A Cas9 nuclease R780A and its uses
By applying Cas9 nuclease R780A to the CRISPR/Cas9 system, the mutated Cas9 nuclease is precisely edited by the cell repair system after DNA double-strand cutting, solving the problem of precision in DNA fragment editing in existing technologies and realizing the editing of specific bases in genomic DNA fragments.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI JIAOTONG UNIV
- Filing Date
- 2017-05-16
- Publication Date
- 2026-05-26
AI Technical Summary
Existing CRISPR/Cas9 systems struggle to achieve precise function and effective genetic editing of specific DNA segments during DNA fragment editing.
Using Cas9 nuclease R780A, the arginine at position 780 of the wild-type Cas9 nuclease was mutated to alanine for use in the CRISPR/Cas9 system, generating different ratios of protruding and blunt ends, which were then precisely edited through the cell's own repair system.
It enables precise editing of specific bases at specific locations within genomic DNA fragments, improving the accuracy and efficiency of DNA fragment editing.
Smart Images

Figure BDA0001295823960000081 
Figure BDA0001295823960000082 
Figure BDA0001295823960000083
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a Cas9 nuclease R780A and its uses. Background Technology
[0002] Since the completion of the Human Genome Project and the Encyclopedia of DNA Elements project, scientists have analyzed and identified a large number of genes and DNA regulatory elements in the genome [1,2]. DNA regulatory elements that play important roles in gene expression regulation include promoters, enhancers, silencers, and insulators. However, the functions of most regulatory elements have not been experimentally verified and elucidated [2-8]. Exploring the functions of genes and DNA regulatory elements can be achieved through genetic DNA fragment editing.
[0003] Early gene editing and gene function modification were achieved through gene transposition and transgenesis [9-14]. With the development of sequencing technology, reverse genetics was applied to specific mutations in the genome [15,16]. In particular, gene-targeting mice relying on homologous recombination were rapidly applied to scientific research [15,17,18]. In addition, the inversion and duplication of DNA segments in mice and zebrafish were used to study specific changes in genome structure [19-24].
[0004] In recent years, the CRISPR / Cas9 system, derived from bacteria and archaea, is an emerging genome editing technology [25-27]. Due to its simple design and ease of operation, it has been rapidly applied to eukaryotic genome editing. We have used the CRISPR / Cas9 system to perform genetic editing (deletion, inversion, and duplication) of DNA fragments in human cell lines and mice
[28] . By using Cas9 and two sgRNAs to perform two site-targeted breaks in the genome, DNA fragment deletion, inversion, duplication, translocation, and insertion (if a donor is provided) can be achieved through the repair system involving proteins such as CtIP [29-32]. Genetic manipulation of DNA fragment editing can be used to study the gene expression regulation of protocadherins and globins and the three-dimensional genome structure [28, 31-33].
[0005] Currently, DNA fragment editing can be achieved using the CRISPR / Cas9 system, but a Cas9 nuclease that can effectively achieve precise genetic editing of DNA fragments for in-depth research into the precise functions of specific DNA segments remains to be discovered. Summary of the Invention
[0006] In order to overcome the problems existing in the prior art, the purpose of this invention is to provide a Cas9 nuclease and its uses.
[0007] To achieve the above-mentioned objectives and other related objectives, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides a Cas9 nuclease (Cas9-R780A) having Cas9 nuclease activity and suitable for CRISPR / Cas9 systems, wherein the Cas9 nuclease (Cas9-R780A) is obtained by mutating the arginine at position 780 of the wild-type Cas9 nuclease to alanine.
[0009] Preferably, compared with wild-type Cas9 nuclease, the Cas9 nuclease (Cas9-R780A) produces a different ratio of protruding ends to blunt ends when cutting the target genomic DNA fragment.
[0010] Preferably, the wild-type Cas9 nuclease is SpCas9.
[0011] Furthermore, the amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID NO.7.
[0012] Preferably, the Cas9 nuclease (Cas9-R780A) contains the amino acid sequence shown in SEQ ID NO.9.
[0013] Preferably, the amino acid sequence of the Cas9 nuclease (Cas9-R780A) is shown in SEQ ID NO.9.
[0014] In a second aspect, the present invention provides a polynucleotide encoding the Cas9 nuclease (Cas9-R780A).
[0015] A third aspect of the present invention provides an expression vector containing the aforementioned polynucleotides.
[0016] In a fourth aspect, the present invention provides a host cell that has been transformed by the aforementioned expression vector.
[0017] A fifth aspect of the present invention provides a method for preparing the Cas9 nuclease (Cas9-R780A), comprising the steps of: constructing an expression vector containing a polynucleotide encoded by the Cas9 nuclease (Cas9-R780A), then transforming the expression vector into a host cell to induce expression, and isolating the Cas9 nuclease (Cas9-R780A) from the expression product.
[0018] In a sixth aspect, the invention provides the use of the aforementioned Cas9 nuclease (Cas9-R780A) or its encoding polynucleotide or an expression vector containing said encoding polynucleotide for genomic DNA fragment editing or for preparing genomic DNA fragment editing tools.
[0019] Preferably, the editing includes single-point editing and multi-site editing. The number of editing sites in the multi-site editing is two or more.
[0020] Preferably, the editing methods include mutation, deletion, reversal or inversion, repetition, transposition or insertion.
[0021] A seventh aspect of the present invention provides a genomic DNA fragment editing tool, wherein the genomic DNA fragment editing tool is a CRISPR / Cas9 system, the CRISPR / Cas9 system comprising the aforementioned Cas9 nuclease (Cas9-R780A) or its encoding polynucleotide or an expression vector containing the encoding polynucleotide.
[0022] Preferably, the CRISPR / Cas9 system includes the aforementioned Cas9-R780A and one or more sgRNAs targeting the target DNA fragment. "Multiple" refers to two or more.
[0023] In an eighth aspect, the present invention provides a method for editing genomic DNA fragments, which uses the aforementioned Cas9 nuclease (Cas9-R780A) and one or more sgRNAs in combination therewith to edit the genomic DNA fragment to be edited using a CRISPR / Cas9 system.
[0024] Preferably, the editing includes single-point editing and multi-site editing. The number of editing sites in the multi-site editing is two or more.
[0025] Preferably, the editing methods include mutation, deletion, reversal or inversion, repetition, transposition or insertion.
[0026] Preferably, the expression vector containing the aforementioned Cas9 nuclease (Cas9-R780A) encoding a polynucleotide, along with one or more sgRNAs that work together, is transferred into the cell to edit the genomic DNA fragment to be edited.
[0027] A ninth aspect of the present invention provides a method for single-point editing of genomic DNA fragments, utilizing a CRISPR / Cas9 system and employing the Cas9 nuclease (Cas9-R780A) as described in claim 1 to cleave the DNA double strand to generate protruding break ends. The method then uses the cell's own repair system to add complementary bases to the protruding break ends in a ligation-completion manner. This single-point editing method can alter the characteristics of base mutations during single-point editing.
[0028] Compared with the prior art, the present invention has the following beneficial effects:
[0029] The Cas9 nuclease (Cas9-R780A) of this invention is suitable for the CRISPR / Cas9 system. The Cas9 nuclease (Cas9-R780A) contains the amino acid sequence shown in SEQ ID NO. 9. Compared with the wild-type Cas9 nuclease, the Cas9 nuclease (Cas9-R780A) produces a different ratio of protruding and blunt breaks when cutting the target genomic DNA fragment. Using the Cas9 nuclease (Cas9-R780A) to cut the DNA double strand can generate protruding breaks. Through the cell's own repair system, complementary bases to the protruding breaks can be added in a ligation manner, enabling precise editing by adding specific bases at specific locations on the genomic DNA fragment. Attached Figure Description
[0030] Figure 1A Cas9 cuts the DNA double strand under the mediation of two sgRNAs, producing four break ends. These break ends are then used by the cell repair system to produce DNA fragment deletion, inversion, and duplication.
[0031] Figure 1B : Deletion, inversion, and duplication of DNA fragments at the HS51 site.
[0032] Figure 1C The DNA fragment deletion linker contains the addition of a "G".
[0033] Figure 1D The DNA fragment repeat linker has an added "T".
[0034] Figure 1E The DNA fragment downstream of the reverse adapter contains the addition of “A”, “G” and “AG”.
[0035] Figure 1F : The proportion of Cas9 cleavage patterns for sgRNAs targeting these two specific sequences.
[0036] Figure 2ASchematic diagram of the Cas9 nuclease structure.
[0037] Figure 2B : A schematic diagram of two sgRNAs that perform DNA fragment editing at the β-globin RE2 site.
[0038] Figure 2C By detecting the ligation of DNA fragment repeat adapters, the proportion of various cleavage ends generated when each Cas9 nuclease cuts genomic DNA fragments under the mediation of sgRNA1 was statistically determined.
[0039] Figure 2D This study investigated the cleavage of the target DNA fragment by upstream sgRNA1, Cas9, and Cas9 mutants.
[0040] Figure 2E By detecting the ligation of DNA fragment deletion adapters, the proportion of various cleavage ends generated by each Cas9 nuclease when cutting genomic DNA fragments under the mediation of sgRNA2 was statistically determined.
[0041] Figure 2F This study investigated the cleavage of the target DNA fragment by downstream sgRNA2, Cas9, and Cas9 mutants.
[0042] Figure 2G : Actual and predicted proportions of base addition at the linker on the reverse side of the DNA fragment in Cas9 and Cas9 mutants.
[0043] Figure 3A At the STM site, the cleavage of the target DNA fragment by upstream sgRNA1, Cas9, and Cas9 mutants.
[0044] Figure 3B At the STM site, the cleavage of the target DNA fragment by downstream sgRNA2, Cas9, and Cas9 mutants. Detailed Implementation
[0045] I. Cas9 nuclease
[0046] The Cas9 nuclease (Cas9-R780A) of the present invention possesses Cas9 nuclease activity and is suitable for CRISPR / Cas9 systems. The Cas9 nuclease (Cas9-R780A) is obtained by mutating arginine at position 780 of the wild-type Cas9 nuclease to alanine. Compared with the wild-type Cas9 nuclease, the Cas9 nuclease (Cas9-R780A) produces a different ratio of overhanging ends to blunt ends when cutting the target genomic DNA fragment. Further, the wild-type Cas9 nuclease is SpCas9. Further, the amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID NO. 7.
[0047] Furthermore, the Cas9 nuclease (Cas9-R780A) contains the amino acid sequence shown in SEQ ID NO.9. In some embodiments of the present invention, the amino acid sequence of the Cas9-R780A as shown in SEQ ID NO.9 is exemplified.
[0048] II. Polynucleotides encoding Cas9 nuclease
[0049] The polynucleotide encoding the Cas9 nuclease (Cas9-R780A) can be in DNA or RNA form. DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded.
[0050] The polynucleotide encoding the Cas9 nuclease (Cas9-R780A) can be prepared using any suitable technique well known to those skilled in the art. Such techniques are described in general in the art, such as in *Molecular Cloning: A Laboratory Manual* (J. Sambrook et al., Science Press, 1995). These include, but are not limited to, recombinant DNA techniques and chemical synthesis.
[0051] In some embodiments of the present invention, examples are given of polynucleotides encoding the Cas9 nuclease (Cas9-R780A) as shown in SEQ ID NO.10.
[0052] III. Expression Vehicle
[0053] The expression vector contains a polynucleotide encoding the Cas9 nuclease (Cas9-R780A). Methods well known to those skilled in the art can be used to construct the expression vector. These methods include recombinant DNA technology, DNA synthesis technology, etc. The DNA of the Cas9 nuclease (Cas9-R780A) can be efficiently ligated to a multiple cloning site in the vector to guide mRNA synthesis and subsequently protein expression.
[0054] IV. Host Cells
[0055] The host cell is transformed by an expression vector expressing the Cas9 nuclease (Cas9-R780A). The host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: *Escherichia coli*, *Streptomyces*; *Salmonella typhimurium*, *Listeria*; fungal cells such as yeast; plant cells; insect cells of *Drosophila* S2 or Sf9; animal cells such as CHO, COS.293 cells, or Bowes melanoma cells.
[0056] V. Method for preparing Cas9 nuclease (Cas9-R780A)
[0057] The method for preparing the aforementioned Cas9 nuclease (Cas9-R780A) includes the following steps: constructing an expression vector containing a polynucleotide sequence encoding the Cas9 nuclease (Cas9-R780A), then transforming the expression vector into a host cell to induce expression, and isolating the Cas9 nuclease (Cas9-R780A) from the expression product.
[0058] Those skilled in the art can select appropriate expression vectors and host cells based on the properties of the Cas9 nuclease (Cas9-R780A).
[0059] VI. Uses of Cas9 nuclease (Cas9-R780A) or its encoded polynucleotide or expression vectors containing said encoded polynucleotide.
[0060] The Cas9 nuclease (Cas9-R780A) of the present invention, or its encoding polynucleotide, or an expression vector containing the encoding polynucleotide, can be used for genomic DNA fragment editing or for preparing genomic DNA fragment editing tools.
[0061] Furthermore, the editing includes single-point editing and multi-site editing. Multi-site editing involves two or more editing sites. The editing methods include mutation, deletion, inversion or reversal, duplication, translocation, or insertion.
[0062] VII. Genomic DNA Fragment Editing Tools
[0063] The genomic DNA fragment editing tool of the present invention can be a CRISPR / Cas9 system, wherein the CRISPR / Cas9 system includes the aforementioned Cas9 nuclease (Cas9-R780A) or its encoding polynucleotide or an expression vector containing the encoding polynucleotide. Further, the CRISPR / Cas9 system also includes one or more sgRNAs targeting the target DNA fragment. The sgRNA is designed for the target DNA fragment; under the mediation of sgRNA (Single-guide RNA), Cas9-R780A can cleave the DNA double strand upstream of the PAM (Protospacer adjacent motif) site, forming a DNA double-strand break, and through the cell's own repair system, complete the precise editing of the DNA fragment. There can be one, two, or more sgRNAs targeting the target gene. When there is only one sgRNA, single-site editing of the target DNA fragment can be achieved; when there are two or more sgRNAs, multi-site editing of the target DNA fragment can be achieved.
[0064] VIII. Genomic DNA Fragment Editing Methods
[0065] The genomic DNA fragment editing method of the present invention uses the aforementioned Cas9 nuclease (Cas9-R780A) and one or more sgRNAs in combination with it to edit the genomic DNA fragment to be edited using a CRISPR / Cas9 system. The editing includes single-site editing and multi-site editing. The number of editing sites in multi-site editing is two or more. When there is only one sgRNA, single-site editing of the target DNA fragment can be achieved; when there are two or more sgRNAs, multi-site editing of the target DNA fragment can be achieved. Furthermore, an expression vector encoding a polynucleotide by the aforementioned Cas9 nuclease (Cas9-R780A) and one or more sgRNAs in combination can be transferred into cells together to edit the genomic DNA fragment to be edited.
[0066] IX. Methods for Editing Genomic DNA Fragments at Individual Sites
[0067] Using the CRISPR / Cas9 system, the Cas9 nuclease (Cas9-R780A) of this invention is used to cleave the DNA double strand to generate protruding break ends. Complementary bases to these protruding break ends are then added via a patching-up process, enabling single-site editing of genomic DNA fragments. This single-site genomic DNA fragment editing method can alter the characteristics of base mutations during single-site editing.
[0068] The term "filling connection" refers to the process whereby the protruding fractured end is first filled with a base complementary to the protruding end through base pairing to form a blunt end before being connected.
[0069] As exemplified in some embodiments of the present invention, when Cas9 nuclease R780A cleaves a genomic DNA fragment (β-globin RE2 site) under the mediation of sgRNA1, the resulting protruding break end U4 is first filled with a base G complementary to the protruding end C through base complementarity pairing to form a blunt end before being connected to the linker.
[0070] When Cas9 nuclease R780A cuts a genomic DNA fragment (β-globin RE2 site) under the mediation of sgRNA2, the resulting protruding break end D4 is first filled by adding a complementary base T to the protruding end A to form a blunt end under the action of the cell repair system, and then ligated to the linker.
[0071] illustrate:
[0072] In this invention, Cas9 can be used as an abbreviation for Cas9 nuclease, meaning the same as Cas9 nuclease. In this invention, Cas9-R780A, R780A, and the R780A mutant can be used interchangeably, all referring to the Cas9 nuclease named R780A.
[0073] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the respective manufacturers.
[0074] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0075] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; *theseries METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.
[0076] Example 1: Study on the ligation of DNA fragment editing adapters reveals a new Cas9 cleavage mechanism.
[0077] To target the HS51 site, construct sgRNA plasmids targeting the HS51 site:
[0078] (1) Purchase primers
[0079] Purchased from Shanghai Sunny Biotechnology Co., Ltd. The 5' hanging ends "ACCG" and "AAAC" of the sgRNA targeting the HS51 site and the sgRNA targeting sequences respectively, which can be complementary pairing forward and reverse deoxyribonucleic acid.
[0080] sgRNAs targeting the HS51 site mentioned above:
[0081] HS51 RE1sgRNA1: GCCACACATCCAAGGCTGAC (SEQ ID NO.1)
[0082] HS51 RE1sgRNA2:GAGATTTGGGGCGTCAGGAAG(SEQ ID NO.2)
[0083] (2) Obtain complementary double-stranded DNA with dangling ends.
[0084] 1) Dissolve the deoxy oligonucleotides to 100 μM using ddH2O, and then dilute to 20 μM;
[0085] 2) Add the positron and trans-deoxy oligonucleotides to the following reaction system:
[0086]
[0087] Reaction conditions: 95℃ water bath, 5 min, then open the water bath lid to reduce the temperature to about 60℃, then close the lid and cool to room temperature.
[0088] (3) Enzyme digestion of pGL3-U6-sgRNA-PGK-Puro vector
[0089] 1) Digest the vector plasmid with BsaI restriction endonuclease. The reaction system is as follows:
[0090]
[0091] Reaction conditions: 37℃, 1.5 hours;
[0092] 2) Purify the DNA digested fragments using gel extraction according to the instructions of the gel extraction kit (Axygen).
[0093] (4) Ligate the enzyme-digested vector with double-stranded DNA with hanging ends.
[0094] The connection system is as follows:
[0095]
[0096] Reaction conditions: Reaction at room temperature for 1.5 hours;
[0097] (5) Conversion linker products
[0098] The product was transformed from Stbl3 competent cells and cultured overnight at 37°C on LB agar plates containing ampicillin (Amp, 100 mg / L).
[0099] (6) Selecting single clones for sequencing
[0100] 1) Pick a single colony from an ampicillin antibiotic LB agar plate and incubate overnight in LB (Amp, 100 mg / L) liquid culture;
[0101] 2) Plasmid extraction: Extract plasmids according to the instructions of the plasmid mini-extraction kit (Axygen);
[0102] 3) The extracted plasmid was sent to Shanghai Sunny Biotechnology Co., Ltd. for sequencing.
[0103] (7) Sequencing successful, plasmid is then extracted.
[0104] 1) The successfully sequenced plasmids were re-transformed using Stbl3 competent cells and cultured overnight on LB plates containing Amp (100 mg / L);
[0105] 2) In the morning, pick a single colony and incubate it in 2 ml of LB (Amp, 100 mg / L) liquid medium for 8 hours, then transfer it to 200 ml of LB (Amp, 100 mg / L) liquid medium and incubate overnight;
[0106] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).
[0107] 2. Preparation of humanized Cas9 plasmids
[0108] 1) The humanized Cas9 plasmid was obtained from the laboratory of Xi Jianzhong at Peking University;
[0109] 2) Re-transform with Stbl3 competent cells and culture overnight on LB plates (Amp, 100 mg / L);
[0110] 3) In the morning, pick a single colony and culture it in 2 ml of LB (Amp, 100 mg / L) liquid medium for 8 hours, then transfer it to 200 ml of LB (Amp, 100 mg / L) liquid medium and culture it overnight for plasmid extraction.
[0111] 3. Cell transfection was performed using Lipofectamine 2000.
[0112] 1) HEK293T cells were cultured in culture flasks at 37°C in a cell culture incubator containing 5% CO2 until they reached 80-90% of the culture flask's capacity.
[0113] 2) The grown cells were seeded in 12-well plates with DMEM completely antibiotic-free medium (containing 10% fetal bovine serum, without penicillin and streptomycin) and cultured overnight.
[0114] 3) When the cells in the 12-well plate reach 80-90% confluency, transfect the prepared humanized Cas9 plasmid (800 ng) and sgRNAs plasmids targeting the HS51 site (600 ng each) into the cells using Lipofectamine 2000, with two replicates for each sample.
[0115] 4) Two days after transfection, collect cells and use a genomic extraction kit ( Genomic DNA Purification Kit (Promega) is used to extract genomes.
[0116] 4. Preparation of high-throughput sequencing libraries
[0117] Primers were designed approximately 30 bp upstream of the precise ligation sites for the expected deletions, inversions, and repeat adapters in the DNA fragments. Then, Illumina sequencing adapters with barcodes were added to the 5' ends of the primers. Downstream primers were designed at positions further away from the splicing sites and Illumina sequencing adapters were added. PCR amplification was performed, followed by purification using a Roche PCR purification kit (Product No.: 11732676001). The DNA product was dissolved in 10 mM Tris-HCl buffer (pH = 8.5), and after equal volumes were mixed, a library was formed for high-throughput sequencing.
[0118] High-throughput primers:
[0119] Hiseq-hHs51-aF:
[0120] ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAAGGAGATCCGTGTCGTC(SEQ ID NO.3)
[0121] Hiseq-hs51-aRa:
[0122] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGATGTTGTGGAAGGCGAGCAG(SEQ ID NO.4)
[0123] Hiseq-hs51-bFa:
[0124] CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTTACATGACAGCTTCCGGTAG(SEQ ID NO.5)
[0125] Hiseq-hHs51-bR:
[0126] CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTGGCTAACAACATAGTGCTTC (SEQ ID NO. 6).
[0127] 5. High-throughput sequencing data processing
[0128] After high-throughput sequencing, the sequencing results of the samples were extracted from the library using a Linux program via barcode and saved in their respective folders. BWA-MEM alignment was then performed. The aligned sequences were analyzed for insertion and deletion mutations in the DNA fragments using the Varscan2 program (V2.3.9). The Varscan2 program parameters are as follows:
[0129] Min coverage: 8
[0130] Min reads2:2
[0131] Min var freq:0.01
[0132] Min avg qual:15
[0133] P-value thresh: 0.01.
[0134] This invention discovers a new Cas9 cleavage mechanism by studying the end-joining behavior of DNA fragment editing.
[0135] like Figure 1A As shown, when editing genomic DNA fragments using a combination of two sgRNAs and the Cas9 nuclease, the Cas9 nuclease cuts the double strand of genomic DNA under the mediation of the two sgRNAs, producing four split ends (DSBs). These DSBs, under the action of cell repair systems (e.g., MRN / CtIP), produce DNA fragment editing such as deletion, inversion, and duplication.
[0136] like Figure 1BAs shown, we edited the genomic DNA fragment HS51 RE1 (HS51 site) using an sgRNA combination of sgRNA1 and sgRNA2 and the Cas9 nuclease. We then detected DNA fragment deletion, inversion, and duplication. High-throughput sequencing was used to examine the ligation of these DNA fragments into attachments. Besides the expected precise ligation, a certain proportion of base insertion was observed at the deletion attachment, inversion downstream attachment, and duplication attachment sites.
[0137] like Figure 1C As shown, when DNA fragment deletion ligation was detected using high-throughput sequencing technology, the proportion of precisely joined ligations (consistent with expectations) was 79.23%, while the proportion of insertions (in addition of "G" bases at the deletion ligation sites, compared to the expected precisely joined ligations) was 11.13%.
[0138] Compared to the expected precise ligation, it is speculated that the "G" base added at the DNA fragment deletion ligation linker originates from a base approximately 3 bp upstream of the PAM (specifically 4 bp upstream of the PAM) in the template DNA (HS51 RE1, HS51 site). Therefore, it is speculated that when Cas9 nuclease cleaves DNA strands complementary to sgRNA, it cleaves at 3 bp upstream of the PAM; while when Cas9 nuclease cleaves DNA strands not complementary to sgRNA, it cleaves at a distance of 4 bp, further upstream of the PAM. Based on the presence of the "G" base added at the DNA fragment deletion ligation linker (compared to the expected precise ligation), it is speculated that when Cas9 nuclease cleaves genomic DNA fragments mediated by sgRNA2, it performs both blunt-end and overhang-end cleavage, thus producing different break ends. When Cas9 nuclease performs blunt-end cleavage on genomic DNA fragments mediated by sgRNA2 (i.e., cleavage of both complementary and non-complementary DNA strands at the PAM), it produces blunt-end cleavage "E3". When DNA fragment deletion occurs under the action of the cell repair system, the blunt-end cleavage "E3" does not lead to the addition of a "G" base at the DNA deletion ligation linker, but rather produces precisely joined ligation as expected. Conversely, when Cas9 nuclease performs overhang-end cleavage on genomic DNA fragments mediated by sgRNA2 (i.e., cleavage of complementary DNA strands at the PAM at 3 bp upstream and non-complementary DNA strands at 4 bp upstream), it produces a 5' overhang-end cleavage "E4". When DNA fragment deletion occurs under the action of the cell repair system, the 5' overhang-end cleavage "E4" leads to the addition of a "G" base at the DNA deletion ligation linker.
[0139] Therefore, we believe that, under Cas9 nuclease cleavage, the proportion of blunt E3 breaks in the resulting fracture ends is equal to the proportion of precisely joined ends (79.23%), and the proportion of protruding E4 breaks is equal to the proportion of "G" base additions (11.13%).
[0140] However, we observed that besides the two main categories of precisely joined ligations (as expected) and the addition of a "G" base at the DNA fragment deletion ligation site, there is another category of random small deletions. We believe that these random small deletions are generated randomly by the various break ends (blunt break ends E3 and protruding break ends E4) under the action of the cellular repair system. Each break end produces small deletions with an equal probability, and the number of small deletions generated by each break end under the action of the cellular repair system is proportional to the number of break ends.
[0141] Based on the existence of random base deletion, we believe that the measured proportions of each break end obtained through sequencing differ from their true proportions and need to be corrected and restored. That is, the proportion of each break end is calculated based on the sum of the measured proportions of all break ends, and this is used as the percentage of that break end. Specifically, the proportions of each break end produced by Cas9 nuclease cleavage are standardized. The proportion of blunt break ends (E3) is 87.7% [calculated as: 79.23% ÷ (79.23% + 11.13%)]. The proportion of protruding break ends (E4) is 12.3% [calculated as: 11.13% ÷ (79.23% + 11.13%)]. In other words, in the sgRNA2-mediated cleavage of genomic DNA fragments by Cas9 nuclease, the proportion of blunt end cleavage is 87.7%, and the proportion of protruding end cleavage is 12.3%.
[0142] like Figure 1D As shown, when high-throughput sequencing technology was used to detect the repeat ligation adapters of DNA fragments, the proportion of precisely joined ligations (as expected) was 8.96%, while the proportion of ligations with the addition of a "T" base at the ligation adapter (in addition to the expected precisely joined ligations) was 82.92%.
[0143] Compared to the expected precise ligation, it is speculated that the "T" base added at the DNA fragment repeat ligation adapter originates from a base approximately 3 bp upstream of the PAM site (specifically 4 bp upstream of the PAM) on the template DNA (HS51 RE1, HS51 site). Therefore, it is speculated that when Cas9 nuclease cleaves DNA strands complementary to sgRNA, it cleaves at 3 bp upstream of the PAM; while when Cas9 nuclease cleaves DNA strands not complementary to sgRNA, it cleaves at a point further upstream of the PAM, at a distance of 4 bp. Based on the detection of the added "T" base at the DNA fragment repeat ligation adapter (compared to the expected precise ligation), it is speculated that when Cas9 nuclease cleaves genomic DNA fragments under sgRNA1-mediated cleavage, it performs both blunt-end and overhang-end cleavage, thus producing different break ends. When Cas9 nuclease performs blunt-end cleavage on genomic DNA fragments mediated by sgRNA1 (i.e., cleavage of both complementary and non-complementary DNA strands at the PAM), it produces blunt-end cleavage "C3". When this blunt-end cleavage "C3" generates DNA fragment repeats under the action of the cell repair system, it does not lead to the addition of a "T" base at the DNA fragment repeat ligation linker, but rather produces precisely joined ligations as expected. Conversely, when Cas9 nuclease performs overhang-end cleavage on genomic DNA fragments mediated by sgRNA1 (i.e., cleavage of complementary DNA strands at the PAM at 3 bp upstream and non-complementary DNA strands at 4 bp upstream), it produces 5' overhang-end cleavage "C4". When this 5' overhang-end cleavage "C4" generates DNA fragment repeats under the action of the cell repair system, it leads to the addition of a "T" base at the DNA fragment repeat ligation linker.
[0144] Therefore, we believe that, under Cas9 nuclease cleavage, the proportion of blunt C3 breaks in the resulting fracture ends is equal to the proportion of precisely joined ends (8.96%), and the proportion of protruding C4 breaks is equal to the proportion of "T" base additions (82.92%).
[0145] However, we observed that besides the two main categories of precisely joined ligations (as expected) and the addition of a "T" base at the DNA fragment repetition linker, there is another category of random small deletions. We believe that these random small deletions are generated randomly at each break end (blunt break end C3 and protruding break end C4) under the action of the cellular repair system. Each break end produces small deletions with equal probability, and the number of small deletions generated by each break end under the action of the cellular repair system is proportional to the number of break ends.
[0146] Based on the existence of random base deletion, we believe that the measured proportions of each break end obtained through sequencing differ from their true proportions and need to be corrected and restored. That is, the proportion of each break end is calculated based on the sum of the measured proportions of all break ends, and this is used as the percentage of that break end. Specifically, the proportions of each break end produced by Cas9 nuclease cleavage are standardized: the proportion of blunt break end C3 is 9.75% [calculated as: 8.96% ÷ (8.96% + 82.92%)], and the proportion of protruding break end C4 is 90.25% [calculated as: 82.92% ÷ (8.96% + 82.92%)]. In other words, in the sgRNA1-mediated cleavage of genomic DNA fragments by Cas9 nuclease, the proportion of blunt end cleavage is 9.75%, and the proportion of protruding end cleavage is 90.25%.
[0147] like Figure 1E As shown, based on the proportion of Cas9 nuclease cutting genomic DNA fragments under the mediation of sgRNA1 and sgRNA2, the sequences of the resulting break ends are predicted, and the base addition at the downstream linker of the DNA fragment inversion is then calculated and its proportion is determined.
[0148] When Cas9 nuclease cleaves the genomic DNA fragment at its protruding ends under the mediation of sgRNA1, producing a protruding break end "C4", and when Cas9 nuclease cleaves the genomic DNA fragment at its blunt ends under the mediation of sgRNA2, producing a blunt break end "E3", then under the action of the cell repair system, an "A" base will be added at the downstream linker of the DNA fragment inversion, and the proportion of this occurrence is 79.14% [calculated as: the proportion of "C4" protruding break ends (90.25%) x the proportion of "E3" blunt break ends (87.7%) = 79.14%], which is close to the proportion of "A" base addition at the downstream linker of the DNA fragment inversion detected in experiments, which is 71.94%.
[0149] When Cas9 nuclease performs blunt-end cleavage on genomic DNA fragments mediated by sgRNA1, producing blunt-end breaks "C3", and when Cas9 nuclease performs overhang-end cleavage on genomic DNA fragments mediated by sgRNA2, producing overhang-end breaks "E4", then under the action of the cell repair system, a "G" base will be added at the downstream linker of the DNA fragment reversal, and the proportion of this occurrence is 1.19% [calculated as: "C3" blunt-end proportion (9.75%) x "E4" overhang-end proportion (12.3%) = 1.19%], which is close to the experimentally detected proportion of "G" base addition at the downstream linker of the DNA fragment reversal, which is 8.54%.
[0150] When Cas9 nuclease cleaves the protruding ends of genomic DNA fragments under the mediation of sgRNA1, producing protruding break ends "C4", and when Cas9 nuclease cleaves the protruding ends of genomic DNA fragments under the mediation of sgRNA2, producing protruding break ends "E4", then under the action of the cell repair system, the downstream linker of the DNA fragment reverses and the addition of the "AG" base will occur at a rate of 11% [calculated as: "C4" protruding break end percentage (90.25%) x "E4" protruding break end percentage (12.3%) = 11%], which is close to the experimentally detected "AG" base addition rate of 3.66% at the downstream linker of the DNA fragment reverses.
[0151] When Cas9 nuclease performs blunt-end cleavage on genomic DNA fragments mediated by sgRNA1, producing blunt-end breaks "C3", and when Cas9 nuclease performs blunt-end cleavage on genomic DNA fragments mediated by sgRNA2, producing blunt-end breaks "E3", then, under the action of the cell repair system, the downstream adapters of the DNA fragments are precisely ligated, and the occurrence rate is 8.55% [calculated as: the proportion of "C3" blunt-end breaks (9.75%) x the proportion of "E3" blunt-end breaks (87.7%) = 8.55%], which is close to the experimentally detected proportion of precise ligation of downstream adapters of DNA fragments.
[0152] In summary, Figure 1E The experimental results further confirmed that when Cas9 nuclease cleaves DNA strands that are not complementary to sgRNA, it can cleave from 3 bp upstream of PAM to bases further away. When Cas9 nuclease cleaves genomic DNA fragments under sgRNA-mediated cleavage, it can perform blunt-end cleavage and overhang-end cleavage, resulting in different break ends. These break ends, under the action of the cellular repair system, can produce either precise DNA fragment editing (precise editing of specific bases) that matches the expected outcome or gene editing that does not match the expected outcome (random base deletion).
[0153] like Figure 1F As shown, different sgRNA designs (different target sequences) result in different proportions of Cas9 nuclease cleaving genomic DNA fragments under sgRNA mediation, leading to different proportions of broken ends. Specifically, when Cas9 nuclease cleaves genomic DNA fragments under sgRNA1 mediation, the proportion of blunt-end cleavage is higher than that of convex-end cleavage, resulting in a higher proportion of blunt-end broken ends than 5' convex-end broken ends. However, when Cas9 nuclease cleaves genomic DNA fragments under sgRNA2 mediation, the proportion of convex-end cleavage is higher than that of blunt-end cleavage, resulting in a higher proportion of 5' convex-end broken ends than blunt-end broken ends.
[0154] Since it has been found that Cas9 nuclease can cut genomic DNA fragments in two ways under sgRNA-mediated cleavage: blunt end cleavage and overhanging end cleavage, when Cas9 nuclease cuts genomic DNA fragments at overhanging ends under sgRNA-mediated cleavage, producing overhanging break ends, complementary bases to the overhanging break ends can be added in a filler manner, thereby achieving the addition of bases at specific positions of genomic DNA fragments.
[0155] Example 2: Mutating SpCas9 to obtain specific Cas9 with altered cutting patterns enables precise DNA fragment editing.
[0156] 1. Constructing Cas9 mutants
[0157] 1) The Cas9 mutant was constructed using the NEB Mutation Kit (Q5Site-Directed Mutagenesis Kit, #E0554S). PCR amplification was performed first, and the reaction was as follows:
[0158]
[0159]
[0160] 2) KLD (Kinase, Ligase & DpnI) treatment, the reaction is as follows:
[0161]
[0162] Reaction conditions: 10 minutes at room temperature
[0163] 3) Use all the reaction product from 2) to transform competent bacteria Stbl3 (50 μl), and culture overnight on LB agar plates containing ampicillin (Amp, 100 mg / L) at 37°C. Pick single clones, extract plasmids, and send them for sequencing.
[0164] The amino acid sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO.7, specifically:
[0165]
[0166]
[0167] The encoding nucleotide sequence of SpCas9 (Cas9WT) is shown in SEQ ID NO.8, specifically:
[0168]
[0169]
[0170]
[0171] like Figure 2A As shown, the Cas9 nuclease contains RuvC and HNH functional domains. The RuvC functional domain is responsible for cleaving DNA strands that are not complementary to sgRNA, while the HNH functional domain is responsible for cleaving DNA strands that are complementary to sgRNA.
[0172] The Cas9 nuclease mutant claimed in this invention is named Cas9-R780A (obtained by mutating arginine at position 780 of the SpCas9 nuclease to alanine).
[0173] The amino acid sequence of Cas9-R780A is shown in SEQ ID NO.9, and is as follows:
[0174]
[0175] The encoding nucleotide sequence of Cas9-R780A is shown in SEQ ID NO.10, specifically as follows:
[0176]
[0177]
[0178]
[0179]
[0180] In addition, mutants K775A, R778A, E779A, and K918P obtained by random mutation of SpCas9 were used as controls. These control mutants are all different from the Cas9-R780A sequence of the present invention.
[0181] 2. DNA fragment editing using Cas9 nuclease mutants.
[0182] (1) Construct sgRNAs targeting the β-globin RE2 site (RRM21 site).
[0183] The sgRNAs target sequences:
[0184] β-globin RE2 sgRNA1: ACCCAATGACCTCAGGCTGT (SEQ ID NO. 11);
[0185] β-globin RE2 sgRNA2: TCACTTGTTAGCGGCATCTG (SEQ ID NO. 12);
[0186] Purchased from Shanghai Sunny Biotechnology Co., Ltd. This product contains forward and reverse deoxyribonucleotides with complementary 5' hanging ends “ACCG” and “AAAC” that target the β-globin RE2 (RRM21 site) sgRNAs.
[0187] (2) Obtain complementary double-stranded DNA with dangling ends.
[0188] 1) Dissolve the deoxy oligonucleotides to 100 μM using ddH2O, and then dilute to 20 μM;
[0189] 2) Add the positron and trans-deoxy oligonucleotides to the following reaction system:
[0190]
[0191] Reaction conditions: 95℃ water bath, 5 min, then open the water bath lid to reduce the temperature to about 60℃, then close the lid and cool to room temperature.
[0192] (3) Enzyme digestion of pGL3-U6-sgRNA-PGK-Puro vector
[0193] 1) Digest the vector plasmid with BsaI restriction endonuclease. The reaction system is as follows:
[0194]
[0195] Reaction conditions: 37℃, 1.5 hours;
[0196] 2) Purify the DNA digested fragments using gel extraction according to the instructions of the gel extraction kit (Axygen).
[0197] (4) Ligate the enzyme-digested vector with double-stranded DNA with hanging ends.
[0198] The connection system is as follows:
[0199]
[0200] Reaction conditions: Reaction at room temperature for 1.5 hours;
[0201] (5) Conversion linker products
[0202] The product was transformed from Stbl3 competent cells and cultured overnight at 37°C on LB agar plates containing ampicillin (Amp, 100 mg / L).
[0203] (6) Selecting single clones for sequencing
[0204] 1) Pick a single colony from an ampicillin antibiotic LB agar plate and incubate overnight in LB (Amp, 100 mg / L) liquid culture;
[0205] 2) Plasmid extraction: Extract plasmids according to the instructions of the plasmid mini-extraction kit (Axygen);
[0206] 3) The extracted plasmid was sent to Shanghai Sunny Biotechnology Co., Ltd. for sequencing.
[0207] (7) Sequencing successful, plasmid is then extracted.
[0208] 1) The successfully sequenced plasmids were re-transformed using Stbl3 competent cells and cultured overnight on LB plates containing Amp (100 mg / L);
[0209] 2) In the morning, pick a single colony and incubate it in 2 ml of LB (Amp, 100 mg / L) liquid medium for 8 hours, then transfer it to 200 ml of LB (Amp, 100 mg / L) liquid medium and incubate overnight;
[0210] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).
[0211] (8) Cell transfection was performed using Lipofectamine 2000.
[0212] 1) HEK293T cells were cultured in culture flasks at 37°C in a cell culture incubator containing 5% CO2. When the cells reached 80-90% of the culture flask's capacity, the grown cells were seeded in 12-well plates with DMEM completely antibiotic-free medium and cultured overnight.
[0213] 2) When the cells in the 12-well plate reach 80-90% confluency, transfect the prepared Cas9 and Cas9 mutant plasmids (800 ng) and sgRNAs plasmids targeting the RRM21 site (600 ng each) using Lipofectamine 2000, with two replicates for each sample.
[0214] 3) Two days after transfection, collect cells and use a genomic extraction kit ( Genomic DNA Purification Kit (Promega) is used to extract genomes.
[0215] (9) Preparation of high-throughput sequencing libraries
[0216] Primers were designed approximately 30 bp upstream of the precise ligation sites for the expected deletions, inversions, and repeat adapters in the DNA fragments. Then, Illumina sequencing adapters with barcodes were added to the 5' ends of the primers. Downstream primers were designed at positions further away from the splicing sites and Illumina sequencing adapters were added. PCR amplification was performed, followed by purification using a Roche PCR purification kit (Product No.: 11732676001). The DNA product was dissolved in 10 mM Tris-HCl buffer (pH = 8.5), and after equal volumes were mixed, a library was formed for high-throughput sequencing.
[0217] Cas9 mutant primers:
[0218] Cas9-R780A-F: CAGTAGGGAAgccATGAAGAGGATTGAAG (SEQ ID NO. 13);
[0219] Cas9-R780A-R:TTCTTCTGTCCCTTCTGG (SEQ ID NO. 14);
[0220] (10) High-throughput sequencing data processing
[0221] After high-throughput sequencing, the sequencing results of the samples were extracted from the library using a Linux program via barcode and saved in their respective folders. BWA-MEM alignment was then performed. The aligned sequences were analyzed for insertion and deletion mutations in the DNA fragments using the Varscan2 program (V2.3.9). The Varscan2 program parameters are as follows:
[0222] Min coverage: 8
[0223] Min reads2:2
[0224] Min var freq:0.01
[0225] Min avg qual:15
[0226] P-value thresh: 0.01.
[0227] PCR amplification of DNA fragment deletion, inversion, and duplication was performed using high-throughput sequencing primers targeting the β-globin RE2 site, followed by library construction and high-throughput sequencing.
[0228] High-throughput primers:
[0229] Hiseq-RRM-1F3:
[0230] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATATGGCATCCTAGCCTTAAGAAACTAG(SEQ ID NO.15)
[0231] Hiseq-RRM-1R2:
[0232] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGACGCAGGAGCCGTATCATG(SEQ ID NO.16)
[0233] Hiseq-RRM-3F2:
[0234] CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATAGCAATGAAATCTTGAAGGAGTG (SEQ ID NO.17)
[0235] Hiseq-RRM-3R2:
[0236] CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCACAGCCCTGCTCTATTACG (SEQ ID NO. 18).
[0237] Referring to the method in Example 1 above, after editing the genomic DNA fragment using an sgRNA combination formed by two sgRNAs and the Cas9 nuclease, high-throughput sequencing technology can be used to detect the deletion and addition of duplicate linker bases in the DNA fragment. This allows for the calculation of the proportion of blunt-end cutting and overhang-end cutting methods when the Cas9 nuclease cuts the genomic DNA fragment under the mediation of each sgRNA.
[0238] Specifically, wild-type SpCas9 nuclease (Cas9WT, WT) Figure 2AA schematic diagram of R780A, two sgRNAs that edit the β-globin RE2 site of genomic DNA fragments under the mediation of each sgRNA in the sgRNA combination, is shown below. Figure 2B .
[0239] like Figure 2C As shown, high-throughput sequencing technology was used to detect the repetitive ligation adapters of DNA fragments. Besides precisely joined ligations as expected, there were also cases where "C" and "GC" bases were added to the adapters compared to the expected precisely joined ligations. The percentages of precisely joined ligations, "+C" bases, and "+GC" bases varied depending on the Cas9 nuclease used. Taking the R780A Cas9 nuclease as an example, the percentage of precisely joined ligations was 58.63%, the percentage of "+C" bases was 2.47%, and the percentage of "+GC" bases was 4.03%.
[0240] Given the presence of a "C" base added at the DNA fragment repeat ligation linker (compared to the expected precise ligation), we hypothesize that this "C" base originates from a base 4 bp upstream of PAM(AGG) on the template DNA (β-globin RE2 site). Furthermore, we hypothesize that when the Cas9 nuclease R780A, mediated by sgRNA1, cleaves the genomic DNA fragment (β-globin RE2 site), it cleaves the DNA strand complementary to the sgRNA at 3 bp upstream of PAM, while cleaving the non-complementary DNA strand at 4 bp upstream of PAM(AGG), resulting in a protruding break end U4. This protruding break end U4, when used by the cellular repair system to generate DNA fragment repeats, leads to the addition of the "C" base at the DNA fragment repeat ligation linker.
[0241] Similarly, given the presence of "GC" bases at the DNA fragment repeat ligation linker (compared to the expected precise ligation), we hypothesize that these "GC" bases originate from the bases 4 bp and 5 bp upstream of PAM (AGG) on the template DNA (β-globin RE2 site). Further, we hypothesize that when the Cas9 nuclease R780A, mediated by sgRNA1, cleaves the genomic DNA fragment (β-globin RE2 site), it cleaves the DNA strand complementary to the sgRNA at 3 bp upstream of PAM, while cleaving the non-complementary DNA strand at 5 bp upstream of PAM (AGG), resulting in the overhanging break U5. When this overhanging break U5 is used by the cellular repair system to generate DNA fragment repeats, it leads to the addition of "GC" bases at the DNA fragment repeat ligation linker.
[0242] When the Cas9 nuclease R780A cleaves genomic DNA fragments (β-globin RE2 sites) mediated by sgRNA1, it cleaves the DNA strand complementary to the sgRNA at a point 3 bp upstream of the PAM, and cleaves the DNA strand not complementary to the sgRNA at a point 3 bp upstream of the PAM (AGG), resulting in blunt-ended breaks (U3). When these U3 breaks generate DNA fragment repeats under the action of the cellular repair system, they do not lead to the addition of bases at the DNA fragment repeat ligation linker, but rather produce precisely joined ligations as expected.
[0243] Therefore, we believe that: In the cleavage produced by Cas9 nuclease R780A, the proportion of blunt break ends (U3) equals the proportion of precisely joined ends (as expected) = 58.63%. The proportion of protruding break ends (U4) equals the proportion of "C" base additions = 2.47%. The proportion of protruding break ends (U5) equals the proportion of "GC" base additions = 4.03%.
[0244] However, we observed that besides the three main categories of precisely joined, "C" base addition, and "GC" base addition, there was also a category of random small deletions. We believe that these random small deletions are generated randomly by the various break ends (blunt break end U3 / protruding break end U4 / protruding break end U5) under the action of the cell repair system. Each break end produces small deletions with equal probability, and the number of small deletions generated by each break end under the action of the cell repair system is proportional to the number of break ends.
[0245] Due to the presence of random base deletion, we believe that the measured proportions of each breakpoint obtained from sequencing differ from their true proportions and need to be corrected and restored. Specifically, we calculate the proportion of each breakpoint based on the sum of the measured proportions of all breakpoints, using this as the percentage of that breakpoint. For example, we standardize the calculation of the proportions of each breakpoint generated by Cas9 nuclease R780A cleavage: the proportion of the blunt breakpoint U3 is 90.02% [calculated as: 58.63% ÷ (58.63% + 2.47% + 4.03%)]. The proportion of the protruding breakpoint U4 is 3.80% [calculated as: 2.47% ÷ (58.63% + 2.47% + 4.03%)]. The proportion of the protruding breakpoint U5 is 6.19% [calculated as: 4.03% ÷ (58.63% + 2.47% + 4.03%)].
[0246] That is, in the sgRNA1-mediated cleavage of genomic DNA fragments by Cas9 nuclease R780A, the proportion of U3 blunt end cleavage is 90.02%, the proportion of U4 protruding end cleavage is 3.80%, and the proportion of U5 protruding end cleavage is 6.19%.
[0247] Following the above method, the proportions of U3 blunt-end cleavage, U4 overhang-end cleavage, and U5 overhang-end cleavage in the sgRNA1-mediated genomic DNA fragment cutting pathways of wild-type Cas9 nuclease (Cas9WT, WT) were calculated as follows: X1. Figure 2D And as shown in Table 2-1 below:
[0248] Table 2-1
[0249]
[0250] It is evident that, under the mediation of sgRNA1, compared with SpCas9 nuclease (Cas9WT), the R780A Cas9 nuclease mutant significantly increased the proportion of cleavage at 5 bp upstream of PAM when cutting DNA strands that are not complementary to sgRNA1 (U5), and decreased the proportion of cleavage at 3 bp upstream of PAM (U3).
[0251] like Figure 2E As shown, high-throughput sequencing technology was used to detect DNA fragment deletion ligation adapters. Besides precisely joined ligations as expected, cases where "T," "AT," or "CAT" bases were added to the deletion ligation adapter compared to the expected precisely joined ligations also occurred. The percentages of precisely joined ligations, "+T," "+AT," and "+CAT" bases varied depending on the Cas9 nuclease used. Taking the R780A Cas9 nuclease as an example, the percentage of precisely joined ligations was 18.35%, "+T" bases were 11.05%, "+AT" bases were 12.70%, and "+CAT" bases were 1.92%.
[0252] Given the presence of a "T" base added at the DNA fragment deletion ligation linker (compared to the expected precise ligation), we hypothesize that this "T" base originates from a base 4 bp upstream of PAM (TGG) on the template DNA (β-globin RE2 site). Furthermore, we hypothesize that when the Cas9 nuclease R780A, mediated by sgRNA2, cleaves the genomic DNA fragment (β-globin RE2 site), it cleaves the DNA strand complementary to the sgRNA at 3 bp upstream of PAM, while cleaving the non-complementary DNA strand at 4 bp upstream of PAM (TGG), resulting in the protruding break D4. This protruding break D4, acting on the cellular repair system to cause DNA fragment deletion, leads to the addition of the "T" base at the DNA fragment deletion ligation linker.
[0253] Similarly, given the presence of an "AT" base at the DNA fragment deletion ligation linker (compared to the expected precise ligation), we hypothesize that the "AT" base at the DNA fragment deletion ligation linker originates from bases 4 bp and 5 bp upstream of PAM (TGG) on the template DNA (β-globin RE2 site). Further, we hypothesize that when the Cas9 nuclease R780A, mediated by sgRNA2, cleaves the genomic DNA fragment (β-globin RE2 site), it cleaves the DNA strand complementary to the sgRNA at 3 bp upstream of PAM, while cleaving the DNA strand not complementary to the sgRNA at 5 bp upstream of PAM (TGG), resulting in the protruding break D5. When this protruding break D5 is used for DNA fragment deletion by the cellular repair system, it leads to the addition of the "AT" base at the DNA fragment deletion ligation linker.
[0254] Similarly, given the presence of the "CAT" base at the DNA fragment deletion ligation linker (compared to the expected precise ligation), we hypothesize that the "CAT" base at the DNA fragment deletion ligation linker originates from bases 4bp, 5bp, and 6bp upstream of PAM (TGG) on the template DNA (β-globin RE2 site). Further, we hypothesize that when the Cas9 nuclease R780A, mediated by sgRNA2, cleaves the genomic DNA fragment (β-globin RE2 site), it cleaves the DNA strand complementary to the sgRNA at 3bp upstream of PAM, while cleaving the non-complementary DNA strand at 6bp upstream of PAM (TGG), resulting in the protruding break D6. When this protruding break D5 is used for DNA fragment deletion by the cellular repair system, it leads to the addition of the "CAT" base at the DNA fragment deletion ligation linker.
[0255] When the Cas9 nuclease R780A cleaves genomic DNA fragments (β-globin RE2 sites) mediated by sgRNA2, cleavage occurs 3 bp upstream of the PAM site when cutting DNA strands complementary to the sgRNA, and 3 bp upstream of the PAM (TGG) site when cutting DNA strands non-complementary to the sgRNA, resulting in blunt-ended breaks (D3). When these blunt-ended breaks (D3) trigger DNA deletions through the cellular repair system, they do not lead to the addition of bases at the DNA deletion ligation linker; instead, they result in precisely joined ligations as expected.
[0256] Therefore, we believe that, under Cas9 nuclease R780A cleavage, the percentage of blunt break ends (D3) is equal to the percentage of precisely joined ends (18.35%). The percentage of protruding break ends (D4) is equal to the percentage of "T" base additions (11.05%). The percentage of protruding break ends (D5) is equal to the percentage of "AT" base additions (12.70%). The percentage of protruding break ends (D6) is equal to the percentage of "CAT" base additions (1.92%).
[0257] However, we observed that besides the four main categories of precisely joined ligations (as expected), DNA fragment deletion ligations with the addition of "T" bases, "+AT" bases, and "+CAT" bases at the linker, there was also a category of random small deletions. We believe that these random small deletions are generated randomly by the various break ends (blunt break end D3 / protruding break end D4 / protruding break end D5 / protruding break end D6) under the action of the cell repair system. Each break end produces small deletions with equal probability, and the number of small deletions generated by each break end under the action of the cell repair system is proportional to the number of break ends.
[0258] Due to the existence of random base deletion, we believe that the measured proportions of each breakpoint obtained through sequencing differ from their true proportions and need to be corrected. Specifically, we calculate the proportion of each breakpoint based on the sum of the measured proportions of all breakpoints, and use this as the percentage of that breakpoint. For example, after standardizing the calculation of the proportions of each breakpoint generated by Cas9 nuclease R780A cleavage, the proportion of the blunt breakpoint D3 is 41.68%.
[0259] The calculation method is: 18.35% ÷ (18.35% + 11.05% + 12.70% + 1.92%).
[0260] The proportion of D4 protruding from the fracture end is 25.10%.
[0261] The calculation method is: 11.05% ÷ (18.35% + 11.05% + 12.70% + 1.92%).
[0262] The proportion of the fracture end D5 that protrudes is 28.85%.
[0263] The calculation method is: 12.70% ÷ (18.35% + 11.05% + 12.70% + 1.92%).
[0264] The proportion of the fracture end D6 that protrudes is 4.37%.
[0265] The calculation method is: 1.92% ÷ (18.35% + 11.05% + 12.70% + 1.92%).
[0266] That is, in the cas9 nuclease R780A's cleavage of genomic DNA fragments mediated by sgRNA2,
[0267] The proportion of D3 blunt-end cuts was 41.68%, D4 protruding-end cuts was 25.10%, D5 protruding-end cuts was 28.85%, and D6 protruding-end cuts was 4.37%.
[0268] Following the above method, the percentages of cleavage at the blunt end (D3) Y1, the protruding end (D4) Y2, the protruding end (D5) Y3, and the protruding end (D6) Y4 of the genomic DNA fragment cleavage patterns mediated by wild-type Cas9 nuclease under sgRNA2 mediation were calculated. The results are as follows: Figure 2F And as shown in Table 2-2:
[0269] Table 2-2
[0270]
[0271]
[0272] It is evident that, under the mediation of sgRNA2, compared with SpCas9 nuclease (Cas9WT), the R780A mutant significantly increases the proportion of cleavage at 3bp upstream of PAM when cutting DNA strands that are not complementary to sgRNA2.
[0273] Following the method in Example 1, based on the proportion of genomic DNA fragments cleaved by Cas9 nuclease under the mediation of sgRNA1 and sgRNA2, the sequences of the resulting break ends were predicted, and the base addition and proportion at the downstream ligation site of the DNA fragment were calculated. The results are as follows: Figure 2G As shown, the calculated results are close to the base addition ratio detected experimentally. This further confirms that the Cas9 nuclease, mediated by sgRNA ensemble, can cleave non-complementary DNA strands from 3 bp upstream of PAM to bases further upstream.
[0274] Furthermore, the Cas9 nuclease mutant Cas9-R780A and control mutants K775A, R778A, E779A, and K918P of this invention were transfected into human embryonic kidney HEK293T cells along with two sgRNAs targeting the STM site (β-globin RE1). Genomic DNA was collected 48 hours after transfection, and DNA fragment deletions, inversions, and duplications were amplified by PCR using high-throughput sequencing primers. Libraries were constructed and high-throughput sequencing was performed. Based on the addition of linker bases in the DNA fragment deletions and duplications, the proportion of cleavage patterns mediated by the two sgRNAs in these mutants was calculated.
[0275] sgRNA targeting sequences at the STM site (β-globin RE1):
[0276] β-globin RE1sgRNA1: GATTGTTGTTGCCTTGGAGTG (SEQ ID NO. 19);
[0277] β-globin RE1sgRNA2:GCTGGTCCCTGGTAACCTGG (SEQ ID NO. 20);
[0278] Forward and reverse deoxy oligonucleotides:
[0279] β-globin RE1sgRNA1F: accgATTGTTGTTGCCTTGGAGTG (SEQ ID NO. 21);
[0280] β-globin RE1sgRNA1R: aaacCACTCCAAGGCAACAACAAT (SEQ ID NO. 22);
[0281] β-globin RE1sgRNA2F: accgCTGGTCCCCTGGTAACCTGG (SEQ ID NO. 23);
[0282] β-globin RE1sgRNA2R: aaacCCAGGTTACCAGGGGACCAG (SEQ ID NO. 24);
[0283] High-throughput primers:
[0284] Hiseq-hSTM-aF1:
[0285] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTTAGAGCCAGGACTAATTGC (SEQ ID NO. 25);
[0286] Hiseq-hSTM-aR2:
[0287] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGGTGTAGAAATGAGCAAATAAGT (SEQ ID NO. 26);
[0288] Hiseq-hSTM-2F:
[0289] CAAGCAGAAGACGGCATACGAGATGATCGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGATTGAGTTCTGTTTGTTTCATCTAC (SEQ ID NO. 27);
[0290] Hiseq-hSTM-2R:
[0291] CAAGCAGAAGACGGCATACGAGATAGTCAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCTCTGCCTGAAAGGAGTC (SEQ ID NO. 28).
[0292] like Figure 3A and 3B As shown, compared with the wild-type SpCas9 nuclease (Cas9WT), the control mutants K775A, R778A, E779A, and K918P did not show significant changes in the way they cleaved genomic DNA fragments under the mediation of sgRNA1 and sgRNA2; while the Cas9 nuclease mutant Cas9-R780A showed significant changes in the way it cleaved genomic DNA fragments under the mediation of sgRNA1 and sgRNA2 compared with the wild-type SpCas9 nuclease (Cas9WT).
[0293] In summary, the Cas9 nuclease (Cas9-R780A) of this invention produces a different ratio of protruding to blunt breaks when cutting target genomic DNA fragments compared to the wild-type Cas9 nuclease. Using the Cas9 nuclease (Cas9-R780A) of this invention, specific locations on the target genomic DNA fragment can be cut to generate protruding breaks. Complementary bases to these protruding breaks can be added via a ligation process, thereby enabling precise DNA fragment editing at specific locations.
[0294] The references for this application are as follows:
[0295] 1.Stamatoyannopoulos,JA.(2012).What does our genome encode? GenomeRes,22:1602-1611.
[0296] 2.The ENCODE Project Consortium.(2012).An integrated encyclopedia ofDNA elements in the human genome.Nature,489:57-74.
[0297] 3. Banerji, J, L Olson, and W Schaffner. (1983). A lymphocyte-specific cellular enhancer is located downstream of the joining region inimmunoglobulin heavy chain genes. Cell, 33:729-740.
[0298] 4. Zhang, T, P Haws, and Q Wu. (2004). Multiple variable first exons: amechanism for cell-and tissue-specific gene regulation. Genome Res, 14: 79-89.
[0299] 5.Neph,S,et al.(2012).An expansive human regulatory lexicon encodedin transcription factor footprints.Nature,489:83-90.
[0300] 6.Shen,Y,et al.(2012).A map of the cis-regulatory sequences in themouse genome.Nature,488:116-120.
[0301] 7.Thurman,RE,et al.(2012).The accessible chromatin landscape of thehuman genome.Nature,489:75-82.
[0302] 8.de Laat,W and D Duboule.(2013).Topology of mammalian developmentalenhancers and their regulatory landscapes.Nature,502:499-506.
[0303] 9.McClintock,B.(1950).The origin and behavior of mutable loci inmaize.Proc Natl Acad Sci U S A,36:344-355.
[0304] 10.McClintock,B.(1984).The significance of responses of the genome tochallenge.Science,226:792-801.
[0305] 11.Brinster,RL,et al.(1981).Somatic expression of herpes thymidinekinase in mice following injection of a fusion gene into eggs.Cell,27:223-231.
[0306] 12.Harbers,K,D Jahner,and R Jaenisch.(1981).Microinjection of clonedretroviral genomes into mouse zygotes:integration and expression in theanimal.Nature,293:540-542.
[0307] 13.Gordon,JW,et al.(1980).Genetic transformation of mouse embryos bymicroinjection of purified DNA.Proc Natl Acad Sci U S A,77:7380-7384.
[0308] 14.Palmiter,RD,et al.(1982).Dramatic growth of mice that develop fromeggs microinjected with metallothionein-growth hormone fusion genes.Nature,300:611-615.
[0309] 15.Capecchi,MR.(2005).Gene targeting in mice:functional analysis ofthe mammalian genome for the twenty-first century.Nat Rev Genet,6:507-512.
[0310] 16.Carroll,D.(2014).Genome engineering with targetable nucleases.AnnuRev Biochem,83:409-439.
[0311] 17.Smithies,O,et al.(1985).Insertion of DNA sequences into the humanchromosomal beta-globin locus by homologous recombination.Nature,317:230-234.
[0312] 18.Thomas,KR and MR Capecchi.(1986).Introduction of homologous DNAsequences into mammalian cells induces mutations in the cognate gene.Nature,324:34-38.
[0313] 19.Zheng,B,et al.(2000).Engineering mouse chromosomes with Cre-loxP:range,efficiency,and somatic applications.Mol Cell Biol,20:648-655.
[0314] 20.Wu,S,et al.(2007).Toward simpler and faster genome-widemutagenesis in mice.Nat Genet,39:922-930.
[0315] 21.Gupta,A,et al.(2013).Targeted chromosomal deletions and inversionsin zebrafish.Genome Res,23:1008-1017.
[0316] 22.Xiao,A,et al.(2013).Chromosomal deletions and inversions mediatedby TALENs and CRISPR / Cas in zebrafish.Nucleic Acids Res,41:e141.
[0317] 23.Kraft,K,et al.(2015).Deletions,Inversions,Duplications:Engineeringof Structural Variants using CRISPR / Cas in Mice.Cell Rep,10:833-839.
[0318] 24.Wu,S,et al.(2008).A protocol for constructing gene targetingvectors:generating knockout mice for the cadherin family and beyond.NatureProtocol,3:1056-1076.
[0319] 25.Jinek,M,et al.(2012).A programmable dual-RNA-guided DNAendonuclease in adaptive bacterial immunity.Science,337:816-821.
[0320] 26.Cong,L,et al.(2013).Multiplex genome engineering using CRISPR / Cassystems.Science,339:819-823.
[0321] 27.Mali,P,et al.(2013).RNA-guided human genome engineering viaCas9.Science,339:823-826.
[0322] 28.Li,J,et al.(2015).Efficient inversions and duplications ofmammalian regulatory DNA elements and gene clusters by CRISPR / Cas9.J Mol CellBiol,7:284-298.
[0323] 29.Sartori,AA,et al.(2007).Human CtIP promotes DNA endresection.Nature,450:509-514.
[0324] 30.Anand,R,et al.(2016).Phosphorylated CtIP Functions as a Co-factorof the MRE11-RAD50-NBS1 Endonuclease in DNA End Resection.Mol Cell,64:940-950.
[0325] 31.Li,J,J Shou,and Q Wu.(2015).DNA fragment editing of genomes byCRISPR / Cas9.Hereditas,37:992-1002.
[0326] 32. Huang, H and Q Wu. (2016). CRISPR Double Cutting through theLabyrinthine Architecture of 3D Genomes. J Genet Genomics, 43: 273-288.
[0327] 33.Guo,Y,et al.(2015).CRISPR Inversion of CTCF Sites Alters GenomeTopology and Enhancer / Promoter Function.Cell,162:900-910.
[0328] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention. SEQUENCE LISTING <110> Shanghai Jiao Tong University <120> A Cas9 nuclease R780A and its uses <130> 171290 <160> 28 <170> PatentIn version 3.3 <210> 1 <211> 20 <212> DNA <213> Artificial <220> <223> HS51 RE1sgRNA1 <400> 1 gccacacatc caaggctgac <210> 2 <211> 21 <212> DNA <213> Artificial <220> <223> HS51 RE1sgRNA2 <400> 2 gagatttggg gcgtcagga g <210> 3 <211> 77 <212> DNA <213> Artificial <220> <223> Hiseq‐hHs51‐aF <400> 3 atgatacggc gaccaccgag atctacactc tttccctaca cgacgctctt ccgatctgca aggagatccg tgtcgtc 77 <210> 4 <211> 82 <212> DNA <213> Artificial <220> <223> Hiseq‐hs51‐aRa <400> 4 60. aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa ggatgttgtg gaaggcgagc ag <210> 5 <211> 87 <212> DNA <213> Artificial <220> <223> Ezek‐hs51‐bFa <400> 5 caagcagaag acggcatacg agatggacgg gtgactggag ttcagacgtg tgctcttccg 60 atctctttac atgacagctt ccggtag 87 <210> 6 <211> 89 <212> DNA <213> Artificial <220> <223> Hiseq‑hHs51‑bR <400> 6 caagcagaag acggcatacg agatttgact gtgactggag ttcagacgtg tgctcttccg 60 atcttttttg gctaacaaca tagtgcttc 89 <210> 7 <211> 1401 <212> PRT <213> Artificial <220> <223> SpCas9 <400> 7 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser 20 25 30 Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys 35 40 45 Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu 50 55 60 Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg 65 70 75 80 Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile 85 90 95 Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp 100 105 110 Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys 115 120 125 Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala 130 135 140 Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val 145 150 155 160 Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala 165 170 175 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn 180 185 190 Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr 195 200 205 Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp 210 215 220 Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu 225 230 235 240 Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly 245 250 255 Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn 260 265 270 Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr 275 280 285 Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala 290 295 300 Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser 305 310 315 320 Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala 325 330 335 Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu 340 345 350 Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe 355 360 365 Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala 370 375 380 Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met 385 390 395 400 Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu 405 410 415 Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His 420 425 430 Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro 435 440 445 Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg 450 455 460 Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala 465 470 475 480 Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu 485 490 495 Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met 500 505 510 Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His 515 520 525 Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val 530 535 540 Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu 545 550 555 560 Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val 565 570 575 Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 580 585 590 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 595 600 605 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu 610 615 620 Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 625 630 635 640 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr 645 650 655 Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg 660 665 670 Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg 675 680 685 Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 690 695 700 Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr 705 710 715 720 Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser 725 730 735 Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys 740 745 750 Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met 755 760 765 Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn 770 775 780 Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg 785 790 795 800 Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His 805 810 815 Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr 820 825 830 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 835 840 845 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu 850 855 860 Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 865 870 875 880 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met 885 890 895 Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg 900 905 910 Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu 915 920 925 Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 930 935 940 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr 945 950 955 960 Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys 965 970 975 Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val 980 985 990 Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala 995 1000 1005 Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser 1010 1015 1020 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1025 1030 1035 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr 1040 1045 1050 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1055 1060 1065 Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn 1070 1075 1080 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1085 1090 1095 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1100 1105 1110 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1115 1120 1125 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1130 1135 1140 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1145 1150 1155 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1160 1165 1170 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1175 1180 1185 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1190 1195 1200 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1220 1225 1230 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1235 1240 1245 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1250 1255 1260 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1265 1270 1275 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1280 1285 1290 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1295 1300 1305 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1310 1315 1320 Glu Asn With Gly Is His Pro 1325 1330 1335 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1340 1345 1350 The Thr Ser of Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1355 1360 1365 Thr Gly to Tyr Glu Thr Arg to Asp to Ser Gln to Gly 1370 1375 1380 Gly Asp Lys Pro Arg Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1385 1390 1395 Lys Lys Lys 1400 <210> 8 <211> 4206 <212> DNA <213> Artificial <220> <223> SpCas9 <400> 8 atggccccaa agaagaagcg gaagtcggt atccacggtg tcccagcagc catggacaag 60 aagtactcca ttgggctcga tatcggcaca aacagcgtcg gctggggccgt cattacggac 120 gagtacaagg tgccgagca aaaattcaa gttctgggca ataccgatcg ccacaccata 180 aagagaacc tcattggcgc cctcctgttc gactccgggg agacggccga agccacgcgg 240 ctcaaagaa cagcacggcg cagatatacc cgcagaaaga atcggatctg ctacctgcag 300 gagatcttta gtaatgagat gctaaggtg gatgactt tctccatag gctggaggag 360 tccttttttgg tggagga taaaaagcac gagcgccacc caatctttgg caatcgtg 420 gacgaggtgg cgtaccatga aaagtaccca accatatatc atctgaggaa gaagcttgta 480 zgagtactg ataaggctga cttgcggttg atctatctcg cgctggcgca tattgatcaa 540 tttcggggac acttcctcat cgagggggac ctgaacccag acacagcga tgtcgacaaa 600 ctctttatcc aactggttca gacttacaat cagctttcg agagaaccc gatcaacgca 660 tccggagttg acgccaagc aatcctgagc gctaggctgt ccaatcccg gcggctcgaa 720 aacctcatcg cacagctccc tggggagaag aagaacggcc tgttgtaa tcttatcgcc 780 ctgtcactcg ggctgacccc siactttaaa tctactcg acctggccga agatgccaag 840 cttcaactga gcaaagacac ctacgatgat gatctcgaca atctgctggc ccagatcggc gaccagtacg cagacctttt tttggcggca aagaacctgt cagacgccat tctgctgagt gatattctgc gagtgaacac gagatcacc aaagctccgc tgagcgctag tatgatcaag cgctatgatg agcaccacca agacttgact ttgctgaagg cccttgtcag agcagcaactg cctgagaagt acaaggaaat tttcttcgat cagtctaaaa atggctacgc cggatacatt gacggcggag caagccagga ggaattttac aaatttatta agcccatctt ggaaaaaatg gacggcaccg aggagctgct ggtaaagctt aacagagaag atctgttgcg caaacagcgc actttcgaca atggaagcat cccccaccag attcacctgg gcgaactgca cgctatactc aggcggcaag aggatttcta cccctttttg aaagataaca gggaaaagat tgagaaaatc ctcacatttc ggatacccta ctatgtaggc cccctcgccc ggggaattc cagattcgcg tggatgactc gcaaatcaga gagaccatc actccctgga acttcgagga agtcgtggat aagggggcct ctgcccagtc cttcatcgaa aggatgacta actttgataa aaatctgcct aacgaaaagg tgcttcctaa acactctctg ctgtacgagt acttcacagt ttataacgag 1620 ctcaccaagg tcaaatacgt cacagaaggg atgagaaagc cagcattcct gtctggagag 1680 cagaagaaag ctatcgtgga cctcctcttc aagacgaacc ggaaagttac cgtgaaacag 1740 ctcaaagaag actatttcaa aaagattgaa tgtttcgact ctgttgaaat cagcggagtg 1800 gaggatcgct tcaacgcatc cctgggaacg tatcacgatc tcctgaaaat cattaaagac 1860 aaggacttcc tggacaatga ggagaacgag gacattcttg aggacattgt cctcaccctt 1920 acgttgtttg aagataggga gatgattgaa gaacgcttga aaacttacgc tcatctcttc 1980 gacgacaaag tcatgaaaca gctcaagagg cgccgatata caggatgggg gcggctgtca 2040 agaaaactga tcaatgggat ccgagacaag cagagtggaa agacaatcct ggattttctt 2100 aagtccgatg gatttgccaa ccggaacttc atgcagttga tccatgatga ctctctcacc 2160 tttaaggagg acatccagaa agcacaagtt tctggccagg gggacagtct tcacgagcac 2220 atcgctaatc ttgcaggtag cccagctatc aaaaagggaa tactgcagac cgttaaggtc 2280 gtggatgaac tcgtcaaagt aatgggaagg cataagcccg agaatcgt tatcgagatg gcccgagaga accaaactac ccagaaggga cagaagaca gtagggaag gatgaagagg attgaagagg gtaaaaaga actggggtcc caaatcctta aggaacaccc agttgaaaac acccagcttc agaatgagaa gctctacctg tactacctgc agaacggcag ggacatgtac gtggatcagg aactggacat caatcggctc tccgactacg acgtggatca tatcgtgccc cagtcttttc tcaaagatga ttctattgat aataaagtgt tgacaagatc cgataaaaat agggaga gtgataacgt cccctcagaa gaagttgtca agaaaatgaa aaattattgg cggcagctgc tgaacgccaa actgatcaca caacggaagt tcgataatct gactaaggct gaacgaggtg gcctgtctga gttggataaa gcaggcttca tcaaaaggca gcttgttgag acacgccaga tcaccaagca cgtggcccaa attctcgatt cacgcatgaa caccaagtac gatgaaaatg acaaactgat tcgagaggtg aaagttatta ctctgaagtc taagctggtc tcagatttca gaaaggactt tcagttttat aaggtgagag agatcaacaa ttaccaccat gcgcatgatg cctacctgaa tgcagtggta ggcactgcac ttatcaaaaa atatcccaag 3060 cttgaatctg aatttgttta cggagactat aaagtgtacg atgttaggaa aatgatcgca 3120 aagtctgagc aggaaatagg caaggccacc gctaagtact tcttttacag caatattatg 3180 aattttttca agaccgagat tacactggcc aatggagaga ttcggaagcg accacttatc 3240 gaacaaacg gagaacagg agaaatcgtg tgggacaagg gtagggattt cgcgacagtc 3300 cggaaggtcc tgtccatgcc gcaggtgaac atcgttaaaa agaccgaagt agaccgga 3360 ggcttctcca aggaagtat cctcccgaaa aggaacagcg acaagctgat cgcacgcaaa 3420 aaagattggg accccaagaa atacggcgga ttcgattctc ctacagtcgc ttacagtgta 3480 ctggttgtgg ccaaagtgga gaagggaag tctaaaaaac tcaaaagcgt caaggaactg 3540 ctgggcatca caatcatgga gcgatcaagc ttcgaaaaaa accccatcga ctttctcgag 3600 gcgaaaggat ataaagaggt caaaaaagac ctcatcatta agcttcccaa gtactctctc 3660 tttgagcttg aaaacggccg gaacgaatg ctcgctagtg cgggcgagct gcagaaaggt 3720 aacgagctgg cactgccctc taaatacgtt aatttcttgt atctggccag cactatgaa 3780 aagctcaaag gtctcccga agataatgag cagaagcagc tgttcgtgga acacaaaa 3840 cactaccttg atgagatcat cgagcaata agcgaattct ccaaagagt gatcctcgcc 3900 gacgctacc tcgataggt gctttctgct tacaatagc acaggata gcccatcagg 3960 gagcaggcag aaaacattat ccacttgttt actctgacca acttgggcgc gcctgcagcc 4020 ttcaagtact tcgacaccac catagacaga aagcggtaca cctctacaaa ggaggtcctg 4080 gacgccac tgattcatca gtcattacg gggctcttg aaaacaagaat cgacctct 4140 cagctcggtg gagacaagcg tcctgctgct actaagaag ctggtcaagc tagaaaaag 4200 AAA 4206 <210> 9 <211> 1401 <212> PRT <213> Artificial <220> <223> Cas9‐ R780A <400> 9 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Only Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser 20 25 30 Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys 35 40 45 Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu 50 55 60 Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg 65 70 75 80 Leu Lys Arg Thr Ala Arg Arg Tyr Thr Arg Lys Asn Arg Ile 85 90 95 Cys Tyr Leu Gln Glu Is Associated With Glue Met Ala Asp Asp 100 105 110 Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys 115 120 125 Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala 130 135 140 Tyr His Glu Lys Tyr Pro Thr And Tyr His Leu Arg Lys Leu Val 145 150 155 160 Asp Ser Thr Asp Lys Ala Asp Leu Arg Ala Ile Tyr Leu Ala Leu Ala 165 170 175 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn 180 185 190 Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr 195 200 205 Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp 210 215 220 Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu 225 230 235 240 Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly 245 250 255 Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn 260 265 270 Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr 275 280 285 Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala 290 295 300 Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser 305 310 315 320 Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala 325 330 335 Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu 340 345 350 Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe 355 360 365 Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala 370 375 380 Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met 385 390 395 400 Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu 405 410 415 Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His 420 425 430 Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro 435 440 445 Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg 450 455 460 Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala 465 470 475 480 Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu 485 490 495 Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met 500 505 510 Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His 515 520 525 Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val 530 535 540 Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu 545 550 555 560 Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val 565 570 575 Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 580 585 590 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 595 600 605 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu 610 615 620 Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 625 630 635 640 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr 645 650 655 Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg 660 665 670 Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg 675 680 685 Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 690 695 700 Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr 705 710 715 720 Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser 725 730 735 Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys 740 745 750 Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met 755 760 765 Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn 770 775 780 Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Ala Met Lys Arg 785 790 795 800 Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His 805 810 815 Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr 820 825 830 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 835 840 845 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu 850 855 860 Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 865 870 875 880 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met 885 890 895 Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg 900 905 910 Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu 915 920 925 Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 930 935 940 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr 945 950 955 960 Asp Glu Asn Asp Lys With Arg Glu Val Lys Val With Thr Lys 965,970,975 Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val 980,985,990 Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala 995 1000 1005 Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser 1010 1015 1020 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1025 1030 1035 I Ile Lys Sere Glu Gln Glu Ile Gly Lys Ike Thr Ike Lys Tyr 1040 1045 1050 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1055 1060 1065 Only Asn Gly Glu With Arg Lys Arg Pro Only With Glu Thr Asn 1070 1075 1080 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1085 1090 1095 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1100 1105 1110 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1115 1120 1125 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1130 1135 1140 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1145 1150 1155 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1160 1165 1170 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1175 1180 1185 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1190 1195 1200 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1220 1225 1230 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1235 1240 1245 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1250 1255 1260 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1265 1270 1275 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1280 1285 1290 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1295 1300 1305 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1310 1315 1320 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1325 1330 1335 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1340 1345 1350 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1355 1360 1365 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1370 1375 1380 Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1385 1390 1395 Lys Lys Lys 1400 <210> 10 <211> 4206 <212> DNA <213> Artificial <220> <223> Cas9‐ R780A <400> 10 atggccccaa agaagaagcg gaagtcggt atccacggtg tcccagcagc catggacaag 60 aagtactcca ttgggctcga tatcggcaca aacagcgtcg gctggggccgt cattacggac 120 gagtacaagg tgccgagca aaaattcaa gttctgggca ataccgatcg ccacaccata 180 aagagaacc tcattggcgc cctcctgttc gactccgggg agacggccga agccacgcgg 240 ctcaaagaa cagcacggcg cagatatacc cgcagaaaga atcggatctg ctacctgcag 300 gagatcttta gtaatgagat gctaaggtg gatgactt tctccatag gctggaggag 360 tccttttttgg tggagga taaaaagcac gagcgccacc caatctttgg caatcgtg 420 gacgaggtgg cgtaccatga aaagtaccca accatatatc atctgaggaa gaagcttgta 480 zgagtactg ataaggctga cttgcggttg atctatctcg cgctggcgca tattgatcaa 540 tttcggggac acttcctcat cgagggggac ctgaacccag acacagcga tgtcgacaaa 600 ctctttatcc aactggttca gacttacaat cagctttcg agagaaccc gatcaacgca 660 tccggagttg acgccaaagc aatcctgagc gctaggctgt ccaaatcccg gcggctcgaa 720 aacctcatcg cacagctccc tggggagaag aagaacggcc tgtttggtaa tcttatcgcc 780 ctgtcactcg ggctgacccc caactttaaa tctaacttcg acctggccga agatgccaag 840 cttcaactga gcaaagacac ctacgatgat gatctcgaca atctgctggc ccagatcggc 900 gaccagtacg cagacctttt tttggcggca aagaacctgt cagacgccat tctgctgagt 960 gatattctgc gagtgaacac ggagatcacc aaagctccgc tgagcgctag tatgatcaag 1020 cgctatgatg agcaccacca agacttgact ttgctgaagg cccttgtcag acagcaactg 1080 cctgagaagt acaaggaaat tttcttcgat cagtctaaaa atggctacgc cggatacatt 1140 gacggcggag caagccagga ggaattttac aaatttatta agcccatctt ggaaaaaatg 1200 gacggcaccg aggagctgct ggtaaagctt aacagagaag atctgttgcg caaacagcgc 1260 actttcgaca atggaagcat cccccaccag attcacctgg gcgaactgca cgctatactc 1320 aggcggcaag aggatttcta cccctttttg aaagataaca gggaaaagat tgagaaaatc 1380 ctcacatttc ggatacccta ctatgtaggc cccctcgccc ggggaaattc cagattcgcg 1440 tggatgactc gcaaatcaga agagaccatc actccctgga acttcgagga agtcgtggat 1500 aagggggcct ctgcccagtc cttcatcgaa aggatgacta actttgataa aaatctgcct 1560 aacgaaaagg tgcttcctaa acactctctg ctgtacgagt acttcacagt ttataacgag 1620 ctcaccaagg tcaaatacgt cacagaaggg atgagaaagc cagcattcct gtctggagag 1680 cagaagaaag ctatcgtgga cctcctcttc aagacgaacc ggaaagttac cgtgaaacag 1740 ctcaaagaag actatttcaa aaagattgaa tgtttcgact ctgttgaaat cagcggagtg 1800 gaggatcgct tcaacgcatc cctgggaacg tatcacgatc tcctgaaaat cattaaagac 1860 aaggacttcc tggacaatga ggagaacgag gacattcttg aggacattgt cctcaccctt 1920 acgttgtttg aagataggga gatgattgaa gaacgcttga aaacttacgc tcatctcttc 1980 gacgacaaag tcatgaaaca gctcaagagg cgccgatata caggatgggg gcggctgtca 2040 agaaaactga tcaatgggat ccgagacaag cagagtggaa agacaatcct ggattttctt 2100 aagtccgatg gatttgccaa ccggaacttc atgcagttga tccatgatga ctctctcacc tttaaggagg acatccagaa agcacaagtt tctggccagg gggacagtct tcacgagcac atcgctaatc ttgcaggtag cccagctatc aaaaaggga tactgcagac cgttaaggtc gtggatgaac tcgtcaaagt aatgggaagg cataagcccg agaatcgt tatcgagatg gcccgagaga accaaactac ccagaaggga cagaagaca gtagggagc catgaagagg attgaagagg gtaaaaaga actggggtcc caaatcctta aggaacaccc agttgaaaac acccagcttc agaatgagaa gctctacctg tactacctgc agaacggcag ggacatgtac gtggatcagg aactggacat caatcggctc tccgactacg acgtggatca tatcgtgccc cagtcttttc tcaaagatga ttctattgat aataaagtgt tgacaagatc cgataaaaat agggaga gtgataacgt cccctcagaa gaagttgtca agaaaatgaa aaattattgg cggcagctgc tgaacgccaa actgatcaca caacggaagt tcgataatct gactaaggct gaacgaggtg gcctgtctga gttggataaa gcaggcttca tcaaaaggca gcttgttgag acacgccaga tcaccaagca cgtggcccaa attctcgatt cacgcatgaa caccaagtac 2880 gatgaaaatg acaaactgat tcgagaggtg aaagttatta ctctgaagtc taagctggtc 2940 tcagatttca gaaggactt tcagttttat aaggtgagag agatcaacaa ttaccaccat 3000 gcgcatgatg cctacctgaa tgcagtggta ggcactgcac ttatcaaaaa atatcccaag 3060 cttgaatctg aatttgttta cggagactat aaagtgtacg atgttaggaa aatgatcgca 3120 aagtctgagc aggaaatagg caaggccacc gctaagtact tcttttacag caatattatg 3180 aattttttca agaccgagat tacactggcc aatggagaga ttcggaagcg accacttatc 3240 gaacaaacg gagaacagg agaaatcgtg tgggacaagg gtagggattt cgcgacagtc 3300 cggaaggtcc tgtccatgcc gcaggtgaac atcgttaaaa agaccgaagt agaccgga 3360 ggcttctcca aggaagtat cctcccgaaa aggaacagcg acaagctgat cgcacgcaaa 3420 aaagattggg accccaagaa atacggcgga ttcgattctc ctacagtcgc ttacagtgta 3480 ctggttgtgg ccaaagtgga gaagggaag tctaaaaaac tcaaaagcgt caaggaactg 3540 ctgggcatca caatcatgga gcgatcaagc ttcgaaaaaa accccatcga cttctcgag 3600 gcgaaaggat ataaagaggt caaaaaagac ctcatcatta agcttcccaa gtactctctc 3660 tttgagcttg aaaacggccg gaaacgaatg ctcgctagtg cgggcgagct gcagaaaggt 3720 aacgagctgg cactgccctc taatacgtt aatttcttgt atctggccag ccactatgaa 3780 aagctcaaag ggtctcccga agataatgag cagaagcagc tgttcgtgga acaacacaaa 3840 cactaccttg atgagatcat cgagcaaata agcgaattct ccaaaagagt gatcctcgcc 3900 gacgctaacc tcgataaggt gctttctgct tacaataagc acagggataa gcccatcagg 3960 gagcaggcag aaaacattat ccacttgttt actctgacca acttgggcgc gcctgcagcc 4020 ttcaagtact tcgacaccac catagacaga aagcggtaca cctctacaaa ggaggtcctg 4080 gacgccacac tgattcatca gtcaattacg gggctctatg aaacaagaat cgacctctct 4140 cagctcggtg gagacaagcg tcctgctgct actaagaaag ctggtcaagc taagaaaaag 4200 August 4206 <210> 11 <211> 20 <212> DNA <213> Artificial <220> <223> β‐globin RE2sgRNA1 <400> 11 acccaatgac ctcaggctgt <210> 12 <211> 20 <212> DNA <213> Artificial <220> <223> β‐globin RE2sgRNA2 <400> 12 tcacttgtta gcggcatctg <210> 13 <211> 29 <212> DNA <213> Artificial <220> <223> Cas9‐R780A‐F <400> 13 cagtaggga gccatgaaga ggattgaag <210> 14 <211> 18 <212> DNA <213> Artificial <220> <223> Cas9‐R780A‐R <400> 14 ttcttctgtc ccttctgg <210> 15 <211> 86 <212> DNA <213> Artificial <220> <223> Hiseq‐RRM‐1F3 <400> 15 60. aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctat atggcatcct agccttaga aactag <210> 16 <211> 81 <212> DNA <213> Artificial <220> <223> Hiseq‐RRM‐1R2 <400> 16 60. aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctta cgacgcagga gccgtatcat g <210> 17 <211> 89 <212> DNA <213> Artificial <220> <223> Hiseq‐RRM‐3F2 <400> 17 60. caagcagaag acggcatacg agataagcta gtgactggag ttcagacgtg tgctcttccg atctatagca atgaaatctt gaaggagtg <210> 18 <211> 85 <212> DNA <213> Artificial <220> <223> Hiseq‐RRM‐3R2 <400> 18 60. caagcagaag acggcatacg agattcaagt gtgactggag ttcagacgtg tgctcttccg atctgcacag ccctgctcta ttacg <210> 19 <211> 21 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA1 <400> 19 gattgttgtt gccttggagt g <210> 20 <211> 21 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA2 <400> 20 gctggtcccc tggtaacctg g <210> 21 <211> 24 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA1F <400> 21 accgattgtt gttgccttgg agtg <210> 22 <211> 24 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA1R <400> 22 aaaccactcc aaggcacaa caat <210> 23 <211> 24 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA2F <400> 23 accgctggtc ccctggtaac ctgg <210> 24 <211> 24 <212> DNA <213> Artificial <220> <223> β‐globin RE1sgRNA2R <400> 24 aaacccaggt taccagggga ccag 24 <210> 25 <211> 81 <212> DNA <213> Artificial <220> <223> Hiseq‐hSTM‐aF1 <400> 25 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60 cttagagcca ggactaattg c 81 <210> 26 <211> 83 <212> DNA <213> Artificial <220> <223> Hiseq‐hSTM‐aR2 <400> 26 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60 ggtgtagaaa tgagcaaata agt 83 <210> 27 <211> 91 <212> DNA <213> Artificial <220> <223> Hiseq‐hSTM‐2F <400> 27 caagcagaag acggcatacg agatgatcgt gtgactggag ttcagacgtg tgctcttccg 60 atctagattg agttctgttt gttcatcta c 91 <210> 28 <211> 85 <212> DNA <213> Artificial <220> <223> Hiseq‐hSTM‐2R <400> 28 caagcagaag acggcatacg agatagtca gtgactggag ttcagacgtg tgctcttccg 60 atctcagctc tgcctgaaag gagtc 85
Claims
1. A method for multi-site editing of genomic DNA fragments, utilizing the CRISPR / Cas9 system, employing the Cas9 nuclease as shown in SEQ ID NO.9 to cleave the DNA double strand to generate protruding break ends, and through the cell's own repair system, adding complementary bases to the protruding break ends in a ligation manner to achieve precise editing by adding specific bases at specific locations on the genomic DNA fragment. The multi-site editing involves two editing sites and uses only two sgRNAs. Compared with wild-type Cas9 nuclease, the Cas9 nuclease produces a different ratio of protruding break ends to blunt break ends when cleaving the target genomic DNA fragment.
2. The method of claim 1, wherein, The wild-type Cas9 nuclease is SpCas9.
3. The method of claim 2, wherein, The amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID NO.
7.
4. A method for single-site editing of genomic DNA fragments, utilizing a CRISPR / Cas9 system, employing a Cas9 nuclease as shown in SEQ ID NO. 9 to cut the DNA double strand to generate protruding break ends, and adding complementary bases to the protruding break ends through the cell's own repair system in a ligation manner, wherein the number of editing sites in the single-site editing is one, and only one sgRNA is used, and the ratio of protruding break ends to blunt break ends generated when the Cas9 nuclease cuts the target genomic DNA fragment is different compared to that of wild-type Cas9 nuclease.
5. The method of claim 4, wherein, The wild-type Cas9 nuclease is SpCas9.
6. The method of claim 5, wherein, The amino acid sequence of the wild-type Cas9 nuclease is shown in SEQ ID NO.7.
Citation Information
Patent Citations
Cas9 variants and methods of use thereof
WO2016196655A1