Methods for the diagnosis, prognosis and treatment of cancer metastasis

By measuring genes expressed in breast cancer tissues that respond to changes in c-MAF gene expression levels, predicting the risk of metastasis in breast cancer, the problem of difficulty in effectively diagnosing and predicting breast cancer metastasis in the prior art is solved, and the need for individualized treatment is achieved.

CN105431548BActive Publication Date: 2025-06-17BIOMEDICAL RES INST FOUNDATION +1
View PDF 29 Cites 0 Cited by

Patent Information

Application Number
CN201480015519.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2013-03-15
Filing Date
2014-03-14
Publication Date
2025-06-17
Estimated Expiration
2034-03-14

AI Technical Summary

Technical Problem

The prior art is difficult to effectively diagnose and predict whether breast cancer patients will experience metastasis, resulting in the inability to take appropriate treatments in a timely manner.

Method used

The risk of metastasis in breast cancer was predicted by determining the expression levels of genes that expressed in response to changes in c-MAF gene expression levels in cancer tissue samples, including PTHLH, PODXL and RERG genes.

Benefits of technology

This method can effectively predict the metastasis risk of breast cancer patients, help formulate individualized treatment plans, and improve treatment results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005301490590000191
    Figure GDA0005301490590000191
  • Figure GDA0005301490590000201
    Figure GDA0005301490590000201
  • Figure GDA0005301490590000211
    Figure GDA0005301490590000211
Patent Text Reader

Abstract

In addition to designing customized therapies for subjects suffering from cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, and thyroid cancer, the present study also describes methods for determining the likelihood of metastasis in a subject suffering from cancer based on the determination of the expression levels of one or more genes whose expression is upregulated by elevated c-MAF expression. It also describes methods for identifying signature genes having a propensity for metastatic cancer based on the modulation of induced c-MAF expression, and ultimately the use of PTHLH and PODXL inhibitors and RERG activators in the treatment and / or prevention of cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, and thyroid cancer.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Object of the invention

[0002] In addition to methods for generating customized therapies for subjects suffering from cancer, in particular breast, colon, lung, kidney or thyroid cancer, the present invention also relates to methods for determining the likelihood that a subject suffering from cancer, in particular breast, colon, lung, kidney or thyroid cancer, will develop metastatic cancer. Such methods consist of measuring the expression levels of a set of genes whose expression is related to the expression of the c-MAF gene. The present invention also includes the use of PTHLH and PODXL inhibitors and RERG activators in the treatment and / or prevention of metastatic cancer, in particular breast, colon, lung, kidney or thyroid cancer. Background of the invention

[0004] Breast cancer is the second most common cancer type worldwide (10.4%; after lung cancer) and the fifth leading cause of cancer death (after lung, stomach, liver and colon cancer). Is breast cancer the most common cause of death in women? In 2005, breast cancer caused 502,000 deaths worldwide (7% of cancer-related deaths; almost 1% of all deaths). The number of global cases has increased significantly since the 1970s, a phenomenon partly attributed to the modern lifestyle in the Western world.

[0005] All cells have receptors on their surface, in the cytoplasm and in the nucleus. Certain chemical messengers such as hormones bind to these receptors, and this leads to changes in the cell. Three main receptors can affect breast cancer cells: estrogen receptor (ER), progesterone receptor (PR) and HER2 / neu. To name cells containing one of these receptors, a plus sign is used when the receptor is present and a minus sign when it is absent: ER positive (ER+), ER negative (ER-), PR+ (positive), PR negative (PR-), HER2+ (positive) and HER2 negative (HER2). Receptor status has become an important assessment for all forms of breast cancer, as it determines the suitability of the use of specific therapies such as tamoxifen or trastuzumab. The alpha isoform of the estrogen receptor (ER) is overexpressed in approximately 65% of diagnosed breast cancer cases. This type of breast cancer is called "ER-positive" (ER+). In this case, the binding of estrogen to ER promotes the proliferation of cancer cells in mammalian cells. Cancerous ER+ cells are highly dependent on this stimulus to spread, which is why ER is currently used as a therapeutic target.

[0006] The fact that the majority of deaths in cancer patients with solid tumors are caused by advanced metastases makes it crucial to understand the molecular and cellular mechanisms that enable tumors to metastasize. Recent publications have illustrated, among other things, how metastatic cell types display tropism for certain organs and how metastasis is caused by complex mechanisms that are poorly understood. These tissue-specific metastatic cells have a set of acquired functions that enable them to colonize in specific organs.

[0007] Patent application EP1961825-A1 describes a method for predicting the occurrence of metastatic breast cancer in bone, lung, liver, and brain, which consists of determining the expression level of one or more markers (including c-MAF) in a cancerous tissue sample relative to the corresponding expression level in a control sample. In addition, this document requires the simultaneous determination of several genes to determine the survival period of breast cancer patients, and the relationship between the ability of the gene signature to predict the survival period without bone metastasis is not statistically significant.

[0008] Bos, P.D., et al. [Nature, 2009, 459:1005-1009] describe genes involved in breast cancer metastasis to the brain.

[0009] Patent application US2005 / 0181375 describes a method for detecting metastatic breast cancer based on the detection of the expression levels of many genes that are upregulated or downregulated in metastatic tumors, especially tumors that metastasize to the brain.

[0010] International patent application WO2010 / 000907 describes a genetic signature that serves as a genomic predictor of distant metastasis in breast cancer patients.

[0011] However, there is a need in the art for genetic markers that diagnose and / or predict whether patients with specific breast cancers, such as ER- or ER+ breast cancers, will develop metastases, thereby allowing the use of appropriate therapies for subjects with such cancers. The identification of new prognostic factors will serve as a guide for selecting the most appropriate treatment. Summary of the Invention

[0013] The authors of the present invention have identified a group of genes whose expression increases or decreases in breast cancer samples due to changes in the expression of the c-MAF gene. Through gain-of-function experiments and relevant clinical data, the authors have confirmed the roles of these genes, particularly the role of the RERG gene whose expression is inversely correlated with the expression of c-MAF, and the roles of the PTHLH and PODXL genes whose expressions are directly correlated with the expression of c-MAF, such as prognostic markers for ER+ breast cancer metastasis to bone.

[0014] Thus, in a first aspect, the present invention relates to an in vitro method for predicting metastatic cancer in a subject, particularly breast cancer, colon cancer, lung cancer, kidney cancer, and thyroid cancer, especially breast cancer, which consists of determining the expression level in a cancer tissue sample of one or more genes whose expression is regulated in response to an increase in the c-MAF expression level of said tumor, wherein the altered expression level of said one or more genes relative to a standard value is an indication of a high risk of developing metastatic cancer.

[0015] A second aspect of the present invention relates to an in vitro method for generating a customized therapy for a subject suffering from cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, which consists of determining the expression level in a cancer tissue sample of one or more genes whose expression is regulated in response to an increase in the c-MAF expression level of said tumor, wherein the altered expression level of said one or more genes relative to a standard value is an indication of a high risk that the subject is receptive to a therapy aimed at preventing metastasis.

[0016] A third aspect of the present invention relates to the use of a reagent for inhibiting the expression of a gene or the activity of the expression product of said gene for the preparation of a medicament for the treatment and / or prevention of metastatic cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, wherein the gene is characterized by the fact that its expression in neoplastic cells (particularly breast cancer cells, colon cancer cells, lung cancer cells, kidney cancer cells, and thyroid cells, especially breast cancer cells) increases in response to an increase in the c-MAF expression level in these cells, or decreases in response to a decrease in the c-MAF expression level in these cells.

[0017] A fourth aspect of the present invention relates to the use of a reagent for stimulating the expression of a gene or the activity of the expression product of said gene for the preparation of a medicament for the treatment and / or prevention of metastatic cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, and thyroid cancer, especially breast cancer, wherein the gene is characterized by the fact that its expression in neoplastic cells (particularly breast cancer cells, colon cancer cells, lung cancer cells, kidney cancer cells, and thyroid cells, especially breast cancer cells) increases in response to an increase in the c-MAF expression level in these cells, or decreases in response to a decrease in the c-MAF expression level in these cells.

[0018] A final aspect of the present invention relates to an in vitro method for identifying a marker gene in a subject suffering from cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, said method comprising:

[0019] (i) determination of the expression levels of a candidate and the c-MAF gene in a primary cancer (particularly breast cancer) tumor sample, and

[0020] (ii) Determine the change in the expression level of the candidate gene in a population of cancer cells, particularly breast cancer cells, in response to the regulation of c-MAF gene expression

[0021] Wherein the expression level of the gene is statistically significantly correlated with c-MAF expression in primary cancer (particularly breast cancer) tumor samples, and the change in expression in response to the regulation of c-MAF gene expression is statistically significantly correlated with the change in the level of the gene, is an indication that the gene is a marker of the propensity of the subject to develop metastases. Brief Description of the Drawings

[0023] Figure 1. (A) Association of increased (left) or decreased (right) MBP gene with the phenotype of bone metastases in ER+ breast cancer patients ("GSEA" algorithm). (B) Association of increased (left) or decreased (right) MBP gene with the phenotype of bone metastases in a series of metastases to bone, lung, liver, and brain from primary breast cancer tumors ("GSEA" algorithm). The same approach for increased genes has been performed for metastases to lung, brain, and liver.

[0024] Figure 2. (A) Analysis of the Ki-67 expression level, a proliferation marker, of metastatic lesions in an experimental mouse model of xenograft type using moderately metastatic (parental) ER+, MCF7 breast cancer cells and its derivative highly metastatic to bone (BoM2). (B) Validation of the relationship between MAF expression and the RERG gene using quantitative RT-PCR. (C) Bone metastases in mice using BoM2 cells with or without MAF. The Ki-67 signal and caspase-3 activity were quantified by immunohistochemistry. (D) Increased RERG was induced in cells highly metastatic to bone. Cell derivatives with RERG expression were injected into the left ventricle of mice, and bioluminescence imaging technology was used to analyze the colonization of bone in situ and in real time to verify the contribution of RERG to ER+ breast cancer metastasis to bone in the presence of MAF.

[0025] Figure 3. (A) Quantification of the number of osteolytic bone metastases in mice injected with different cell types characterized by different MAF levels using X-rays. (B) Quantification of the number of TRAP (tartrate-resistant acid phosphatase), an osteoclast marker, cells on the periphery of metastatic lesions of damage caused by cells characterized by different MAF levels. (C) Validation of the relationship between MAF expression and the PTHLH gene using quantitative RT-PCR. (D) Experiment on the differentiation of osteoclasts in vitro using stem cells. The differentiation process is carried out in the presence of RANK ligand, G-CSF, and media from different populations. Parental cells, parental cells expressing short and long MAF isoforms, and the latter cells in the presence of a peptide that neutralizes the function of PTHLH. (E) Bone metastasis experiment in an experimental metastasis model of mice. Cells with or without c-MAF expression are injected, and in the latter case, a group of mice is inoculated intraperitoneally with an antagonist PTHLH peptide (12 μg / mouse / day) into the left ventricle twice daily, thereby quantifying the appearance of lesions and growth into bone. The left graph illustrates the intensity of the endpoint signal. The right graph designates the number of osteolytic lesions in each group. (F) On the left, the figure frame shows X-ray images (white areas show osteolytic lesions, missing bone) and TRAP+ staining (osteoclast marker) of bone representing the groups described in (E). White triangles indicate osteoclasts. On the right, the figure frame shows the area of the TRAP signal normalized by the perimeter.

[0026] Figure 4. (A) Quantification by fluorescence of the number of cells expressing high (shControl) or reduced (shMAF) c-MAF gene levels bound to a layer of bone marrow-derived cells (BMSC). (B) Quantification by fluorescence of the number of cells expressing high (shControl) or reduced (shMAF#1 or #2) c-MAF gene levels bound to a layer of extracellular lung matrix proteins such as fibronectin. This situation shows the opposite effect on the binding of bone marrow cells. (C) A panel of genes whose expression changes with the change in c-MAF expression and has been verified by RT-PCR. One of them is PODXL, a gene of a protein from the selectin family (glycoprotein) that can participate in the process of transient weak cell-cell binding. (D) Functional validation of the binding of cancerous breast cells expressing c-MAF to bone marrow cells by the PODXL gene. Comparison of the competitive effects of neutral (RGES) or blocking (RGDS) peptides with integrin-mediated attachment. This process is specific because it is not reproduced in human umbilical vein endothelial cells (HUVEC). DETAILED DESCRIPTION OF THE INVENTION

[0028] Definitions of general expressions and terms

[0029] As used in the present invention, " c-MAF inhibitor"refers to any molecule that can partially or completely inhibit the expression of the c-MAF gene, prevent the expression of said gene from occurring (disrupt the transcription of the c-MAF gene and / or block the translation of mRNA from the c-MAF gene expression), and directly inhibit the activity of the c-MAF protein. Inhibitors of c-MAF gene expression can be identified using methods based on the ability of a putative inhibitor to block the ability of c-MAF to promote cell proliferation in vitro (as illustrated in International Patent Application WO2005 / 046731), based on the ability of a putative inhibitor to block the transcription of a reporter gene under the control of the cyclin D2 promoter and a promoter containing a c-MAF response region (MARE or c-MAF response element) in cells expressing c-MAF (as described in WO2008098351), or based on the ability of a putative inhibitor to block gene expression under the control of the IL-4 promoter in response to stimulation with PMA / ionomycin in cells expressing NFATc2 and c-MAF (as described in US2009048117A).

[0030] In the specification of the present invention, "inhibitor antibody" means an antibody that can bind to the expression product in a specific manner and inhibit one of the more functions of the protein.

[0031] The term " Small interfering RNA " ("s iRNA") refers to a duplex of small RNA inhibitors that induce RNA interference. These molecules can vary in length (usually 18 - 30 base pairs) and have varying degrees of complementarity to their target mRNA on the antisense strand. Some (but not all) s iRNAs are characterized by unpaired bases in overhangs at the 5' or 3' ends of the sense and / or antisense strands. The term "s iRNA" includes duplexes of two separate strands. As used herein, s iRNA molecules are not limited to RNA molecules and also include nucleic acids having one or more chemically modified nucleotides such as morpholinos.

[0032] As used herein, the term " shRNA " or "short hairpin RNA" refers to a dsRNA of nucleotides in which the two strands form a duplex structure by strand binding without disrupting the 3' end of one strand and the 5' end of the other strand.

[0033] The term " Increased gene expression" refers to the fact that the expression level of a gene is relatively high compared to a standard or control value (which corresponds to the expression level of the same gene in a control sample). According to the present invention, when the level of a patient's sample is elevated by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150% or more, the expression level of the gene is considered relatively high compared to the standard value.

[0034] As used herein, " c-MAF " refers to the gene also known as "v-maf musculoaponeurotic fibrosarcoma oncogene homolog" (avian), MAF or MGC71685), which is a transcription factor containing a leucine zipper that functions as a homodimer or heterodimer. Depending on the DNA binding site, the encoded protein can be a transcriptional activator or repressor. The DNA sequence encoding c-MAF is described in the NCBI database under accession number NG_016440 (corresponding to the NCBI version of December 18, 2011). The foregoing DNA sequence is followed by the transcription of 2 messenger RNAs, each of which gives rise to one of the c-MAF protein isoforms, isoform α or 1 (corresponding to the long c-MAF isoform) and isoform β or 2 (corresponding to the short c-MAF isoform). The complementary DNA sequences of each of the foregoing isoforms are described in the NCBI database under accession numbers NM_005360.4 and NM_001031804.2, respectively (corresponding to the NCBI version of December 18, 2011).

[0035] The terms "cancer", "carcinoma", or "tumor" refer to diseases characterized by the uncontrolled proliferation of abnormal cells that are capable of invading adjacent tissues and spreading to distant organs. The term includes, but is not limited to, cancers of the breast, heart, small intestine, colon, spleen, kidney, bladder, head, neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testicle, hepatobiliary system, and liver; in addition, there are tumors such as, but not limited to, adenoma, angiosarcoma, astrocytoma, epithelial carcinoma, germ cell tumor, glioblastoma, glioma, hemangioendothelioma, angiosarcoma, hematoma, hepatoblastoma, leukemia, lymphoma, medulloblastoma, melanoma, neuroblastoma, hepatobiliary carcinoma, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma, and teratoma. In addition, the term includes acral lentiginous melanoma, actinic keratosis adenocarcinoma, adenoid cystic carcinoma, adenoma, adenosarcoma, adenosquamous cell carcinoma, astrocytoma, Bartholin gland adenocarcinoma, basal cell carcinoma, bronchioalveolar adenocarcinoma, capillary carcinoid, carcinoma, carcinosarcoma, cholangiocarcinoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymosarcoma, Ewing sarcoma, focal nodular hyperplasia, germ cell tumor, glioblastoma, glucagonoma, hemangioblastoma, hemangioendothelioma, hemangioma, hepatic adenoma, hepatic adenomatosis, hepatocellular carcinoma, hepatobiliary carcinoma, insulinoma, intraepithelial neoplasia, squamous intraepithelial neoplasia, invasive squamous cell carcinoma, large cell carcinoma, leiomyosarcoma, melanoma, malignant melanoma, malignant mesothelial tumor, medulloblastoma, medulloepithelioma, mucoepidermoid carcinoma, neuroblastoma, neuroepithelial adenocarcinoma, nodular melanoma, osteosarcoma, papillary serous adenocarcinoma, pituitary tumor, plasmacytoma, pseudosarcoma, pulmonary blastoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, serous carcinoma, small cell carcinoma, soft tissue carcinoma, somatostatin-secreting tumor, squamous cell carcinoma, squamous cell carcinoma, undifferentiated carcinoma, uveal melanoma, verrucous carcinoma, pancreatic tumor, Wilm tumor, intracranial carcinoma, head and neck carcinoma, rectal carcinoma, astrocytoma, glioblastoma, small cell carcinoma, and non-small cell carcinoma, metastatic melanoma, androgen-independent metastatic prostate cancer, androgen-dependent metastatic prostate cancer, and breast cancer. For the purposes of the present specific invention, cancer refers to breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, particularly breast cancer.

[0036] The expression "colon cancer" refers to any malignant proliferative disease of the cells of the colon, rectum, and appendix. The term colon cancer includes the staging of any of the following diseases:

[0037] - Stage 0: Occult carcinoma in the innermost layer of the intestine

[0038] - Stage 1: Cancer in the inner layer of the intestine

[0039] - Stage 2: Cancer that has spread through the muscular wall of the colon

[0040] - Stage 3: Cancer that has spread to the lymph nodes

[0041] - Stage 4: Cancer that has spread to other organs.

[0042] The expressions “breast cancer,” “mammary cancer,” or “bosom cancer” refer to the types of cancer that arise in breast tissue. The term “breast cancer” includes cancers classified under the TNM staging system. Prognosis is closely related to the classification results of the stage, and the stage classification is also used to assign patient treatment in clinical trials and medical practice. Information related to the stage classification is as follows:

[0043] ● TX: Primary tumor cannot be evaluated: T0: No evidence of primary tumor. Tis: Carcinoma in situ, non-invasive. T1: Tumor is 2.0 cm or smaller. T2: Tumor is greater than 2 cm but not greater than 5 cm. T3: Tumor is greater than 5 cm. T4: Tumor of any size growing on the chest wall or skin, inflammatory breast cancer.

[0044] ● NX: Adjacent lymph nodes cannot be evaluated. N0: Cancer has not spread to the lymph nodes. N1: Cancer has spread to 1 to 3 axillary lymph nodes or 1 internal mammary lymph node. N2: Cancer has spread to 4 to 9 axillary lymph nodes or multiple internal mammary lymph nodes. N3: Applies to one of the following:

[0045] ■ Cancer has spread to 10 or more axillary lymph nodes, or cancer has spread to the lymph nodes below the clavicle, or cancer has spread to the lymph nodes above the clavicle, or cancer is affecting the axillary lymph nodes and has spread to the internal mammary lymph nodes, or cancer affects 4 or more axillary lymph nodes, and a minimal amount of cancer is found in the internal mammary lymph nodes or in the sentinel lymph node biopsy tissue.

[0046] ● Mx: Presence of distant spread (metastasis) cannot be evaluated. M0: No distant spread. M1: Spread to distant organs has occurred, excluding supraclavicular lymph nodes.

[0047] The expressions “lung cancer” or “cancer of the lung” or “lung tumor” refer to any cancer of the lung, including but not limited to non-small cell lung cancer, non-microcytic lung cancer (NSCLC), and small cell lung cancer.

[0048] The expressions “renal cancer” or “kidney cancer” or “renal tumor” refer to any malignant proliferative disorder of renal cells.

[0049] The expression “ Thyroid cancer ” or “thyroid cancer” refers to any proliferative disease of the thyroid, including but not limited to papillary thyroid cancer and follicular thyroid cancer.

[0050] As used herein with respect to two events (the expression level of a modifying gene and the expression level of the c-MAF gene), " system Statistically significant correlation " means that there is a high probability that these events are related and the variation is not random.

[0051] "Determining the expression of metastatic cancer in a subject having cancer (especially breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer), preferably in a subject having breast cancer Probability of occurrence ", refers to using evidence to determine whether the cancer affecting the subject will metastasize in the future. In the specification of the present invention, an index is the change in the expression level of one or more genes whose expression is regulated in response to an increase in the c-MAF expression level relative to a standard value. "Change in the expression level of a gene" refers to an upward or downward change in the expression level of a gene relative to a standard value. Thus, the "high" or "increased" or "enhanced" likelihood of metastasis occurring in a subject having cancer, especially breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, is attributed to the change in the expression level of one or more genes whose expression is regulated in response to an increase in the c-MAF expression level relative to a standard value.

[0052] The term " Reduced gene expression " means when the expression level of a gene decreases or drops relative to a standard or control value (which corresponds to the expression level of the same gene in a control sample). For the purposes of the present invention, when the level in a patient sample drops by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150% or more, the expression level of the gene relative to the standard value is considered to be reduced.

[0053] As used in the present invention, the term " Signature gene " or "information gene" refers to a gene that expresses itself in a differential manner in populations having different phenotypes and whose differential expression (either alone or in combination with other genes) is correlated with a particular phenotype to a degree greater than that expected randomly.

[0054] " PODXL gene", also known as podocalyxin-like, refers to the gene encoding the protein that forms part of the sialomucin family and is an important component of glomerular epithelial podocytes. Podocytes are highly differentiated epithelial cells with finger-like combined protrusions covering the outer surface of the glomerular basement membrane. Other biological activities caused by the protein encoding include: the binding of the protein in the membrane-protein complex to the regulator of the Na+ / H+ exchanger of the intracellular cytoskeletal element and its binding to L-selectin. Descriptions of two transcription PODXL variants have been provided in the NCBI database (version of March 3, 2013) under accession numbers NM_001018111.2 (variant 1) and NM_005397.3 (variant 2). The sequences of the proteins encoded by the PODXL gene have been submitted to the NCBI database (version of March 3, 2013) under accession numbers NP_001018121.1 (isoform 1) and NP_005388.2 (isoform 2).

[0055] “ PTHLH ” (parathyroid hormone-like hormone gene) is located on human chromosome 12 and encodes a protein belonging to the parathyroid hormone family called PTHrP (parathyroid hormone-related protein). In addition to regulating the interaction between epithelium and mesenchyme during mammary gland and tooth formation, this protein also regulates endochondral bone development. The receptor for this hormone is called PTHR1. The DNA sequence related to PTHLH has been submitted to the NCBI database under accession number NG_023197 (version of November 6, 2011). Descriptions of 4 PTHLH transcript variants have been submitted to the NCBI database (November 20, 2011) under accession numbers NM_198965.1 (variant 1), NM_002820.2 (variant 2), NM_198964.1 (variant 3), and NM_198966.1 (variant 4). Similarly, the protein sequences encoded by the PTHLH gene have been provided in the NCBI database (version of January 10, 1995) under accession numbers AAA60360.1 (form A), AAA60358.1 (form B), and AAA60359.1 (form C).

[0056] “ RERG gene", also known as growth inhibitor regulated by Ras-like estrogen, refers to a gene that encodes a part of the protein forming the RAS GTPase superfamily and serves as an inhibitor of cell proliferation and tumor formation. Descriptions of two transcript variants of RERG have been submitted to the NCBI database (version of November 28, 2011) under accession numbers NM_032918.2 (variant 1) and NM_001190726.1 (variant 2). Sequences of the proteins encoded by the RERG gene have been provided to the NCBI database ((November 28, 2011) under accession numbers NP_116307 (isoform 1) and NP_001177655 (isoform 2).

[0057] “ Metastasis ” is the spread of cancerous origin from the initial location of the cancer to another organ. This usually occurs through the blood or lymphatic system. When cancer cells spread and cause a new tumor, this is called a secondary tumor or metastatic tumor. The cancer cells that form the second tumor are very similar to those in the original tumor. For example, if breast cancer spreads (metastasizes) to the lung, the second tumor contains malignant breast cancer cells. The disease in the lung is called metastatic breast cancer (not lung cancer). In the case of the present particular invention, metastasis is breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer that has spread (metastasized) to the bone. For an even more specific aspect of the present invention, metastasis is ER+ breast cancer that has spread (metastasized) to the bone.

[0058] “Osteolytic bone metastasis” refers to the bone resorption (gradual loss of bone density) in the adjacent site of metastasis caused by the stimulation of osteoclast activity by tumor cells, and is a type of metastasis characterized by severe pain, pathological fracture, hypocalcemia, spinal cord compression, and other syndromes caused by nerve compression.

[0059] The term “ "microRNA" or "miRNA" ” refers to a short single-stranded RNA molecule, which is usually about 21 - 23 nucleotides in length and can regulate gene expression. miRNA can be synthetic (in other words, recombinant) or natural. Natural miRNA is encoded by a gene that is transcribed from DNA and then processed from the primary transcript (“pri-miRNA”) into a short stem-loop structure (“pre-miRNA”), and finally processed into mature miRNA. The mature miRNA molecule is partially complementary to one or more mRNA molecules and reduces gene expression by a process similar to RNA interference or by inhibiting the translation of mRNA.

[0060] " Tumor tissue sample"is a tissue sample from a primary tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more specifically ER+ or ER-Her2- breast cancer. The sample can be obtained by conventional methods, such as biopsy, using methods known to relevant medical technical experts. Methods for obtaining biopsy samples include dividing the tumor into large fragments, or microdissection or other cell separation methods known in the art. Tumor cells can alternatively be obtained by cytological methods, by aspirating with a small gauge injection needle. To simplify sample preservation and handling, the sample can be fixed in formalin and subsequently immersed in paraffin or first frozen and then immersed in a tissue freezing medium such as OCT compound by immersion in a highly refrigerating medium that enables rapid freezing. According to the present invention, the sample also includes any body fluid containing tissue derived from the tumor, RNA derived from the tumor, DNA derived from the tumor or protein derived from the tumor, including, but not limited to, plasma or serum, such as plasma or serum in which exosomes or tumor-derived DNA are present.

[0061] A "dominant negative mutant" that expresses a gene expression product, as used in the present invention, refers to a variant of the expression product that is capable of interfering with the activity of the naturally expressed product.

[0062] The term " Inhibitory peptide ", as used herein, refers to those peptides that are capable of binding to an expression product and inhibiting its activity.

[0063] The term " Metastasis prediction " is used herein to refer to the probability that a patient may develop metastases. The prediction method of the present invention can be used clinically to determine the most appropriate choice of treatment for each specific individual. The prediction method of the present invention is a valuable tool for predicting whether a patient will respond favorably to a treatment regimen such as chemotherapy. The prediction can include prognostic factors. As will be understood by experts in the field, although this is not better, the prediction does not have to be correct for 100% of the subjects that can be diagnosed or evaluated. However, the term requires that a significant portion of the subjects can be identified as those with a greater likelihood of having a determined outcome. If the subjects are statistically significant, this can be determined by experts in the field using different known statistical evaluation tools, such as determination of confidence intervals, determination of p-values, classification and cross-validation rates of details, etc. (as shown in Dowdy and Wearden, Statistics for Research by Wiley, John & Sons, New York, 1983). The recommended confidence interval is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. The p-value is preferably 0.01, 0.005 or lower.

[0064] The term " Probability", as used herein, measures the frequency of obtaining a result (or a set of results) from a randomized experiment under sufficiently stable conditions, where all possible results are known. The probability can be "high" or "low". As will be understood by those skilled in the art, the probability need not be 100% for all subjects being evaluated, although it should preferably be so. Whether the correlation is statistically significant or not can be determined by those skilled in the art using different known statistical evaluation tools, such as by determination of confidence intervals, determination of p-values, Student's t-test, Mann-Whitney test, without great difficulty. Additional information on these statistical tools can be found in Dowdy and Wearden, Statistics for Research. John Wiley & Sons, New York 1983. The preferred confidence interval is at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. The p-value is preferably 0.05, 0.02, 0.01 or lower.

[0065] As used in the present invention, " Mammary tissue-specific promoter " refers to a nucleic acid sequence that functions as a promoter and enables a nucleic acid operably linked to the promoter to be specifically expressed on the surface of mammary tissue and no significant expression is observed in other tissues.

[0066] As used herein, the term " Subject " or " Patient " refers to all animals classified as mammals, including, but not limited to, domestic and farm animals, primates and humans; for example, humans, non-human primates, cattle, horses, pigs, sheep, goats, dogs, cats or rodents. Preferably, the subject is a man or a woman of any age or race.

[0067] " Primary tumor " refers to a tumor that originates from the tissue or organ in which it is found and has not metastasized to that location from another site.

[0068] " ER+ tumor " refers to a tumor that expresses ER at a level higher than a determined level. An ER level of higher than or equal to 10 fmol / mg and positive detection of more than 10% of the cell nuclei by immunohistochemical medium are the generally accepted criteria for considering a breast tumor as ER+.

[0069] As used in the present invention, " ER- tumor " refers to a tumor in which less than 5% of the cell nuclei of the tumor cells show ER expression by using immunohistochemical techniques (for example, using the method described by Elizabeth H et al., 2010, Journal of Clinical Oncology, 28: 2784 - 2795).

[0070] " Her2- tumor "refers to a tumor in which the cells do not show amplification of the HER2 gene. When the value obtained by semi - quantitative immunohistochemical assay using a polyclonal anti - HER2 antibody (e.g., HercepTest kit (Code K5204), Dako North America, Inc., (Code K5204)) is 0, 1+, or 2+, the tumor cells are considered negative for HER2. Alternatively, when the HER2 gene copy number per cell nucleus is less than 4 or when the ratio of the HER2 gene copy number to the chromosome 17 copy number measured by FISH is less than 1.8, the tumor is considered Her2 -. The standard assays for determining whether a tumor is Her2+ or Her2 - are described, for example, in the American Society of Clinical Oncology / College of American Pathologists guidelines (Wolff AC, et al. J Clin Oncol., 2007, 25:118 - 145; Wolff AC, et al., 2007, Archives of Pathology & Laboratory Medicine 131:18 - 43).

[0071] " PR- tumor" "refers to a tumor that undetectably expresses progesterone receptor. In the present specification, an immunohistochemical observation of progesterone receptor less than 10 fmol / mg and / or less than 10% of positive cell nuclei is considered PR - negative.

[0072] " Triple-negative tumor "refers to breast cancer characterized by ER -, PR -, and HER2 -.

[0073] Expression" Reference value "refers to a laboratory value used as a reference for the values / data obtained from a sample from a patient. A reference value or reference level can be an absolute value, a relative value, a value with upper and / or lower limits, a series of values, an average value, a median value, a mean value or (mean value) or a value expressed by reference to a control or reference value. The reference value can be based on values obtained from an individual sample, such as, for example, values obtained from a sample of the target patient of the study (but obtained at a previous time point). The reference value can be based on a large number of samples, such as values obtained in a group of subjects in an age cohort consistent with the patient population of the present study, or based on the inclusion or exclusion of samples in a set of samples to be analyzed.

[0074] As used in the present invention, the expression" Gene-specific antisense oligonucleotide"Refers to an oligonucleotide whose sequence is partially or fully complementary to a region of the gene, pre-mRNA encoded by the gene, or mRNA of the gene, so that it can specifically hybridize with the gene, pre-mRNA, or mRNA, thereby blocking gene transcription or mRNA translation.

[0075] Antisense nucleic acids can bind to potential targets of drugs through conventional base complementarity or, for example, in the case of binding to double-stranded DNA, through specific interactions in the major groove of the duplex. Generally, these methods refer to the scope of techniques commonly used in the art and include any method based on specific binding to oligonucleotide sequences.

[0076] The antisense construct of the present invention can be provided in the form of, for example, an expression plasmid, which, when transcribed in a cell, produces RNA that is complementary to at least one single part of the cellular mRNA encoding the target gene. Alternatively, the antisense construct is an oligonucleotide probe generated in vitro and, when introduced into a cell, inhibits gene expression by hybridizing with the mRNA and / or genomic sequence of the target nucleic acid. The oligonucleotide probe is preferably a modified oligonucleotide that is resistant to endogenous nucleases, such as exonucleases and / or endonucleases, and thus is stable in vivo. Exemplary nucleic acid molecules used as antisense oligonucleotides are phosphoramidite, phosphorothioate, and methylphosphonate DNA analogs (see also U.S. Patent Nos. 5,176,996, 5,264,564, and 5,256,775). In addition, general methods for constructing oligomers for antisense therapy have been reviewed, for example, in Vander Krol et al., BioTechniques 6:958-976, 1988; and Stein et al., Cancer Res 48:2659-2668, 1988.

[0077] Regarding antisense oligonucleotides, regions of oligodeoxynucleotides derived from the translation start site (e.g., between -10 and +10 of the target gene) are preferred. Antisense methods include the design of oligonucleotides (DNA or RNA) complementary to the mRNA encoding the target polypeptide. The antisense oligonucleotide will bind to the mRNA transcript and prevent translation.

[0078] Oligonucleotides that are complementary to the 5'-end of an mRNA, such as a 5'-untranslated sequence and include the AUG start codon should be used in the most efficient manner to inhibit translation. However, it has recently been shown that sequences complementary to the 3'-untranslated sequence of an mRNA are also effective in inhibiting translation of the mRNA (Wagner, Nature 372:333, 1994). Thus, complementary oligonucleotides can be used in an antisense approach on the non-coding 5' or 3'-untranslated regions of a gene to inhibit translation of the mRNA. Complementary oligonucleotides directed against the 5'-untranslated region of an mRNA should be included in the complementary sequence of the AUG start codon. Complementary oligonucleotides directed against the coding region of an mRNA are less effective translation inhibitors, but can also be used according to the present invention. If they are designed to hybridize to the 5', 3' or coding region of an mRNA, the antisense nucleic acid should be at least 6 nucleotides in length and preferably less than about 100 nucleotides in length, more preferably less than about 50, 25, 17 or 10 nucleotides in length.

[0079] Antisense oligonucleotides can be derived from single-stranded or double-stranded DNA or RNA or chemical mixtures or derivatives or modified forms of said DNA or RNA. The oligonucleotides can be modified in the base group, sugar group or phosphate backbone to improve the stability of the molecule, its hybridization ability, etc. The oligonucleotides can include other attached groups, such as peptides (e.g., to direct them to host cell receptors) or agents that facilitate transport across cell membranes (see, e.g., Letsinger et al., Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556, 1989; Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652, 1987; PCT Publication No. WO88 / 09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO89 / 10134), intercalating agents (see, e.g., Zon, Pharm. Res. 5:539-549, 1988). For this purpose, the oligonucleotides can be conjugated to another molecule, such as a peptide, transport agent, hybridization-triggered cleavage agent, etc.

[0080] Antisense oligonucleotides can contain at least one group of modified bases. Antisense oligonucleotides can also contain at least one group of modified sugars selected from, but not limited to, arabinose, 2-fluoroarabinose, xylulose and hexose. Antisense oligonucleotides can also contain a backbone similar to a neutral peptide. Such molecules are called peptide nucleic acid (PNA) oligomers and are described, for example, in Perry-O'Keefe et al., Proc. Natl. Acad. Sci. U.S.A. 93:14670, 1996 and Eglom et al., Nature 365:566, 1993.

[0081] In another form of synthesis, the antisense oligonucleotide comprises at least a modified phosphate backbone. In another form of synthesis, the antisense oligonucleotide is an α-anomeric oligonucleotide.

[0082] Although antisense oligonucleotides complementary to the coding region of the target mRNA sequence can be used, those oligonucleotides complementary to the untranslated regions can also be used.

[0083] In some cases, it may be difficult to achieve an intracellular concentration capable of inhibiting the translation of endogenous mRNA. Thus, a preferred method is to use a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.

[0084] Alternatively, target gene expression can be reduced by directing the formation of a triple helix structure by a deoxyribonucleotide sequence complementary to a gene regulatory region (i.e., a promoter and / or potentiator), which prevents the gene from being transcribed in target cells of the body (see generally, Helene, Anticancer Drug Des. 6(6):569-84, 1991). In certain forms of synthesis, the antisense oligonucleotide is an antisense morpholino.

[0085] Expression RNA interference " or RNAi is a sequence-specific and post-transcriptional method of gene expression inhibition that can occur in eukaryotic cells. Generally, the process involves the degradation of a specific sequence of mRNA induced by double-stranded RNA (dsRNA) homologous to the sequence. The dsRNA is capable of causing gene expression silencing by converting the RNA into siRNA using ribonuclease II (dicer).

[0086] As used herein, the term Nucleic acid " refers to a molecule polymer having two or more deoxyribonucleotide, ribonucleotide, or nucleotide analogue molecules, and that is structurally identical to a natural nucleic acid but differs from the natural nucleic acid (e.g., by chemical modification) in one or more of the nucleic acid backbone (e.g., the phosphate in natural nucleic acids), the nucleic acid sugar (e.g., the deoxyribose in natural DNA and ribose in natural RNA), and the nucleic acid base (e.g., adenosine, cytidine, guanine, thymidine, or uracil in natural nucleic acids).

[0087] As used herein, " Antisense sequence"Antisense or sense oligonucleotides comprising single-stranded nucleic acid sequences (RNA or DNA) that are capable of binding to a target DNA (antisense) or mRNA (sense) sequence. The ability to generate antisense or sense oligonucleotides based on the cDNA sequence encoding a given protein is described, for example, in Stein and Cohen, Cancer Res. 48:2659, (1988) and van der Krol et al., BioTechniques 6:958, (1988).

[0088] As used herein, the term " Ribozyme " or " RNA enzyme " or " Catalytic RNA " refers to an RNA molecule that catalyzes a chemical reaction. Many natural ribozymes catalyze the hydrolysis of one or more of their own phosphodiester bonds or the hydrolysis of bonds in other RNAs, but they have been found to catalyze the aminotransferase activity of ribosomes, the ligation activity of DNA ligases, and many other chemical reactions carried out by conventional protein assays.

[0089] The term Treatment refers to the administration of a drug to provide relief from a disease or the elimination of a disease, to reduce or eliminate one or more symptoms associated with the disease, or to provide a clinical benefit to a patient, and is broadly defined as: a reduction in tumor size, the occurrence or reduction in size of metastases, a slowing or arrest of tumor growth, the induction of remission, an increase in the duration before recurrence, a reduction in pain associated with the tumor, an inhibition of tumor cell division, the eradication of tumor cells, the induction of apoptosis in tumor cells, a reduction, a reduction in tumor recurrence, and / or an increase in patient survival rate.

[0090] In vitro method for predicting metastasis in subjects with cancer, particularly breast cancer

[0091] The inventors of the present invention have identified a group of genes whose expression is positively or negatively correlated with the expression of c-MAF. Specifically, the inventors have identified a series of genes characterized in that: (i) their expression in primary tumors is significantly correlated with MAF expression and (ii) their expression in MCF7 cells is modified by overexpression (long or short isoform) or silencing of c-MAF in highly bone-metastatic cells derived from MCF7 expressing MAF. Genes that meet these conditions are considered to be members of the program of c-MAF-mediated bone metastasis. These genes are shown in Table 1 (genes increased by the c-MAF program) and Table 2 (genes inhibited by the MAF program). By using gain-of-function experiments and clinical correlation data, the inventors have functionally verified the role of PTHLH, PODXL, and RERG as causative target genes in the process of bone metastasis of ER+ breast cancer and as part of the program of c-MAF-mediated bone metastasis.

[0092] Accordingly, as a first matter, the present invention relates to an in vitro method for predicting metastasis of cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, in a subject (hereinafter, the first method of the present invention), which comprises the expression level of one or more genes in a tumor tissue sample of the subject, wherein the expression of the genes is regulated in response to an increase in the c-MAF expression level, and wherein the altered expression level of the one or more genes relative to a reference gene indicates a high risk of metastasis.

[0093] The first method of the present invention comprises, as a first step, quantifying the expression level of one or more genes (whose expression is regulated in response to an increase in the c-MAF expression level) in a tumor tissue sample from a subject having cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer.

[0094] As used in the present invention, the expression "genes whose expression is regulated in response to an increase in the c-MAF expression level" refers to genes in which the expression is significantly altered in response to a change in the c-MAF expression level. Genes whose expression is regulated in response to an increase in the c-MAF expression level include genes whose expression in a primary tumor sample is significantly correlated with the c-MAF expression and / or genes whose expression in breast cancer cells is altered in response to a change in the c-MAF expression level.

[0095] In a preferred form, genes whose expression is regulated in response to an increase in the c-MAF expression level include genes whose expression increases in primary tumor samples showing high c-MAF expression, and / or genes whose expression increases in cancer cells, preferably breast cells, colon cells, lung cells, kidney cells or thyroid cells, even more preferably breast cells, in response to an increase in the c-MAF expression level, and / or genes whose expression decreases in cancer cells, preferably breast cells, colon cells, lung cells, kidney cells or thyroid cells, even more preferably breast cells, in response to c-MAF expression silencing.

[0096] In a preferred form, genes whose expression is regulated in response to an increase in the c-MAF expression level include genes whose expression decreases in primary tumor samples showing high c-MAF expression, and / or genes whose expression decreases in cancer cells, preferably breast cells, colon cells, lung cells, kidney cells or thyroid cells, even more preferably breast cells, in response to an increase in the c-MAF expression level, and / or genes whose expression increases in cancer cells, preferably breast cells, colon cells, lung cells, kidney cells or thyroid cells, even more preferably breast cells, in response to c-MAF expression silencing.

[0097] In the present invention, an "elevated" or "increased" expression level is understood to refer to an expression level that is higher than a reference value level. Specifically, when the expression level in a sample from a subject is at least 1.1-fold, 1.5-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold or even more than 100-fold of the reference value, it can be considered that the sample from the subject exhibits an elevated expression level.

[0098] Furthermore, in the present invention, a "decreased" or "reduced" expression level refers to an expression level that is lower than a reference value level. Specifically, when the expression level in a reference sample is at least 1.1-fold, 1.5-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold or even more than 100-fold of the expression level in the sample from the subject, it can be considered that the sample from the subject exhibits a reduced expression level.

[0099] In a preferred form, the first method of the present invention comprises quantifying the expression level of one or more genes selected from the genes shown in Table 1 and / or one or more genes selected from the genes shown in Table 2 in a tumor tissue sample from a subject suffering from cancer, particularly breast cancer.

[0100]

[0101]

[0102]

[0103]

[0104] Table 1. Genes whose expression is positively correlated with c-MAF expression. A: Genes whose expression in primary tumors is significantly correlated with MAF expression. B: Genes whose expression in MCF7 cells is altered by the expression of the long isoform of c-MAF. C: Genes whose expression in MCF7 cells is altered by the expression of the short isoform of c-MAF. D: Genes whose expression in MCF7 cells is altered by c-MAF silencing. + Increase in expression, - Decrease in expression.

[0105]

[0106]

[0107] Table 2. Genes whose expression is negatively correlated with c-MAF expression. A: Genes whose expression in primary tumors is significantly correlated with MAF expression. B: Genes whose expression is altered by the long isoform expression of c-MAF. C: Genes whose expression is altered by the short isoform expression of c-MAF. D: Genes whose expression is altered by c-MAF silencing. + Increase in expression, - Decrease in expression.

[0108] Table 1 corresponds to a set of 76 genes, characterized in that (i) their expression levels in primary tumor samples are directly correlated with c-MAF expression levels and (ii) their expression levels increase when c-MAF expression is induced in breast cancer cell lines or decrease when c-MAF is silenced.

[0109] According to the first method of the present invention, an increase in the expression level of one or more of the genes shown in Table 1 compared to a reference value indicates that the subject has a high probability of developing metastases.

[0110] Preferably carried out according to the first method of the present invention, the expression level of the PTHLH gene is quantified so that if the expression level of the PTHLH gene increases compared to a reference value, the subject has a high probability of developing metastases. In another preferred performance of the first method of the present invention, the expression level of the PODXL gene is quantified so that if the expression level of the PODXL gene increases compared to a reference value, the subject has a high probability of developing metastases.

[0111] Table 2 corresponds to a set of 33 genes, characterized in that (i) their expression levels in primary tumor samples are inversely correlated with c-MAF expression levels and (ii) their expression levels decrease when c-MAF expression is induced in breast cancer cell lines or increase when c-MAF is silenced in breast cancer cell lines.

[0112] According to the first method of the present invention, a decrease in the expression level of one or more of the genes shown in Table 2 compared to a reference value indicates that the subject has a high probability of developing metastases.

[0113] Preferably carried out according to the first method of the present invention, the expression level of the RERG gene is quantified so that if the expression level of the RERG gene decreases compared to a reference value, the subject has a high probability of developing metastases.

[0114] As will be understood by the patents in this subject matter, quantification of gene expression levels can be determined by measuring the RNA levels of the genes or the levels of the proteins encoded by the genes.

[0115] For this purpose, a biological sample can be processed to physically or mechanically disrupt the structure of tissues or cells, thereby releasing intracellular components in an aqueous or organic solution to prepare nucleic acids. The nucleic acids are extracted by methods known to and commercially available to experts in the art (Sambroock, J., et al., "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbor Laboratory Press, N.Y., vols. 1-3).

[0116] Thus, the quantification of the expression level of a gene whose expression is regulated in response to an increase in the c-MAF expression level can be performed from RNA (messenger RNA or mRNA) generated by transcription of the gene or, alternatively, from the complementary DNA (cDNA) of the gene. Thus, in a specific embodiment of the present invention, the quantification of the gene expression level of a gene whose expression is regulated in response to an increase in the c-MAF expression level includes the quantification of the messenger RNA of the gene, or a fragment of the mRNA, DNA complementary to the gene, or a fragment of the cDNA, or a mixture thereof.

[0117] In fact, any conventional method can be used in the context of the present invention to detect and quantify the level of mRNA encoded by a gene or its corresponding cDNA, the expression of which is regulated in response to an increase in the c-MAF expression level. For example, but not limited to, the level of mRNA encoded by the gene can be quantified using conventional methods, such as methods including amplifying the mRNA and quantifying the product of the mRNA amplification, such as electrophoresis and staining, or alternatively, by Southern blotting and the use of appropriate probes, Northern blotting and the use of specific probes for the mRNA of the target gene regulated by c-MAF or its corresponding cDNA, mapping using S1 nuclease, RT-LCR, hybridization, microarray, etc., preferably by real-time quantitative PCR using an appropriate marker. Similarly, the level of cDNA corresponding to the mRNA encoded by the gene c-MAF can also be quantified using conventional techniques, in which case the method of the present invention includes the steps of synthesizing the corresponding cDNA by reverse transcription (RT) of the corresponding mRNA, followed by amplifying the cDNA and quantifying the product of the cDNA amplification. Conventional methods for quantifying expression levels can be found, for example, in Sambrook et al., 2001. (cited above).

[0118] In a specific embodiment, the quantification of the expression level of a gene whose expression is regulated in response to an increase in the c-MAF expression level is carried out using quantitative polymerase chain reaction (PCR) or a DNA or RNA array. In addition, the quantification of the expression level of a gene whose expression is regulated in response to an increase in the c-MAF expression level can also be carried out by quantifying the expression level of the protein encoded by the gene or any functional equivalent of the protein. The expression level of a gene whose expression is regulated in response to an increase in the c-MAF expression level can also be carried out by quantifying the expression level of any isoform of the protein. Thus, in a specific embodiment, the quantification of the level of a protein encoded by a gene whose expression level is regulated in response to an increase in the c-MAF expression level includes the quantification of the protein.

[0119] The expression level of a protein can be quantified by using any conventional method that enables the protein to be detected and quantified in a sample from a subject. For example, but not limited to, the level of the protein can be quantified, for example, by using an antibody (or a fragment thereof containing an epitope) that binds to the protein, and subsequently quantifying the formed complex. The antibodies used for these assays can be labeled or unlabeled. Illustrative examples of markers that can be used include radioisotopes, enzymes, fluorophores, chemiluminescent reagents, enzyme substrates or cofactors, enzyme inhibitors, particles, dyes, etc. There are a variety of assays known to be useful in the present invention that use unlabeled antibodies (primary antibodies) and labeled antibodies (secondary antibodies); these techniques include Western blotting or Western transfer, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (competitive enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), immunocytochemistry and immunohistochemistry techniques, techniques based on the use of biochips or protein chips containing specific antibodies, or assays based on colloidal precipitates present in the form of dipsticks. Other methods for detecting and quantifying the protein include affinity chromatography techniques, ligand binding assays, etc. When using immunological methods, any antibody or reagent known to bind to the protein with high affinity to detect its amount can be used. However, the use of antibodies is preferred; for example, polyclonal sera, hybridoma supernatants or monoclonal antibodies, antibody fragments, Fv, Fab, Fab', and F(ab')2, scFv, diabodies, triabodies, tetra-bodies, and humanized antibodies. There are commercial antibodies available on the market for anti-PTHrP or RERG for use in the context of the present invention. Antibodies specific for the PTHrP protein include, but are not limited to, the mouse monoclonal antibody 3H1-5G8 (ab115488) that recognizes PTHrP provided by Abcam, the rabbit polyclonal antibody P12272 (catalog number 251478) that recognizes rat, mouse, and human PTHrP provided by Abbiotech, the rabbit polyclonal antibody that recognizes human PTHrP provided by BioVision (product catalog number 5652-100), or the mouse monoclonal antibody that recognizes human PTHrP provided by Novus Biologicals (catalog number NBP1-26542), etc.Antibodies specific for the RERG protein include, but are not limited to, goat polyclonal antibodies (sc-109008 and sc-109009) that recognize human RERG provided by Santa Cruz, rabbit polyclonal antibodies (10687-1-AP) that recognize human, rat, and mouse RERG provided by ProteinTech, rabbit polyclonal antibodies (ab115806) that recognize rat RERG provided by Abcam, and mouse polyclonal antibodies (H00085004-B01) that recognize human RERG provided by NovusBiologicals.

[0120] Specifically, in the present invention, protein levels are quantified by western blot, ELISA, or protein array.

[0121] In a second stage, the first method of the present invention includes comparing the expression levels obtained for the genes analyzed in the first stage with a reference range.

[0122] After measuring the expression levels of one or more genes (whose expression is regulated in response to an increase in the c-MAF expression level in tumor tissue samples of subjects with breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer) and comparing said levels with a reference range, if the expression level of the gene(s) is elevated relative to the reference range, it can be concluded that the subject has a high probability of developing metastasis.

[0123] When specifically implementing the first method of the present invention, if the expression levels of one or more genes included in Table 1 in tumor tissue samples of subjects (who have cancer, especially breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer) are elevated relative to the reference range, and / or the expression levels of one or more genes included in Table 2 in tumor tissue samples of subjects (who have cancer, especially breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer) are decreased relative to the reference range, then the subject has a high probability of developing metastasis.

[0124] The determination of the expression levels of genes whose expression needs to be regulated in response to an increase in the c-MAF expression level is related to a reference range. Depending on the type of tumor being analyzed, the exact nature of the reference range can vary. Thus, if the probability of developing metastasis is to be determined, the reference range is derived from tumor tissue samples of subjects who have cancer, especially breast cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, but have not yet experienced metastasis, or corresponds to the median of the expression levels measured in tumor tissue collected from biopsy samples of subjects who have cancer, especially breast cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer but have not yet developed metastasis.

[0125] The reference sample is typically obtained by combining equal amounts of samples from a population of subjects. A typical reference sample is typically obtained from subjects who are clinically well-documented and those subjects in whom metastasis is clearly known not to be present. In such samples, the normal (reference) concentration of a biomarker can be determined, for example, by providing the average concentration of the reference population. When determining the reference concentration of a biomarker, several factors need to be considered. These considerations include age, weight, gender, the general physical condition of the patient, etc. For example, equal amounts from a group of at least 2, at least 10 to preferably more than 100 to more than 1000 subjects are used as the reference group, preferably classified according to previous considerations, such as different age classifications. The sample set resulting from the reference level preferably consists of subjects having the same type of cancer as the patient being studied.

[0126] Once the median is determined, the level of the biomarker in the patient's tumor tissue can be compared to the median, and in this way the level can be assigned an "elevated" expression level. Due to variability among subjects (e.g., with respect to age, ethnicity, etc.), it is extremely difficult (if not practically impossible) to determine an absolute reference range for gene expression. Thus, specifically in the present invention, the reference range for "increased" or "decreased" expression of gene expression whose expression is regulated in response to an elevated c-MAF expression level is determined by calculating percentiles by conventional methods, the conventional methods including determining the gene expression level whose expression is regulated by c-MAF in one or more isolated samples in which the disease is well-documented by any of the above methods. Thus, a "decreased" level can preferably be assigned to a sample in which the expression level is equal to or lower than the 50th percentile in the normal population, including, for example, equal to or lower than the 60th percentile in the normal population, equal to or lower than the 70th percentile in the normal population, equal to or lower than the 80th percentile in the normal population, equal to or lower than the 90th percentile in the normal population, equal to or lower than the 95th percentile in the normal population. Thus, an "elevated" expression level can preferably be assigned to a sample in which the expression level is equal to or higher than the 50th percentile in the normal population, including, for example, equal to or higher than the 60th percentile in the normal population, equal to or higher than the 70th percentile in the normal population, equal to or higher than the 80th percentile in the normal population, equal to or higher than the 90th percentile in the normal population, equal to or higher than the 95th percentile in the normal population.

[0127] Specifically in the present invention, the cancer is selected from breast cancer, colon cancer, lung cancer, kidney cancer, and thyroid cancer. The preferred cancer in the present invention is breast cancer. Even more preferred is any type of ER+ or triple-negative breast cancer.

[0128] When practicing the first method of the present invention, the preferred metastasis in a subject suffering from cancer, in particular breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, is bone metastasis. When practicing the first method of the present invention, an even more preferred metastasis in a subject suffering from cancer, in particular breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, is osteolytic bone metastasis.

[0129] Design method for individualized treatment of subjects with cancer, especially breast cancer

[0130] As is known in the state of the art, the treatment administered to a subject suffering from cancer, such as breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, can vary based on the high probability of associated metastasis therein. In cases where the probability of metastasis is high, the treatment selected includes systemic treatment such as chemotherapy.

[0131] Therefore, in accordance with what is explained in the present invention, given that the alteration in the expression level of one or more genes whose expression is regulated in response to an increase in c-MAF expression level is associated with the probability of metastasis, the determination of the levels of these c-MAF-regulated genes helps to decide the most suitable therapy for a subject suffering from cancer.

[0132] Therefore, in other aspects, the present invention relates to an in vitro method (hereinafter, the second method of the present invention) for designing an individualized therapy for a subject suffering from cancer, in particular breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, which comprises determining the expression level of one or more genes whose expression is regulated in response to an increase in c-MAF expression level in a tumor tissue sample of the subject, wherein an altered expression level of the one or more genes relative to a reference range indicates that the subject is receptive to a therapy aimed at preventing metastasis.

[0133] The second method of the present invention in the first stage comprises quantifying the expression level of one or more genes (whose expression is regulated in response to an increase in c-MAF expression level) in a tumor tissue sample of a subject (who suffers from cancer, in particular breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer).

[0134] When specifically practicing the second method of the present invention, in a tumor tissue sample of the subject, the genes whose expression is regulated in response to an increase in c-MAF expression level are selected from one or more genes included in Table 1 and / or one or more genes included in Table 2, wherein if the expression level of one or more of the genes from Table 1 increases relative to the reference range and / or the expression level of one or more genes from Table 2 decreases relative to the reference range, the subject is receptive to a therapy for preventing metastasis.

[0135] When implementing the second method of the present invention, the preferred expression level of the PTHLH gene is quantified so that if the PTHLH gene expression level is elevated relative to a reference range, the subject is receptive to a therapy aimed at preventing metastasis.

[0136] When implementing the second method of the present invention, the preferred expression level of the PODXL gene is quantified so that if the PODXL gene expression level is elevated relative to a reference range, the subject is receptive to a therapy aimed at preventing metastasis.

[0137] When implementing the second method of the present invention, the preferred expression level of the RERG gene is quantified so that if the RERG gene expression level is decreased relative to a reference range, the subject is receptive to a therapy aimed at preventing metastasis.

[0138] When specifically implementing the second method of the present invention, the cancer is selected from breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, preferably breast cancer. When even more specifically implementing the second method of the present invention, the breast cancer can be any type of ER+ or ER-HER2- (ER-HER2-PR+ or ER-HER2-PR-) breast cancer.

[0139] When specifically implementing the second method of the present invention, the metastasis is bone metastasis. When even more specifically implementing the second method of the present invention, the bone metastasis is osteolytic metastasis.

[0140] In the case of the second method of the present invention, the sample is a primary tumor tissue sample of the subject.

[0141] In the second stage, the expression of one or more genes whose expression is regulated in response to an increase in the c-MAF expression level in the subject's tumor sample is compared with a reference range. This reference range is obtained from the expression levels of genes whose expression is regulated in response to an increase in the c-MAF expression level in control samples. Depending on the type of tumor under analysis, the exact nature of the control sample can vary. Thus, a preferred control sample is a tumor tissue sample from a subject with breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer but who has not yet experienced metastasis. And even more preferably for the control sample is a tumor tissue sample from a subject with ER+ breast cancer but who has not experienced metastasis. Alternatively, the reference range corresponds to the median c-MAF expression level measured in tumor tissue samples collected in biopsies from subjects with cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially ER+ breast cancer, but who have not yet developed metastasis.

[0142] In the second stage of the second method of the present invention, the expression level of one or more genes, whose expression is regulated in response to an increase in the c-MAF expression level, obtained in a tumor tissue sample of a subject suffering from cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, is compared with a reference range so that if the expression level of one or more of these genes is altered relative to the reference range, it can be concluded that the subject is likely to respond favorably to a therapy aimed at preventing metastasis (if the subject has not yet developed metastasis) and / or treating metastasis (if the subject has already developed metastasis).

[0143] When cancer has caused metastasis, systemic treatments can be used, including, but not limited to, chemotherapy, hormone therapy, immunotherapy or combinations of these therapies. In addition, radiotherapy and / or surgery can be used. The choice of treatment usually depends on the type of primary cancer, its size, the location of the metastasis, the age, the general health status of the patient and the type of previous treatment used.

[0144] Treatments aimed at preventing and / or treating metastasis in subjects with cancer, such as breast cancer, include chemotherapy, hormone therapy and immunotherapy.

[0145] Chemotherapy uses drugs to kill cancer cells. It is usually administered orally or intravenously. When necessary, chemotherapy is used in combination with radiotherapy. Suitable chemotherapy treatments for breast cancer include, but are not limited to, anthracyclines (doxorubicin, epirubicin, pegylated, liposome-encapsulated doxorubicin), taxanes (paclitaxel, docetaxel, nab-paclitaxel), 5-fluorouracil, vinca alkaloids (vinorelbine, vincristine), gemcitabine, platinum salts (cisplatin and carboplatin), cyclophosphamide, etoposide and combinations of one or more of the above such as cyclophosphamide-anthracycline + / - 5-fluorouracil (e.g., doxorubicin-cyclophosphamide (AC), epirubicin-cyclophosphamide (EC), cyclophosphamide-epirubicin-5-fluorouracil (CEF), cyclophosphamide-doxorubicin-5-fluorouracil (CAF), 5-fluorouracil-epirubicin-cyclophosphamide (FEC)), cyclophosphamide-methotrexate-5-fluorouracil (CMF), anthracycline-taxane (e.g., doxorubicin-paclitaxel or doxorubicin-docetaxel), docetaxel-capecitabine, gemcitabine-paclitaxel, taxane-platinum salt (e.g., paclitaxel-carboplatin or docetaxel-carboplatin).

[0146] - Hormone therapy is based on the fact that some hormones promote the growth of some cancers. For example, estrogen in women (which is produced by the ovaries) sometimes promotes the growth of breast cancer. There are various ways to stop the production of these hormones. One way is to surgically remove the organs that produce them: the ovaries in the case of women and the testicles in the case of men. More commonly, drugs can be used to stop these organs from producing hormones or to prevent the hormones from acting on cancer cells.

[0147] - Immunotherapy is a treatment that helps the immune system itself fight the patient's cancer. There are several types of immunotherapy for treating patients with metastases. These therapies include, but are not limited to, cytokines, monoclonal antibodies, and anti-tumor vaccines.

[0148] Therapeutic method based on inhibiting genes whose expression is positively correlated with c-MAF expression

[0149] The inventors of the present invention have shown that inhibition of PHTLH in a bone metastasis cluster model generated by xenotransplantation of breast tumors results in a decrease in the number of osteolytic lesions within the metastases. This indicates that a gene whose expression increases in response to an increase in c-MAF expression (or whose expression decreases in response to a decrease in c-MAF expression) in breast tumors is a causative target gene in the bone metastasis process from ER+ breast cancer, and thus inhibition of it can be used to terminate the emergence of breast cancer metastases.

[0150] On the other hand, the inventors of the present invention have functionally verified the relationship between the expression of the metastasis gene PODXL in an adhesion assay and bone marrow cells in an experimental model based on purified mouse bone marrow cells (Example 5). PODXL expression is decreased in vivo in highly metastatic bone cells MCF7, which shows a high expression level of c-MAF that causes an increase in the endogenous level of the PODXL gene. Therefore, this gene is regarded as a prognostic marker as well as a causative target gene in the bone metastasis process in ER+ breast cancer and part of the bone metastasis program mediated by c-MAF.

[0151] Accordingly, in other aspects, the present invention relates to the use of a reagent that inhibits the expression of the activity of a gene or gene product for the preparation of a medicament for treating and / or preventing metastatic cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, wherein the gene is characterized in that its expression in tumor cells, particularly those found in the breast, colon, lung, kidney, or thyroid, especially the breast, increases in these cells in response to an increase in the c-MAF expression level, or decreases in these cells in response to a decrease in the c-MAF expression level.

[0152] In another aspect, the present invention relates to a reagent for inhibiting the expression of a gene or the activity of a gene product for treating and / or preventing metastatic cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, wherein the gene is characterized in that its expression in tumor cells found in the breast, colon, lung, kidney or thyroid, especially the breast, increases in these cells in response to an increase in the c-MAF expression level or decreases in these cells in response to a decrease in the c-MAF expression level.

[0153] In another aspect, the present invention relates to a method for treating and / or preventing metastatic cancer in a subject, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer, the method comprising administering a reagent that inhibits gene expression or the activity of a gene product, the gene being characterized in that its expression in tumor cells, particularly those found in the breast, colon, lung, kidney or thyroid, especially the breast, increases in these cells in response to an increase in the c-MAF expression level or decreases in these cells in response to a decrease in the c-MAF expression level.

[0154] The expression "reagent for inhibiting gene expression" refers to any molecule capable of producing a reduction in gene transcription, destabilizing mRNA and / or reducing mRNA translation.

[0155] Inhibitors of expression can be identified by standard methods for determining the ability of a compound to inhibit the transcription of certain genes (RT-PCR, Northern blotting and hybridization, run-on assays, etc.), destabilize mRNA or inhibit the translation of mRNA (in vitro translation assays in reticulocyte lysates or wheat germ lysates). In the present invention, a compound is considered to be an inhibitor of gene expression when it is capable of reducing the amount of mRNA of the gene, the transcription of the gene and / or the translation of the gene by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% (complete inactivation of the expression product).

[0156] Examples of inhibitors of gene expression for use in the present invention include, but are not limited to, gene-specific antisense oligonucleotides, gene-specific interfering RNAs (siRNAs) and gene-specific catalytic RNAs or ribozymes.

[0157] A preferred inhibitor of gene expression for use in the present invention is a gene-specific antisense oligonucleotide.

[0158] Also preferred as an agent for suppressing gene expression is gene-specific interfering RNA. Small interfering RNA or siRNA is an agent capable of suppressing the expression of a target gene by RNA interference. siRNA can be chemically synthesized, obtained by in vitro transcription, or synthesized in vivo in target cells. Generally, siRNA consists of double-stranded RNA with a length of 15 to 40 nucleotides and may contain 3' and / or 5' overhanging regions of 1 to 6 nucleotides. The length of the overhanging region does not depend on the total length of the siRNA molecule. siRNA acts by degrading or post-transcriptionally silencing the target messenger.

[0159] The siRNA of the present invention is substantially homologous to the mRNA of the gene encoding PTHLH, to the gene encoding PODXL, or to the genomic sequence encoding said protein. By "substantially homologous", it can be understood that they have a sequence sufficiently complementary or similar to the target mRNA such that the siRNA is capable of inducing the degradation of the target mRNA by interfering RNA. Suitable siRNAs for inducing such interference include siRNAs formed of RNA, as well as siRNAs containing different chemical modifications, such as:

[0160] - siRNAs in which the linkages between nucleotides are different from those occurring naturally (such as phosphorothioate linkages).

[0161] - Conjugates of RNA with functional reactive moieties such as fluorophores.

[0162] - Modifications of the ends of the RNA strands (especially the 3' end) by using modifications of the different functional 2'-position hydroxyls.

[0163] - Nucleotides having modified sugars (such as O-alkylation retained at the 2'-position, such as 2'-O-methylribose p 2'-O-fluororibose).

[0164] - Nucleotides having modified bases such as halogenated bases (e.g., 5-bromouracil and 5-iodouracil), alkylated bases (e.g., 7-methylguanosine).

[0165] siRNA can be used as such, meaning in the form of double-stranded RNA having the above characteristics. Alternatively, it is possible to use a vector containing the sense and antisense strands of siRNA under the control of a promoter suitable for expression in target cells.

[0166] Suitable vectors for siRNA expression are those vectors in which the two strands encoding siRNA are present in two regions of DNA, arranged in tandem in a single DNA strand, separated by a spacer region that forms a loop after transcription, and in which a single promoter directs the transcription of the DNA molecule producing shRNA.

[0167] Alternatively, vectors may be used in which each strand forming the siRNA is transcribed from a different transcription unit. These vectors are further divided into convergent and divergent transcription vectors. In divergent transcription vectors, the transcription units encoding each strand of the DNA strands forming the siRNA are tandemly located in the vector in such a way that the transcription of each DNA strand depends on its own proprietary promoter, which may be the same or different (Wang, J. et al., 2003, Proc. Natl. Acad. Sci. USA., 100: 5103-5106; Lee, N. S., et al., 2002, Nat. Biotechnol., 20: 500-505). In convergent transcription vectors, the DNA region that gives rise to the siRNA is found to form the sense and antisense strands of a DNA region flanked by two opposing promoters. After transcription of the sense and antisense RNA strands, the strands will hybridize to form a functional siRNA. Vectors are described as opposing promoter systems in those systems using two U6 promoters (Tran, N. et al., 2003, BMC Biotechnol., 3: 21), the murine U6 promoter and the human H1 promoter (Zheng, L., et al., 2004, Proc. Natl. Acad. Sci. USA., 135-140; WO2005026322), and the human U6 promoter and the murine H1 promoter (Kaykas, A., Moon, R., 2004, BMC Cell Biol., 5: 16).

[0168] Promoters suitable for expressing siRNA from convergent and divergent vectors include any promoter or pair of promoters that are compatible with the cells in which siRNA expression is desired. Thus, promoters suitable for the development of the present invention include, but are not limited to, constitutive promoters such as those from the genomes of eukaryotic viruses (such as polyomavirus, adenovirus, SV40, CMV, avian sarcoma virus, hepatitis B virus), metallothionein promoter genes, herpes simplex virus thymidine kinase promoter, the LTR region of retroviruses, immunoglobulin promoters, actin promoters, EF-1α promoters, and inducible promoters in which protein expression is dependent on the addition of a molecular or exogenous signal, such as the tetracycline system, NF-kB and UV light systems, Cre-lox system, heat shock promoters, the RNA polymerase II regulatory promoters described in WO / 2006 / 135436, and tissue-specific promoters (e.g., the PSA promoter described in WO2006012221). A constitutively acting RNA polymerase III promoter is a preferred promoter for the present invention. RNA polymerase III promoters are present in a limited number of genes such as 5S RNA, tRNA, 7S LRNA, and U6 snRNA. Different from other RNA polymerase III promoters, type III promoters do not require any intragenic sequences, but require a 5' direction sequence including a TATA box at positions -34 and -24, a proximal sequence element (PSE) between -66 and -47, and in some cases, a distal sequence element (DSE) between -265 and -149. The RNA polymerase III type III is a preferred promoter for human or murine H1 and U6 genes. More preferred are two human or murine U6 promoters, the murine U6 promoter and the human H1 promoter, or the human U6 promoter and the murine H1 promoter. In the specification of the present invention, promoters that are particularly suitable for specifically expressing a target gene in breast tumors (preferably in ER+ breast tumors) and are thus preferred for such expression are the αER or cyclin D1 promoters.

[0169] siRNA can be generated intracellularly from so-called shRNA (short hairpin RNA), which is characterized by the formation of reverse-flat strands of siRNA linked by a loop or hairpin region. siRNA can be encoded by plasmids or viruses, particularly retroviruses, and is under the control of a promoter. Promoters suitable for expressing shRNA are those indicated in the foregoing paragraphs regarding siRNA expression.

[0170] Vectors suitable for siRNA and shRNA expression include prokaryotic expression vectors such as pUC18, pUC19, pBluescript and derivatives, mp18, mp19, pBR322, pMB9, CoIEI, pCRI, RP4, phages and shuttle vectors such as pSA3 and pAT28, yeast expression vectors such as 2-micron plasmids, integrating plasmids, YEp vectors, centromere plasmids and similar vectors, expression vectors in insect cells such as pAC series and pVL series vectors, expression vectors in plant cells such as pIBI series, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE and similar vectors, and large eukaryotic cell expression vectors based on viral vectors (adenoviruses, adeno-associated viruses and retroviruses, specifically, lentiviruses) and non-viral vectors (such as pcDNA3, pHCMV / Zeo, pCR3.1, pEFI / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXI, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDTI). Lentiviral vectors are the preferred vectors for development.

[0171] The siRNA and shRNA of the present invention can be obtained by using a series of techniques known to experts in the art. The nucleotide sequence region used as the basis for designing siRNA is not restricted and can contain the region of the coding sequence (between the start codon and the stop codon) or, alternatively, it can contain the sequence of the 5' or 3' untranslated region (preferably 25 to 50 nucleotides in length), and any position in the sense 3' position relative to the start codon. Methods for designing siRNA include identifying the AA(N19)TT motif, where N can be any nucleotide in the gene sequence, especially PTHLH or PODXL, and the selection of gene sequences with a high GC content. If such a base sequence is not found, NA(N21) may be identified, where N can be any nucleotide.

[0172] Gene-specific DNAzymes are the preferred reagents for inhibiting gene expression. DNAzymes incorporate some of the mechanistic features of antisense technology and ribozymes. DNAzymes are designed to recognize the target sequence of a specific nucleic acid, similar to antisense oligonucleotides, but like ribozymes, they catalyze and specifically cleave the target nucleic acid.

[0173] Preferred reagents for inhibiting gene expression are ribozymes designed to catalytically cleave transcripts of target mRNAs to prevent translation of mRNAs encoding PTHLH or PODXL, the activities of which are desired to be inhibited. Ribozymes are RNA enzyme molecules capable of catalyzing the specific cleavage of RNA. (For a review, see Rossi, Current Biology 4:469-471, 1994). The mechanism of ribozyme action involves hybridization to a specific molecular sequence of a complementary target RNA, followed by an endonucleotide cleavage event. The composition of ribozyme molecules preferably includes one or more complementary sequences directed against the target mRNA, and known or functionally equivalent sequences responsible for mRNA cleavage (see, for example, U.S. Patent No. 5,093,246).

[0174] Ribozymes useful in the present invention include hammerhead ribozymes, endoribonuclease RNAs (hereinafter referred to as "Cech ribozymes" (Zaug et al., Science 224:574-578, 1984).

[0175] Ribozymes can be composed of modified oligonucleotides (e.g., to increase stability, guidance, etc.) and should be delivered to cells that express the target gene in vivo. Preferred delivery methods include using DNA constructs "encoding" ribozymes under the control of strong pol III or pol II constitutive promoters in such a way that the transfected cells will produce an adequate amount of ribozyme to disrupt endogenous target messengers and inhibit translation. Since ribozymes, unlike other antisense molecules, require extremely low intracellular concentrations to function.

[0176] In the case of compounds that inhibit the activity of gene products, these compounds can be identified by using specific assays capable of measuring the activity of such products. As a preference, compounds that inhibit the activity of gene products can be identified by using the assays explained in Example 3 of the present invention, which assays are characterized by the measurement of the ability of the inhibitor to reduce the formation of osteolytic lesions and / or the ability to differentiate osteoclasts in vitro in an animal model of breast cancer metastasis with high metastatic clustering ability. In the present invention, a compound is considered an inhibitor of the activity of a gene product when it can reduce the activity of such product by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% reduction (complete inactivation of the gene product).

[0177] Examples of reagents for inhibiting the activity of gene products useful in the present invention include, but are not limited to, specific inhibitory antibodies against the gene product, negative dominant variants of the gene product, and inhibitory peptides of the gene product.

[0178] Another preferred reagent for inhibiting a gene product is a specific inhibitory antibody against the product. The antibody can be prepared by using any method known to experts in the art, some of which have been described previously. Thus, polyclonal antibodies can be prepared by immunizing an animal with the protein to be inhibited. Monoclonal antibodies can be prepared by using the method described by Kohler, Milstein et al. (Nature, 1975, 256: 495). Suitable antibodies in the specification of the present invention include intact antibodies, Fab, F(ab’)2 and Fab’ fragments, Fv, scFv, nanobodies, diabodies and bispecific antibodies comprising variable and constant regions that bind an antigen. After an antibody has been identified by its protein-binding ability (especially against PTHLH or PODXL), those antibodies that are capable of inhibiting the activity of the protein will be selected by using the assays for identifying a reagent as an inhibitor.

[0179] Another preferred reagent for inhibiting the activity of a gene product is an inhibitory peptide of the product.

[0180] Another preferred reagent for inhibiting the activity of a gene product is a “dominant negative mutant” of the gene product. The present invention contemplates the use of dominant negative mutants of gene products and polynucleotides encoding said mutants. A promoter that can be used to regulate the transcription of the polynucleotides of the present invention can be a constitutive promoter, meaning that they can mainly direct the transcription of an inducible promoter where transcriptional activity requires an external signal. Suitable constitutive promoters for regulating transcription include, among others, the CMV promoter, SV40 promoter, DHFR promoter, mouse mammary tumor virus (MMTV) promoter, elongation factor 1a (EF1a) promoter, albumin promoter, ApoA1 promoter, cathepsin promoter, CD3 promoter, heavy- or light-immunoglobulin chain promoter, neurofilament promoter, neuron-specific enolase promoter, L7 promoter, CD2 promoter, myosin light chain promoter, HOX promoter, thymidine kinase promoter, RNA polymerase II promoter, MyoD promoter, phosphoglycerate kinase (PGK), low density lipoprotein promoter, actin promoter. A preferred promoter for regulating the expression of a transcriptional activator is the PGK promoter. A preferred promoter for regulating the transcription of the polynucleotides of the present invention is the bacteriophage T7 RNA polymerase.

[0181] Preferably, the inducible promoters that can be used in the context of the present invention are those that respond to an inducer, do not show baseline expression or show insignificant baseline expression in the absence of the inducer and are capable of promoting the activation of a gene located at position 3'. Based on the type of inducer, inducible promoters are classified as Tet on / off promoters (Gossen, M. y H. Bujard (1992) Proc. Natl. Acad. Sci. USA, 89:5547-5551; Gossen, M. et al., 1995, Science 268:1766-1769; Rossi, F.M.V. y H.M. Blau, 1998, Curr. Opin. Biotechnol. 9:451-456); Pip on / off promoters (US6287813); anti-progesterone-dependent promoters (US2004132086), ecdysone-dependent promoters (Christopherson et al., 1992, Proc. Natl. Acad. Sci. USA, 89:6314-6318; No et al., 1996, Proc. Natl. Acad. Sci. USA, 93:3346-3351, Suhr et al., 1998, Proc. Natl. Acad. Sci. USA, 95:7999-8004 y WO9738117), metallothionein-dependent promoters (WO8604920), rapamycin-dependent promoters (Rivera et al., 1996, Nat. Med. 2:1028-32).

[0182] Vectors suitable for the expression of polynucleotides encoding dominant-negative variants of c-MAF [sic: variants] include vector derivatives of expression vectors in prokaryotes such as pUC18, pUC19, Bluescript and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCRa, RP4, phages, and "shuttle" vectors such as pSA3 and pAT28, expression vectors in yeast such as 2 micron plasmid vectors, integrating plasmids, Yep vectors, centromeric and similar plasmids, insect cell expression vectors such as pAC and pVL series vectors, plant expression vectors such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors and similar vectors, and virus-based vectors (adenoviruses or viruses associated therewith, such as retroviruses, particularly lentiviruses) and non-viral vectors (such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hygpHCMV / Zeo, pCR3.1, pEF1 / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTracer-HCMV, pUB6 / V5-His, pVAX1, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDT1) in higher eukaryotic cells.

[0183] In a preferred embodiment, genes are selected whose expression increases in response to an increase in the c-MAF expression level in tumors, particularly breast tumors, colon tumors, lung tumors, kidney tumors or thyroid tumors, more particularly breast tumors, or whose expression decreases in response to an increase in the c-MAF expression level in tumors, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer, the genes described in Table 1.

[0184] In an even more preferred embodiment, the gene whose expression increases in response to an increase in the c-MAF expression level in breast tumors is the PHTLH gene. In an alternative preferred embodiment, the gene whose expression increases in response to an increase in the c-MAF expression level in breast tumors is the PODXL gene.

[0185] Thus, reagents that inhibit PHTHL expression or the activity of the product of said gene include, but are not limited to, specific siRNAs against the PHTHL gene, specific antisense oligonucleotides against the PHTHL gene, specific ribozymes against the PHTHL gene, specific antibody inhibitors against the PHTHL protein, dominant-negative PHTHL variants of the expression product, and PHTHL inhibitory peptides.

[0186] Inhibitors of PODXL expression or the activity of the expression product of said gene include, but are not limited to, specific siRNAs against the PODXL gene, specific antisense oligonucleotides against the PODXL gene, specific ribozymes against the PODXL gene, specific inhibitory antibodies against the PODXL protein, dominant negative PODXL variants of the expression product, and PODXL inhibitory peptides.

[0187] PTHLH - specific siRNAs include, but are not limited to, commercially available siRNAs such as Abgent's step - designed siRNA against PTHLH (Catalog No. RI14318), Qiagen's siRNA against murine PTHLH (GS19227), Cambridge Bioscience's siRNA duplex against human PTHLH (Catalog No. SR303874), and so on.

[0188] PODXL - specific siRNAs include, but are not limited to, commercially available siRNAs such as Santa Cruz Biotechnology's sc - 44765 siRNA, OriGene's siRNA duplex against human PODXL (SR303611), or Cambridge Bioscience's siRNA duplex against human PODXL (Catalog No. SR303611), and so on.

[0189] PTHLH inhibitory antibodies effectively useful in the present invention include, but are not limited to, Abcam's 3H1 - 5G8 mouse monoclonal antibody (ab115488) that recognizes human PTHLH, Abbiotech's P12272 rabbit polyclonal antibody (Catalog No. 251478) that recognizes rat, mouse, and human PTHLH, BioVision's rabbit polyclonal antibody (Catalog No. 5652 - 100) that recognizes human PTHLH, or Novus Biologicals' mouse monoclonal antibody (Catalog No. NBP1 - 26542) that recognizes human PTHLH, and so on.

[0190] PODXL inhibitory antibodies effectively useful in the present invention include, but are not limited to, ab62594 rabbit polyclonal antibody that recognizes the N - terminal region of human PODXL, or Santa Cruz Biotechnology's sc - 23903 mouse monoclonal antibody that recognizes human PODXL.

[0191] PTHLH inhibitory peptides include, but are not limited to:

[0192] - Truncated variants of PTHLH such as hPTHrP(7-34) with the sequence LLHDKGKSIQDLRRRFFLHHLIAEIHTA (SEQ ID NO: 8), PTHrP(3-34), PTHrP(8-34), PTHrP(9-34), PTHrP(10-34), and amidated variants and variants resulting from the substitution of the amino acids corresponding to positions 10, 11, and 12 of PTHLH with Asn (Asn10 variant), Leu (Leu11 variant), and D-Trp (D-Trp12 variant), respectively, and specifically, peptides described in Nutt et al., 1990, Endocrinology 127:491-493, Doppelt et al., 1986, Proc. Natl. Acad. Sci. USA 83:7557-7560, and US6362163 and US5527772) such as [Nle 8 ' 18 , Tyr 34 bPTH(7-34)NH2, [Tyr 34 bPTH(7-34)NH2, hPTHrP(7-34), [Leu 11 , D-Trp 12 hPTHrP(7-34)2, [Asn 10 Leu 11 hPTHrP(7-34)-NH2 and [Asn 10 , Leu 11 , D-Trp 12 hPTHrP(7-34)-NH2.

[0193] - Truncated derivatives of TIP (tuberoinfundibular peptide) such as the TIP peptide (1-39) (tuberoinfundibular peptide 1-39) and its derivatives as described in Hoare et al., Peptides 23:989-998, 2002.

[0194] - Peptide NCT00051779 (Chugai Pharmaceuticals)

[0195] - Peptides described in Tables 1 to 5 of US2007203071AA

[0196] - Peptides whose structures are shown in Formula 1 of WO04103273A2

[0197] - Peptides described by Ols tad et al. (Peptides 1995, 16:1031-1037) and Roubini et al. (Biochemistry, 1992, 31:4026-4033)

[0198] - The peptides [Asn10Leu11]-PTHrP(7-34)-NH2 and [Asn10,Leu11,D-Trp12]-PTHrP-(7-34)-NH2 described by Nut t et al. (Endocrinology, 1990, 127:491-3)

[0199] - Fc conjugates of any of the peptides described above, such as those described in the WO04060386 peptide.

[0200] - Functionally equivalent variants of these peptides.

[0201] As used in the present invention, the term "functionally equivalent variant" refers to those peptides derived from the sequences of the peptides of the present invention by modification, insertion and / or deletion of one or more amino acids, provided that the function of the peptide is maintained at least 20%, at least 50%, at least 80% of the function of the corresponding peptide of the present invention without modification, insertion and / or deletion. Variants suitable for use in the present invention include those showing at least 25%, at least 40%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the peptide sequences described above. The degree of identity between two amino acid sequences can be determined by conventional methods, such as by standard alignment algorithms for known sequences in the prior art, such as BLAST (Altschul SF et al. Basic Local Alignment Search Tool. J Mol Biol. 1990 Oct 5;215(3):403-10).

[0202] Other PTHLH inhibitors include, but are not limited to, polypeptides that specifically bind to the N-terminal region of PTHLH as described in WO2011003935.

[0203] In a specific form of the first use of the present invention, the cancer is breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, preferably breast cancer.

[0204] In a more specific form of the second use of the present invention, the breast cancer is of the ER+ type or the triple-negative type.

[0205] In a specific form of the use of the present invention, cancer metastasis, particularly metastasis of breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, preferably breast cancer, is bone metastasis. In a more specific form, the bone metastasis is osteolytic metastasis.

[0206] Therapeutic method based on activation of genes with expression inversely correlated with c-MAF expression

[0207] The inventors of the present invention have shown that the expression level of the RERG gene is inversely correlated with the c-MAF expression level and that an increase in RERG expression in breast tumors can reduce the number of metastatic cells. Thus, this indicates that the regulation of the expression of genes whose expression is downregulated by c-MAF can be used for the treatment and / or prevention of breast cancer metastasis. In this context, the present inventors have shown that the use of RERG activators can reduce the number of metastatic cells.

[0208] Accordingly, in one aspect, the present invention relates to the use of an agent that stimulates the expression of a gene or the activity of the expression product of said gene for the preparation of a medicament for the treatment and / or prevention of cancer metastasis, particularly breast, colon, lung, kidney or thyroid cancer, more particularly metastasis of breast cancer, wherein the gene is characterized in that its expression in tumor cells (particularly breast, colon, lung, kidney or thyroid cancer, more particularly breast cancer cells) decreases in response to an increase in the expression level of c-MAF in said cells, or because its expression increases in response to a decrease in the expression level of c-MAF in said cells.

[0209] In another aspect, the present invention relates to the use of an agent that stimulates the expression of a gene or the activity of the expression product of said gene for the preparation of a medicament for the treatment and / or prevention of cancer metastasis, particularly breast, colon, lung, kidney or thyroid cancer, more particularly metastasis of breast cancer, wherein the gene is characterized in that its expression in tumor cells (particularly breast, colon, lung, kidney or thyroid cancer, more particularly breast cancer cells) decreases in response to an increase in the expression level of c-MAF in said cells, or in that its expression increases in response to a decrease in the expression level of c-MAF in said cells.

[0210] In another aspect, the present invention relates to a method for the treatment and / or prevention of cancer metastasis in a subject, particularly breast, colon, lung, kidney or thyroid cancer, more particularly metastasis of breast cancer, said method comprising administering to the subject an agent that stimulates the expression of a gene or the activity of the expression product of said gene, wherein the gene is characterized in that its expression in tumor cells, particularly breast, colon, lung, kidney or thyroid cancer, more particularly breast cells, decreases in response to an increase in the expression level of c-MAF in said cells or in that its expression increases in response to a decrease in the expression level of c-MAF in said cells.

[0211] In a preferred embodiment, the agent that stimulates the expression of the gene is a polynucleotide comprising the coding sequence of the gene or the agent that stimulates the activity of the expression product of the gene is a polypeptide encoded by the gene.

[0212] In another aspect, a polynucleotide that stimulates the expression of the gene can be part of a gene construct. Preferably, the gene construct contains a polynucleotide of the invention together with regions suitable for regulating the expression of the polynucleotide, including promoters, transcription terminators, 5' and 3' untranslated regions, polyadenylation signals, and similar regions.

[0213] In principle, any promoter can be used to clone a vector in the context of the present invention, provided that the promoter is compatible with the cell in which it is desired to express the polynucleotide. Thus, promoters suitable for use in embodiments of the present invention include, but are not limited to, constitutive promoters such as derivatives of genes of eukaryotic viruses (such as polyomavirus, SV40, CMV, avian sarcoma virus, hepatitis B virus), metallothionein gene promoters, herpes simplex virus thymidine kinase gene promoters, LTR regions of retroviruses, immunoglobulin a [sic: immunoglobulin] gene promoters, actin gene promoters, EF-1α gene promoters, and inducible promoters in which the expression of a protein depends on the addition of a molecule or exogenous signal, such as the tetracycline system, the NFκB / UV light system, the Cre / Lox system, and heat shock gene promoters, and regulatable RNA polymerase II promoters as described in WO / 2006 / 135436.

[0214] In a preferred embodiment, the polynucleotide is effectively coupled to a mammary tissue-specific promoter. Examples of suitable specific promoters for mammary tissue for use in the present invention illustratively include:

[0215] - Matrix metalloproteinase 3 promoter (Basset et al., Nature 348.: 699, 1990)

[0216] - Promoter of mucin-like glycoprotein (DF3, MUC1) ((Abe et al. Proc. Natl. Acad. Sci. U.S.A. 90: 282, 1993)

[0217] - c-erbB-3, c-erbB-2 or c-erbB-4 promoter

[0218] - Promoter of mouse mammary tumor virus (MMTV),

[0219] - Promoter of whey acidic protein

[0220] - Human α-lactalbumin promoter

[0221] - Bovine β-lactoglobulin promoter.

[0222] In a preferred embodiment, the reagent that stimulates gene expression is part of a vector. Accordingly, the present invention contemplates the use of vectors derived from expression vectors in prokaryotes such as pUC18, pUC19, Bluescript and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage, and "shuttle" vectors such as pSA3 and pAT28, expression vectors in yeast such as 2-micron plasmid-type vectors, integrating plasmids, YEP vectors, centromeric plasmids, etc., insect expression vectors such as pAC and pVL series vectors, plant expression vectors such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors, etc., expression vectors in higher eukaryotes based on viral vectors and [sic: or] non-viral vectors such as pcDNA3, pHCMV / Zeo, pCR3.1, pEFL / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV pUB6 / V5-His, pVAX1, pZeoSV2, pCI, pSVL, and pKSV-10, pBPV-1, pML2d, and pTDT1.

[0223] In a preferred embodiment, the reagent that stimulates gene expression is delivered in the form of a viral vector. Suitable viral vectors for use in the present invention include, but are not limited to, adenoviral vectors, lentiviral vectors, retroviral vectors, vaccinia virus-derived vectors, adeno-associated virus (AAV), and herpesvirus vectors.

[0224] The present invention includes several non-viral methods for transferring an expression construct into cultured mammalian cells. These methods include calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, DNA-loaded liposomes and lipofectamine-DNA complexes, cell sonication, microprojectile bombardment accelerated using a gene gun, and receptor-mediated transfection. Some of these techniques can be adapted for proper use in vivo or ex vivo.

[0225] In other embodiments of the present invention, the reagent that stimulates gene expression can be encapsulated within liposomes. Liposomes are small vesicular structures characterized by a phospholipid bilayer membrane and an internal aqueous medium.

[0226] The present invention contemplates the administration, locally, regionally or systemically, of an agent that promotes the expression of a gene or the activity of the expression product of said gene. The administration of the agent can be carried out in a localized manner, in which case the agent is administered directly into the tumor, the tumor vasculature, the tumor-associated lymphatics or the ducts associated with the tumor. The administration can be intraperitoneal, intrapleural, intraendothelial or intrathecal. Gene therapy can include regional administration in the vasculature of tumor-associated members.

[0227] In the case where a polypeptide is used as an agent that stimulates the expression of the activity of the product of a gene, the present invention contemplates the use of variants of the polypeptide modified with a peptide capable of promoting the transport of the protein into the interior of the cell, said peptides being such as the Tat peptide derived from the HIV-1 Tat protein, the third helix of the homeodomain of the Antennapedia protein of Drosophila melanogaster, the VP22 protein of Herpes simplex virus and arginine oligomers (Lindgren, A. et al., 2000, Trends Pharmacol. Sci, 21:99-103, Schwarze, S.R. et al., 2000, Trends Pharmacol. Sci., 21:45-48, Lundberg, M et al., 2003, Mol. Therapy 8:143-150 and Snyder, E.L. and Dowdy, S.F., 2004, Pharm. Res. 21:389-393).

[0228] In a more preferred embodiment, the gene whose expression decreases in response to a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially in response to an increase in the expression level of c-MAF in breast cancer, or whose expression increases in response to a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially in response to a decrease in the expression level of c-MAF in breast cancer, is selected from the genes described in Table 2.

[0229] In an even more preferred embodiment, the gene whose expression decreases in response to a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, especially in response to an increase in the expression level of c-MAF in breast cancer, is the RERG gene.

[0230] In a specific embodiment of the second use of the present invention, the RERG activator is selected from:

[0231] (i) a nucleic acid encoding RERG or a functionally equivalent variant of RERG and

[0232] (ii) the RERG protein or a functionally equivalent variant of RERG.

[0233] In a preferred embodiment, the nucleic acid encoding RERG corresponds to either of two transcript variants with accession numbers NM_032918.2 (variant 1) and NM_001190726.1 (variant 2) as collected in the NCBI database (version of November 28, 2011).

[0234] The term "functionally equivalent variant of the RERG protein" is understood to mean a polypeptide whose sequence is derived from the RERG protein by substitution, insertion or deletion of one or more amino acids and which retains substantially the same function as the RERG protein, which means that it serves as an inhibitor of cell proliferation and tumor formation. Variants of the RERG protein can be identified using methods based on the ability of RERG to inhibit cell proliferation, such as the methods described in Example 4 of the present invention.

[0235] According to the present invention, the variant preferably has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the nucleotide sequence of any RERG gene variant or with the amino acid sequence of any RERG protein isoform. The degree of identity between the variant and the specific sequence of the gene or RERG protein defined above can be determined using computer algorithms and methods well known to those of ordinary skill in the art. The identity between two nucleic acid sequences is preferably determined using the BLASTN algorithm, and the identity between two amino acid sequences is preferably determined using BLASTP [BLAST Manual, Altschul, S., et al. algorithm., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., y col., J. Mol. Biol. 215: 403-410 (1990)].

[0236] In a preferred embodiment, the cancer is breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer. In a preferred embodiment, breast cancer is selected from ER+ cancer and ER-Her2- cancer. In a preferred embodiment, the bone metastasis is a bone metastasis. In an even more preferred embodiment, the bone metastasis is an osteolytic metastasis.

[0237] Pharmaceutical composition and administration method

[0238] The following reagents are usually administered in combination with a pharmaceutically acceptable carrier: a reagent that inhibits the expression of a gene whose expression increases in response to an increase in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer, or whose expression decreases in response to a decrease in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer; a reagent that inhibits the activity of the expression product of a gene whose expression increases in response to an increase in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more preferably breast cancer, or whose expression decreases in response to a decrease in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer; a reagent that stimulates the expression of a gene whose expression decreases in response to an increase in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer, or whose expression increases in response to a decrease in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer; and / or a reagent that stimulates the activity of the expression product of a gene whose expression decreases in response to an increase in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more particularly breast cancer, or whose expression increases in response to a decrease in the expression level of c-MAF in a tumor, particularly breast cancer, colon cancer, lung cancer, kidney cancer or thyroid cancer, more preferably breast cancer.

[0239] The term "carrier" refers to a diluent or excipient administered together with the active ingredient. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. These reagents are preferably used as aqueous carriers or saline aqueous solutions and aqueous glucose and glycerol solutions, particularly for injectable solutions. Suitable pharmaceutical carriers are described by EW Martin, 1995 in "Remington's Pharmaceutical Sciences". Preferably, the carriers of the present invention are approved by the regulatory agencies of the federal government or listed in the United States Pharmacopeia or other generally recognized pharmacopeias for animals, more particularly humans.

[0240] The vehicle and auxiliary substances necessary for manufacturing the required pharmaceutical administration form of the pharmaceutical composition of the present invention will depend, among other factors, on the selected pharmaceutical administration form. The pharmaceutical administration form of the pharmaceutical composition can be prepared according to conventional methods known to those of ordinary skill in the art. A review of the different administration methods of the active ingredient and excipients to be used and the methods for producing them can be found in "Tratado de Farmacia Galénica", C. Fauli i Trillo, Luzán 5, S.A. de Ediciones, 1993. Examples of pharmaceutical compositions include any solid composition (tablets, pills, capsules, granules, etc.) or liquid (solutions, suspensions or emulsions) for oral, topical or parenteral administration. Additionally, if necessary, the pharmaceutical composition may also contain stabilizers, suspending agents, preservatives, surfactants, etc.

[0241] For use in medicine, the inhibitors / activators of the present invention can exist alone or in combination with other active agents in the form of prodrugs, salts, solvates or inclusion compounds, and can be formulated together with excipients acceptable from a pharmaceutical perspective. Preferred excipients for the present invention include sugars, starches, celluloses, gums and proteins. In a specific embodiment, the pharmaceutical composition of the present invention should be formulated into solid pharmaceutical dosage forms (such as tablets, capsules, dragees, granules, suppositories, sterile crystals or amorphous solids that can be reconstituted to provide a liquid form, etc.), liquids (such as solutions, suspensions, emulsions, elixirs, lotions, ointments, etc.) or semi-solids (gels, pastes, creams, etc.). The pharmaceutical composition of the present invention can be administered by any route, including but not limited to oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal routes. A review of the different administrations of the active ingredient and excipients to be used and their manufacturing methods can be found in Tratado de Farmacia Galénica, C. Fauli i Trillo, Luzán 5, S.A. de Ediciones, 1993 in Remington's Pharmaceutical Sciences (AR Gennaro, editor), 20th edition, Williams & Wilkins PA, USA (2000). Examples of pharmaceutically acceptable carriers are known in the art and include phosphate buffered saline solutions, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. Compositions containing such carriers can be formulated by conventional methods known in the art.

[0242] In the case of administering a nucleic acid (siRNA, polynucleotide encoding siRNA or shRNA, or polynucleotide encoding a dominant negative), the present invention contemplates a pharmaceutical composition specifically prepared for the administration of said nucleic acid. The pharmaceutical composition may be in naked form, i.e., contain the nucleic acid in the absence of a compound that protects the nucleic acid from degradation by nucleases of the organism, which results in the advantageous aspect that the toxicity associated with the reagents for transfection is eliminated. Suitable routes for the administration of naked compounds include intravascular, intratumoral, intracranial, intraperitoneal, intrasplenic, intramuscular, subretinal, subcutaneous, mucosal, topical and oral routes (Templeton, 2002, DNA Cell Biol, 21:857-867). Alternatively, the nucleic acid can be administered by forming part of a liposome, conjugating to cholesterol or conjugating to a compound that promotes transport across the cell membrane, such as the Tat peptide derived from the HIV-1 Tat protein, the third helix of the homeodomain of Drosophila melanogaster Antennapedia protein, the VP22 protein of herpes simplex virus, and arginine oligomers and peptides described in WO07069090 (Lindgren, A. et al., 2000, Trends Pharmacol. Sci, 21:99-103, Schwarze, S.R. et al., 2000, Trends Pharmacol. Sci., 21:45-48, Lundberg, M et al., 2003, Mol Therapy 8:143-150 and Snyder, E.L. and Dowdy, S.F., 2004, Pharm. Res. 21:389-393). Alternatively, the polynucleotide can be administered by forming a plasmid vector or a viral vector, preferably a vector based on adenovirus, adeno-associated virus or retrovirus, such as part of a virus based on murine leukemia virus (MLV) or lentivirus (HIV, FIV, EIAV).

[0243] The inhibitor / activator or pharmaceutical compounds containing these substances can be administered at a dose lower than 10 mg / kg body weight, preferably lower than 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg / kg body weight. The unit dose can be administered by injection, inhalation or by topical application.

[0244] The dosage depends on the severity and response of the condition to be treated and may vary over several days to months until the condition is observed to enter a remission phase. The optimal dosage can be determined by regularly measuring the concentration of the agent in the patient's system. The optimal dosage can be determined using the EC50 value obtained from preliminary in vitro or in vivo tests conducted in animal models. The unit dosage can be administered once a day or at least once a day, preferably at least once a day, for 2, 4, 8, or 30 days. Alternatively, an initial dosage may be administered, followed by one or more maintenance dosages, which are generally an amount less than the initial dosage. The maintenance regimen can include treating the patient with dosages ranging from 0.01 μg to 1.4 mg / kg body weight / day, such as 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg / kg body weight / day. Preferably, the maintenance dosage is administered at most once every 5, 10, or 30 days. The treatment should be maintained for a period of time that varies depending on the type of disorder the patient is suffering from, its severity, and the patient's state / condition. After treatment, the patient's progression should be monitored to determine whether the dosage should be increased if the disease does not respond to the treatment being administered, or whether the dosage should be decreased if improvement of the disease is observed or if unwanted side effects are observed.

[0245] Method for identifying signature (blueprint) genes indicative of susceptibility to metastasis

[0246] The inventors of the present invention have developed a method by means of which it is possible to identify genes associated with the propensity / susceptibility of breast cancer patients to develop metastases. The method is based on the identification of genes whose expression in breast tumors is correlated with the expression of c-MAF and whose expression in breast cancer cell lines is observed to vary in response to changes in the expression level of c-MAF.

[0247] Thus, in another aspect, the present invention relates to an in vitro method (hereinafter referred to as the gene identification method of the present invention) for identifying genetic markers predisposing to metastasis in patients suffering from cancer, particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, especially breast cancer, which comprises (i) determining the expression levels of a candidate gene and the c-MAF gene in a primary breast cancer tumor sample, and (ii) determining the change in the expression level of the candidate gene in a set of breast cancer cells in response to modulation of the c-MAF gene expression

[0248] wherein the expression level of the gene is statistically significantly correlated with the expression of c-MAF in a tumor sample of a primary cancer (particularly breast cancer, colon cancer, lung cancer, kidney cancer, or thyroid cancer, more particularly breast cancer), and the change in the expression level resulting from the alteration of the c-MAF gene expression shows a statistical correlation with the change in the level of the gene, indicating that the gene is a marker of the patient's propensity / trend to metastasis.

[0249] In a first stage, the method for identifying the gene of the present invention comprises determining the expression levels of a candidate gene and the c-MAF gene in tumor samples of primary cancers (particularly breast, colon, lung, kidney or thyroid cancers, more particularly breast cancer).

[0250] The determination of the expression levels of the candidate gene and the c-MAF gene in the primary tissue sample can be carried out substantially as described in the content of the in vitro method to predict the occurrence of metastasis in cancer patients (particularly breast cancer). In a preferred method, the expression levels of the candidate gene and the c-MAF gene can be determined using RNA (messenger RNA or mRNA) produced by transcription of the gene, based on the complementary DNA (cDNA) of the gene or by quantification of the expression level of the protein encoded by the gene.

[0251] In a second stage, the method for identifying the gene of the present invention comprises determining the change in the expression level of the candidate gene in a group of cancer cells (particularly breast, colon, lung, kidney or thyroid cancers, more particularly breast cancer) in response to the regulation of the expression of the c-MAF gene.

[0252] The determination of the change in the expression level of the candidate gene requires determining the expression level in tumor cells at two specific time points during which a change in the expression level of c-MAF has been introduced. The change in the expression level of c-MAF between the first time point and the second time point can represent an increase in c-MA expression or a decrease in the expression level of c-MAF.

[0253] In a preferred method, the regulation of the level of c-MAF carried out during stage (ii) represents an increase in the level of c-MAF. To achieve this, this stage requires the introduction of a polynucleotide encoding c-MAF or a portion of c-MAF into the cell. Suitable methods for introducing a target gene into a cell and appropriately arranging it to express the gene of interest in the cell have been described in the content of the treatment method, which is based on the expression being inversely correlated with the expression of c-MAF and is used in the same form for the activation of the gene of the present invention.

[0254] To induce an increase in the expression level of c-MAF in a target / given cell population, the cell may be modified by introducing a polynucleotide encoding c-MAF, which is operably linked to a promoter that promotes the expression of cells in tumors such as breast, colon, lung, kidney or thyroid cancers, but preferably breast cancer. The polynucleotide is generally produced by forming a part of a vector that contains, in addition to the polynucleotide, additional sequences (e.g., an origin of replication) that ensure its amplification in a host prokaryote and a selection marker. By way of example, the following promoters suitable for the expression of a target gene in breast cancer tumor cells can be used:

[0255] - Promoter of matrix metalloproteinase 3 (Basset et al., Nature 348:699, 1990)

[0256] - Promoter of mucin-like glycoprotein (DF3, MUC1) ((Abe et al., Proc. Natl. Acad. Sci. U.S.A. 90:282, 1993)

[0257] - Promoter of c-erbB-3, c-erbB-2 or c-erbB-4

[0258] - Promoter of mouse mammary tumor virus (MMTV)

[0259] - Promoter of whey acidic protein

[0260] - Promoter of human α-lactalbumin

[0261] - Promoter of bovine β-lactoglobulin

[0262] Introduce a polynucleotide encoding c-MAF or a vector containing said polynucleotide into cells that are the target of this study using any transfection method known to those of ordinary skill in the scientific field (see Sections 9.1 to 9.5 in Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc, 2003). Specifically, transfect cells using DNA co-precipitation with phosphate bonds, DEAE-dextran, polybrene, electroporation, microinjection, liposome-mediated fusion, lipofection, infection by retrovirus, and gene gun transfection.

[0263] Alternatively, modify the cells by introducing c-MAF protein into the cells. For this purpose, the present invention provides the use of c-MAF modified by a peptide, the peptide being capable of promoting protein transport to the inside (subcellular level) of the cell, such as peptides, Tat derived from the HIV-1 Tat protein, the third helix of the homeodomain of the antennapedia protein of Drosophila melanogaster, the VP22 protein of herpes simplex virus, and arginine oligomers (Lindgren, A. et al., 2000, Trends Pharmacol. Sci, 21:99-103, Schwarze, S.R. et al., 2000, Trends Pharmacol. Sci., 21:45-48, Lundberg, M et al., 2003, Mol. Therapy 8:143-150y Snyder, E.L. and Dowdy, S.F., 2004, Pharm. Res. 21:389-393).

[0264] In a more specific model, the increase in the expression of c-MAF occurs during the expression of the short isoform of c-MAF in cancer cells, particularly breast cancer as well as colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer cells. In another even more specific model, the increase in the expression of c-MAF occurs during the expression of the long isoform of c-MAF in cancer cells, particularly breast cancer as well as colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer cells. In an even more specific model, the increase in the expression of c-MAF occurs during the co-expression of the long and short isoforms of c-MAF in cancer cells, particularly breast cancer as well as colon cancer, lung cancer, kidney cancer or thyroid cancer, especially breast cancer cells.

[0265] If the regulation of the c-MAF level that occurs during the second step involves reducing the c-MAF level, then this step requires introducing into the cell a reagent capable of silencing c-MAF. By way of example and this is in no way exhaustive, examples of suitable reagents for achieving a reduction in the level of c-MAF include antisense oligonucleotides specific to the gene, RNA interference (RNAi) treatment specific to the gene, catalytic RNA or specific ribonucleases of the gene, C-MAF inhibitors and inhibitory antibodies.

[0266] The RNA interference (RNAi) method for c-MAF includes the RNAi described in WO2005046731, where one strand is ACGGCUCGAGCAGCGACAA (SEQ ID NO: 1). Other sequences of RNAi specific to c-MAF include, but are not limited to, CUUACCAGUGUGUUCACAA (SEQ ID NO: 2), UGGAAGACUACUACUGGAUG (SEQ ID NO: 3), AUUUGCAGUCAUGGAGAACC (SEQ ID NO: 4), CAAGGAGAAAUACGAGAAGU (SEQ ID NO: 5), ACAAGGAGAAAUACGAGAAG (SEQ ID NO: 6) and ACCUGGAAGACUACUACUGG (SEQ ID NO: 7).

[0267] Dominant negatives of c-MAF useful in the context of the present invention include mutants that are capable of dimerizing with c-MAF, but that lack the ability to activate transcription in view of their inability to homodimerize and heterodimerize with other members of the AP-1 family such as Fos and Jun. Thus, dominant negatives of c-MAF can be any small maf protein (e.g., mafK, mafF, mafg, and pi18) that is present in the cell but lacks 2 / 3 of the amino-terminal domain that contains the transactivation domain (Fujiwara et al. (1993) Oncogene 8, 2371-2380; Igarashi et al. (1995) J. Biol. Chem. 270, 7615-7624; Andrews et al. (1993) Proc. Natl. Acad. Sci. USA 90, 11488-11492; Kataoka et al. (1995) Mol. Cell. Biol. 15, 2180-2190) (Kataoka et al. (1996) Oncogene 12, 53-62).

[0268] Alternatively, dominant negative proteins for c-MAF include variants of c-MAF that maintain the ability to dimerize with other proteins but lack the ability to activate transcription. These variants are, for example, those that lack the domain for transactivation of c-MAF that is located in the N-terminal end of the protein. Thus, c-MAF dominant negative variants include, for example, variants in which at least amino acids 1 to 122, at least amino acids 1-187, or at least amino acids 1 to 257 (as numbered considering human c-MAF as described in US6274338) have been deleted.

[0269] In a specific model of the method of the present invention, the tumor sample for step (i) is obtained from a breast cancer tumor, or a tumor of the colon, lung, kidney, or thyroid, particularly a breast cancer tumor. In a more specific model of the method of the present invention, the tumor sample used in step (i), particularly a sample of a breast cancer tumor, is obtained from an ER tumor and a triple-negative tumor. In a preferred model, the cancer cells used in step (ii), particularly those from a breast cancer tumor, are ER+ or are obtained from a triple-negative tumor. In an even more specific model, the metastasis is a bone metastasis.

[0270] Other c-MAF compound inhibitors suitable for use in the present invention include:

[0271]

[0272]

[0273]

[0274]

[0275]

[0276] Table 3: Other inhibitors of c-MAF with the ability to inhibit c-MAF are described in patent application WO2005063252, as shown in the following table

[0277] (Table 4).

[0278]

[0279]

[0280]

[0281]

[0282]

[0283] Table 4: c-MAF inhibitors

[0284] In yet another even more specific (particular) model, a reduction in the expression level of c-MAF is produced by silencing the short isoform of c-MAF in breast cancer tumor cells, or cancer cells from colon, lung, kidney, or thyroid cancer, but especially breast cancer. In another model, a reduction in the expression level of c-MAF is produced by silencing the long isoform of c-MAF in breast cancer tumor cells, or cancer cells from colon, lung, kidney, or thyroid cancer, but especially breast cancer. In yet another even more specific model, a reduction in the expression level of c-MAF is produced by silencing both the long and short isoforms of c-MAF in breast cancer tumor cells, or cancer cells from colon, lung, kidney, or thyroid cancer, but especially breast cancer. A population of cancer cells, particularly breast cancer cells, or cells from colon, lung, kidney, or thyroid cancer, more particularly cells from breast cancer, can be obtained from biopsy samples taken from patients suffering from these types of cancer, or can be a line of these types of cells, such as, including but not limited to, line breast cancer cells from the strains MCF-7, T47D, and MDA-MB-231, MDA-MB-435, MDA-MB-468, BT20, SkBr3, HCC-1937, BT-474, and ZR75.1. In a preferred model, cells from the MCF7 breast cancer cell line are used for step (ii). Colon cancer cell lines include, but are not limited to, HCA-7, KM12C, KM12SM, KM12 l4a, SW480, SW620. Lung cancer cell lines include, but are not limited to, NCI-H1781, NCI-H1373, LC319, A549, PC14, SK-MES-1, NCI-H2170, NCI-H1703, NCI-H520, LU61, LX1, SBC-3, SBC-5, DMS273, and DMS114. Kidney cancer cell lines include, but are not limited to 786-0, 769-P, A-498, SW-156, SW-839, A-704, ACHN, CaKi-1, and CaKi-2. Thyroid cancer cell lines include, but are not limited to, BCPAP, KTC-1, K1, TCP1, FTC133, ML1, 8505C, SW1736, Cal-62, T235, T238, Uhth-104, Uhth-104, HTh74, KAT18, TTA1, FRO81-2, HTh7, C643, BHT101, and KTC-2.

[0285] Once the following aspects have been determined: (i) the expression levels of a candidate gene and the c-MAF gene in primary cancer tumor samples (such as from breast cancer tumors, or from colon, lung, kidney, or thyroid cancer tumor cells, more particularly breast cancer cells), and (ii) the change in the expression level of the candidate gene in a set of cancer cells such as breast, lung, kidney, or thyroid cancer, more particularly breast cancer cells, in response to regulation of the expression of the c-MAF gene, an in vitro method for identifying a marker gene for identifying susceptibility (propensity) to metastasis comprises

[0286] (i) comparison of the expression levels of the gene and the c-MAF gene in the primary cancer tumor sample and

[0287] (ii) comparison of the change in the expression level in response to regulation of the expression of the c-MAF gene with the level of the gene

[0288] In a preferred model, if the expression of the gene defined / determined in step (i) is directly related to the level of c-MAF in the primary tumor sample and if the change in the expression level in response to regulation of the expression of the c-MAF gene is directly related to the regulation, this indicates that an elevated level of the gene indicates a propensity to metastasis.

[0289] In another preferred model, if the expression of the gene measured in step (i) is directly related to the level of c-MAF in the primary tumor sample and if the change in the expression level in response to regulation of the expression of the c-MAF gene is negatively related to the regulation, this indicates that a decreased level of the gene indicates a propensity to metastasis.

[0290] A correlation between the expression of the candidate gene and the expression of c-MAF in the primary tumor sample is generated by comparison of the expression levels of the two genes with a reference value, where a correlation is considered to exist between the expressions of the two genes if both genes show a change in their expression relative to the reference value in the same sample. The correlation can be direct (an increase in the expression of the candidate gene relative to the reference value is correlated with an increase in the expression of c-MAF relative to the reference value of the gene, or a decrease in the expression of the candidate gene relative to the reference value is correlated with a decrease in the expression of the c-MAF gene relative to the reference value of the gene) or inverse (an increase in the expression of the candidate gene relative to the reference value is correlated with a decrease in the expression of c-MAF relative to the reference value of the gene, or a decrease in the expression of the candidate gene relative to the reference value is correlated with an increase in the expression of the c-MAF gene relative to the reference value of the gene).

[0291] The correlation between the expression level of a modified gene in response to the regulation of the c-MAF gene is achieved by measuring the expression level of the gene before inducing the regulation of the expression of the c-MAF gene and the expression level of the gene in the same sample after the regulation of the expression of the c-MAF gene has been generated. If a change in the expression of the candidate gene has occurred concomitant with the change in the expression of c-MAF, a correlation is considered to exist. The correlation can be direct (the expression of the candidate gene increases with increasing c-MAF expression, or the decreased gene expression decreases with decreasing c-MAF expression) or inverse (the expression of the candidate gene increases with decreasing c-MAF expression, or the expression of the candidate gene decreases (relative to the reference value) with increasing c-MAF expression (relative to the reference value of the gene)).

[0292] When an increase in the expression level of the gene of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150% or more has occurred relative to the level before introducing the change in the expression of c-MAF, an increase in the expression of the candidate gene concomitant with the change in the expression of c-MAF is considered to exist.

[0293] When a decrease in the expression level of the gene of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150% or more has occurred relative to the level before introducing the change in the expression of c-MAF, a decrease in the expression of the candidate gene concomitant with the change in the expression of c-MAF is considered to exist.

[0294] In a preferred model, the metastasis is bone metastasis.

[0295] The present invention is described hereinafter by the following examples, which are considered for illustrative purposes only and do not limit the scope of the present invention. Examples

[0296] I. Materials and Methods

[0297] Experimental research model

[0298] A new experimental model for the study of the metastasis of breast cancer ER+ and ER-PR-Her2- has been developed. For this purpose, a human cell line of breast cancer ER+ called MCF7, which has been stably transfected with a vector allowing the expression of GFP / luciferase, has been used. The cells were inoculated into immunodeficient mice (Balb-c / nude mice) by injection via the intraventricular or in the (tail) tail vein to be able to select cells with the ability to metastasize in different organs. Rats have subcutaneous implants of estrogen to ensure the presence of these hormones throughout the experiment.

[0299] Selection of metastasis population

[0300] Metastatic populations in different tissues were selected by the identification and isolation of cells from metastatic lesions. For this, bioluminescence imaging techniques were used, which include techniques by means of which it is possible to detect the establishment and growth of tumor cells in the target organ at different times and to quantify the number of tumor cells present. For the application of this technique, the cells have been transduced to express the genes of luciferase and GFP, by these methods, it has been possible to perform their in vivo real-time monitoring / observation using non-invasive methods. An apparatus of the Xenogen IVIS type and Livingimage software were used as the preferred method for capturing luminescence images (luciferase activity) of the animals under general anesthesia due to their sensitivity level and speed. To isolate metastatic cells, the tumor lesions were incised, and then cell counting techniques (using scanning with activation-induced fluorescence (GFP) (green fluorescent protein)) were used to separate the metastatic cells from the other cells of the host organism. Once these cells have been isolated, the process was repeated to enrich / supply their tropism through specific tissues. By using these methods, specific metastatic populations with tissue specificity were isolated, including metastases in bone and brain.

[0301] Once the metastatic populations have been identified and isolated, high-throughput transcriptional analysis was performed. First, this strategy allowed the identification of genes whose transcription was enhanced, including some genes that serve as mediators in the metastasis process of cancer cells with poor prognosis. The involvement of genes whose expression was found to be altered in the colonization of metastatic cells in specific tissues and organs was confirmed by an unbiased in vivo selection method. A cell population selected with a high ability to colonize bone was called BoM2.

[0302] Identification of a group of genes whose expression is correlated with the expression of c-MAF

[0303] By comparing the whole-genome transcriptional signatures of 349 primary breast tumors, genes were identified whose expression was well-correlated with the expression of c-MAF in a positive (direct) manner, or alternatively, in a negative (opposite) manner with genes well-correlated with the expression of c-MAF. Cells obtained in this way were validated by analyzing their expression relative to the expression of c-MAF in defined cell models. The MCF7 ER+ breast cancer cell line was modified to express well either the long or short isoform of the c-MAF gene, and the expression signature of RNAm was determined using the Affymetrix U133A2Plus assay. Derivatives of MCF-7 bone metastatic cells were obtained in which c-MAF was depleted, using conventional techniques. Gene expression signatures were determined in the previous cell populations, and those genes that were significantly altered as a function of the expression of c-MAF were selected. These results made it possible to obtain the metastatic program of c-MAF in bone, which includes 99 genes (76 of these genes were overexpressed, Table 1, and 33 were repressed, Table 2), the expression of which was significantly correlated with the expression level of c-MAF in primary breast cancer tumors and which varied as a function of c-MAF in at least one of the cell conditions used. The metastatic program of c-MAF in bone includes cytokines, cell adhesion molecules, membrane-anchored proteases, signal transduction mediators, and transcription factors.

[0304] The group of genes (in which changes in the expression levels were observed in ER+ breast cancer cells) was subjected to validation. To this end, the expression levels of the candidate genes were compared with the gene expression signatures obtained using primary breast cancer tumors and a group of metastases, which included 560 primary breast cancer tumors and 46 metastatic cells from breast cancer patients.

[0305] Bioinformatics and computational biology

[0306] To obtain a group of genes enriched in metastases and to validate their clinical relevance, the R statistical package and Bioconductor were used. Specific functions and structures for data processing were input and made publicly accessible on the website www.bioconductor.org available.

[0307] Example 1

[0308] Selection of related genes

[0309] An analysis was performed with the aim of selecting genes that were expressed differently in response to changes in the expression level of c-MAF in a single R+ breast cancer cell line (Table 1, Figure 1B ). Genes and functions that were decisive for the bone metastatic program mediated by c-MAF were selected according to the following criteria:

[0310] i) Genes whose expression in primary tumors is significantly correlated with the expression of c-MAF.

[0311] ii) Genes whose expression is altered by the expression of c-MAF when c-MAF is overexpressed (long or short isoform) in MCF7 cells, or when the expression of c-MAF is reduced in highly metastatic bone cells derived from MCF7-expressing cells expressing c-MAF, and

[0312] iii) Genes associated with the expression of MAF in one of the cell conditions mentioned in primary tumors and in ii) are considered members of the bone metastasis program mediated by c-MAF.

[0313] Based on these criteria, genes whose expression levels are correlated with the expression level of c-MAF were identified, and how the changes in their expression levels are correlated with the expression of c-MAF in ER+ primary breast cancer tumors was determined (Table 1).

[0314] Example 2:

[0315] Therapeutic and prognostic value of genes enriched for the development of bone metastasis.

[0316] Relative to two different databases containing expression signatures and clinical records of 560 primary breast cancer tumors and 58 metastases from breast cancer patients, genes enriched in bone metastasis were evaluated by the experimental system for the selection of metastatic cell populations developed herein. These tumors represent all subtypes of breast cancer and the location of metastases. The two databases and related clinical records are publicly available (GSE 2603, 2034, 12276, and 14020).

[0317] Gene expression of genes obtained from bone metastases in ER+ primary tumors showed a significant correlation with recurrence in bone and was also associated with metastasis to bone ( Figure 1A ) but not with metastasis to other tissues ( Figure 1B ).

[0318] Example 3

[0319] In vivo functional validation of members of the bone metastasis program mediated by c-MAF:PTHLH gene

[0320] In mice, in the colonization assay of metastasis in bone in an experimental xenograft model of breast cancer metastasis, the metastatic PTHLH gene that was functionally verified to be positive in previous analyses and was directly related to the expression of c-MAF (Table 1 and Figure 3). The standard approximation / approach for validating candidate genes that guide the metastatic process is a sample in which PTHLH function is lost in low-metastatic cells expressing c-MAF. The expression of the c-MAF gene was induced in MCF7 cells, which are moderately metastatic in bone in vivo and which exhibit a low expression level of the gene c-MAF. The overexpression of c-MAF was the cause of the elevated endogenous level of the PTHLH gene (Figure 3). In the present specification, the activity of the cytokine PTHLH was subsequently blocked using an antagonistic peptide (Figure 3).

[0321] In the method for gene transduction, a lentiviral system was used to infect tumor cells and introduce the expression of the candidate gene into the tumor cells. A monitoring technique using bioluminescence imaging of metastatic cells including intragastric inoculation in mice was used to determine the function of promoting the metastasis of the c-MAF gene and its effector PTHLH. In all cases, corresponding control cells infected with an empty lentiviral vector were injected into parallel groups of immunodeficient rats for comparison purposes. (Figure 3). The ability to form osteolytic lesions was evaluated, and likewise, the differentiation of osteoclasts in metastatic foci in vivo and the causative function of PTHLH in this process were evaluated (Figure 3).

[0322] Gain-of-function experiments and data related to clinical relevance made it possible to functionally verify the role of PTHLH as a prognostic marker and as a target gene that effectively leads to the bone metastasis process in ER+ breast cancer cases and as part of the bone metastasis program mediated by the c-MAF gene.

[0323] Example 4

[0324] In vivo functional verification of a member of the bone metastasis program mediated by the c-MAF gene: the RERG gene

[0325] The metastasis suppressor gene RERG is involved in proliferation. Previous analyses conducted showed that the expression of the RERG gene was inversely correlated with the expression of c-MAF (Table 2 and Figure 2). In rats, the RERG gene was functionally verified in the colonization assay of metastasis in bone in an experimental xenograft model of breast cancer.

[0326] The involvement of the RERG gene in metastasis was verified by conducting a gain-of-function assay in highly metastatic cells. The expression of RERG was induced in highly metastatic cells BoM2 selected in bone in vivo, which cells exhibit an elevated expression level of the c-MAF gene that is responsible for the suppression of the endogenous level of RERG (Figure 2).

[0327] During gene transfer, a lentiviral system was used to infect tumor cells and introduce the expression of modified genes into the tumor cells. The prometastatic function of EGRG inhibition was determined by monitoring metastatic cells inoculated into the cardia in mice using bioluminescence imaging technology. In all cases, for comparison purposes, corresponding control cells infected with an empty lentiviral vector were injected into parallel groups of immunodeficient rats. (Figure 2). Loss of c-MAF was associated with greater RERG expression and reduced proliferation of metastatic cells. (Figure 2). Overexpression of RERG in cells highly metastatic to bone (BoM2) (which express high levels of c-MAF) led to a decrease in the ability of these cells to colonize bone (Figure 2). This decrease was accompanied by a decrease in the proliferation rate as measured by the marker Ki-67 (Figure 2).

[0328] Gain-of-function experiments in the context of c-MAF overexpression and data related to clinical relevance enabled the functional validation of RERG as a prognostic marker and its role as a target gene effectively leading to the bone metastasis process in ER+ breast cancer cases and as part of the bone metastasis program mediated by the c-MAF gene.

[0329] Example 5

[0330] In vivo functional validation of PODXL gene, a member of the bone metastasis program mediated by c-MAF

[0331] In an experimental model based on purified bone marrow cells from mice, the PODXL metastasis gene, which was positive in previous analyses and directly related to the expression of c-MAF, was functionally validated in an assay for attachment to bone marrow-derived cells. This attachment process was specific for bone cells, as, conversely, neither greater attachment in the presence of PODXL nor high levels of c-MAF were observed when using endothelial cells or proteins from the extracellular matrix of the lung (obtained from the vascular system) to repeat it (Figure 4). A standard approach for validating that a candidate gene directs the metastatic process is the loss-of-function assay in highly metastatic cells (either bone cells or endothelial cells). Expression of the PODXL gene was decreased in vivo in bone in highly metastatic cells MCF7 (which exhibit high levels of the c-MAF gene responsible for the elevated endogenous level of the PODXL gene).

[0332] During the transduction of interfering RNAs, a lentiviral system that infects tumor cells and introduces the expression of RNAi candidates into the tumor cells is used. The metastasis-promoting function of the PODXL gene is determined by applying fluorescence imaging techniques (techniques) to metastatic cells on a monolayer of endothelial cells or cells derived from the bone marrow. In all cases, for comparison purposes, corresponding control cells infected with an empty lentiviral vector are used. (Figure 4). The process is evaluated using two peptides, RGES and RGDS (the first peptide does not bind to integrins, whereas the second peptide competes with such integrins and prevents cell attachment) to determine whether it is related to the activity of integrins. In summary, the causative function of PODXL in this process is potentially verified through its interaction via integrins (Figure 4).

[0333] Loss-of-function experiments and associated data allow for the functional validation of the role of PODXL as a prognostic marker and a target gene that effectively contributes to the metastasis of ER+ breast cancer to bone and as part of the bone metastasis program mediated by the c-MAF gene.

[0334] ***

[0335] The terms "Sequence Listing" and "Artificial Sequence" from the sequence are translated as "Sequence Listing" and "Artificial Sequence", respectively.

Claims

1. Use of a substance for quantifying the expression level of one or more target genes in a tumor sample of a subject in the preparation of a preparation for in vitro predicting the risk of osteolytic bone metastasis of ER+ breast cancer in a subject, wherein the prediction includes quantifying the expression level of one or more target genes, and the expression of the genes is regulated in response to an increase in the expression level of c-MAF in the sample of the subject, wherein the regulated expression level of the one or more target genes relative to a reference value indicates an increased risk of osteolytic bone metastasis, wherein the one or more target genes whose expression is regulated in response to an increase in the expression level of c-MAF are selected from PTHLH, PODXL, and RERG, and wherein the expression level of PTHLH and / or PODXL increases in response to an increase in the expression of c-MAF, and the expression level of RERG decreases in response to an increase in the expression of c-MAF.

2. Use of a substance for quantifying the expression level of one or more target genes in a tumor sample of a subject in the preparation of a preparation for in vitro designing an individualized therapy for a subject with ER+ breast cancer, wherein the design includes quantifying the expression level of one or more target genes, and the expression of the genes is regulated in response to an increase in the expression level of c-MAF in the sample of the subject, wherein the regulated expression level of the one or more target genes relative to a reference value indicates that the subject is suitable for receiving a therapy aimed at preventing and / or treating osteolytic bone metastasis, wherein the one or more target genes whose expression is regulated in response to an increase in the expression level of c-MAF are selected from PTHLH, PODXL, and RERG, and wherein the expression level of PTHLH and / or PODXL increases in response to an increase in the expression of c-MAF, and the expression level of RERG decreases in response to an increase in the expression of c-MAF.

3. The use according to claim 1 or 2, wherein the quantification of the expression level of the one or more target genes is carried out by measuring the expression level of the mRNA of the one or more target genes.

4. The use according to claim 1 or 2, wherein the quantification of the expression level of the one or more target genes is carried out by measuring the expression level of the polypeptide encoded by the one or more target genes.

5. Use of a reagent capable of inhibiting the expression of a target gene or the activity of the expression product of a target gene for the preparation of a medicament for the treatment and / or prevention of osteolytic bone metastases of ER+ breast cancer in a subject, wherein the subject has a regulated expression of one or more target genes, the expression of which is regulated in response to the expression level of c-MAF, wherein the expression of the target gene in ER+ breast cancer tumor cells increases in response to an increase in the expression level of c-MAF in the cells or decreases in response to a decrease in the expression level of c-MAF in the cells, and wherein the target gene is PTHLH and / or PODXL.

6. The use of claim 5, wherein the reagent capable of inhibiting the expression of the target gene is selected from RNAi specific for the target gene, antisense oligonucleotides specific for the target gene, ribozymes specific for the target gene, inhibitory antibodies specific for the expression product of the target gene, dominant negative variants of the expression product of the target gene, inhibitory peptides from the expression product of the target gene, siRNA, DNAzymes, and c-MAF inhibitory reagents selected from: antisense oligonucleotides, RNA interference (RNAi), catalytic RNA or specific ribonucleases, dominant negative variants of c-MAF, c-MAF inhibitors and inhibitory antibodies, and c-MAF inhibitory compounds.

7. Use of a reagent capable of stimulating the expression of a target gene or the activity of the expression product of a target gene for the preparation of a medicament for the treatment and / or prevention of osteolytic bone metastases of ER+ breast cancer in a subject, wherein the subject has a regulated expression of the target gene, the expression of which is regulated in response to the expression level of c-MAF, wherein the expression of the target gene in ER+ breast cancer tumor cells decreases in response to an increase in the c-MAF expression level in the cells or increases in response to a decrease in the c-MAF expression level in the cells, and wherein the target gene is RERG.

8. The use of claim 7, wherein the reagent capable of stimulating the expression of the target gene is selected from polynucleotides encoding the target gene, polypeptides encoding the target gene and / or c-MAF, and c-MAF inhibitory reagents selected from: antisense oligonucleotides, RNA interference (RNAi), catalytic RNA or specific ribonucleases, dominant negative variants of c-MAF, c-MAF inhibitors and inhibitory antibodies, and c-MAF inhibitory compounds.

Citation Information

Patent Citations

  • Progesterone receptor-regulated gene expression and methods related thereto

    US20040132086A1

  • Novel methods of diagnosis of metastatic cancer, compositions and methods of screening for modulators of metastatic cancer

    US20050181375A1

  • Modulation of immune system function by modulation of polypeptide arginine methyltransferases

    US20090048117A1

  • corning

    US451456A

  • RNA ribozyme polymerases, dephosphorylases, restriction endoribo-nucleases and methods

    US5093246A