interacting vessels was quantified and reported. Quantifying signal intensity for Mucin 2 (MUC2)
[00220] Human normal colon organoids were set up in co-culture with endothelial cells as described above. At day 8, cultures were fixed and processed for staining with Mucin 2 and EpCAM. After the staining procedure was complete, the inventors utilized 710 Zeiss confocal microscope to image the whole well of all cultures under a lOx air objective. To ensure accurate comparison between different culture conditions, the inventors used the same microscopic settings to image all the samples: same objective, same laser intensity, and same number of slices for each z-stack. Maximum projection of z-stack images was performed with ImageJ for all conditions. From maximum projection images, several organoids were blindly picked for each condition for quantification. Utilizing a custom MATLAB code, all organoids across all conditions were subjected to the same level of thresholding for Mucin 2 to remove the background. Using the merged image of EpCAM and Mucin2, the area of individual organoid was then traced and generated a binary image. The binary image of organoid area was overlaid with signal in Mucin 2 to isolate the signal of Mucin 2 within each organoid. The inventors then calculated the total signal intensity of Mucin 2 per area of each individual organoid. To enable comparison across different conditions, the signal intensity of Mucin 2 was normalized to the average value of signal intensity of Mucin 2 / organoid area quantified from the culture with intestinal organoids alone. Primary human pancreatic islets in static co-culture with endothelial cells:
[00221] Primary human islets were purchased from Prodo Laboratories Inc, California. 25 human islets were either cultured alone, co-cultured with CTRL-ECs, or co-cultured with R-VECs. CTRL-ECs and R-VECs were used at 5 million cells / ml. The human islets with and without endothelial cells were mixed in 40pL of Matrigel and plated into wells of Nunc IVF 4-well dish (Thermo Scientific, cat# 144444). The medium was comprised of glucose-free RPMI 1640 and supplemented with 0.1% human serum albumin, lOpg / ml human transferrin, 50pM Ethanolamine, 50pM Phosphoethanolamine, 6.7pg / ml sodium selenite, lOng / ml bFGF, lOOpg / ml heparin, and 5.5mM Glucose. After two weeks of co-culture, samples were prepared for glucose stimulated insulin secretion (GSIS). Samples were starved in Krebs-Ringer bicarbonate HEPES (KRBH) buffer containing 2mM glucose for 2hrs, followed by 45min in 2mM glucose as the basal insulin secretion and 45min in 16.7mM glucose as the stimulated insulin secretion. Insulin concentrations at the end of basal and stimulated phases were determined using STELLUX Chemi human Insulin ELISA (ALPCO). For each group, there were 11 replicates, with islets derived from 4 different donors. In other experiments, 200 human islets were cultured alone, or mixed with 250,000 CTRL-ECs or 250,000 R-VECs in 50pl Matrigel droplets (domes). Human islet explants in co-culture were stained and imaged at 1 and 2 weeks. EpCAM and VEcad antibodies were used to post-stain the co-cultures as described above for the mouse / human intestine and colon organoids.
[00222] To quantify the interacting vessels with human pancreatic islets, co-cultures were imaged using a lOx objective to capture both GFP-labeled vessels and human pancreatic islets in bright field. Using the custom MATLAB code, the area of GFP-labeled vessels that surrounded and wrapped the human pancreatic islets were traced for both cocultures with CTRL-ECs and with R-VECs. Organoids and human pancreatic islet co-culture in microfluidic devices.
[00223] To incorporate several human normal colon organoids and human pancreatic islets into the culture in a microfluidic device, the inventors manufactured a larger scale device using photo-lithography. The dimensions of the devices were extended and lengthened. The distance between the two fluidic channels or the width of the device is 3mm (increased from 1mm). The length of the device or the length of the fluidic channels is 5mm long. The height of the device is 1mm high. The device was cast off from the silicon wafer using PDMS (Dow-Coming) and adhered to a glass coverslip. Overall, the cell culture chamber is enclosed in a PDMS gasket of 5mm x 3mm x 1mm with the large volume capacity of 15 microliters. Before usage, the devices were plasma-etched and immediately treated with (3-Glycidyloxypropyl)trimethoxysilane (Sigma) overnight. The next day, they were submerged in water to wash overnight before usage. All experiments with human normal colon organoids, and human pancreatic islets were performed in the devices with 5mm x 3mm x 1mm dimension. All devices were kept in 37°C incubator with 20% oxygen.
[00224] For organoid co-culture in microfluidic device, human normal colon organoids (~40) were mixed with R-VECs in 5mg / ml bovine fibrinogen and 3U / ml bovine thrombin to a total of 30pL. R-VECs were used at 3million cells / ml. Two acupuncture needles 400pm diameter were also inserted inside the cell culture chamber. The gel and cell mixture was then injected into the cell culture chamber. After polymerization of fibrin gel, the needles were removed leaving two hollow fluidic channels in the devices. 200pL of human normal colon organoid medium supplemented with lOng / ml FGF-2, lOOpg / ml Heparin, and 5000U / ml Aprotinin (Sigma) was added into each of the two fluidic channels and refreshed daily. The devices were placed on a platform rocker (Benchmark 2000) during the entire experiment.
[00225] For human pancreatic islet culture experiments, devices were also set up similar to how human normal colon organoid experiments were set up. Approximately 75 human pancreatic islets were mixed either alone or with CTRL-EC or R-VECs (4 million cells / ml) cells in 5mg / ml bovine fibrinogen and 3U / ml bovine thrombin to a total volume of 30pL and injected into the devices with two acupuncture needles of 400pm diameter. The needles were removed after fibrin gel polymerization, and 200pL of medium for human pancreatic islet co-culture medium (described above) was added into each of the fluidic channels. The devices were placed on a platform rocker (Benchmark 2000) during the entire experiment. Glucose stimulation insulin secretion (GSIS) assay for human pancreatic islets in the devices.
[00226] Human pancreatic islets were placed in the devices as described above either alone, or in co-culture with CTRL-ECs or R-VECs. Cadaveric islets (from Prodo Labs, California) were procured from three separate donors, with a total of n=4 devices for No-EC, n=4 devices for CTRL-EC, n=8 devices for R-VEC. After 4 days in culture, a semi-dynamic GSIS assay was performed for islet co-culture in the devices. First, the media was removed in all the devices. The devices were then starved with 2 mM glucose for 2 hours in the incubator. At the end of starvation, 300pL of 2 mM glucose KRBH buffer was added at the inlet of the device, and devices were incubated at 37°C for 3 minutes. Driven by gravity, KRBH buffer flew through to the other side (outlet) of the device during the incubation. After the 3-minute incubation, fluid from the outlets was collected for insulin measurement through ELISA. The inlets were also emptied of any remaining fluid. Then, another 300 pL KRBH buffer was added to inlets, leaving the outlets empty. In R-VECs co-culture devices, 30 - 150 pL fluid was collected in the outlets due to high perfusion rates. In islets alone and CTRL-EC co-culture devices, only a small amount of fluid (< 10 pL) was found in the outlets. To enable sample collection, the inventors rinsed the outlets of islets alone and CTRL-ECs co-culture devices with 150 pL KRBH buffer and collected all outlet liquid for insulin measurement through ELISA. Such sample collection was repeated for a total of 8 times using 2 mM glucose KRBH buffer, and another 8 times using 16.7 mM glucose KRBH buffer. At the end, a series of semi-dynamic GSIS samples was rd acquired. The inventors examined the insulin concentration at the outlet of the device at the 3 (at t=9 min) and 8th (t=24 min) collections at both 2 mM and 16.7 mM glucose phases. The insulin level per device was calculated as: insulin per device = insulin concentration x collected volume. Basal insulin levels were determined as the average of the 3rd and 8th collections at 2 mM glucose. Insulin concentration was determined using STELLUX Chemi human Insulin ELISA (ALPCO). Staining protocol for experiments in devices.
[00227] To stain for endothelial cells in the devices, right before the experiment was terminated, the inventors aspirated all medium in both fluidic channels in the devices. 200pL VEcadherin antibody conjugated with Alexa 647 at lOpg / ml (Biolegend) was placed on one of the fluidic channels and allowed to slowly perfuse through the lumenized R-VEC vessels for 15-20mins in the incubator from one fluidic channel to the other fluidic channel. The device was then washed 3x with basal medium and fixed with PFA for 30-45mins.
[00228] When co-culture experiments were set up with human normal colon organoids and human pancreatic islets, the same protocol was utilized to stain for R-VEC lumenized vessels with VE-cadherin conjugated antibody. Post-fixation, the device was permeabalized with 0.1% Triton-X for 45mins and further stained with either EpCAM for human colon organoids or human pancreatic islets. To stain for EpCAM (Biolegend) the conjugated antibodies were added to both fluidic channels at lOpg / ml for 48hrs on a rocker at 4°C. The devices were washed 3x with IxPBS and subsequently washed submerged into IxPBS for 24 hrs on a rocker at 4°C. A similar staining procedure was used for insulin and post-VEcad staining, except permeabilization was done over night, followed by primary antibody staining as described above and secondary staining for 24 hrs on a rocker at 4 °C. The devices went through a washing for another 24 hrs with IxPBS on a rocker at 4 °C and then imaged were imaged using a Zeiss 710 confocal. Perfusion movies for beads and whole blood perfusion in larger scale devices (dimensions: 5mm x 3mm x 1mm).
[00229] For bead movie with human normal colon organoids in devices: the device (dimensions of 5mm x 3mm x 1mm) with human normal organoids was set up as described above. After 4 days, the device was placed on a Zeiss microscope. Using vacuum grease, the inventors sealed one end of both fluidic channels such that the two fluidic reservoirs diagonally to one another were left open for perfusion experiment. 4pm fluorescent microbeads (Invitrogen, F8858) were perfused into the open entrance of one of the fluidic channels at 20pL / min with a syringe pump (Harvard apparatus). The 4pm fluorescent microbeads entered the fluidic channel, traversed through the lumenized R-VEC vessels and exited to the other reservoir diagonally to reservoir where the beads entered.
[00230] For blood perfusion movie, the device (dimensions of 5mmx3mmxlmm) was prepared with 3million / ml R-VEC cells. 400pL medium was refreshed daily (PromoCell). At day 7, blood was collected from a donor following IRB protocol in a heparinized tube. Similar to how the device was prepared for bead movies with human normal colon organoids, the inventors sealed one end of both of the fluidic channels leaving two reservoirs diagonal to one another open for perfusion experiment. Whole heparinized human peripheral blood was obtained from consented healthy subjects with phlebotomy. Immediately, 200 microliters of whole blood was pipetted into one of the fluidic channels at the open reservoir, the blood cells along with intact plasma entered the fluidic channel, traversed through the lumenized R-VEC vessels and exited to the reservoir diagonal to the reservoir where blood entered. In experiments to perfuse blood in devices with R-VECs in co-culture with human pancreatic islets, the inventors stained blood cells with Pkh26 Red fluorescent dye (Sigma, MMIDI26-1KT) according to the manufacturer protocol for 5mins on ice. Fluorescently labeled blood cells were pipetted into the reservoir, traversed through the lumenized R-VEC vessels, and exited to the diagonal reservoir. In other devices (CTRL-ECs + human pancreatic islets, and human pancreatic islets alone), fluorescently labeled blood cells were not able to traverse from one fluidic channel to the other fluidic channel. Images were taken with Axio Observer Z1 equipped with Hamamatsu Flash 4.0 v2, sCMOS camera and 10x / 0.45 objective. RNA Library Preparation and Sequence Data Processing
[00231] RNA was isolated and purified using Qiagen’s Rneasy Mini Kit or Accurus PicoPure RNA isolation kit (ThermoFisher). RNA quality was verified using an Agilent Technologies 2100 Bioanalyzer. RNA library preps were prepared and multiplexed using Illumina TruSeq RNA Library Preparation Kit v2 (non-stranded and poly-A selection) and 10 nM of cDNA was used as input for high-throughput sequencing via Illumina’s HiSeq 2500 or HiSeq 4000 producing 51 bp paired-end reads. Sequencing reads were de-multiplexed (bcl2fastq) and mapped with STAR v2.6.0c (Dobin, A. et al., Bioinformatics 29, 15-21, (2013)) with default parameters to the appropriate NCBI reference genome (GRCh38.pl2 for human samples and GRCm38.p6 for mouse samples). Fragments per gene were counted with feature Counts vl.6.2 (Liao, Y. et al., Bioinformatics 30, 923-930, (2014)) with respect to Gencode comprehensive gene annotations (release 28 for human samples and M17 for mouse samples). Transcriptome Data Analysis
[00232] Differential gene expression analysis was performed using DESeq2 vl.18.1 (Love, M. I. et al., Genome Biol 15, 550, (2014)), and only FDR adjusted P-values <0.05 were considered statistically significant. Prior to differential gene expression analysis, lowly expressed genes were filtered out by only keeping genes that have more than 1 counts-per-million (CPM) in the condition with the least number of replicates. Base-2 log-transformed CPM values were used for heatmap plots, which were centered and scaled by row. Prior to visualization, tissue specific effects were removed using the removeBatchEffect function from limma v3.34.9 (Ritchie, M. E. et al., Nucleic Acids Res 43, e47, (2015)). Gene ontology analysis was performed using DAVID Bioinformatics Resource Tools v 6.8 (Huang da, W. et al., Nat Protoc 4, 44-57, (2009)). ChIP and antibodies
[00233] To identify genome-wide localization of ETV2, K4me3, and K27ac modification in R-VEC or CTRL-EC, ChIP assays were performed with approximately 1x10 cells per experiment. Cells introduced with triple flagged ETV2 lentivirus (as described above) were used for the ETV2 ChIP. Briefly, cells were crosslinked in 1% paraformaldehyde (PFA) for 10 min at 37°C, then quenched by 0.125M glycine. Chromatin was sheared using a Bioruptor (Diagenode) to create fragments of 200-400 bp, immunoprecipitated by 2-5 |lg of antibody or mouse IgG bound to 75 pl Dynabeads M-280 (Invitrogen) and incubated overnight at 4°C. Magnetic beads were washed and chromatin was eluted. The ChIP DNA was reverse-crosslinked and column-purified. All ChIP antibodies are identified at attached in table below. ChlP-qPCR
[00234] Primers are listed in Table 1. DNA samples collected before (input) or after ChIP experiment were diluted 1:100 in H2O and applied to qPCR analysis with SYBR Green PCR master mix in an Applied Biosystems StepOnePlus system. The signal was calculated as fold enrichment relative to an intergenetic region. ChlP-seq library construction and sequencing
[00235] ChlP-seq libraries were prepared with the Illumina TruSeq ChIP Library Preparation Kit for DNA from ETV2, K4me3, and K27ac modification ChIP; and with the KAPA Hyper Prep Kit for DNA from K4me3, K27ac and K27me3 modification collected from small-scale ChIP assays. ChlP-seq libraries were sequenced with Illumina HiSeq 4000 system. ChlP-seq data processing and analysis
[00236] ChlP-seq reads were aligned to the reference human genome (hgl9, Genome Reference Consortium GRCh37) using the BWA alignment software (version 0.5.9) (Li, H. & Durbin, R., Bioinformatics 25, 1754-1760, (2009)). Unique reads that mapped to a single best-matching location with no more than 4% of the read length of mismatches were kept for peak identification and profile generation. Sequence data were visualized with IGV by normalizing to 1 million reads. The software MACS2 (Zhang, Y. et al., Genome Biol 9, R137, (2008)) was applied to the ChlP-seq data with sequencing data from input DNA as control to identify genomic enrichment (peak) of ETV2. SICER (version 1.1) (Zang, C. et al., Bioinformatics 25, 1952-1958, (2009)) algorithm was applied to the ChlP-seq data with sequencing data from input DNA as control to identify genomic regions with significant enrichment differences in different cell types. The resulting peaks were filtered by p-value<0.05 for ETV2 and FDR<0.01 for histone modifications. The inventors computed the read counts in individual promoters by HOMER (Heinz, S. et al., Mol Cell 38, 576-589, (2010)). Each identified peak was annotated to promoters (±2 kb from transcription start site), gene body, or intergenic region by HOMER. lOx Chromium single cell transcriptomics and analysis
[00237] Once the inventors established a stable 3D model of arborized organoids (both normal and tumor organoids) with R-VECs, the inventors set forth to study the molecular crosstalk between endothelial cells and the organoids. Tissue-specific endothelial cells manifest remarkable vascular heterogeneity in vivo, therefore the inventors proposed that R-VECs could model this adaptation to surrounding tissue when co-cultured with either normal colon organoids or tumor colon organoids in vitro. Single cell analysis could help elucidate this interaction by molecularly defining the adaptation or maladaptation of R-VECs at the single cell level, therefore informing the inventors not only of intersample heterogeneity, but also of intrasample heterogeneity of endothelial cells upon 3D co-culture. The following two experiments were performed for single cell library preparation to establish adaptation of R-VECs upon co-culture with organoids:
[00238] Experiment 1: R-VECs were co-cultured alone or together with Normal Colon Organoids for 7 days in complete organoid growth media with FGF and Heparin. Normal Colon Organoids were also cultured alone in complete organoid growth media with FGF and Heparin for 7 days. After 7 days, all three conditions (R-VEC alone, R-VEC + Normal Colon Organoids, or Normal Colon Organoids alone) were dissociated with collagenase, dispase and TryplE and submitted for lOx Chromium single cell analysis. All three samples were processed and run at the same time.
[00239] Experiment 2: R-VECs were co-cultured alone or together with Colon Tumor Organoids for 7 days in complete organoid growth media with FGF and Heparin. Tumor Colon Organoids were also cultured alone in complete organoid growth media with FGF and Heparin for 7 days. After 7 days, all three conditions (R-VEC alone, R-VEC + Colon Tumor Organoids, or Tumor Colon Organoids alone) were dissociated with collagenase, dispase and TryplE and submitted for lOx Chromium single cell analysis. All three samples were processed and run at the same time.
[00240] The single cell suspension was loaded onto a well on a lOx Chromium Single Cell instrument (lOx Genomics). Barcoding and cDNA synthesis were performed according to the manufacturer's instructions. Briefly, the lOx™ GemCode™ Technology partitions thousands of cells into nanoliter-scale Gel Bead-In-EMulsions (GEMs), where all the cDNA generated from an individual cell share a common lOx Barcode. In order to identify the PCR duplicates, Unique Molecular Identifier (UMI) was also added. The GEMs were incubated with enzymes to produce full length cDNA, which was then amplified by PCR to generate enough quantity for library construction. Qualitative analysis was performed using the Agilent Bioanalyzer High Sensitivity assay. The cDNA libraries were constructed using the lOx ChromiumTM Single cell 3’ Library Kit according to the manufacturer’s original protocol. Briefly, after the cDNA amplification, enzymatic fragmentation and size selection were performed using SPRI select reagent (Beckman Coulter, Cat# B23317) to optimize the cDNA size. P5, P7, a sample index and read 2 (R2) primer sequence were added by end repair, A-tailing, adaptor ligation and sample-index PCR. The final single cell 3’ library contains a standard Illumina paired-end constructs (P5 and P7), Read 1 (RI) primer sequence, 16 bp lOx barcode, 10 bp randomer, 98 bp cDNA fragments, R2 primer sequence and 8 bp sample index. For post library construction QC, lul of sample was diluted 1:10 and ran on the Agilent Bioanalyzer High Sensitivity chip for qualitative analysis. For quantification, Illumina Library Quantification Kit (KAPA Biosystems, Cat# KK4824) was used.
[00241] Libraries were sequenced on Illumina NextSeq500 with 150 cycle kit using the following read length: 26bp Readl for cell barcode and UMI, 8bp 17 index for sample index and 132bp Read2 for transcript. Cell Ranger 2.2.0 was used to process Chromium single cell 3’ RNA-seq output. First, "cellranger mkfastq" demultiplexed the sequencing samples based on the 8bp sample index read to generate fastq files for the Readl and Read2, followed by extraction of 16bp cell barcode and lObp UMI. Second, "cellranger count" aligned the Read2 to the huma Dobin, A. et al., Bioinformatics 29, 15-21, (2013)). Then, aligned reads were used to generate data matrix only when they have valid barcodes and UMI, map to exons (Ensembl GRCh38) without PCR duplicates. Valid cell barcodes were defined based on UMI distribution.
[00242] All single cell analyses were performed using the Seurat package in R (version 2.3.4) (Butler, A. et al., Nat Biotechnol 36, 411-420, (2018)). Once the gene-cell data matrix was generated, poor quality cells were excluded, including cells with more than 6,000 unique expressed genes (as they are potentially cell doublets). Only genes expressed in 3 or more cells in a sample were used for further analysis. Cells were also discarded if their mitochondrial gene percentages were over 10% or if they expressed less than 600 unique genes, resulting in 20,778 genes across 24,478 cells and median UMI count for each cell across the entire dataset being 7,845 and the median number of unique genes per cell being 2,397. Following best practices in the package suggestions UMI counts were log-normalized and after the most highly variable genes selected the data matrices were scaled using a linear model with variation arising from UMI counts and mitochondrial gene expression mitigated for. Principal component analysis was subsequently performed on this matrix and after reviewing principal component heatmaps and jackstraw plots Uniform Manifold Approximation and Projection (UMAP) visualization were performed on the top 29 components and clustering resolution was set at 1.0 for visualizations. Differential gene expression for gene marker discovery across the clusters were performed using the Wilcoxon rank sum test as used in the Seurat package.
[00243] Epithelial cells were identified by epithelial cell markers EpCAM, CDH1, KRT19 and endothelial cells were identified by endothelial cell markers VEcadherin (CDH5), PECAM1 (CD31) and VEGFR2 (KDR). Subsequent to this, epithelial cells were filtered out from the next analysis to identify heterogeneity amongst the endothelial cell populations of the cocultured normal and tumor cell populations. The epithelial cell fraction was also analyzed on its own in the tumor and cocultured samples. In both these analyses best practices were again followed for cluster discovery using the top 20 components and cluster resolution 0.6 in the matched tumor and normal sample sets and differential gene expression for gene marker discovery across the clusters were performed using the Wilcoxon rank sum test as used in the Seurat package. Statistical analysis:
[00244] Data were assessed and analyzed using appropriate statistical methods. Normality of data was assessed using Kolmogorov-Smirnov test. Sample sizes and statistics for each experiment are provided in figure legends. GraphPad Prism 7 was used for all statistical analysis, unless otherwise indicated.
Claims
1. A method for vascularizing a pancreatic islet comprising:coculturing a pancreatic islet comprising p cells with an endothelial cell which comprises an exogenous nucleic acid encoding an ETV2 transcription factor, wherein the ETV2 transcription factor is expressed in the endothelial cell, thereby generating a vascularized pancreatic islet.
2. The method of claim 1, wherein the endothelial cell further comprises an exogenousnucleic acid encoding a Sox17 transcription factor, and wherein the Sox17 is expressed in the endothelial cell.
3. The method of claim 1 or claim 2, wherein the coculturing is performed for at least 34 weeks.
4. The method of claim 3, further comprising coculturing the pancreatic islet and theendothelial cell for an additional period of time, wherein the further co-culturing occurs under conditions wherein the endothelial cell does not express the ETV2 transcription factor.
5. The method of claim 4, wherein the further coculturing is performed for at least oneweek.
6. The method according to any one of claims 1-5, wherein the endothelial cellcomprises a human umbilical vein endothelial cell (HUVEC), an adipose-derived endothelial cell, or an organ-specific endothelial cell.
7. The method of claim 6, wherein the organ-specific endothelial cell is selected fromthe group consisting of a heart-specific endothelial cell, a muscle-specific endothelial cell, a kidney-specific endothelial cell, a testis-specific endothelial cell, an ovary-specific endothelial cell, a lymphoid-specific endothelial cell, a liver-specific endothelial cell, a pancreas-specific endothelial cell, a brain-specific endothelial cell, a lung-specific endothelial cell, a bone marrow-specific endothelial cell, a spleen-specific endothelial cell, a large intestine-specific endothelial cell, and a small intestine-specific endothelial cell.
8. The method according to any one of claims 1-7, wherein the coculturing comprisesculturing in media comprising basic FGF (FGF-2) and heparin.2020299624 15 Jun 20269. The method according to any one of claims 1-8, wherein the coculturing is performedin a bioreactor or a microfluidic device.
10. The method according to any one of claims 1-9, wherein the coculturing is performed on an extracellular matrix comprising a laminin and entactin mixture of between 10 and 12 mg / ml final combined concentration and collagen IV of between 0.2 and 0.5 mg / ml.
11. The method according to any one of claims 1-10, wherein the vascularization comprises the formation of an artery, a vein, a capillary, an arteriole, a venule, lymphatic vessels, or a combination thereof.
12. A vascularized pancreatic islet obtained by the method according to any one of claims 1-11.
13. A method, comprising administering the vascularized pancreatic islet obtained according to claim 12 to a subject in need.
14. The method of claim 13, wherein the pancreatic islet is autologous to the subject.
15. The method of claim 13 or 14, wherein the islet is administered to the subject bysurgical or catheter implantation or infused through an intravascular route.
16. The method of claim 13 or 14, wherein the islet is administered to the subject subcutaneously or through intravascular infusion.
17. A method for making a vascularized 0-cell organoid, comprising coculturing 0-cells with an endothelial cell comprising an exogenous nucleic acid encoding an ETV2 transcription factor under conditions wherein the endothelial cell expresses the ETV2 transcription factor.
18. The method of claim 17, wherein the endothelial cell further comprises an exogenous nucleic acid encoding a Sox17 transcription factor, wherein the endothelial cell expresses the Sox17 transcription factor.
19. The method of claim 17 or 18, wherein the coculturing comprises culturing in media comprising basic FGF (FGF-2) and heparin.2020299624 15 Jun 202620. The method according to any one of claims 17-19, wherein the coculturing is performed for at least 3-4 weeks.
21. The method of claim 20, further comprising coculturing the P-cells and the endothelial cell for an additional period of time, wherein the further coculturing is performed under conditions wherein the endothelial cell does not express the ETV2 transcription factor.
22. The method of claim 21, wherein said further coculturing is performed for at least one week.
23. The method according to any one of claims 17-22, wherein the endothelial cell comprises a human umbilical vein endothelial cell (HUVEC), an adipose-derived endothelial cell or an organ-specific endothelial cell.
24. The method of claim 23, wherein the organ-specific endothelial cell is selected from the group consisting of a heart-specific endothelial cell, a muscle-specific endothelial cell, a kidney-specific endothelial cell, a testis-specific endothelial cell, an ovary-specific endothelial cell, a lymphoid-specific endothelial cell, a liver-specific endothelial cell, a pancreas-specific endothelial cell, a brain-specific endothelial cell, a lung-specific endothelial cell, a bone marrow-specific endothelial cell, a spleen-specific endothelial cell, a large intestine-specific endothelial cell, and a small intestine-specific endothelial cell.
25. The method of claim 17, wherein the coculturing is carried out on an extracellular matrix comprising a laminin and entactin mixture of between 10 and 12 mg / ml final combined concentration and collagen IV of between 0.2 and 0.5 mg / ml.
26. The method according to any one of claims 17-25, wherein the coculturing is performed in a bioreactor or a microfluidic device.
27. The method according to any one of claims 17-26, wherein the vascularization comprises the formation of an artery, a vein, a capillary, an arteriole, a venule or lymphatic vessels or a combination thereof.
28. A vascularized P-cell organoid obtained according to any one of claims 17-27.
29. A method, comprising administering the vascularized P-cell organoid of claim 28 to a subject in need.2020299624 15 Jun 202630. The method of claim 29, wherein the vascularized p-cell organoid is administered to the subject by surgical or catheter implantation or infused through an intravascular route.
31. The method of claim 29, wherein the vascularized p-cell organoid islet isadministered to the subject subcutaneously.
32. The method according to any one of claims 30-31, wherein the vascularized p-cell organoid comprises cells selected from the group consisting of (1) p-cells derived from Embryonic Pluripotent Stem Cells (ESC), (2) p-cells derived from induced Pluripotent Cells (iPS), (3) p-cells derived from direct transcriptional conversion of fibroblasts, and (4) p-cells isolated from the adult subjects.
33. The method according to any one of claims 30-31, wherein the vascularized p-cell organoid are autologous to the subject.
Citation Information
Patent Citations
Method for providing vascular system in biological tissue
EP3026110A1
Vascularized islets and methods of producing same
WO2008111064A1
Methods of generating functional human tissue
WO2016141137A1
Compositions and methods for organoid generation and disease modeling
WO2017205511A1
Stable three-dimensional blood vessels and methods for forming the same
WO2018144860A1