Methods for detecting lentivirus

Abstract

The present disclosure is based on methods for detecting and quantifying lentiviral (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in biological samples.

Description

[0001] Related application data

[0002] This application claims priority to Australian Patent Application No. 2016903599, entitled “Methods for detecting lentiviruses”, filed on September 7, 2016. The entire contents of this patent application are hereby incorporated by reference.

[0003] Sequence Listing

[0004] This application is submitted together with a sequence listing in electronic format. The entire contents of the sequence listing are hereby incorporated by reference.

[0005] Public domain

[0006] The present disclosure is based on methods for detecting and quantifying lentiviral (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in biological samples.

[0007] background

[0008] Human immunodeficiency virus (HIV) is a slow virus that causes HIV infection and over time is the causative agent of acquired immunodeficiency syndrome (AIDS). HIV belongs to the Retroviridae family of viruses, and two types of HIV have been characterized: HIV-1 and HIV-2. HIV-1 is a more virulent and therefore more contagious virus and is responsible for most infections worldwide.

[0009] HIV is transmitted as a single-stranded, positive-sense, enveloped RNA virus (ssRNA). HIV's primary target is CD4 + T cells, macrophages and dendritic cells. HIV virus particles are adsorbed to receptors on target cells through glycoproteins on their surfaces, and then the viral envelope fuses with the cell membrane, and the HIV capsid is released into the cell, thereby entering the target cell. Once entering the target cell, the nucleocapsid containing the viral genome dissociates, releasing the contents of the virus, including ssRNA, into the cytoplasm. The viral RNA genome is reverse transcribed into double-stranded DNA by the virally encoded reverse transcriptase (RT). The generated viral DNA is then imported into the nucleus and integrated into the cellular DNA by the virally encoded integrase.

[0010] The integrated HIV DNA is flanked by identical 5' and 3' long terminal repeat (LTR) sequences from which HIV can initiate transcription of the integrated HIV genome. The integrated viral DNA may remain dormant, in the latent stage of HIV infection, or the viral DNA may be transcribed, producing new RNA genomes and viral proteins that are packaged and released from the cell as new viral particles.

[0011] The main test for detecting HIV is an enzyme-linked immunosorbent assay (ELISA) that detects antibodies to HIV-1. If a positive test result is received, a western blot test is usually performed to confirm the diagnosis.

[0012] Treatment of HIV infection consists of combined antiretroviral therapy (cART), which works to suppress HIV replication. The primary goal of cART is to suppress plasma viral load to undetectable levels (<50 copies per milliliter) while maintaining immune system function and preventing opportunistic infections. Plasma viral load (pVL) monitoring is currently the most important predictor of response to cART treatment. Levels above 200 copies per milliliter are considered virological failure. Although cART reduces the extent of infection, residual virus forms a viral reservoir that resides in long-lived resting T cells and tissue-based macrophages. In the vast majority of patients, pVL levels rebound rapidly after ART is stopped, usually within a few weeks. There is currently no reliable assay to monitor and evaluate treatment outcomes of ART used in HIV-infected patients. Although pVL and CD4 + Cell counts still play an important role in patient care, but these markers are not sensitive enough to monitor activated HIV infection.

[0013] Therefore, there is a need in the art to develop more sensitive assays that can detect and quantify HIV DNA and RNA, particularly HIV transcripts in latently infected reservoirs, to guide improvements in antiretroviral therapy.

[0014] Public Overview

[0015] The present disclosure is based on a method for detecting and quantifying lentiviral (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in biological samples. In particular, the present disclosure is based on such a discovery that when both HIV DNA and HIV RNA are detected, a more sensitive detection of lentiviral infection in HIV-infected subjects is obtained. The inventors have developed a PCR-based assay that provides a more sensitive detection of HIV-1 or HIV-2 DNA and RNA compared to prior art methods. In addition, the inventors have developed a PCR-based method for detecting and quantifying HIV DNA and RNA, where existing assays cannot detect HIV DNA or RNA.

[0016] Current methods for detecting and quantifying HIV in diagnostic laboratories rely on measuring HIV plasma viral load (VL) (the number of HIV RNA copies in plasma). This assay quantifies the number of HIV RNA copies in a patient's plasma to assess the efficacy of antiretroviral therapy (ART) in treating infected patients. This classical marker of pVL still plays an important role, but the assay is not sensitive enough to adequately identify patients who are receiving optimal antiretroviral therapy (ART) and are therefore prone to relapse.

[0017] The present disclosure advantageously provides a highly specific and sensitive method for amplifying the R region within the long terminal repeat (LTR) of a lentiviral genome (e.g., HIV genome). The 5'LTR and 3'LTR regions are composed of three subregions, i.e., U3, R, and U5, and both the 5'LTR and 3'LTR are present when the virus is integrated into the host cell genome. In particular, the inventors have found that the prior art strategies that focus on targeting 3'LTR, pol, or gag are less sensitive than R region detection, because 3'LTR, pol, or gag are present only as a single copy in the viral genome, while the R region is present as two copies in the transcribed viral mRNA and the viral HIV DNA integrated in the human genome. Therefore, the method of the present disclosure is based on R region detection in both RNA and DNA of HIV-1 or HIV-2 in a subject suffering from or suspected of having HIV infection. Therefore, the present method provides clinicians with HIV DNA levels in subjects and reservoir cells (usually CD4 + Knowledge of HIV transcript levels (RNA) in T cells and monocytes / macrophages) is needed to more accurately guide appropriate treatment with antiretroviral therapy.

[0018] The present disclosure provides a method for detecting human immunodeficiency virus (HIV) in a subject having HIV or a subject suspected of having HIV infection (acquired immunodeficiency syndrome, AIDS), the method comprising PCR amplification of R region nucleic acid in a biological sample obtained from the subject, wherein the amplification comprises a forward primer and a reverse primer that hybridize to sequences within the R region of the long terminal repeat (LTR) of HIV, and subsequently detecting any amplification, wherein detection of amplification indicates the presence of HIV in the subject.

[0019] Preferably, detection amplification is performed using a labeled oligonucleotide probe that hybridizes to a sequence within the R region sequence being amplified.

[0020] In one example, the nucleic acid is DNA or reverse transcribed RNA.

[0021] In one example, the HIV is HIV-1 or HIV-2.

[0022] In one example, the PCR amplification is real-time PCR or end-point PCR. In another example, the PCR amplification is real-time quantitative PCR.

[0023] In one example, the detection method further comprises a labeled oligonucleotide probe. In another example, the oligonucleotide probe binds to a sequence within the R region of the long terminal repeat (LTR) of HIV. In another example, the oligonucleotide probe is a hydrolysis probe. In another example, the probe is Probe. In another example, the oligonucleotide probe is a fluorescently labeled hybridization probe. In certain examples, the probe may comprise one or more locked nucleic acids.

[0024] In one example, the method further comprises:

[0025] (i) obtaining an aliquot of a sample from which DNA (or reverse transcribed RNA) has been extracted;

[0026] (ii) contacting an aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0027] (iii) contacting the aliquot with a forward primer and a reverse primer that hybridize to a sequence within the R region sequence;

[0028] (iv) Amplification of the R region sequence by PCR.

[0029] The present disclosure also provides a method for quantifying HIV DNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0030] (i) amplifying and detecting HIV-R region sequences as described herein; and

[0031] (ii) quantifying the amplified HIV-R region sequence by reference to the corresponding HIV plasmid standard to obtain the number of HIV-R region copies per volume of HIV DNA in the sample.

[0032] In one example, the amplification is real-time PCR. In another example, the amplification is end-point PCR.

[0033] In one example, the method further comprises normalizing the HIV DNA copy number to a DNA standard to obtain the HIV DNA copy number per one or more cells in the biological sample.

[0034] The present disclosure also provides a method for quantifying HIV DNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection by normalizing to a standard, the method comprising:

[0035] (i) amplifying and detecting HIV-R region sequences as described herein;

[0036] (ii) quantifying the number of HIV-R region copies per volume of DNA in the sample by quantitative PCR by reference to the corresponding HIV standards;

[0037] (iii) quantifying the endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the number of copies of the housekeeping gene per volume of DNA present in the sample;

[0038] (iv) dividing the copy number obtained by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the sample; and

[0039] (v) Calculate the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0040] In one example, the DNA standard is actin.

[0041] In one example, the quantitative PCR is real-time PCR.

[0042] In another example, HIV DNA copy number is expressed as HIV R region copy number / 10 6 cell.

[0043] Alternatively, quantification of HIV DNA copy number in a sample can be obtained by measuring the absorbance of the DNA in the sample.

[0044] The present disclosure also provides a method for quantifying HIV DNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0045] (i) amplifying and detecting HIV-R region sequences as described herein;

[0046] (ii) quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of the DNA in the sample;

[0047] (iii) calculating the number of cells per volume of DNA in the sample based on DNA absorbance; and

[0048] (iv) Calculate the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0049] In one example, the method of quantifying the mass of DNA per volume in a sample optionally includes adding a DNA intercalating dye and measuring the fluorescence emitted by the dye. In one example, the DNA intercalating dye is selected from SyBr Green I, Syto-9, Syto-10-14, Syto-16, Syto-21, Syto-24, Syto-29, YoYo-1, YoYo-3 and ToTo-1.

[0050] In one example, HIV DNA copy number is expressed as HIV R region copy number / 10 6 cells.

[0051] In one embodiment, the method described herein may further include

[0052] (i) obtaining an aliquot from which a DNA sample has been extracted;

[0053] (ii) contacting an aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0054] (iii) contacting the aliquot with a forward primer and a reverse primer that hybridize to a sequence within the R region sequence;

[0055] (iv) amplifying the R region sequence by PCR;

[0056] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of serial dilutions of HIV standards to derive the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0057] In one example, the PCR is real-time PCR or end-point PCR.

[0058] In one example, the oligonucleotide is a hydrolysis oligonucleotide probe (e.g. In one example, the oligonucleotide is a fluorescently labeled hybridization probe.

[0059] In one example, the forward primer and the reverse primer bind to the R region sequence upstream and downstream, respectively, of the R region sequence to which the oligonucleotide binds.

[0060] In some instances, PCR amplification is performed by endpoint PCR. In one instance, a forward primer or a reverse primer is labeled. In one instance, a forward primer or a reverse primer is labeled (e.g., with biotin). In one instance, an oligonucleotide probe is labeled with digoxin (Dig).

[0061] In one example, the forward primer comprises or consists of a sequence according to SEQ ID NO:29, SEQ ID NO:33 or SEQ ID NO:35.

[0062] In one example, the reverse primer comprises or consists of a sequence according to SEQ ID NO:30, SEQ ID NO:34 or SEQ ID NO:36.

[0063] In one example, the labeled probe comprises or consists of a sequence according to SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, or SEQ ID NO:51.

[0064] The method for quantitative DNA described herein can be used to monitor antiretroviral therapy (ART) being administered to HIV-positive subjects. Therefore, the present disclosure also provides a method for monitoring antiretroviral therapy (ART) being administered to HIV-positive subjects, the method comprising quantifying HIV DNA copy number as described herein at at least two time points, and comparing the HIV DNA copy number difference between at least two time points, wherein the reduction of HIV DNA copy number indicates that the subject is receiving optimal / effective ART.

[0065] Biological samples can be obtained at multiple time points in the subject's life, including but not limited to three, four, five, six, eight, ten, twelve, fifteen, twenty, twenty-five, thirty, thirty-five, forty, etc. times. In another example, the time period between at least two time points is days, weeks, or months. In another example, the time period between at least two time points is 1 week, 2 weeks, 1 month, 3 months, 4 months, 6 months, 8 months, or 12 months.

[0066] In another example, a reduction of at least 50%, at least 45%, at least 40%, at least 35%, at least 30%, at least 25%, at least 20%, at least 15%, at least 12%, at least 10%, at least 8%, or at least 5% between time points indicates that the subject is receiving optimal / effective ART.

[0067] In another example, every 10 6 A count of about 800 or fewer HIV DNA copies per cell indicates that the subject is receiving optimal / effective ART. 6 An HIV DNA copy number of about 80 or fewer, or about 8 or fewer copies of HIV R region DNA in each cell, indicates that the subject is receiving optimal / effective ART.

[0068] In another example, the method includes adjusting the dose or type of ART administered to the subject. For example, adjusting the type of ART may include substituting one antiretroviral drug for another in a combination therapy, or substituting a combination therapy for another combination therapy.

[0069] The present disclosure also provides a method for quantifying HIV RNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0070] (i) amplifying and detecting HIV-R region sequences on reverse transcribed HIV RNA R region sequences as described herein; and

[0071] (ii) The amplified HIV-R region sequence is quantified by reference to the corresponding HIV plasmid standard to obtain the number of HIV RNA copies per sample volume.

[0072] In one example, the amplification is real-time PCR or end-point PCR.

[0073] In one example, the method further comprises normalizing the HIV RNA copy number to an RNA standard to obtain the HIV RNA copy number per one or more cells in the biological sample.

[0074] The present disclosure also provides a method for quantifying HIV RNA copy number (i.e., transcriptional activity) in a biological sample from a subject with HIV or a subject suspected of having HIV infection by normalizing to a standard, the method comprising:

[0075] (i) amplifying and detecting HIV-R region sequences on reverse transcribed HIV RNA R region sequences as described herein;

[0076] (ii) quantifying the number of HIV-R region copies per volume of RNA in the sample by quantitative PCR by reference to the corresponding HIV standards;

[0077] (iii) quantifying the endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the number of copies of the housekeeping gene per volume of RNA present in the sample;

[0078] (iv) dividing the copy number obtained by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the sample; and

[0079] (v) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0080] In one example, the RNA standard is GAPDH.

[0081] In one example, the method further comprises obtaining a biological sample from the subject and preparing RNA from the sample.

[0082] In one example, HIV RNA copy number is expressed as HIV R region copy number / 10 6 cells.

[0083] In another example, the housekeeping standard is amplified by real-time PCR. In another example, the housekeeping standard is identical to the endogenous gene. Methods for generating a standard curve based on serial dilutions of an amplified standard are known to those skilled in the art. For example, the housekeeping standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 copies / μl.

[0084] Alternatively, methods for quantifying RNA in a sample are based on measuring the absorbance of the RNA in the sample.

[0085] The present disclosure also provides a method for quantifying HIV RNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0086] (i) amplifying and detecting HIV-R region sequences on reverse transcribed HIV RNA R region sequences as described herein;

[0087] (ii) quantifying the mass of RNA per volume (w / v) in the sample by measuring the absorbance of the RNA in the sample;

[0088] (iii) calculating the number of cells per volume of RNA in the sample based on RNA absorbance; and

[0089] (iv) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0090] In one example, quantifying the mass of RNA per volume in a sample includes an RNA intercalating dye and measuring fluorescence emitted by the dye.

[0091] In one example, RNA copy number is expressed as HIV-R region copy number / 10 6 cells.

[0092] In another example, the method of quantifying the mass of RNA per volume in a sample includes adding an RNA intercalating dye and measuring the fluorescence emitted by the dye. In one example, the RNA intercalating dye is selected from SyBr Green II, Syto RNA select green-fluorescent and ToTo-1.

[0093] Those skilled in the art will appreciate that methods for quantifying the mass of DNA or RNA per volume in a sample are known in the art. For example, such methods include, but are not limited to, Qubit (Thermo Fisher), Nanodrop (Thermo Fisher), and QuantideX (Asuragen).

[0094] In one example, the HIV-R region is quantified by:

[0095] (i) obtaining an aliquot of the sample from which RNA has been extracted;

[0096] (ii) contacting an aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0097] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region of the reverse transcribed HIV RNA (cDNA);

[0098] (iv) amplifying the R region sequence by PCR;

[0099] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of serial dilutions of HIV standards to derive the number of HIV-R region RNA copies per volume of RNA in the aliquot.

[0100] In one example, the forward primer and the reverse primer bind to the R region sequence upstream and downstream, respectively, of the R region sequence to which the oligonucleotide binds.

[0101] In one example, the method further comprises obtaining a biological sample from a subject and preparing RNA from the sample. In one example, the housekeeping standard is amplified by real-time PCR. In another example, the housekeeping standard is identical to the endogenous gene.

[0102] The present disclosure also provides a method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0103] (i) quantifying HIV-R region DNA copy number as described herein;

[0104] (ii) quantifying HIV-R region RNA copy number as described herein;

[0105] (iii) determining a normalized HIV RNA copy number in a sample obtained from the subject by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0106] (iv) comparing the normalized HIV RNA copy number value to one or more previous normalized values ​​obtained from the same subject;

[0107] A reduction in normalized HIV RNA copy number indicates that the subject is receiving optimal / effective ART.

[0108] In one example, quantifying HIV-R region DNA or RNA copy number is according to methods described herein or known in the art.

[0109] In one example, the method further comprises obtaining a biological sample from the subject and preparing DNA and RNA from the sample.

[0110] The HIV DNA copy number or HIV RNA copy number described herein can be expressed as per 1,000,000 cells (10 6 The number of copies is the number of copies / 10 6 In one example, HIV RNA copy number is expressed as a value for any fixed number of cells, including but not limited to 1.5×10 6 , 2×10 6 , 2.5×10 6 or 3×10 6 cell.

[0111] In one example, the volume is expressed as μl or ml.

[0112] The above method is preferably performed in a polymerase chain reaction (PCR) tube.

[0113] The biological sample may be a cell population selected from blood or tissue or any other biological fluid in which lentiviral infected cells are present. The biological sample may be whole blood, plasma or peripheral blood mononuclear cells (PBMC), or CD4 enriched + Sorting samples of T cells and monocytes / macrophages, or using magnetic beads to enrich for cell population subsets (e.g., CD4 + In one embodiment, the biological sample is obtained from a subject. In one embodiment, the subject is a human or a primate.

[0114] Those skilled in the art will appreciate that the R region of the sequence within the 5'LTR and 3'LTR of the lentiviral / HIV nucleic acid will be amplified by the aforementioned method. In one example, the R region sequence amplified is a sequence contained in a sequence consisting of the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In one example, the R region sequence consists of the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0115] In another example, the housekeeping standard may be selected from the group consisting of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta actin (beta actin), beta-2 microglobulin (B2M), peptidylprolyl isomerase A (PPIA), eukaryotic translation elongation factor 1γ (EEF1γ), succinate dehydrogenase complex subunit A (SDHA), hydroxymethyl-dioxane synthase (HMBS), 18s ribosomal RNA (18s rRNA) and phosphoglycerate kinase 1 (PGK 1).

[0116] In one example, the housekeeping gene and housekeeping standard for HIV DNA is β-actin. In another example, the housekeeping gene and housekeeping standard for HIV RNA is GAPDH.

[0117] In one example, the number of cells in a sample is determined by measuring the mass of the DNA after DNA extraction. In another example, the mass of the DNA is estimated by the absorbance at 260 nm by a spectrophotometer. In one example, the number of cells in a sample is determined by measuring the mass of the RNA after RNA extraction. In another example, the amount of RNA is estimated by the absorbance at 260 nm by a spectrophotometer.

[0118] In one example, the number of cells in a sample is determined by measuring the quality of the DNA after DNA extraction. In another example, the quality of the DNA is estimated by measuring the fluorescence emitted by a DNA intercalating dye; in one example, the number of cells in a sample is determined by measuring the quality of the RNA after RNA extraction. In another example, the amount of RNA is estimated by measuring the fluorescence emitted by an RNA intercalating dye.

[0119] In one embodiment, the labeled oligonucleotide or hydrolyzed oligonucleotide is Probe. The probe comprises a fluorophore covalently attached to the 5' end of the oligonucleotide probe and a quencher at the 3' end for real-time PCR quantification. In one example, the fluorophore is selected from the group consisting of hydroxycoumarin, methoxycoumarin, Alexa fluor, aminocoumarin, Cy2, Alexa fluor 488, 430, 532, 546, 555, 594, 633, 660, 680FITC, TRITC, PE, LC Cyan500, FAM, TET, JOE, Yakima Yellow, HEX, Cy3, TAMARA, ROX, Texas Red, LC Red610, LC Red640, Cy5, Cy5.5, Cy7 and IRD700. In one example, the quencher is selected from the group consisting of BHQ-1, BHQ-2, IBRQ, IBFQ. In one example, the probe is a double quencher. In another example, the probe is a dual quencher comprising ZEN in combination with IBRQ, IBFQ quenchers. TM Internal Quencher.

[0120] In one example, according to any of the methods described herein, the oligonucleotide binds to a sequence comprising or consisting of about 13 to 40 consecutive nucleotides located in the HIV-1 R region sequence set forth in SEQ ID NO: 1, or a sequence at least 70% identical to said sequence. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 1.

[0121] In one example, according to any of the methods described herein, the oligonucleotide binds to a sequence comprising or consisting of the sequence 5'TAAGCAGTGGGTTCCCT 3' (SEQ ID NO: 3) or a sequence at least 70% identical thereto. In another example, the oligonucleotide binds to a sequence at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence set forth in SEQ ID NO: 3.

[0122] In another example, the oligonucleotide comprises the sequence 5'AGGGAACCCACTGCTTA 3' (SEQ ID NO: 4) or consists of the sequence 5'AGGGAACCCACTGCTTA 3' (SEQ ID NO: 4). In another example, the oligonucleotide comprises the sequence X-AGGGAACCCACTGCTTA-Z (SEQ ID NO: 5) or consists of the sequence X-AGGGAACCCACTGCTTA-Z (SEQ ID NO: 5), wherein X is a reporter molecule, Z is a quencher molecule, and the sequence optionally comprises at least one locked nucleic acid (LNA). In another example, X is FAM (carboxyfluorescein) and Z is BHQ-1. In another example, the oligonucleotide comprises between 1 and 6 LNAs, between 2 and 5 LNAs, or between 2 and 4 LNAs. In another example, the oligonucleotide comprises the sequence FAM-AGG LNA GA LNA AC LNA CCAC LNA TG LNA CTTA-BHQ-1 (SEQ ID NO: 6) or the sequence FAM-AGG LNA GA LNA AC LNA CCAC LNA TG LNA CTTA-BHQ-1 (SEQ ID NO: 6), wherein X is a reporter molecule, Z is a quencher molecule, and LNA is a locked nucleic acid. For clarity, the locked nucleic acid is referred to herein as N LNA , wherein N is an A, T, C or G nucleobase as indicated.

[0123] Those skilled in the art will appreciate that LNA modification is not limited to the above positions and that the number of positions for LNA modification will be determined to increase specificity and reduce background in real-time PCR assays.

[0124] In one example, the HIV-1 forward primer comprises or consists of the sequence 5'GAGCCTGGGAGCTCTCTG 3' (SEQ ID NO: 7), or a sequence at least 75% identical thereto. In another example, the forward primer comprises or consists of a sequence at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 7.

[0125] In one example, the forward primer hybridizes to a sequence comprising or consisting of a sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO: 8) or a sequence at least 75% identical thereto. In another example, the forward primer hybridizes to a sequence comprising or consisting of a sequence comprising at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 8.

[0126] In one example, the reverse primer comprises or consists of a sequence 5'ACTCAAGGCAAGCTTTATTGAGGC 3' (SEQ ID NO: 9) that is at least 75% identical thereto. In another example, the reverse primer comprises or consists of a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 9.

[0127] In one example, the reverse primer hybridizes to an HIV-1 R region sequence comprising or consisting of the sequence 5'GCCTCAATAAAGCTTGCCTTGAGT 3' (SEQ ID NO: 10) or a sequence at least 75% identical thereto. In another example, the reverse primer comprises or consists of a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 10.

[0128] In another example, the forward primer comprises or consists of the sequence 5'GAGCCTGGGAGCTCTCTG 3' (SEQ ID NO: 7), and the reverse primer comprises or consists of the sequence 5'ACTCAAGGCAAGCTTTATTGAGGC 3' (SEQ ID NO: 9).

[0129] In another example, the oligonucleotide binds to a sequence that comprises or consists of about 13 to 40 consecutive nucleotides located within the HIV-2R region sequence set forth in SEQ ID NO: 2 or a sequence that is at least 70% identical to the consecutive nucleotides. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 2.

[0130] In another example, the oligonucleotide binds to a sequence comprising or consisting of the sequence 5'GCCTGGGTGTTCCCTGCTAGACTCT 3' (SEQ ID NO: 11) or a sequence at least 70% identical thereto. In another example, the oligonucleotide binds to a sequence at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence set forth in SEQ ID NO: 11.

[0131] In another example, the oligonucleotide comprises the sequence 5'AGAGTCTAGCAGGGAACACCCAGGC 3' (SEQ ID NO: 12), or consists of it. In another example, the oligonucleotide comprises the sequence X-GCCTGGGTGTTCCCTGCTAGACTCT-Z (SEQ ID NO: 13) or consists of it, wherein X is a reporter molecule and Z is a quencher molecule. In another example, X is FAM (carboxyfluorescein), and Z is BHQ-1.

[0132] In one example, the HIV-2 forward primer comprises or consists of or is a sequence of SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35 or a sequence at least 75% identical thereto. In another example, the forward primer comprises or consists of a sequence at least 75%, at least 80%, at least 82%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35.

[0133] In one example, the forward primer hybridizes to a sequence comprising or consisting of a sequence 5'-GAGAACCTCCCAGGGCTC-3' (SEQ ID NO: 15) or a sequence at least 75% identical thereto, or a sequence of the HIV-2R region that is at least 75% identical thereto. In another example, the forward primer hybridizes to a sequence comprising or consisting of a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence set forth in SEQ ID NO: 15.

[0134] In one example, the HIV-2 reverse primer comprises or consists of a sequence that is at least 75% identical to the sequence of SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34, or SEQ ID NO: 36. In another example, the reverse primer comprises or consists of a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34, or SEQ ID NO: 36.

[0135] In another example, the forward primer comprises or consists of SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35, and the reverse primer comprises or consists of SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34 and SEQ ID NO: 36.

[0136] The present disclosure provides a composition for amplifying HIV-1 nucleic acid, the composition comprising a labeled oligonucleotide probe, the labeled oligonucleotide probe comprising or consisting of a combination of a probe, a forward primer and a reverse primer, the combination being selected from one or more of the following combinations:

[0137] (i) oligonucleotide probe: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48;

[0138] (ii) forward primer: SEQ ID NO: 7 or SEQ ID NO: 29; and

[0139] (iii) Reverse primer: SEQ ID NO: 9 or SEQ ID NO: 30.

[0140] The present invention also provides a composition for amplifying HIV-2 nucleic acid, comprising a labeled oligonucleotide, the labeled oligonucleotide comprising or consisting of a combination of a probe, a forward primer and a reverse primer, the combination being selected from one or more of the following combinations:

[0141] (i) Oligonucleotide probe: SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53;

[0142] (ii) forward primer: SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33, or SEQ ID NO: 35;

[0143] (iii) Reverse primer: SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34 or SEQ ID NO: 36.

[0144] The present disclosure also provides a method for identifying a subject in need of antiretroviral therapy (ART) and / or in need of adjustment of ART dosage, the method comprising performing one or more methods described herein.

[0145] The present disclosure also provides methods of treating HIV-positive subjects, the methods comprising detecting or quantifying lentiviral nucleic acid or HIV DNA and / or RNA according to one or more methods described herein, and administering ART to the subject.

[0146] Method described herein can be used to determine whether a subject suspected of being HIV positive by serology suffers from HIV-1 or HIV-2. In one example, this can be carried out in a reaction tube by using different fluorescently labeled oligonucleotides. Then, the detectable signal sent from the labeled oligonucleotide can be associated with the existence of HIV-1 or HIV-2. For example, the existence of HIV-1 can be detected by yellow fluorescence, and the existence of HIV-2 can be detected by red fluorescence.

[0147] In another example, the GAPDH oligonucleotide comprises the sequence X-AAGGTCGGAGTCAACGGATTTGGTCGT-Z (SEQ ID NO: 17) or a composition thereof, wherein X is a reporter molecule and Z is a quencher molecule. In one example, X is FAM and Z is BHQ-1.

[0148] In another example, the forward primer and the reverse GAPDH primer comprise or consist of the following sequences: 5'GGCAACAATATCCACTTTACCAG 3' (SEQ ID NO: 18) and 5'TCGACAGTCAGCCGCATCTT 3' (SEQ ID NO: 19), respectively.

[0149] In another example, the β-actin oligonucleotide comprises or consists of the sequence X-ATGCCCTCCCCCATGCCATCCTGCG-Z (SEQ ID NO: 20), wherein X is a reporter molecule and Z is a quencher molecule. In one example, X is FAM and Z is BHQ-1.

[0150] In another example, the forward primer and the reverse β-actin primer comprise or consist of the sequence 5'TCACCCACACTGTGCCCATCTACGA 3' (SEQ ID NO: 21) and 5'CAGCGGAACCGCTCATTGCCAATGG 3' (SEQ ID NO: 22), respectively.

[0151] In another example, the 3' LTR oligonucleotide comprises or consists of the sequence 5' FAM-TTAGACCAGATCTGAGCCTGGGAGCTCTC-BHQ-13' (SEQ ID NO: 25).

[0152] In another example, the forward primer and the reverse 3'LTR primer each comprise or consist of the sequence 5'CCAAAGAAGACAAGATATCCTTGA 3' (SEQ ID NO: 23).

[0153] In another example, the gag oligonucleotide comprises or consists of the sequence 5′-FAM-ATCLNAALNAATGLNAAGGAAGLNACTGLNAC-BHQ-1 3′ (SEQ ID NO: 28).

[0154] In another example, the forward primer and the reverse gag primer comprise or consist of the sequence 5'AGTGGGGGGACATCAAGCAGCCATGCAAAT3' (SEQ ID NO: 26) and 5'TACTAGTAGTTCCTGCTATGTCACTTCC 3' (SEQ ID NO: 27), respectively.

[0155] The present disclosure also provides a kit for detecting HIV-1, the kit comprising a composition as described herein, and suitable reagents and instructions for detecting and quantifying HIV-1 according to the methods described herein. In one example, the kit further comprises a beta actin oligonucleotide according to SEQ ID NO: 20 and a forward primer and a reverse primer according to SEQ ID NO: 21 and 22, respectively. In another example, the kit further comprises a composition comprising a GAPDH oligonucleotide according to SEQ ID No: 17 and a forward primer and a reverse primer according to SEQ ID NO: 18 and 19.

[0156] The present disclosure also provides a kit for detecting HIV-2, the kit comprising the composition described herein, and suitable reagents and instructions for detecting and quantifying HIV-2 according to the methods described herein. In one example, the kit further comprises a beta actin oligonucleotide according to SEQ ID NO: 20 and a forward primer and a reverse primer according to SEQ ID NO: 21 and 22, respectively. In another example, the kit further comprises a composition comprising a GAPDH oligonucleotide according to SEQ ID NO: 17 and a forward primer and a reverse primer according to SEQ ID NO: 18 and 19.

[0157] In one example, the PCR amplification is 40 cycles. In another example, the PCR amplification is 50 cycles.

[0158] In one example, the steps of the method are performed sequentially. BRIEF DESCRIPTION OF THE DRAWINGS

[0160] Figure 1 The genome structure of HIV-1 is shown.

[0161] Figure 2 The genome structure of HIV-2 is shown.

[0162] Figure 3-1 The positions of PCR primers and oligonucleotide probes targeting the HIV-1 R region sequence are shown (A). The R region of the HIV-1 sequence is 95 bases long. Figure 3-1 B. Figure 3-2 Figures C and D show the positions of the PCR primer and oligonucleotide probe combinations for HIV-2 R region sequences exemplified herein. The R region of the HIV-2 sequence is 174 bases long. Locked nucleic acid modifications are introduced into some oligonucleotide probes to increase the annealing temperature of the probes.

[0163] Figure 4 Show the comparison of oligonucleotide probe (HIV-1 probe 1) and HIV-1 subtype sequence.Shading represents the position of sequence conservation to provide effective PCR between HIV-1 subtype.HIV sequence is obtained from Los Alamos National Laboratory-HIV Sequence Consortium 2013 database (HIV Sequence Compendium 2013Foley B, et al.Published by Theoretical Biology and Biophysics Group, Los Alamos Laboratory NM, LA-UR 13-26007).

[0164] Figure 5 Sequences among HIV-2 subtypes to which HIV-2 probe 1 binds are shown.

[0165] Figure 6 Schematic diagrams of real-time PCR assay (A) and endpoint PCR assay (B) are shown. Real-time PCR assay uses Taqman probe and unlabeled primer set. The endpoint PCR assay in this embodiment uses a biotinylated reverse primer and an unlabeled forward primer and a probe labeled with digoxigenin (Dig). An anti-Dig antibody labeled with peroxidase is added, followed by a chemiluminescent reaction, thereby providing an output in relative luminescence units (RLU).

[0166] Figure 7 It was shown that the plasma viral load assay could not distinguish between optimal ART subjects and suboptimal ART subjects.All 46 subjects (suboptimal ART and optimal ART groups) showed suppressed VL (VL<20 copies / mL) at the time of blood sampling.

[0167] Figure 8Figure 3 shows that intracellular RNA amplification and quantification using GAPDH standards according to the present method distinguished between the "suboptimal ART" (n=18) and "optimal ART" (n=29) subject groups, and the difference was statistically significant (A). Further analysis based on HIV-1 DNA levels defined the "improved optimal ART" group, in which HIV-1 DNA levels were less than 10% of the subjects. 6 800 HIV-1 DNA per cell (B). The difference in HIV-1 RNA transcription activity between "modified optimal ART" (n=6) and "optimal ART" (n=23) was statistically significant (B and C). Patients who experienced "blips" and "immune failure" were classified as suboptimal ART subjects, where blips were defined as at least one transient high pVL (less than 200 copies / mL) within 6 months. Immune failure was defined as pVL <20 copies / ml and CD4 + T cell counts <350 counts / μl, while subjects on optimal ART showed suppressed VL (VL <20 copies / mL) for more than 6 months.

[0168] Fig. 9 Typical VL data of successfully treated patients are shown, and HIV-1 VL rebounds after stopping ART treatment. Four patients who were treated for the first time received ART treatment for a period of one year. During the 24-week treatment period (A, B and D) and during the 12-week treatment period (C), the plasma viral load (pVL, black line with circle) in four patients was below the detection limit. The pVL level remained below the detection level until the 52nd week (one year) of ART treatment. Although the pVL in these four patients was undetectable, low levels of intracellular HIV-1 transcriptional activity (gray column) were detected. After stopping treatment, the VL of 4 patients increased rapidly, and the VL increase was accompanied by an increase in intracellular HIV-1 transcriptional activity. ART = antiretroviral therapy. STI = Stricture Treatment Interruption (STI: stop ART).

[0169] Fig.10 exist Fig. 9 Subjects in entered the second phase of ART treatment. During this second phase of ART, VL was suppressed below detection levels, however, even though VL was below detection levels, there was consistent detection of intracellular HIV-1 transcriptional activity (grey bars). After stopping the second phase of ART treatment, rapid rebound VL was observed in both patients (A and B). ART = antiretroviral therapy. STI = strict treatment interruption (STI: stop ART).

[0170] Fig.11To investigate whether the increase in transcriptional activity originates from cells in the latently infected reservoir, intracellular RNA at w1 (ART) and week 4 after cessation of ART (sw4) is shown as gray circles on the horizontal axis. HIV-1 plasma RNA that rebounded at week 16 after ART was collected and analyzed by Sanger sequencing. The data were analyzed using the neighbor-joining clustering method on the web-based HIV database (http: / / www.hiv.lanl.gov / content / sequence / HIV / HIVTools.html). Samples isolated from the same subject clustered together (gray rectangular boxes), indicating that the latent viral reservoir has persistent HIV transcriptional activity, which contributes to the rebound of plasma viral load.

[0171] Fig.12 PCR analysis and quantification based on TaqMan probes of HIV-2 RNA obtained from plasma samples of two subjects are shown. (A) shows the analysis of HIV-2 copies / ml plasma and HIV-2 standards in the samples. HIV-2 RNA copy number is estimated by the Cp value generated from 7 standards. (B) shows the standard analysis of HIV-2 determination. The Cp value generated by the standards is represented by open circles.

[0172] Fig.13 Intracellular HIV-2 transcription analysis performed in subjects with plasma viral loads below the limit of detection is shown. Despite negative plasma viral load tests, HIV-2 intracellular transcripts (HIV-2 RNA) were detected when normalized to the number of integrated HIV-2 DNA copies.

[0173] Fig.14 Plasma viral load (A) analysis performed on 28 subjects is shown. As shown in (A), there was no detectable HIV-1 in the subject plasma. (B) Quantification of HIV-1 DNA in optimal (n=7) and suboptimal (n=21) ART subjects is shown. (C) HIV-1 transcriptional activity (RNA) is shown.

[0174] Fig.15 HIV-1 transcriptional activity (RNA) in improved optimal ART, optimal ART, and suboptimal ART subjects is shown.

[0175] Fig.16 HIV transcription normalized to GAPDH is shown for activated HIV-1 in latent HIV-1 infected cells.

[0176] Fig.17 A standard curve for a 40-cycle endpoint amplification of an HIV-1 DNA standard is shown.

[0177] Sequence Listing

[0178] The following table summarizes the sequences mentioned in this disclosure.

[0179]

[0180]

[0181]

[0182]

[0183]

[0184] Detailed Description

[0185] General Description

[0186] Throughout the specification, references to individual steps, compositions of matter, groups of steps or groups of compositions of matter shall be deemed to include both one and plurality (i.e., one or more) of these steps, compositions of matter, groups of steps or groups of compositions of matter, unless specifically stated otherwise or the context requires otherwise.

[0187] Those skilled in the art will appreciate that, except for those specifically described, the aspects and embodiments described herein are susceptible to changes and modifications. It should be understood that the present disclosure encompasses all such changes and modifications. The present disclosure also encompasses all steps, features, compositions and compounds mentioned or indicated in this specification individually or collectively, and any or all combinations of any two or more of the steps or features.

[0188] The scope of the present disclosure is not to be limited by the specific examples described herein, which are provided for illustrative purposes only. Functionally equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0189] Unless specifically stated otherwise, any example of the present disclosure herein should be considered to be applicable by reference to any other example of the present disclosure.

[0190] Unless specifically defined otherwise, all technical and scientific terms used herein should be interpreted as having the same meanings as commonly understood by one of ordinary skill in the art (eg, in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0191] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in this disclosure are standard procedures well known to those skilled in the art. These techniques are described and explained in the literature, for example, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Humes (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and JE Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0192] The term "and / or", such as "X and / or Y", should be understood to mean "X and Y" or "X or Y", and should be understood to provide clear support for both meanings or just one of them.

[0193] Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of stated elements, integers or steps, or groups of elements, integers or steps, but not the exclusion of any other elements, integers or steps, or groups of elements, integers or steps.

[0194] References to the singular forms "a", "an" and "the" are also to be understood as implying the plural forms as well, unless the context requires otherwise.

[0195] Any description of documents, regulations, materials, designs, articles or the like contained in this specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field of technology relevant to the present invention as it existed before the priority date of each claim of this application.

[0196] Selected Definition

[0197] As used herein, the term "lentivirus" refers to a genus of viruses in the family Retroviridae. Its genome contains two copies of positive-sense ssRNA within a conical capsid. Examples of lentiviruses include humans (HIV), simians (SIV), and felines (FIV).

[0198] As used herein, the term "HIV" or "human immunodeficiency virus" refers to HIV-1 or HIV-2, including various subtypes. Subtypes of HIV-1 include A, B (the most predominant form), C, D, E, F, G, H, J, and K. Subtypes of HIV-2 include A, B, C, F, or G. HIV-1 and HIV-2 are now divided into groups corresponding to phylogenetically related groups or branches (e.g., HIV-1 M, N, O, and P groups). Figure 1 The structures of HIV-1 and HIV-2 are provided.

[0199] As used herein, the term "hydrolyzable oligonucleotide" or "probe" refers to a dual-labeled oligonucleotide in which the 5' end is labeled with a fluorescent reporter molecule and the 3' end is labeled with a quencher molecule. The sequence of the probe is specific to the region of interest in the target molecule to be amplified (i.e. Figure 1The R region in the probe is specific. Usually the probe length is between 20-30 bases. The probe is designed so that the length of the sequence places the 5' fluorophore and 3' quencher close enough to inhibit fluorescence. In the amplification reaction, when the extension reaches the bound hydrolysis probe, the 5'-3' exonuclease activity of the Taq polymerase degrades the probe. The cutting of the probe separates the fluorescent reporter molecule from the rest of the probe, causing the reporter molecule to fluoresce. In subsequent PCR cycles, the amount of fluorescent reporter released and the amount of fluorescence accumulated thereby increase. An example of a hydrolyzed oligonucleotide is Probe.

[0200] The term "identity" and its grammatical variants mean that two or more referenced entities are identical. Therefore, when two sequences are identical, they have the same amino acid sequence at least in the referenced region or portion. When two nucleic acid sequences are identical, they have the same polynucleotide sequence at least in the referenced region or portion. Identity can be on the defined region (region or domain) of the sequence. The % identity of polynucleotides is determined by GAP (Needleman and Wunsch, J.Mol Biol) 48:444-453.1970) analysis (GCG program), wherein the gap creation penalty = 5, and the gap extension penalty = 0.3. Unless otherwise specified, the query sequence length is at least 45 nucleotides, and the GAP analysis compares the two sequences in the region of at least 45 nucleotides. Preferably, the query sequence length is at least 100 nucleotides, and the GAP analysis compares the two sequences in the region of at least 100 nucleotides. Most preferably, the two sequences are compared over their entire length.

[0201] As used herein, the term "viral load or VL" refers to a measurement of the number of viral particles (ie, HIV-1 or HIV-2) or the amount of viral genetic material in an organism, typically the number of viral particles per volume of plasma.

[0202] As used herein, the term "antiretroviral therapy" or "ART" refers to the treatment of HIV-positive subjects with a combination of antiviral drugs that are used to reduce the rate at which HIV multiplies in the body.

[0203] As used herein, the term "optimal / effective ART" refers to subjects whose plasma viral load (pVL) is suppressed for more than 6 months. "Suppressed viral load" means below the limit of detection according to pVL.

[0204] The term "primer" refers to an oligonucleotide capable of serving as a point of initiation of synthesis when placed under conditions under which synthesis of a primer extension product complementary to a nucleic acid strand (template) is initiated.

[0205] The term "suboptimal / subeffective ART" as used herein refers to subjects who have experienced at least one transient blip (BL) or have immune failure (IL). A transient blip refers to a transient increase in viral load, where the viral load rises to between 50 and 100 copies / ml (or approximately <200 copies / mL). Suboptimal ART subjects are those who exhibit one or more transient blips within 6 months. Immune failure is defined as pVL <20 copies / ml, CD4 + T cell count <350 counts / μl. The term "improved optimal ART" as used herein refers to a DNA copy number less than 10 6 Participants with 800 DNA per cell, especially in the optimal ART group.

[0206] The term "real-time PCR" as used herein refers to any method that monitors the amplification of DNA or reverse transcribed RNA in real time during the PCR process, rather than at the end of the PCR as in conventional PCR. Generally, the terms "real-time PCR" and "quantitative PCR" are used interchangeably. Methods for performing real-time PCR are known in the art from the resources described herein. Kits for real-time PCR using TaqMan probes are available from commercial suppliers, such as Thermofisher or Applied Biosystems.

[0207] As used herein, the term "Cp" or "crossing point" refers to the cycle during real-time PCR at which the fluorescence from amplification exceeds the background fluorescence. For example, a lower Cp is associated with a higher target expression level in the sample.

[0208] The term "RNA" as used herein is also intended to encompass mRNA.

[0209] As used herein, the terms "treat," "treating," "treatment," and grammatical variations thereof mean subjecting an individual to a procedure, regimen, process, or therapy in which a physiological response or outcome is desired in that individual. Because every subject treated may not respond to a particular treatment procedure, regimen, process, or therapy, a treatment need not achieve a desired physiological response or outcome in every subject or population of subjects. Thus, a given subject or population of subjects may not respond or respond inadequately to a treatment.

[0210] The term "binds" means that an oligonucleotide reacts to a particular nucleic acid sequence more frequently, more rapidly, longer lastingly, and / or with greater affinity than it reacts to other nucleic acid sequences.

[0211] The term "hybridization" as used herein refers to the formation of a double-stranded nucleic acid from a complementary single-stranded nucleic acid. Hybridization may occur between two substantially matched nucleic acids that are fully matched or have some mismatches. The complementarity of the hybridization may depend on the hybridization conditions, particularly the temperature. Detailed conditions for hybridization can be found in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY (2001) and MLM Anderson, Nucleic acid hybridisation, Springer-Verlag, New York, NY (1999).

[0212] The term "locked nucleic acid" as referred to herein refers to a modified DNA nucleotide wherein the deoxyribose portion of the LNA nucleotide has been modified with an additional bridge linking the 2' oxygen and the 4' carbon.

[0213] The term "PBMC" as used herein refers to any peripheral blood cell with a round nucleus, such as T cells, B cells, NK cells, and monocytes. PBMC also contain progenitor cells. They are usually separated from whole blood using Ficoll or Ficoll-Paque.

[0214] Detection of HIV-1 or HIV-2 in subjects and differentiation of HIV-1 and HIV-2

[0215] Most people living with HIV are receiving antiretroviral therapy (ART). ART treatment can significantly and rapidly reduce plasma viral load (pVL) (the number of HIV RNA copies in plasma) to levels below the limit of detection. ART treatment has significantly improved the morbidity and mortality associated with HIV infection, but ART is not a cure. Despite long-term ART treatment, HIV persists as integrated HIV DNA in many cell types forming long-lived cellular reservoirs. After ART is stopped, pVL levels rebound rapidly, usually within a few weeks in most subjects. There is currently no reliable assay to monitor and evaluate ART treatment outcomes in people infected with HIV (HIV-1 or HIV-2). Generally, pVL and CD4 + T cell counts are used to monitor ART treatment in HIV-infected patients. In most successfully treated subjects, pVL values ​​are below the limit of detection and CD4 + Cell numbers usually remain high. Although these classic markers still play an important role, they are not sensitive enough to monitor active HIV infection.

[0216] Assays based on detecting HIV activity, including proviral DNA, HIV-integrated DNA, 2LTR circles, and ultrasensitive viral load in plasma, suffer from lack of sensitivity and / or the requirement for large sample sizes.

[0217] Currently, the detection of HIV in a subject starts with a first serology-based screening assay ("HIV-1 / 2 antigen / antibody combined immunoassay"), in which a biological sample, usually blood, is tested for HIV antibodies and p24 antigen. If the sample is positive, a second confirmatory assay is performed using a "HIV-1 / HIV-2 antibody discrimination immunoassay". Such tests include Western blot analysis, multiplex analysis or Geenius TM Complementary assay. This test is used to differentiate HIV-1 from HIV-2 in a subject. This test has good sensitivity but not good specificity, so in some cases HIV-positive samples and subjects with unknown HIV-1 / 2 status will be further tested using a nucleic acid test (NAT).

[0218] Roche has developed an HIV-1 DNA confirmation assay (Amplicor HIV-1 DNA PCR Test). However, this assay has now been discontinued and HIV diagnostic algorithms are shifting from HIV-1 DNA testing to HIV-1 RNA testing using large automated machines (Cobas 6800 / 8800 systems, M2000 and Panther systems). The method is based on the simultaneous amplification and detection of two independent regions of the HIV-1 genome for quantification of HIV-1 RNA. The machine is designed to process a large number of samples, but most HIV reference laboratories do not have a large number of samples for confirmation test requests. In addition, it takes at least eight hours to obtain results, and this does not take into account the time associated with shipping samples to facilities with the machine. In many HIV-1 diagnostic laboratories, plasma viral load RNA assays are now used as an alternative to HIV-1 confirmation assays. However, there are some risks in using HIV-1 plasma VL RNA assays as HIV-1 confirmation assays. In the early HIV-1 infection stage, the inventors were unable to detect plasma VL RNA in plasma because HIV-1 plasma RNA levels did not increase in the early HIV-1 infection stage. Plasma LV increases 2-3 weeks after HIV-1 infection. Therefore, the plasma VL HIV-1 RNA assay is not entirely suitable as an HIV-1 confirmatory assay.

[0219] As the trend has shifted towards HIV-1 RNA assays, there is currently no HIV-1 DNA assay for confirmation. In addition, the machine cost and test cost make the Cobas 6800 / 8800 system too expensive for hospital laboratories.

[0220] Although HIV-1 RNA viral load testing is sensitive and reliable, there remains a need in the art for HIV-1 DNA testing due to the increasing prevalence of HIV-2. In addition, there is a need for more sensitive methods to confirm the HIV status of samples that are considered indeterminate HIV-1 / 2 and HIV positive samples by a second serology-based supplemental confirmatory test.

[0221] There is currently no HIV-2 DNA confirmatory assay available. The method described herein provides detection and quantification of HIV-1 and HIV-2 DNA, which can be performed in a much shorter time frame, at a much lower cost, and does not require the sample to be shipped to a suitable facility for testing.

[0222] Due to the current changes in HIV diagnostic strategies, where the focus has shifted to HIV plasma viral load RNA analysis, there remains a great need for confirmatory assays that can distinguish between HIV-1 and HIV-2 infection in subjects. Such assays are particularly important when subjects are assessed as "indeterminate HIV-1 / 2" and "HIV positive" by a second, supplemental serology-based confirmatory test.

[0223] The method for detecting HIV-1 or HIV-2 described herein is based on targeting the R region within the long terminal repeat (LTR) of the lentivirus. In order to develop this assay, the inventors needed to overcome many technical difficulties. First, the length of the R region is relatively short, approximately 95-175 bases long (see SEQ ID NO: 1 and 2 herein). Typically, the PCR primer length of the forward primer and the reverse primer is between 18-25 bases, and the probe length is approximately 20-30 bases. Therefore, only limited sequences are available for oligonucleotide and primer binding. Another problem is the possibility of primer dimer formation. In addition, primers and oligonucleotide probes must be designed to provide reliable and sensitive detection across all HIV subtypes (HIV-1 or HIV-2). For HIV-1, this is, for example, Figure 4 and for HIV-2 Figure 5 Shown in. Figure 4 Alignment of oligonucleotide probes between HIV-1 subtypes A, B, C, D, F, and G is shown. Figure 5 The alignment of the oligonucleotide probes between HIV-2 subtypes A and B is shown. The inventors found that good alignment of the 3' end of the forward primer and the 5' end of the reverse primer is necessary to achieve effective PCR analysis. The inventors also found that the oligonucleotide probes need to perfectly match the HIV-1 sequence at the 3' and 5' ends of the probe sequence to achieve effective PCR. The inventors successfully overcame the limitations of short sequences and multi-subtype sequence variations and designed a quantitative real-time PCR assay that can detect the R region of HIV lentivirus.

[0224] Detection of HIV in subjects

[0225] The present disclosure provides a method for detecting human immunodeficiency virus (HIV) in a subject suffering from HIV or a subject suspected of suffering from HIV infection (AIDS), the method comprising performing PCR amplification on nucleic acid in a biological sample obtained from the subject, wherein the amplification comprises primers that hybridize to sequences within the R region of the long terminal repeat (LTR) of HIV, and subsequently detecting any amplification, wherein detection of the amplification indicates the presence of HIV in the subject.

[0226] Since there are two copies of the R region in the HIV genome, amplification will result in the amplification of both R regions present in the 5'LTR and the 3'LTR.

[0227] PCR amplification can be performed using conventional PCR or quantitative PCR (RT-PCR). In one example, step (b) is performed using real-time PCR.

[0228] In one example, the method further comprises a probe. The probe can be a labeled hydrolyzed oligonucleotide. In another example, the probe is Probe. The probe may also be a fluorescently labeled hybridization probe.

[0229] In one example, the method further comprises:

[0230] (i) contacting nucleic acid in the sample with a labeled hydrolysis oligonucleotide that binds within the R region sequence of the HIV long terminal repeat (LTR);

[0231] (ii) further contacting the nucleic acid with a forward primer and a reverse primer that hybridize to a sequence within the R region sequence;

[0232] (iv) amplifying the R region sequence; and

[0233] (v) detection amplification;

[0234] The amplification is detected by a signal emitted by the labeled oligonucleotide, which signal indicates the presence of HIV in the subject.

[0235] Preferably, the forward primer and the reverse primer bind to the R region sequence upstream and downstream of the R region sequence to which the oligonucleotide binds, respectively.

[0236] In one example, the method further comprises obtaining a biological sample from a subject. In another example, the biological sample is whole blood, plasma or peripheral blood mononuclear cells (PBMC). In another example, DNA is extracted from the biological sample.

[0237] HIV may be HIV-1 or HIV-2. In another embodiment, the HIV nucleic acid is DNA or RNA. In another embodiment, the method detects integrated HIV. In another embodiment, the amplification is performed by quantitative PCR. In another embodiment, the amplification is performed by real-time PCR (RT-PCR). In another embodiment, the hydrolyzed oligonucleotide is Probe.

[0238] Quantitative HIV DNA

[0239] The present disclosure also provides a method for quantifying HIV DNA copy number in a biological sample. Therefore, the present disclosure provides a method for quantifying HIV DNA copy number in a biological sample from a subject suffering from HIV or a subject suspected of suffering from HIV infection, the method comprising:

[0240] (i) detecting HIV-R region sequences; and

[0241] (ii) quantifying the HIV-R region copy number in the sample by reference to an HIV standard, wherein the HIV-R region copy number is expressed as the number of HIV-R region copies per volume of DNA present in the sample.

[0242] In one example, detecting HIV-R region sequences is performed as described herein or known in the art.

[0243] In one example, the method further comprises:

[0244] (iii) quantifying the endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the number of copies of the housekeeping gene per volume of DNA present in the sample;

[0245] (iv) dividing the copy number obtained by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the sample; and

[0246] (v) Calculate the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV DNA copy number to obtain the DNA copy number in the biological sample (copy number / cell).

[0247] "Corresponding" means that the housekeeping standard is identical to the endogenous housekeeping gene.

[0248] Preferably, quantification of HIV-R region DNA and endogenous housekeeping genes is performed using aliquots of the same sample obtained from the subject. In a specific example, it is performed on aliquots of a sample from which DNA was extracted from the subject.

[0249] In one example, HIV-R regions are quantified by:

[0250] (i) obtaining an aliquot of the sample from which DNA has been extracted;

[0251] (ii) contacting an aliquot with a labeled oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0252] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to a sequence within the R region sequence;

[0253] (iv) amplifying the R region sequence by quantitative PCR;

[0254] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of serial dilutions of HIV standards to derive the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0255] In another example, endogenous housekeeping genes are quantified by:

[0256] (i) obtaining an aliquot of the sample containing the extracted DNA;

[0257] (ii) contacting the housekeeping gene in the aliquot with a labeled oligonucleotide that binds to a sequence within the housekeeping gene;

[0258] (iii) further contacting the aliquot with a forward primer and a reverse primer, which hybridize to upstream and downstream sequences of a housekeeping gene sequence, respectively, which housekeeping gene sequence is bound to the oligonucleotide;

[0259] (iv) amplifying the housekeeping gene sequence using quantitative PCR; and

[0260] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by serial dilutions of the corresponding amplification standard to derive the number of endogenous housekeeping gene copies per volume of DNA in the aliquot.

[0261] In one embodiment, the aliquots used to amplify the HIV R region and the endogenous gene are obtained from the same sample, preferably from DNA extracted from the same sample. In one embodiment, the oligonucleotide is a hydrolyzed oligonucleotide.

[0262] Those skilled in the art will appreciate that any known housekeeping gene is suitable for use in the present method. In one example, the housekeeping gene is beta actin. In another example, the housekeeping standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 Copy number / μl.

[0263] The number of cells per volume of DNA in a biological sample is obtained by quantifying an endogenous housekeeping gene by real-time PCR using the same standard as the endogenous housekeeping gene to obtain the number of copies of the endogenous gene, which is expressed as a value of X copies / μl DNA in the sample. The number of cells can then be estimated from the actin copy number by dividing by 200 (assuming that there are 200 copies of β-actin per cell) to provide a value of X cells / μl DNA in the sample. Those skilled in the art will appreciate that, depending on the housekeeping gene used, the value of 200 for β-actin may need to be replaced with a different value corresponding to the number of copies of the gene in the cell.

[0264] In one example, the HIV is HIV-1 or HIV-2.

[0265] In another example, the HIV standard is a plasmid standard containing a single copy number of the HIV genome.

[0266] In another example, the HIV standard is serially diluted to provide 0, 4, 40, 400, 4×10 3 , 4×10 4 , 4×10 5 and 4×10 6 copies / μl.

[0267] Alternatively, the number of HIV DNA copies in a sample can be obtained by replacing the use of housekeeping genes with a calculation based on DNA absorbance. Thus, the use of housekeeping gene standards may be replaced by measuring the absorbance of DNA. This method is familiar to those skilled in the art and generally involves measuring the absorbance at 260 nm.

[0268] Therefore, in one example, the method for quantifying HIV DNA copy number further comprises:

[0269] (iii) quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of the DNA in the sample relative to that of a standard;

[0270] (iv) calculating the number of cells per volume of DNA in the sample based on the absorbance of the DNA; and

[0271] (v) Calculate the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0272] In another example, the method of quantifying the mass of DNA per volume in a sample optionally comprises adding a DNA intercalating dye and measuring the fluorescence emitted by the dye. In one example, the DNA intercalating dye is selected from SyBr Green I, Syto-9, Syto-10-14, Syto-16, Syto-21, Syto-24, Syto-29, YoYo-1, YoYo-3 and ToTo-1.

[0273] In one example, the HIV is HIV-1 or HIV-2.

[0274] In another example, HIV DNA copy number is expressed as per 1,000,000 cells (10 6 The number of copies of HIV-R region is 10 6 In another example, HIV DNA copy number is expressed as a value of any fixed number of cells, including but not limited to 1.5×10 6 , 2×10 6 , 2.5×10 6 or 3×10 6 cells.

[0275] In one example, the volume is expressed in μl. In another example, the mass is the amount of DNA quantified by absorbance at 260 nm. In another example, the mass is expressed in ng.

[0276] The methods described herein can be used to quantify the pVL of HIV-1 in a subject. Two methods are illustrated below that can be used to calculate the pVL of HIV-1 in a subject (in copies / 10 6 These methods are to be regarded as illustrative rather than limiting.

[0277] Method 1 (Actin Standard Based)

[0278] 1. Quantify the HIV-1 R region copy number A in the biological sample from which DNA was extracted by real-time PCR using HIV-1 standards (e.g., 42.5 copies per microliter of extracted DNA)

[0279] 2. Actin copy number was also quantified by real-time PCR using the same DNA extracted samples with an actin standard (e.g., 2,520,000 copies per microliter of extracted DNA)

[0280] 3. Then estimate the cell number by dividing the actin copy number by 200 (actin has a copy number of 200 per cell) (e.g., the estimated cell number is 12,600 cells per microliter of extracted DNA) B

[0281] 4. The number of HIV-1 R region copies per cell is calculated by dividing the A value by the B value (A / B) (e.g., the estimated number of HIV-1 copies per cell is 0.003373 copies / cell)

[0282] 5. Every 10 6 The number of HIV-1 R region copies per cell was calculated as C × 1,000,000 (e.g., 6 The estimated HIV-1 copy number per 10 cell is 3373 copies / 10 6 cells).

[0283] HIV-1 standards were plasma standards used to generate the standard curve (0, 4, 40, 4x10 2 , 4x 10 3 , 4x 10 4 , 4x 10 5 and 4x 10 6 Actin standards were measured at 0, 20, and 2×10 2 , 2×10 3 , 2×10 4 , 2×10 5 and 2×10 6 Copies / μl used.

[0284] Method 2: Absorbance-based

[0285] Another way HIV-1 levels can be measured is to determine the quality of DNA in a sample from which the DNA has been extracted using absorbance at 260 nm as follows:

[0286] 1. In a biological sample from which DNA has been extracted, the HIV-1 R region copy number is quantified by real-time PCR using HIV-1 standards (eg, 42.5 copies per microliter of extracted DNA)A.

[0287] 2. The mass of DNA in the solution from which DNA was extracted from the patient sample was quantified by absorbance at 260 nm (eg, extracted DNA was 111.8 ng / μl).

[0288] 3. Then estimate the number of cells based on the absorbance of DNA. After extracting 150 cells, it is estimated that 1 ng of DNA can be obtained (for example, the estimated number of cells per microliter of extracted DNA is 16,673 cells) B.

[0289] 4. The number of HIV-1 R region copies per cell is calculated by dividing the A value by the B value (A / B) (e.g., the estimated number of HIV-1 copies per cell is 0.002535 copies / cell)

[0290] 5. Every 10 6 The number of HIV-1 R region copies per cell was calculated as C × 1,000,000 (e.g., 6 The estimated HIV-1 copy number per cell is 2535 copies / 10 6 cells).

[0291] Therefore, HIV-1 DNA levels determined by the above method provide the clinician with an indication of the HIV-1 DNA level in a fixed number of cells.

[0292] Method 3 is based on the use of DNA intercalating dyes

[0293] Another way HIV-1 levels can be measured is by using DNA intercalating dyes.

[0294] 1. Quantify HIV-1 R region copy number in biological samples from which DNA has been extracted by real-time PCR using HIV-1 standards (e.g., extracted DNA is 42.5 copies / μl) A

[0295] 2. The DNA mass in the solution from which the DNA was extracted from the patient sample was quantified by the level of fluorescence emission from the DNA intercalating dye (e.g., 111.8 ng / μl for the extracted DNA)

[0296] 3. Then estimate the number of cells based on the fluorescence of the dye that intercalates into DNA. After extracting 150 cells, an estimated 1 ng of DNA is obtained (e.g., the estimated number of cells per microliter of extracted DNA is 16,673 cells)

[0297] 4. Calculate the number of HIV-1 R region copies per cell by dividing the A value by the B value (A / B) (e.g., estimate the number of HIV-1 copies per cell to be 0.002535 copies / cell)

[0298] 5. Every 10 6 The number of HIV-1 R region copies per cell was calculated as C × 1,000,000 (e.g., 6The estimated HIV-1 copy number per cell is 2535 copies / 10 6 cells). C

[0299] Therefore, HIV-1 DNA levels determined by the above method provide the clinician with an indication of the HIV-1 DNA level in a fixed number of cells.

[0300] Quantitative HIV RNA

[0301] The present disclosure also provides a method for quantifying HIV RNA in biological samples, more specifically, reverse transcription HIV RNA (cDNA). Therefore, the present disclosure also provides a method for quantifying the number of HIV RNA copies in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection, the method comprising:

[0302] (i) performing real-time PCR amplification of reverse transcribed HIV RNA (cDNA) in the sample using a forward primer and a reverse primer that hybridize to sequences within the R region of the long terminal repeat (LTR) of HIV cDNA; and

[0303] (ii) Quantify the number of HIV-R region copies per volume of RNA in the sample by reference to HIV standards.

[0304] In such an instance, the method further comprises:

[0305] (iii) quantifying the endogenous housekeeping gene via quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the copy number of the housekeeping gene per volume of RNA present in the sample;

[0306] (iv) dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the sample; and

[0307] (v) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0308] In one example, the method further comprises obtaining a biological sample from the subject, and extracting RNA from the sample.

[0309] In one example, the housekeeping standard is amplified by real-time PCR.

[0310] The term "corresponding" as used herein means that the housekeeping standard is identical to the endogenous housekeeping gene.

[0311] In one example, HIV-R regions are quantified by:

[0312] (i) obtaining an aliquot of the sample containing the extracted RNA;

[0313] (ii) contacting an aliquot with a labeled hydrolysis oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0314] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence of the reverse transcribed HIV RNA;

[0315] (iv) amplifying the R region sequence by quantitative PCR;

[0316] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of serial dilutions of HIV standards to derive the number of HIV-R region RNA copies per volume of RNA in the aliquot.

[0317] In one example, endogenous housekeeping genes are quantified by:

[0318] (i) obtaining an aliquot of an RNA sample prepared from a biological sample;

[0319] (ii) contacting the housekeeping gene in the aliquot with a labeled oligonucleotide that binds to a sequence within the housekeeping gene;

[0320] (iii) further contacting the aliquot with a reverse transcriptase and a forward primer and a reverse primer that hybridize to upstream and downstream sequences of the housekeeping gene sequence to which the oligonucleotide binds, respectively;

[0321] (iv) amplifying the reverse transcribed housekeeping gene sequence using quantitative PCR; and

[0322] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by serial dilutions of the corresponding amplification standard to derive the number of copies per volume of DNA of the endogenous housekeeping gene in the aliquot.

[0323] In one example, the oligonucleotide is a hydrolyzable oligonucleotide.

[0324] The method may alternatively provide a method for quantifying the number of HIV RNA copies in a biological sample based on RNA absorbance. Therefore, the present disclosure also provides a method for quantifying the number of HIV RNA copies in a biological sample from a subject with HIV or a subject suspected of having HIV infection, the method comprising:

[0325] (i) Detection of HIV-R region sequences;

[0326] (ii) quantifying the number of HIV-R region copies per volume of reverse transcribed RNA (cDNA) in the sample by real-time PCR with reference to HIV standards, wherein the copy number is expressed as the number of HIV-R region copies per volume of RNA in the sample;

[0327] (iii) quantifying the mass of RNA per volume in the sample by measuring the absorbance of the RNA in the sample;

[0328] (iv) calculating the number of cells per volume of RNA in the sample based on RNA absorbance; and

[0329] (v) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv) to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0330] In one example, detecting HIV-R region sequences is according to methods described herein or known in the art.

[0331] In one example, the mass is the amount of RNA quantified by absorbance at 260 nm. In another example, the mass is expressed as ng.

[0332] In one example, the housekeeping gene is GAPDH.

[0333] In one example, the housekeeping RNA standard is a plasmid standard. In another example, the RNA standard is GAPDH. In another example, the RNA standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 Copy number / μl.

[0334] In another example, the number of cells is determined by dividing the number of GAPDH copies by 6.35 (assuming that there are 6.35 copies of GAPDH RNA per cell). One skilled in the art will appreciate that, depending on the control RNA standard used, the value of 6.35 for GAPDH may need to be replaced with a different value corresponding to the number of copies of the gene in the cell.

[0335] In another example, the method for quantifying HIV RNA copy number further comprises:

[0336] (iii) Quantifying the RNA mass per volume (w / v) of the RNA extracted solution from the patient sample by measuring the fluorescence emission of the RNA intercalating dye.

[0337] (iv) calculating the number of cells per volume of RNA in the sample based on the fluorescence emission of the intercalating dye; and

[0338] (v) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV-R region RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0339] In one example, RNA copy number is expressed as HIV R region copy number / 10 6 cell.

[0340] Detection of HIV transcription in latently infected reservoir cells

[0341] The methods described herein provide for the detection and quantification of lentiviral transcription in latently infected cells. This is achieved by measuring HIV-1 transcriptional activity normalized to HIV-1 DNA levels.

[0342] The above method for calculating HIV-1 DNA can also be applied to calculate HIV-1 RNA. In this case, as shown in the example, a GAPDH standard is used. Real-time PCR is used to amplify the RNA that has been reverse transcribed.

[0343] To obtain a numerical value for HIV transcriptional activity normalized to HIV DNA levels, HIV RNA levels were divided by HIV DNA levels. This normalized HIV transcriptional activity (RNA copy number of HIV-R region divided by DNA copy number of HIV-R region) provides a measure of the transcriptional activity occurring to identify active HIV-1 transcription. The advantage of this approach is that we are able to obtain HIV transcriptional activity without the need to sort or isolate cells from the reservoir (i.e., CD4 + T cells and macrophages). This intracellular transcriptional assay is very useful for obtaining the efficacy of ART treatment, especially in patients with plasma viral loads below the detection level (e.g., 20 copies / mL). The inventors were able to obtain and identify HIV-1 transcriptional activity in latently infected reservoir cells. In this way, the applicant was able to separate subjects receiving optimal ART from subjects receiving suboptimal ART.

[0344] Using this formula, subjects receiving ART can be monitored over time. If the treatment is effective, the subject's integrated HIV-1 DNA levels will decrease during treatment. In addition, if the subject is receiving optimal ART, HIV-1 infection will not expand within the reservoir cells, and therefore the level of HIV-1 DNA integration will decrease.

[0345] Therefore, the ratio of HIV-1 RNA copy number to HIV-1 DNA copy number provides clinicians with diagnostic data that indicates current HIV-1 transcriptional activity normalized by HIV-1 DNA levels at the time of sample collection. This gives a measure of how ART treatment affects the latently infected cell population. Because the level of integrated HIV DNA may vary from patient to patient, it is very important to measure the accurate HIV transcriptional activity normalized to the amount of HIV DNA.

[0346] Evaluating the effectiveness of antiretroviral therapy

[0347] Without wishing to be bound by theory, the inventors have found that HIV DNA copy number and normalized HIV RNA copy number provide a more sensitive method that separates subjects receiving antiretroviral therapy (ART) from subjects receiving suboptimal / sub-effective ART. Simply measuring HIV RNA copy number does not distinguish between subjects because when a patient is first infected or in a later stage of infection, the level of integrated HIV DNA may vary from patient to patient due to the initial amount of HIV present in the patient's body. When HIV RNA copy number is normalized relative to HIV DNA copy number, statistically significant differences can be observed between subjects receiving optimal and suboptimal ART. By performing the method at multiple time points, the normalized HIV RNA copy number can be monitored and compared with one or more previously determined values ​​to assess whether the subject is receiving optimal ART. Therefore, it is crucial to detect accurate HIV transcriptional activity normalized for HIV DNA.

[0348] Therefore, the present disclosure also provides a method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0349] (i) Quantification of HIV-R region DNA copy number;

[0350] (ii) quantification of HIV-R region RNA copy number;

[0351] (iii) determining a normalized HIV RNA copy number in a sample obtained from the subject by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0352] (iv) comparing the normalized HIV RNA copy number value to one or more previously normalized values ​​obtained from the same subject;

[0353] A reduction in normalized HIV RNA copy number indicates that the subject is receiving optimal / effective ART.

[0354] In one example, quantification of HIV-R region DNA or RNA is performed using methods described herein or known in the art.

[0355] In one example, the method further comprises obtaining a biological sample from the subject and preparing DNA and RNA from the sample.

[0356] In another example, HIV-R region RNA is quantified by:

[0357] (i) obtaining an aliquot of an RNA sample prepared from a biological sample;

[0358] (ii) contacting an aliquot with a labeled hydrolyzed oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of the reverse transcribed RNA (cDNA);

[0359] (iii) further contacting the aliquot with a reverse transcriptase and a forward primer and a reverse primer that hybridize to sequences within the reverse transcribed R region sequence upstream and downstream of the R region sequence to which the oligonucleotide binds;

[0360] (iv) amplifying the reverse transcribed R region (cDNA) sequence by quantitative real-time DNA PCR;

[0361] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of a serial dilution of an HIV standard to determine the number of HIV-R region RNA copies per volume of RNA in the first aliquot.

[0362] In one example, the HIV standards used in the methods for quantifying HIV DNA and RNA are the same.

[0363] Methods for quantification of RNA copy number have been described previously. Preferably, the aliquots used for quantification of endogenous housekeeping genes and quantification of HIV-R region RNA (cDNA) are from the same RNA prepared from a biological sample. Preferably, quantification of HIV DNA and HIV RNA is performed in the same biological sample from which DNA and RNA were prepared / extracted, respectively.

[0364] In one example, the HIV is HIV-1 or HIV-2.

[0365] In assessing whether a subject is receiving optimal ART, clinicians may compare the ratio of HIV RNA values ​​normalized by HIV DNA values ​​to the ratio of one or more previous values ​​obtained from the same subject. If the ratio decreases over time, this may indicate to the clinician that the subject is receiving optimal ART. However, if the ratio increases, then this may suggest to the clinician to adjust the dose of ART or the type of ART. If the subject is receiving combination therapy, this may also include replacing one of the components of the combination therapy.

[0366] In another example, the method includes adjusting the dose or type of ART administered to the subject.

[0367] In another example, the normalized HIV RNA copy number ratio of the subject is determined at at least two time points. In another example, the ratio is determined at multiple time points in the subject's lifetime, including but not limited to three, four, five, six, eight, ten, twelve, fifteen, twenty, twenty-five, thirty, thirty-five, forty, etc. In another example, the time period between at least two time points is days, weeks, or months. In another example, the time period between at least two time points is 1 week, 2 weeks, 1 month, 3 months, 4 months, 6 months, 8 months, or 12 months.

[0368] In another example, a decrease in the ratio of greater than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 2% indicates that the subject is receiving optimal ART.

[0369] Antiretroviral therapy and monitoring treatment response

[0370] HIV RNA (viral load) and CD4 T lymphocyte (CD4) cell count are two surrogate markers of antiretroviral therapy (ART) response and HIV disease progression that have been used for decades to manage and monitor HIV infection.

[0371] Viral load is a marker of response to ART. The patient's pre-ART viral load level and the magnitude of the viral load decline after ART initiation provide predictive information about the probability of disease progression. The main goal of ART is to achieve and maintain durable viral suppression. Therefore, the most important use of viral load is to monitor treatment efficacy after ART initiation.

[0372] Measurement of CD4 count is particularly useful before ART initiation. CD4 cell count provides information about the overall immune function of HIV-infected patients. This measurement is essential for determining thresholds for initiation and discontinuation of opportunistic infection (OI) prevention and for assessing the urgency of starting ART.

[0373] CD4 count monitoring

[0374] The CD4 count is the most important laboratory indicator of immune function in HIV-infected patients. It is also the strongest predictor of subsequent disease progression and survival, based on findings from clinical trials and cohort studies. The CD4 count is highly variable; a significant change (2 standard deviations) between two tests is approximately a 30% change in the absolute count, or a 3 percentage point increase or decrease in the CD4 percentage.

[0375] HIV infection is characterized by high rates of viral turnover throughout the course of the disease, ultimately leading to CD4 depletion and disease progression. (Wei X, Ghosh SK, Taylor ME, et al. (1995) Nature 343, 117–122 and Ho DD, Naumann AU, Perelson AS, et al. (1995) Nature 373, 123–126). The goal of antiretroviral therapy is to achieve substantial and prolonged suppression of viral replication. Achieving sustained viral control may involve the use of sequential therapies, typically each containing a combination of three or more antiretroviral drugs. The main principle of combination therapy involves synergistic or additive activity to achieve greater suppression of viral replication. However, tolerability of drug therapy remains critical because treatment needs to be continued for many years.

[0376] In an untreated patient, approximately 10 10 Combined with the inability of HIV reverse transcriptase (RT) to correct transcription errors through exonucleolytic proofreading, this high level of viral turnover results in 10 new viral particles per day per position in the HIV genome. 4 to 10 5 The result is rapid establishment of widespread genotypic variation.

[0377] Early development of antiretroviral therapy focused on reverse transcriptase inhibitors. Both nucleoside and non-nucleoside inhibitors of the enzyme have shown significant antiviral activity (DeClerq, E. (1992) AIDS Res. Hum. Retrovir. 8: 119–134). However, due to drug resistance, limited efficacy and host cell factors, the clinical benefits of these drugs are limited (Richman, D. (1993) Ann. Rev. Pharm. Tox. 32: 149–164).

[0378] Recent treatments have focused on the use of protease inhibitors. These drugs include saquinavir developed by Hoffmann-La Roche, ritonavir developed by Abbott Laboratories, indinavir developed by Merck & Co., nelfinavir developed by Agouron Pharmaceuticals, and amprenavir developed by Vertex Laboratories. Other protease inhibitors include atazanavir, darunavir, fosamprenavir, and tipranavir.

[0379] Other types of drugs that may be used for treatment include fusion inhibitors such as enfuvirtide, CCR5 co-receptor antagonists such as maraviroc, and HIV integrase strand transfer inhibitors such as isentress, tivicay, and vitekta.

[0380] Protease and reverse transcriptase inhibitors combined with antiviral therapy have demonstrated potential efficacy in the treatment of HIV. This combination includes Atripla, Complera, Evotaz, Prezcobix, and Stribild.

[0381] Those skilled in the art will appreciate that many changes and / or modifications may be made to the above specific embodiments without departing from the broad general scope of the present invention. Therefore, the embodiments listed are considered to be illustrative and non-restrictive in all aspects. The present disclosure includes the following non-limiting examples. Example

[0382] Materials and methods

[0383] Design of primer and probe sequences

[0384] exist Figure 1 The genome structure of HIV-1 is shown in Figure 2 The genomic structure of HIV-2 is shown in . Primer sets are designed to target the same "R" region sequence in the 5'LTR and 3'LTR of HIV-1 or HIV-2 genome. Primer sets are designed according to the following criteria: (a) being located in the conserved region of all HIV-1 and HIV-2 subtypes for reliable detection; (b) primer length is between 18-25 bases long; (c) primer dimers are not formed, but sensitive detection is maintained. Forward primers are designed to provide good comparisons at the 3' end of primers for all HIV subtypes, and reverse primers are designed to provide good comparisons at the 5' end of primers for all HIV subtypes. Forward primers and reverse primers are shown in Table 1 below.

[0385] Table 1 Sequences of forward primers and reverse primers used for PCR

[0386]

[0387] The probes were designed to bind to a conserved region in all HIV subtypes to ensure efficient detection. Locked nucleic acid (LNA) modification was used to allow for increased annealing temperatures and the use of short TaqMan probes.

[0388] The sequence of the HIV-1 oligonucleotide probe is as follows:

[0389] 5'FAM-AGG LNA GA LNA AC LNA CCAC LNA TG LNA CTTA-BQH-13' (SEQ ID NO: 6), wherein FAM is a fluorescent reporter, BHQ1 is a quencher molecule, and N LNA represents a locked nucleic acid analog, wherein N is an A, T, G, or C nucleobase as indicated.

[0390] The sequence of HIV-2 oligonucleotide probe No.1 is as follows:

[0391] 5'FAM-GCCTGGGTGTTCCCTGCTAGACTCT–BQH-13', where FAM is the fluorescent reporter and BHQ1 is the quencher molecule.

[0392] The sequence of HIV-2 oligonucleotide probe No.2 is as follows:

[0393] 5'FAM-CT LNA GC LNA TA LNA GT LNA G LNA CTG LNA A-BQH-13' (SEQ ID NO: 40), where FAM is the fluorescent reporter, BHQ1 is the quencher molecule, and N LNA represents a locked nucleic acid analog, wherein N is an A, T, G, or C nucleobase as indicated.

[0394] The sequence of HIV-2 oligonucleotide probe No.3 is as follows:

[0395] 5'FAM TC LNA CA LNA GC LNA AC LNA TA LNA GC LNA AG-BQH-1 3' (SEQ ID NO: 44), wherein N LNArepresents a locked nucleic acid analog, wherein N is an A, T, G, or C nucleobase as indicated.

[0396] Figure 3-1 A and B, Figure 3-2 C and D show the alignment of the probes and PCR primers used in the HIV-R region sequences of HIV-1 and HIV-2. Figure 3-1 The A indicates alignment on HIV-1, and Figure 3-1 B and Figure 3-2 C and D show the alignment on HIV-2.

[0397] Alignment of HIV-1 oligonucleotide probes for HIV-1 subtypes Figure 4 shown.

[0398] HIV-2 probes and oligonucleotide probes for HIV-2 subtypes are aligned as follows Figure 5 shown.

[0399] The sequence of the GAPDH probe is 5'FAM-AAGGTCGGAGTCAACGGATTTGGTCGT-BQH-1 3' (SEQ ID NO: 17), where FAM corresponds to the fluorescent reporter and BHQ1 is the quencher molecule.

[0400] The sequence of the β-actin probe was 5′ FAM-ATGCCCTCCCCCATGCCATCCTGCG BHQ-1 3′ (SEQ ID NO: 20).

[0401] Primer and probe labeling

[0402] All primers were synthesized by standard commercial oligo DNA synthesis services. Biotin-labeled primers were used for end-point PCR assays. Biotin modification was performed at the 5' end of the oligo DNA primers.

[0403] Cell Line and Plasmid Standards

[0404] HIV-1 plasmid standards used herein are obtained from the genome HIV-1 plasmid of pNL4-3 (NIH Cat No.114). HIV-2 plasmid standards cloned by TA are produced by standard procedures. Initially, HUT78 cells were infected with HIV-2CBL-20 virus (NIH Cat No 600). Genomic DNA was separated and then PCR amplified. HIV-2 cloned by T / A was obtained from this amplicon to produce a plasmid containing the HIV-2R region. HIV-2 plasmid copy number was measured using 260nm absorption spectra and the molecular weight of each plasmid.

[0405] HUT78 cells (CD4+ T cell line, Cat No. 89) and OM10.1 cells (HIV-1 latent cell line, Cat No. 1319) were also obtained from NIH. The OM10.1 cell line contains a single copy of HIV-1 genomic DNA in a single OM10.1 cell.

[0406] HIV Subject Data

[0407] Plasma viral load data of the subjects were obtained from the St Vincent's Hospital Diagnostic Laboratory. Data on the HIV status of the subjects were obtained by TaqMan HIV-1 assay. The subjects were adult subjects over 18 years old, and informed consent was obtained for the use of their blood samples.

[0408] Isolation and preparation of peripheral blood mononuclear cells (PBMC)

[0409] Whole blood was obtained from subjects using a standard blood collection protocol. Fresh blood no older than 4 days was obtained from the HIV Diagnostic Laboratory at St Vincent's Hospital.

[0410] Peripheral blood mononuclear cells (PBMC) were isolated from whole blood using conventional Ficoll gradient centrifugation. In brief, blood was collected in 9mL acid citrate dextrose anticoagulant (ACD) tubes, and 9mL phosphate buffered saline (PBS) was added. After inversion mixing, 15mL Ficoll-plaque culture medium was added, and centrifuged at 18-20°C for 40 minutes at 400g. The upper layer containing plasma and platelets was discarded, and the mononuclear cell layer was transferred to a clean tube. 30mL PBS was added, mixed, and centrifuged at 18-20°C for 15 minutes at 400g. Supernatant was removed, and mononuclear cells were washed in 10mL PBS, and centrifuged at 18-20°C for 10 minutes at 400g. Supernatant was removed and mononuclear cells were retained for future analysis.

[0411] Whole blood separation and preparation

[0412] For whole blood experiment, 4mL red blood cell lysis buffer (Roche company) was added to 15mL Falcon tubes. The whole blood collection tube was inverted 10 times, and then 2mL whole blood was added to the 15mL Falcon tube containing 4mL lysis buffer. The tube was incubated on a rotating platform at room temperature (RT) for 10 minutes in a slow rotation mode. Then the tube was centrifuged at room temperature for 5 minutes at 500xg using a desktop centrifuge. After centrifugation, the supernatant was poured into a waste bottle. The cells were resuspended in 1800μl PBS. Two equal portions of 900μl cell suspensions were made in two O-ring tubes.

[0413] The tubes were then centrifuged at 7800 x g (9000 rpm) for 3 minutes at room temperature using a microcentrifuge. The supernatant was removed using a P1000 pipette without disturbing the leukocyte pellet.

[0414] Two tubes of cell pellets were prepared from each patient. One tube was used for DNA extraction and the other tube was used for RNA extraction.

[0415] The concentration of DNA extracted from the sample was measured at 260 nm (A 260 ) absorbance measurement, using the average extinction coefficient of double-stranded (ds) DNA (1A 260 =50 μg / ml), and the nucleic acid concentration was determined based on the absorbance of the nucleic acid preparation.

[0416] Preparation of PBMCs

[0417] PBMCs were obtained from whole blood by the Ficol-Paque separation method. The patient's blood was collected in a 9mL ACD (acid citrate dextrose, anticoagulant) tube. 9mL of blood was transferred to a 50mL Falcon tube and 9mL of PBS was added. The tube was inverted several times to mix the blood and buffer. 15mL of Ficoll-Paque medium was added to the bottom of the 50mL Falcon tube very slowly without disturbing the interface between the Ficoll-Paque medium and the blood phase. The tube was centrifuged at 400g for 40 minutes at 18°C ​​to 20°C (the brake of the centrifuge was turned off). The upper layer was drawn from the plasma and platelets with a sterile pipette, leaving the mononuclear cell layer undisturbed at the interface. The mononuclear cell layer was then transferred to a 50mL Falcon tube. 30mL of PBS was added to the cells and mixed by inverting the tube several times. The tube was centrifuged at 400g for 15 minutes at 18°C ​​to 20°C (the brake was turned on). The supernatant was removed. Resuspend the mononuclear cells in 10 ml PBS. Centrifuge at 400 x g for 10 minutes at 18°C ​​to 20°C. Remove the supernatant.

[0418] Purification of leukocyte subtypes

[0419] To purify RO+R5+, RO+R5- and RO-R5- cell populations, PBMC cells were sorted based on surface markers on PBMCs by FACS Aria cell sorter (BD Biosciences).

[0420] PBMC (about 2×10 6 Cells) were incubated with mAbs against CD4 (PerCP; Becton Dickinson), and against CD3 (APC; Becton Dickinson), against CCR5 (clone 2D7, FITC-conjugated; PharMingen), and against CD45 RO (PE; PharMingen). The cells were incubated with the markers for 30 min at room temperature. The tubes were then centrifuged at 400 g for 5 min and the cells were resuspended in 1 mL PBS with 10% FCS. This was repeated two more times and the cells were resuspended in 1 mL PBS with 10% FCS. The cells were sorted by the "Aria Cell Sorter" to obtain the following three T cell subsets:

[0421] CD3+CD4+CD45RO+ccr5+

[0422] CD3+CD4+CD45RO+ccr5-

[0423] CD3+CD4+CD45RO-ccr5-.

[0424] Use magnetically labeled particles according to the manufacturer's instructions. PBMCs with CD14 were isolated.

[0425] DNA extraction

[0426] Genomic DNA was extracted using the QIAamp DNA mini kit (Qiagen) according to the manufacturer's instructions.

[0427] Briefly, 200 μl of AL buffer (provided in the kit) was added to the cell pellet and the tube was vortexed until the pellet was dissolved. A proteinase-K master mix was prepared.

[0428] 200 μl PBS x number of tubes

[0429] 20 μl Proteinase K x number of tubes

[0430] Add 220 μl of proteinase-K master mix and vortex the tube. DNA digestion lasts for 10 minutes at 56°C, and then vortex briefly every 2-3 minutes. Then the tube is briefly centrifuged, and 200 μl of EtOH is added, followed by vortexing for 15 seconds. Then the tube is briefly centrifuged, and all cleaved solutions are added to the QIAamp DNA Minicolumn and centrifuged at room temperature for 1 minute at 6,000xg. The top of the QIAamp column is transferred to a new liquid collection tube (provided in the kit). The used lower part of the collection tube is discarded as waste. Add 500 μl of AW1 buffer (provided in the kit), and centrifuge at room temperature for 1 minute at 6,000xg. The top of the QIAamp column is transferred to a new liquid collection tube (provided in the kit). The used lower part of the collection tube is discarded as waste. Add 500 μl of AW2 buffer, and centrifuge at room temperature for 3 minutes at 13,000xg.

[0431] The liquid in the collection tube was emptied and an additional centrifugation was performed at room temperature at 13,000 x g for 1 minute. The upper column was removed and placed in a 1.5 mL amp tube. 60 μl AE buffer (provided in the kit) was added and kept at room temperature for 1 minute, and then kept at room temperature for 1 minute in a centrifuge at 6,000 x g. The upper part of the used collection tube was discarded and the lower part of the centrifuge tube was stored at 4 ° C.

[0432] RNA extraction

[0433] Use ReLiaprep according to the manufacturer's instructions. TM Total RNA was extracted from blood samples using RNA cell system (Promega).

[0434] Briefly, 250 μl of Bl+TG buffer (provided in the kit) was added to each cell pellet. The tube was vortexed until the pellet dissolved. 85 μl of isopropanol was added and the tube was vortexed. The lysed solution was transferred to a ReliaPrep Minicolumn (provided in the kit) and centrifuged at 14,000 x g for 1 minute at room temperature. The liquid from the collection tube was emptied into waste.

[0435] Prepare DNA-1 master mix in a new tube to obtain the required volume for all tubes.

[0436] 24μl Yellow Core Buffer x number of tubes

[0437] 3μl 0.09MnCl2 x number of tubes

[0438] 3μl DNase I enzyme. Mix x number of tubes

[0439] Add 30ul DNA-1 Master Mix onto the filter of the ReliaPrep Minicolumn and incubate at room temperature for 15 minutes. Add 200μl Column Wash Solution (provided in the kit) and centrifuge at 14,000xg for 1 minute at room temperature. Add 500μl RNA Wash Solution (with ethanol added) and centrifuge at 14,000xg for 1 minute at room temperature. ReliaPrep TM The minicolumn was placed in a new collection tube and 300 μl RNA Wash Solution (provided in the kit) was added. The tube was centrifuged at maximum speed for 2 minutes at room temperature and then moved to a 1.5 mL amplicon tube. 60 μl nuclease-free water was added and the tube was kept at room temperature for 1 minute, then centrifuged at room temperature at 13,000 x g for 1 minute. The upper part of the used collection tube was discarded and the lower part of the centrifuge tube was stored at 4 ° C.

[0440] All DNA and RNA samples were analyzed spectrophotometrically to confirm quality using Qubit Fluorometric Quantitation (ThermoFisher).

[0441] DNA amplification real-time assay

[0442] Figure 6 A and B schematically show the use of a set of PCR primers and TaqMan TM The real-time PCR method used in the present disclosure of the probe. Using SensiFAST Probe No-ROX One-step kit (BIO76005), DNA analysis was performed using two sets of real-time PCR. Each reaction mixture of 40 μl final volume contained: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl DNA, 5 μM Taqman probe and PCR grade water. The cycling and melting conditions were as follows: using LightCycle480 (Roche), 94°C for 30 seconds, followed by 50 cycles of: 95°C for 7 seconds, and 60°C for 30 seconds. HIV-1 DNA standards were serially diluted to provide 0, 40, 400, 4000, 40000, 4×10 5 and 4×10 6 copies / μl.

[0443] For β-actin analysis, the reaction mixture in a final volume of 40 μl contained: 2× PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl DNA, 5 μM Taqman probe, and PCR grade water. Cycling and melting conditions were as follows: 94°C for 30 seconds, followed by 50 cycles of 95°C for 7 seconds, and 60°C for 30 seconds using LightCycle 480 (Roche). β-actin standards were serially diluted to provide 0, 20, 200, 2000, 20000, 2×10 5 and 2×10 6 The β-actin standard is a plasmid containing a single copy of the β-actin gene. The β-actin plasmid standard was prepared by TA cloning using PCR amplified β-actin DNA and standard cloning methods. The β-actin primer and probe sequences are as described above.

[0444] HIV-1 cloning plasmids were obtained from NIH, and a single plasmid contains a single copy of the HIV-1 genome.

[0445] RNA Amplification Real-Time Assay

[0446] Using SensiFAST Probe No-ROX One-step kit (BIO76005), RNA analysis was performed using two sets of real-time PCR. For RNA analysis, the reaction mixture of 40 μl final volume contained: 2 × PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl RNA, 5 μM Taqman probe, 0.45 μl reverse transcriptase, 0.8 μl RNase inhibitor and PCR grade water. Cycling and melting conditions were as follows: using LightCycle 480 (Roche), 45 ° C for 20 minutes, 94 ° C for 2 minutes, followed by the following 50 cycles: 95 ° C for 7 seconds, and 60 ° C for 30 seconds. Unless otherwise stated, each PCR amplification was repeated three times.

[0447] For glyceraldehyde 3-phosphate dehydrogenase (GAPDH) analysis, the reaction mixture in a final volume of 40 μl contained: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl RNA, 5 μM Taqman probe, 0.45 μl reverse transcriptase, 0.8 μl RNase inhibitor, and PCR grade water. The cycling and melting conditions were as follows: using LightCycle 480 (Roche), 45°C for 20 minutes, 94°C for 2 minutes, followed by 50 cycles of: 95°C for 7 seconds, and 60°C for 30 seconds.

[0448] GAPDH standards were serially diluted to provide 0, 20, 200, 2,000, 20,000, 2 × 10 5 and 2×10 6 The GAPDH standard is a plasmid containing a single copy of the GAPDH gene. The GAPDH plasmid control was achieved by TA cloning using PCR amplified GAPDH DNA by standard cloning methods.

[0449] GAPDH primer and probe sequences are as described above.

[0450] End-point PCR assay

[0451] The inventors developed an end-point PCR assay, referred to herein as the Streptavidin (SA)-plate end-point assay. Figure 6 B schematically shows the assay, and it is performed using biotin-labeled primers. After PCR, the PCR product is hybridized with a probe labeled with digoxigenin (Dig). The newly hybridized product is captured on the surface of a 96-well plate coated with streptavidin. After washing away unbound Dig probe, an anti-Dig antibody labeled with peroxidase (POD) is added, and then a chemiluminescent reaction is performed. The released light is then detected by a luminescent plate reader.

[0452] All PCR reactions were performed in the same manner as the TaqMan-based real-time PCR method (see "DNA amplification real-time assay" and "RNA amplification real-time assay" above), except for the following two conditions: i) TaqMan probes were not used, and the probes were replaced by water in the reaction; and ii) one of the primers in the set was labeled with biotin at the 5' end of the oligoDNA. After the PCR was completed, 10 μl of the PCR amplicon was transferred to a PCR tube containing 40 μl of hybridization buffer, which had 20 pmol of the Dig-labeled probe and 3.85×SSC buffer (e.g., 20×SSC contains 3.0 M NaCl and 0.3 M sodium citrate pH 7.0). In order to hybridize the PCR amplicon and the Dig-labeled probe, the temperature of the solution in the PCR tube was raised to 95° C. for 2 minutes, then at 40° C. for 2 minutes, and then at 4° C. The hybridization product with a total volume of 50 μl was transferred to a streptavidin-coated 96-well plate containing 50 μl of dilution buffer having 10 mM Tris-HCl pH 7.6, 150 mM NaCl, 1 mM EDTA and 0.0002% Tween20. The 96-well plate was incubated at 37°C for 30 minutes. The hybridization product of the biotin-labeled PCR amplicon and the Dig probe was bound to the streptavidin plate during the incubation. During 3× washing with washing buffer (10 mM Tris-HCl pH 7.5, 0.15 M NaCl, 1 mM EDTA, 0.01% Tween20), the unbound product was washed out of the plate. Subsequently, 100 μl of peroxidase-conjugated anti-Dig antibody (1 / 5000 dilution) was added, using a dilution buffer of 5% BSA, 10 mM Tris-HCl pH 7.5, 0.15 M NaCl. The 96-well plate was then incubated at 37 ° C for 30 minutes, followed by 6× washing with wash buffer. 100 μl of chemiluminescent peroxidase substrate (CPS260, Sigma) was then added. The plate was then incubated at room temperature for 5 minutes. The light generated from the substrate was detected with a luminescent plate reader to obtain relative light units (RLU). The gain (adjustment value) of the luminescent plate reader was 1200.

[0453] Example 1 HIV-1 Normalized by HIV-1 DNA Copy Number RNA copy number (pVL)

[0454] As detailed above, samples were obtained from forty-seven (47) HIV-1 subjects on ART, and DNA and RNA were extracted from whole blood cell lysates. At the time of collection, all patients had suppressed plasma viral load (pVL) of >20 copies / mL ( Figure 7 ).

[0455] HIV-1 patients were assigned to receive either “optimal ART” or “suboptimal ART” based on plasma viral load in the past 6 months. Patients with pVL <20 copies / mL in the past 6 months were considered to receive “optimal ART,” whereas patients with occasional increases in pVL (i.e., >20 to <200 copies / mL; referred to as transient changes (BL)) in the past 6 months were designated as receiving “suboptimal ART.”

[0456] Quantification of HIV-1 RNA and DNA based on amplification of HIV-1 R region sequences was performed by real-time PCR analysis as described according to the above protocol, using β-actin standards for DNA quantification and GAPDH standards for RNA quantification. 47 samples obtained from the SVH diagnostic laboratory were analyzed.

[0457] At the time of collection, the RNA plasma viral load (pVL) of these 47 samples was completely suppressed (<20 copies / mL). Figure 7 As can be seen in Figure 3, there was no difference between optimal and suboptimal ART subjects using the standard pVL assay.

[0458] like Figure 8 As shown, when HIV-1 RNA copy number was normalized to HIV-1 DNA copy number, the assay could distinguish subjects receiving optimal ART from those receiving suboptimal ART, as a statistically significant difference in intracellular viral activity was found between subjects on "optimal ART" (n=29) and "suboptimal ART" (n=18) (p=0.0016). Figure 8 A). Subjects who had previously experienced transient viral load (BL), defined as at least one transient episode of high HIV-1 DNA levels, and four subjects with immune failure (IF) were identified in the suboptimal ART category as having significantly higher normalized mean ratios of HIV-1 RNA ( Figure 8 B) Subjects whose pVL was suppressed for more than 6 months had lower mean ratios normalized to HIV-1 RNA.

[0459] Thus, although the pVL RNA assay showed no differences between the two groups of subjects, our assay was able to distinguish subjects receiving optimal or suboptimal ART based on normalization.

[0460] like Figure 8 C, according to the inventors' determination, when the HIV-1 DNA copy number is less than 10 6 An additional category, named "improved optimal ART," was found in subjects with 800 HIV-1 DNA in 10 cells, which was statistically significant (p=0.012) compared with the rest of the optimal ART group.

[0461] This data demonstrates that HIV activity in latently infected reservoirs can be detected using primers located in the 5' and 3' LTR R regions, and that determining intracellular HIV-1 copy number as shown herein provides a more sensitive indicator of treatment response than standard pVL. Furthermore, as RNA transcript levels are normalized to integrated DNA levels, an increase in intracellular HIV load indicates that latent viral reservoirs are transcriptionally active.

[0462] The results also showed that low normalized HIV-1 RNA ratios (i.e., low transcriptional activity) and low HIV-1 DNA ratios in subjects were indicative of improved optimal ART. Therefore, clinicians may refer to these two measurements, normalized HIV-1 RNA ratios (less than 0.05) and HIV-1 DNA copies less than 10 copies per 10, when determining whether a subject is receiving appropriate (i.e., optimal) ART. 6 800 HIV-1 DNA in each cell.

[0463] Example 3 Evaluation of HIV-1 R region DNA detection

[0464] Two subjects (A and B in Table 3) known to be infected with HIV-1 were evaluated in this study. HIV-1 infected peripheral blood mononuclear cells (PBMCs) from the subjects were sorted by flow cytometry based on the expression of the markers CD3+, CD4+, CD45RO+, CD45RO-, and CCR5+, which have previously been shown to contain an enriched population of infected cells.

[0465] Briefly, PBMCs were sorted based on cell surface markers using a FACS ARIA cell sorter (BD Biosciences) according to the manufacturer's instructions. 6 Cells were incubated with mAbs to CD4 (PerCP, Becton Dickinson), CD3 (APC, Becton Dickinson), CCR5 (clone 2D7, FITC-conjugated; PharMingen), and CD45 RO (PE; PharMingen). CD45 RO+ cells typically distinguish memory T cells, while CD45 RO- cells typically distinguish naive T cells. CD3 is a pan-T cell marker used to separate T cells from non-T cells. CD4 is typically found on T helper cells, monocytes, macrophages, and dendritic cells. CCR5 is a chemokine receptor found on leukocytes and is typically used by HIV to infect leukocytes.

[0466] The cells were incubated at room temperature for 30 minutes and centrifuged at 400 g for 5 minutes. The cells were washed 3 times in 1 mL PBS / 10% FCS. The washed cells were sorted to isolate the following T cell subsets:

[0467] CD3+CD4+CD45 RO+CCR5+

[0468] CD3+CD4+CD45 RO+CCR5-

[0469] CD3+CD4+CD45 RO-CCR5-

[0470] Samples were analyzed using primer sets targeting three different intracellular locations within HIV-1 DNA:

[0471] (1) 5' and 3' LTR R regions,

[0472] (2) 3'LTR region

[0473] (3) gag area.

[0474] The 5' and 3' LTR R region primers were as described previously herein.

[0475] The forward primer and reverse primer for 3'LTR amplification are 5'-CCAAAGAAGACAAGATATCCTTGA-3' (SEQ ID NO: 23) and 5'-TTGAGGCTTAAGCAGTGG-3' (SEQ ID NO: 24), respectively. The sequence of the oligonucleotide probe is 5'-FAM-TTAGACCAGATCTGAGCCTGGGAGCTCTC-BHQ1-3' (SEQ ID NO: 25), where FAM is a fluorescent marker dye and BQ1 is a quencher of the fluorescent dye. This primer set amplifies a region spanning the U3 and R regions of the 3'LTR.

[0476] The gag forward primer and reverse primer are 5'AGTGGGGGGACATCAAGCAGCCATGCAAAT 3' (SEQ ID NO: 26) and 5'TACTAGTAGTTCCTGCTATGTCACTTCC 3' (SEQ ID NO: 27), respectively. The sequence of the oligonucleotide probe is 5'-FAM-ATC LNA A LNA ATG LNA AGGAAG LNA CTG LNA C-BHQ1-3′ (SEQ ID NO: 28), where FAM corresponds to the fluorescent reporter and BHQ1 is the quencher molecule. LNAdenoted as , wherein N is an A, T, G or C nucleobase.

[0477] The results are shown in Table 3 below. The R region primers detected intracellular HIV-1 DNA in unsorted samples from both subjects. After cell sorting, HIV-1 DNA detection using 3'LTR and gag primers was variable in subject A, while in subject B, both primer sets failed to detect HIV-1 DNA. In contrast, the R region primers detected HIV-1 DNA in all samples from subject A and detected HIV-1 DNA at low levels in CD3+CD4+CD45RO-CCR5- in subject B.

[0478] These results suggest that the use of primers targeting the R region is more sensitive for detecting HIV-1 DNA than assays based on amplification of non-R regions.

[0479] Table 3: Evaluation of HIV-1 R region DNA detection

[0480]

[0481] Example 4: HIV-1 Evaluation of the sensitivity of R region RNA detection

[0482] To assess HIV-1 RNA in patient samples, eight (8) subjects known to be HIV-1 positive were selected and analyzed using primer sets targeting three different intracellular locations: (1) 5' and 3' LTR R regions, (2) 3' LTR region, and (3) gag region, similar to the HIV-1 DNA analysis in Example 3.

[0483] Primers for the 5' and 3' LTR R regions, the 3' LTR region, and the gag region were used as described previously.

[0484] In contrast to Example 3 above, the analysis was performed on cells isolated from whole blood as previously described. RNA extraction and PCR amplification were performed as previously described.

[0485] As shown in Table 4 below, primers located in the R region of the 5' and 3' LTRs were able to detect intracellular HIV transcripts in all eight subjects, whereas primers located in the 3' LTR and gag regions only detected HIV loads in four and three subjects, respectively.

[0486] The data suggest that primers located in the R region of the 5' and 3' LTR are more sensitive for detection of intracellular DNA copy number when compared with primers located in the 3' LTR and gag regions. Although the VL of these subjects was below the detection level, consistent detection of intracellular HIV-1 transcriptional activity based on the R region was detected.

[0487] Table 4: Evaluation of HIV-1 R region RNA detection

[0488]

[0489] Example 5: Intracellular HIV load indicates sustained HIV transcriptional activity and contributes to plasma viral load rebound

[0490] To investigate whether low but persistent intracellular HIV load levels indicate HIV transcriptional activity, subjects were sampled during antiretroviral therapy (ART) and structured treatment interruption (STI) (i.e., no ART treatment).

[0491] During ART, subjects were analyzed for plasma viral load and viral RNA every 12 weeks. After cessation of treatment, subjects were sampled every up to 16 weeks. Intracellular transcriptional activity was measured using the R region assay as described previously.

[0492] Four treatment-naive patients received ART for one year. Fig. 9 A, B, and D) and during the 12-week treatment period ( Fig. 9 C) Plasma viral load (pVL, circled line) levels were below the detection limit in four patients. pVL levels remained below detection until week 52 (one year) of ART treatment. Although pVL was undetectable in these four patients, low levels of intracellular HIV-1 transcriptional activity were detected (gray bars). After stopping treatment, VL in the four patients increased rapidly, and the increase in VL was accompanied by an increase in intracellular HIV-1 transcriptional activity.

[0493] ART treatment periods are shown in gray horizontal bars, and Stenosis Treatment Interruption (STI: Stop ART) periods are shown in white horizontal bars ( Fig. 9 ).

[0494] Fig. 9 Participants in the second phase of ART treatment ( Fig.10 During the second phase of ART, VL was suppressed to below-detectable levels; however, consistent detection of intracellular HIV-1 transcriptional activity (grey bars) was detected even with sub-detectable VL. After stopping second phase ART, rapid rebound of VL was observed in two subjects ( Fig.10 A and B).

[0495] To investigate whether the increase in transcriptional activity originated from cells in the latently infected reservoir, intracellular RNA at baseline (pre-ART) and week 2 after cessation of ART (grey circles on the horizontal axis), as well as rebound HIV-1 plasma RNA at week 16 after ART (indicated by the upper grey circle) were collected and analyzed by Sanger sequencing.

[0496] Data were analyzed using the neighbor-joining clustering method on a web-based HIV database (http: / / www.hiv.lanl.gov / content / sequence / HIV / HIVTools.html). Samples isolated from the same subject clustered together (grey rectangles), indicating a latent viral reservoir with persistent HIV transcriptional activity, which drives the rebound of plasma viral load ( Fig.11 ).

[0497] Example 6 Evaluation of HIV-2 copy number in plasma

[0498] Two plasma samples containing HIV-2 RNA were analyzed. An automated extractor (NucliSENSE easyMAG system, BioMedirux) was used to extract RNA from plasma for analysis of HIV-2 RNA. The results are shown in Fig.12 middle.

[0499] The assay detected 2.4 copies / ml of HIV-2 RNA in patient B and 0.1 copies / ml of HIV-2 RNA in patient A.

[0500] Example 7 Evaluation of HIV-2 transcription

[0501] The same strategy used for HIV-1 transcriptional analysis is applied to HIV-2 transcriptional analysis. A single subject sample can be obtained. The method of HIV-2 analysis is as described previously herein.

[0502] The results are shown in Fig.13 The HIV-2 plasma viral load of the subject was below the detection level. However, when HIV-2 intracellular RNA transcripts were detected and the RNA copy number was normalized to HIV-2 DNA copy number, relatively high levels of intracellular HIV-2 RNA were observed.

[0503] Example 8 for HIV-1 Comparison of sensitivity of PCR assays for DNA detection

[0504] The inventors have developed two different PCR assay formats for the detection of HIV-1 DNA, which are compared below.

[0505] As described in the methods and Table 1 (SEQ ID NO: 6), real-time PCR assays were performed on DNA extracted from PBMCs using HIV-1 forward and reverse primers and Taqman probes. End-point assays were performed using a biotinylated HIV-1 forward primer, an unlabeled reverse primer, and a digoxigenin-labeled probe (SEQ ID NO: 45). The probe sequence used for the end-point assay was a shorter version of the same probe used for real-time PCR.

[0506] The samples analyzed by PCR were as follows:

[0507] Digoxigenin probe: Dig / -TTTTTTTTTTTTTTTGGAACCCACTGCTTA (SEQ ID. NO: 45)

[0508] HIV-1 plasmid standards: 0, 4, 40, 400, 4,000, 40,000 copies of HIV-1 plasmid.

[0509] HUT-78 and OM10.1 mixed samples: 0, 4, 40, 400, 4000, 40,000 HIV-1 cells / million (1×10 6 uninfected cells)

[0510] HUT-78 cells are a CD4+ T cell line (not infected with HIV-1). OM10.1 cells are a CD4+ HIV-1 latently infected cell line, in which each cell contains one integrated HIV-1 provirus. To prepare "HIV-1 spiked" samples, HUT-78 and OM10.1 cells were mixed together so that 0, 4, 40, 400, 4000, 40,000 OM10.1 cells were mixed with 1×10 6 This was designed to mimic actual HIV-1 infected clinical samples from human subjects.

[0511] Serial dilutions of plasmid standards were prepared as above and 8 μl of standard were used in 50 μl PCR reactions.

[0512] DNA extracted from the HUT-78 / OM10.1 cell mixture was subjected to real-time PCR analysis and endpoint PCR analysis using 50 PCR cycles against HIV-1 plasmid standards. The results are shown in Table 5 below. 10 μl of PCR product was used for endpoint assay analysis.

[0513] Table 5: Comparison of real-time PCR and end-point PCR assays

[0514]

[0515] Results shown are the average of two replicates.

[0516] Using real-time PCR, HIV-1 plasmid standards ranging from 4 to 40,000 copies were detected using a linear standard curve generated (not shown). As shown in Table 5, the minimum detection limit for the HUT-78 / OM10.1 cell mixture was 1×10 6 40 OM10.1 cells in 40 HUT-78 cells.

[0517] Using 40 cycles of end-point PCR, between 4 and 40,000 copies of HIV-1 plasmid standards were clearly detected. As shown in Table 5, the minimum detection limit for the HUT-78 / OM10.1 cell mixture was 1 × 10 6 Luminescence readings >1,000 RLU were considered positive.

[0518] The results showed that both PCR assays provided very sensitive detection of HIV-1.

[0519] Example 9 Comparison of PCR assay specificity

[0520] HIV-2 DNA detection was measured using HIV-2 plasmid standards and the results were compared to HIV-1 plasmid standards to show specificity. HIV-1 and HIV-2 plasmid standards containing 0, 4, 40, 400, 4000 and 40,000 copies were assayed by both real-time PCR and endpoint PCR, amplified with 50 PCR cycles.

[0521] For real-time PCR, HIV-1 DNA was amplified using forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 9). The amplicon was probed with a Taqman probe (SEQ ID NO: 6) and the copy number was determined.

[0522] As shown in Table 6 below, the HIV-1 probe was able to detect 4 to 40,000 copies of HIV-1 DNA and was specific for HIV-1 because only HIV-1 DNA was amplified. In addition, HIV-2 DNA was amplified using a forward primer (SEQ ID NO: 35) and a reverse primer (SEQ ID NO: 36). As shown in Table 6, the HIV-2 Taqman probe (SEQ ID NO: 44) was able to detect 4 to 40,000 copies of HIV-2 and was specific for HIV-2 because no HIV-1 amplicon was detected using the HIV-2 probe.

[0523] Table 6 Real-time determination of HIV-1 and HIV-2 standards

[0524]

[0525] For endpoint PCR, HIV-1 DNA was amplified using a biotinylated forward primer (SEQ ID NO: 7) and an unlabeled reverse primer (SEQ ID NO: 9). The amplicon was probed with a digoxigenin (Dig) labeled HIV-1 probe (SEQ ID NO: 45). The results are shown in Table 7 below.

[0526] HIV-2 DNA was amplified using an unlabeled forward primer (SEQ ID NO: 35) and a biotin-labeled reverse primer (SEQ ID NO: 36). The amplicon was detected using a digoxigenin (Dig)-labeled HIV-2 probe (SEQ ID NO: 49).

[0527] Dig HIV-1:Dig / -TTTTTTTTTTTTTTTGGAACCCACTGCTTA(SEQ ID NO:45)

[0528] Dig HIV-2:Dig / -TTTTTTTTTTTTTTTCCAGCAGTAGCAGGT (SEQ ID NO:49)

[0529] As shown in Table 7, the HIV-1 probe can detect 4 to 40,000 copies of HIV-1 and is specific for HIV-1. The HIV-2 probe can also detect 4 to 40,000 copies of HIV-2 and is specific for HIV-2.

[0530] Table 7 End-point PCR assay for HIV-1 and HIV-2 standards

[0531]

[0532] Results shown are the average of two replicates.

[0533] These results demonstrate that both real-time PCR and end-point PCR assays provide specific detection of HIV-1 or HIV-2 without cross-reactivity.

[0534] Example 10 Comparison of real-time and end-point PCR assays of isolated CD14+ cells

[0535] The assay described in Example 8 was repeated. However, in the experiment the HIV-1 plasma standard was further diluted to provide 0.2 copies / μl and 0.4 copies / μl. The number of PCR cycles for the endpoint PCR was also reduced from 50 to 40.

[0536] Blood samples were obtained from HIV-1 infected subjects and their white blood cells were separated into CD14 positive (CD14+) and CD14 negative (CD14-) cells. CD14+ cells make up about one-third of white blood cells and are mainly monocyte populations. These cells differentiate into macrophages in peripheral blood and into microglia in the brain. CD14- cells make up about two-thirds of white blood cells and include CD4+T cells.

[0537] A 6 ml blood sample was obtained from the subjects for separation into CD14+ and CD14- cell populations. The subjects were divided into two categories, those with successful antiviral treatment and those with treatment failure. Successful treatment subjects were defined as those whose HIV-1 plasma levels were controlled by antiretroviral therapy (ART). Their HIV-1 viral load was below detection levels for two consecutive years. Treatment failure subjects were defined as those whose HIV-1 plasma viral load was detectable (i.e., 20-400 copies / ml in plasma) within 2 years.

[0538] HIV-1 DNA was amplified by end-point PCR for 40 cycles using forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 9). HIV-1 DNA was amplified by real-time PCR for 50 cycles using forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 9).

[0539] Serial dilutions of plasmid standards were prepared as above, using 8 μl of standard in a 50 μl PCR reaction.

[0540] The results are shown in Table 8.

[0541] Table 8 Real-time and endpoint PCR assays of CD14+ and CD14- cells isolated from blood

[0542]

[0543] The subjects with successful treatment are indicated by ^. The subjects with treatment failure are indicated by #.

[0544] Results shown are the average of two replicates.

[0545] As shown in Table 8, the detection limit of the real-time PCR was 4 copies / μl of HIV-1 DNA standard. The endpoint assay was able to detect 0.4 copies / μl of HIV-1 DNA and was therefore more sensitive than the real-time PCR assay.

[0546] Real-time PCR analysis showed HIV-1 was detected in most CD14 cell populations from subjects. However, the assay did not detect HIV-1 in CD14+ cell populations from subjects who had failed treatment. In contrast, the endpoint assay was able to detect HIV-1 DNA in all CD14- cell populations (whether treatment-positive or treatment-negative) and in CD14+ cell populations from subjects who had failed treatment, indicating that the endpoint assay provides a more sensitive detection method.

[0547] Example 11 Analysis of HIV-2 clinical samples

[0548] In this example, the inventors wanted to determine whether plasma HIV-2 levels would increase (ie rebound) after cessation of ART.This example shows a subject with latent HIV-2 infection under ART treatment.

[0549] This example relates to a subject whose HIV-2 plasma viral load (pVL, i.e., the number of HIV-2 copies in the plasma) remained suppressed due to her ART treatment. The subject had been monitored for two years and her pVL was below the limit of detection. The subject, against the advice of her physician, stopped taking her ART in mid-June 2017. A blood sample was obtained from the subject one month after stopping ART.

[0550] Plasma was extracted from subject samples and the presence of HIV-2 RNA was determined using forward primer (SEQ ID NO: 35) and reverse primer (SEQ ID NO: 36) and probe (SEQ ID NO: 37). Endpoint and real-time PCR amplifications were performed using 50 PCR cycles.

[0551] The subjects' samples were compared with (i) HIV-2 plasmid standards (2 to 20,000 copies of HIV-2 plasmid DNA), (ii) HIV-2 positive control samples, (iii) two HIV-2 RNA-spiked controls prepared by spiking normal plasma with two different concentrations (one high and one low) of HIV-2 RNA (released into the culture supernatant of HIV-2-infected CD4+ cells), and (iv) a negative control (negative plasma sample).

[0552] The results of the real-time PCR analysis and the endpoint PCR analysis are shown in Table 9 below.

[0553] Table 9 PCR assay of HIV-2 clinical samples

[0554]

[0555] As shown in Table 9, real-time PCR was able to detect the presence of HIV-2 in the subject's samples as well as the spiked controls and the positive control. Thus, the assay confirmed that the subject still had HIV-2 in her blood.

[0556] In addition, the endpoint PCR detected the presence of HIV-2 in the subject's sample as well as the spiked control and the positive control. Thus, the assay also confirmed that the subject still had HIV-2 in her blood.

[0557] Example 12 Analysis of HIV-1 clinical samples

[0558] Two subject case studies are shown in this example. The first subject (subject 320) has a high HIV-1 antibody titer. Western blot analysis showed that there were HIV-1 antibodies against all HIV-1 (env, gag, pol) in the subject's plasma. Based on serology, the subject had a confirmed HIV-1 infection, but her pVL was negative. She did not receive any ART.

[0559] For the second subject (Subject 321), the Western blot analysis was inconclusive and has been for several years. The subject's pVL is negative and he is not receiving any ART. Based on serology, the subject is considered likely HIV-1 negative, but a more sensitive assay is needed to determine if the subject is ultimately HIV-1 negative.

[0560] PBMCs were isolated from whole blood as described in Methods and DNA extraction. For assay validation, samples were run along with the following controls: (i) HIV-1 plasmid standards containing 0, 0.2, 0.4, 4, 40, and 400 copies / μl, (ii) 6 (iii) another positive control was a sample from a known HIV-1 positive subject (subject 291), and (iv) the HUT-78 cell line as a negative control. When the assay detected 40 OM10.1 cells, the assay was considered valid.

[0561] Real-time PCR was performed in duplicate using forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 9) and HIV-1 probe (SEQ ID NO: 6). End-point PCR was also performed in duplicate using biotin-labeled reverse primer (SEQ ID NO: 9), unlabeled forward primer (SEQ ID NO: 7) and dioxin-labeled HIV-1 probe (SEQ ID NO: 45). Both real-time PCR and end-point PCR were performed in the same run with 50 cycles.

[0562] The analysis of the subjects is shown in Table 10 below.

[0563] Table 10 PCR assay of HIV-1 clinical samples

[0564]

[0565] Regarding the real-time assay, subject 320 showed one positive result and one negative result, indicating that the HIV-1 level was just above the detection limit of the assay. The estimated HIV-1 copy number for this subject was 6There were 27 HIV-1 infected cells in each PBMC (0.0027%). Subject 321 was clearly negative for HIV-1.

[0566] Regarding the endpoint assay, subject 320 was clearly positive and subject 321 was clearly negative.

[0567] Example 13 Analysis of HIV-1 in mothers and newborns

[0568] This example describes the analysis of a mother (subject 118) and her 2-month-old infant (subject 142). The mother was previously diagnosed as HIV-1 positive, but when HIV-1 is not detectable when tested with the Cepheid test and the standard viral load assay. A more sensitive assay is needed to determine the HIV status of both mother and baby.

[0569] According to the method described in the present disclosure, quantification of HIV-1 DNA and RNA was performed by real-time PCR. DNA and RNA were extracted from 2 ml of whole blood (4 ml of whole blood in total), respectively, wherein PBMC were separated by standard ficoll-hypaque density gradient centrifugation. The sample obtained from subject 118 was run in duplicate. The sample obtained from subject 142 was run four times.

[0570] The copy numbers determined for each assay are as follows:

[0571] Table 11 HIV-1 copy number

[0572] Subjects <![CDATA[HIV-1 copies / 10 6 cells]]> HIV status HIV-1 DNA assay Subject 118 (mother) 1.82 Positive Subject 142 (infant) 0 Negative Negative control 0 Negative Positive control (subject 95) 34 Positive Positive control (subject 97) 1410 Positive HIV-1 RNA transcription assay Subject 118 (mother) 51 Positive Negative control 0 Negative Positive control (subject 95) 598 Positive

[0573] Subject 95 was an HIV-1 positive individual with pVL less than 20 copies / ml and CD4 + The count is 588.

[0574] Subject 97 was an HIV-1 positive, immunocompromised individual; VL was suppressed to less than 20 copies / ml and the CD4 count was low.

[0575] Therefore, the assay can definitively diagnose the mother as HIV-1 positive and the baby as HIV-1 negative. T / A cloning confirmed that the amplified sequence was the R region sequence of HIV-1. Sequence data showed that the HIV-1 Taqman probe assay detected the HIV-1 R region sequence extracted from the sample.

[0576] Example 14 Analysis of samples determined to be negative by GeneXpart and viral load.

[0577] This example describes the quantification of HIV-1 DNA in a subject (Subject 197) who was previously found to be HIV-1 negative by both the GeneXpart assay and the viral load assay.

[0578] Quantification of HIV-1 DNA was performed by real-time PCR (triplicate) according to the method described in the present disclosure. The results are summarized in Table 12.

[0579] Table 12 HIV-1 copy number

[0580] Subjects <![CDATA[HIV-1 copies / 10 6 cells]]> HIV status Subject 197 108 Positive Negative control (subject 94) 0 Negative Positive control (subject 124) 983 Positive

[0581] Subject 124 was an HIV-1 positive control with immune failure; VL was suppressed to less than 20 copies / ml and CD4 count was low. DNA was extracted from the sample using lysis buffer.

[0582] Therefore, the assay can clearly diagnose the subject as HIV-1 positive. T / A cloning confirmed that the amplified sequence is the R region sequence of HIV-1. Sequence data showed that the HIV-1 Taqman probe assay detected the HIV-1 R region sequence extracted from the sample.

[0583] Example 15 HIV-1 transcription assay

[0584] Automated extraction of DNA and RNA from 26 subject samples obtained from St Vincent's Hospital was prepared using a Maxwell extractor (Promega). Quantification of DNA and RNA was determined according to the protocol described herein. The medical records of the 28 subjects were reviewed and the subjects were divided into two groups: the first group was the "optimal ART" group (n = 7) and the second group was the "suboptimal ART" group (n = 21). The optimal ART group was those with sustained suppression of pVL for at least 6 months and CD4 + Subjects with T cell counts above 500. The "suboptimal ART" group (n=21) experienced transient fluctuations (occasional and transient increases in pVL over a period of 6 months) and immune failure (CD4+ T cell counts below 500 counts / μl).

[0585] like Fig.14 As shown in A, there was no difference in plasma VL between the two groups of subjects (ie, optimal ART and suboptimal ART groups), and their levels were below the detection limit of the assay.

[0586] When checking HIV-1 DNA levels ( Fig.14 B), some differences were observed between the two groups. This was even more evident when RNA levels (transcriptional activity) were examined ( Fig.14 C) Quantification was determined and normalized as described herein.

[0587] like Fig.15As shown, another group within the “optimal ART” group was identified, which was called “improved optimal ART”. This group was defined as those with less than 1×10 HIV-1 DNA per 6 In this group, there was little ongoing RNA expression, most likely due to transcriptional repression. Thus, HIV-1 integration into the genome was reduced. Ideally, the goal of ART would be to move subjects into the improved optimal ART category.

[0588] Thus, the data presented provide a method for assessing HIV RNA transcriptional activity in a subject, particularly while the subject is receiving ART.

[0589] Example 16A Evidence for HIV-1 activation in latently infected cells

[0590] It is well known that HIV-1 can be activated from latently infected cell reservoirs when exposed to HIV-1 stimulants. If latently infected cell reservoirs are activated, transcription levels are expected to increase. This example tests this hypothesis by measuring RNA transcription after exposure to various stimulants.

[0591] Fourteen (14) subjects who were successfully treated with ART were examined. These subjects had pVL levels below the limit of detection and CD4 + T cell counts were more than 500 cells / μl.

[0592] PBMCs (between 3 and 6 ml) were obtained from each subject and divided into four equal portions (preferably each portion contained >1 × 10 6 cells). If the cell number was insufficient for a given subject, PBMCs were divided into three parts.

[0593] The groups are specified as follows:

[0594] Group 1: BI (BI-2536); Polo-like kinase (PLK) inhibitor

[0595] Group 2: JQ1; Barmodomain inhibitor

[0596] Group 3: PMA; phorbol-12-myristate-13-acetate (HIV activator)

[0597] Group 4: Control group (no irritant)

[0598] PBMCs were cultured in RPMI medium with 20% FBC in the presence of the indicated reagents in a 24-well plate in a CO2 incubator for 14 hours. Total RNA was extracted from the cultured PBMCs after 14 hours. HIV-RNA analysis was performed according to the method described herein.

[0599] like Fig.16 As shown, in the presence of an activating stimulus, HIV-1 transcription is activated and this increased transcription can be detected, although the degree of activation varies from subject to subject, indicating that the mechanisms of HIV-1 latency are diverse and that more than one mechanism may be required to transition from a latent state to an activated state. Thus, this assay allows the detection of HIV in latently infected cells whose pVL is typically below the detection limit of patient plasma VL. The data confirm that the transcriptional activity detected by the developed assay is a real signal, as the level of transcriptional activity is increased in the presence of HIV-1 stimulants in the culture medium compared to control cultures (in the absence of stimulants).

[0600] Example 16B Quantification of HIV by Endpoint Assay

[0601] This example shows the quantification of HIV-1 by end-point PCR. The number of PCR cycles was reduced to 40 cycles instead of performing 50 amplification cycles. Samples from eight (8) subjects were examined. Briefly, DNA from PBMC obtained from each subject was extracted using the Maxwell Extraction System (Promega) and then subjected to 40 cycles of PCR amplification. Amplification was performed using forward primers (SEQ ID NO:7) and reverse primers (SEQ ID NO:9) and probes (SEQ ID NO:6). PCR curves generated from plasmid standards are shown in Figure 1. Fig.17 As shown, and the estimated copy number was determined based on this standard curve.

[0602] The results are summarized in Table 13 below.

[0603] Table 13 Quantification of end-point PCR amplification products

[0604]

[0605] Example 17 PCR Assay for Dried Blood Spot Test (DBS) Biological Sampling

[0606] Real-time PCR and endpoint PCR analysis was performed on dried blood spot (DBS) samples. For this analysis, 8 samples with different HIV-1 RNA copy numbers (pVL) were amplified by real-time PCR and endpoint PCR. From these samples, 70 μl of whole blood was spotted on DBS paper, and RNA was extracted from these spotted samples.

[0607] As shown in Table 14, real-time PCR and end-point PCR assays can be used to detect HIV-1 RNA in a sample. For real-time PCR, amplification was performed using a forward primer (SEQ ID NO: 7) and a reverse primer (SEQ ID NO: 9) and a probe (SEQ ID NO: 6). For end-point PCR, amplification was performed using an unlabeled forward primer (SEQ ID NO: 7) and a biotin-labeled reverse primer (SEQ ID NO: 9) and a Dig-labeled probe (SEQ ID NO: 45).

[0608] These results suggest that samples can be collected from remote or underdeveloped or under-resourced areas and moved to locations where they can be analyzed.

[0609] Table 14 PCR analysis of DBS

[0610]

[0611] This disclosure also relates to the following items:

[0612] 1. A method for detecting human immunodeficiency virus (HIV) in a subject having HIV or a subject suspected of having HIV infection (AIDS), the method comprising performing PCR amplification of R region nucleic acid in a biological sample obtained from the subject, wherein the amplification comprises a forward primer and a reverse primer that hybridize to sequences located within the R region of the long terminal repeat (LTR) of HIV, and subsequently detecting any amplification, wherein detection of amplification indicates the presence of HIV in the subject.

[0613] 2. The method according to item 1, wherein the detection amplification is performed using a labeled oligonucleotide probe that hybridizes to a sequence within the amplified R region sequence.

[0614] 3. The method according to any one of items 1 to 2, wherein the nucleic acid is DNA or reverse transcribed RNA (cDNA).

[0615] 4. The method according to any one of items 1 to 3, wherein the HIV is HIV-1 or HIV-2.

[0616] 5. The method according to any one of items 1 to 4, wherein the PCR is real-time PCR.

[0617] 6. The method according to any one of items 1 to 4, wherein the PCR is an endpoint PCR.

[0618] 7. A method for quantifying HIV DNA copy number in a biological sample from a subject with HIV or a subject suspected of having HIV infection, the method comprising:

[0619] (i) amplifying and detecting HIV-R region sequences as described in item 1; and

[0620] (ii) The amplified HIV-R region sequence is quantified by reference to the corresponding HIV plasmid standard to obtain the HIV DNA copy number per sample volume.

[0621] 8. The method according to item 7, wherein the amplification is real-time PCR or end-point PCR.

[0622] 9. The method according to item 7 or 8, further comprising normalizing the HIV DNA copy number against a DNA standard to obtain the HIV DNA copy number per one or more cells in the biological sample.

[0623] 10. A method for quantifying HIV DNA copy number in a biological sample from a subject with HIV or a subject suspected of having HIV infection by normalizing to a standard, the method comprising:

[0624] (i) amplifying and detecting HIV-R region sequences according to any one of items 1 to 6;

[0625] (ii) quantifying the number of copies of the HIV-R region per volume of DNA in the sample by quantitative PCR by reference to a corresponding HIV standard;

[0626] (iii) quantifying the endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the number of copies of the housekeeping gene per volume of DNA present in the sample;

[0627] (iv) dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the sample; and

[0628] (v) calculating the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0629] 11. The method according to item 10, wherein the DNA standard is actin.

[0630] 12. A method for quantifying HIV DNA copy number in a biological sample from a subject with HIV or a subject suspected of having HIV infection, the method comprising:

[0631] (i) amplifying and detecting HIV-R region sequences according to any one of items 1 to 6;

[0632] (ii) quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of the DNA in the sample;

[0633] (iii) calculating the number of cells per volume of DNA in the sample based on DNA absorbance; and

[0634] (iv) calculating the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV DNA copy number to obtain the HIV R region DNA copy number (copy number / cell) in the biological sample.

[0635] 13. The method according to item 12, wherein quantifying the mass of DNA per volume in the sample comprises a DNA intercalating dye and measuring the fluorescence emitted by the dye.

[0636] 14. The method according to any one of items 7 to 13, comprising:

[0637] (i) obtaining an aliquot of said sample from which DNA has been extracted;

[0638] (ii) contacting the aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0639] (iii) contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence;

[0640] (iv) amplifying the R region sequence by PCR;

[0641] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of a serial dilution of an HIV standard to derive the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0642] 15. The method according to any one of items 1-4 or 7-8, wherein the forward primer or the reverse primer is labeled with biotin, and the probe is labeled with digoxigenin (Dig).

[0643] 16. The method according to item 15, wherein the forward primer comprises or consists of a sequence according to SEQ ID NO: 29, SEQ ID NO: 33 or SEQ ID NO: 35.

[0644] 17. The method according to item 15 or 16, wherein the reverse primer comprises or consists of a sequence according to SEQ ID NO: 30, SEQ ID NO: 34 or SEQ ID NO: 36.

[0645] 18. The method according to any one of items 15 to 17, wherein the labeled probe comprises or consists of a sequence according to SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, or SEQ ID NO:51.

[0646] 19. A method for monitoring antiretroviral therapy (ART) being administered to an HIV-positive subject, comprising quantifying HIV DNA copy number according to any one of items 7 to 18 at at least two time points, and comparing the difference in HIV R region DNA copy number between the at least two time points, wherein a decrease in the HIV R region DNA copy number indicates that the subject is receiving optimal / effective ART.

[0647] 20. The method according to item 19 also includes adjusting the dose or type of ART administered to the subject.

[0648] 21. A method for quantifying HIV RNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0649] (i) amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNAR region sequence according to any one of items 1 to 6; and

[0650] (ii) The amplified HIV-R region sequence is quantified by reference to the corresponding HIV plasmid standard to obtain the number of HIV RNA copies per sample volume.

[0651] 22. The method according to item 21, wherein the amplification is real-time PCR or end-point PCR.

[0652] 23. The method according to item 21 or 22, further comprising normalizing the HIV RNA copy number against an RNA standard to obtain the HIV RNA copy number per one or more cells in the biological sample.

[0653] 24. A method for quantifying HIV RNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection by normalizing to a standard, the method comprising:

[0654] (i) amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNAR region sequence according to any one of items 1 to 6;

[0655] (ii) quantifying the number of HIV-R region copies per volume of RNA in the sample by quantitative PCR by reference to corresponding HIV standards;

[0656] (iii) quantifying the endogenous housekeeping gene by quantitative PCR using the corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the number of copies of the housekeeping gene per volume of RNA present in the sample;

[0657] (iv) dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the sample; and

[0658] (v) calculating the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the HIV R region RNA copy number (copy number / cell) in the biological sample.

[0659] 25. The method according to item 24, wherein the RNA standard is GAPDH.

[0660] 26. A method for quantifying HIV RNA copy number in a biological sample from a subject having HIV or a subject suspected of having HIV infection, the method comprising:

[0661] (i) amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNAR region sequence according to any one of items 1 to 6;

[0662] (ii) quantifying the mass of RNA per volume (w / v) in the sample by measuring the absorbance of the RNA in the sample;

[0663] (iii) calculating the number of cells per volume of RNA in the sample based on RNA absorbance; and

[0664] (iv) calculating the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV RNA copy number to obtain the HIV R region RNA copy number (copy number / cell) in the biological sample.

[0665] 27. The method according to item 25, wherein quantifying the mass of RNA per volume in the sample comprises an RNA intercalating dye and measuring the fluorescence emitted by the dye.

[0666] 28. The method according to any one of items 21 to 27, wherein the HIV-R region is quantified by:

[0667] (i) obtaining an aliquot of said sample from which RNA has been extracted;

[0668] (ii) contacting the aliquot with a labeled hydrolysis oligonucleotide probe, The labeled hydrolyzed oligonucleotide Glycoside The probe hybridizes to the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0669] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region of the reverse transcribed HIV RNA (cDNA);

[0670] (iv) amplifying the R region sequence by PCR;

[0671] (v) The signal obtained from the labeled oligonucleotide is extrapolated to a standard curve obtained by corresponding amplification of a serial dilution of an HIV standard to derive the number of HIV-R region RNA copies per volume of RNA in the aliquot.

[0672] 29. The method according to any one of items 21 to 28, further comprising obtaining a biological sample from the subject, and preparing RNA from the sample.

[0673] 30. A method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0674] (i) quantifying the number of HIV-R region DNA copies according to any one of items 7 to 14;

[0675] (ii) quantifying the number of HIV-R region RNA copies according to any one of items 21 to 29;

[0676] (iii) determining a normalized HIV RNA copy number in the sample by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0677] (iv) comparing the normalized HIV RNA copy number value to one or more previous normalized values ​​obtained from the same subject;

[0678] wherein a reduction in the normalized HIV RNA copy number indicates that the subject is receiving optimal / effective ART.

[0679] 31. The method according to item 30 further comprises obtaining a biological sample from the subject, and preparing DNA and RNA from the sample.

[0680] 32. The method according to any of the preceding items, wherein the biological sample is a cell population selected from blood or tissue or any other biological fluid in which HIV infected cells are present.

[0681] 33. The method according to item 32, wherein the biological sample is PBMC.

[0682] 34. The method according to any of the preceding items, wherein the R region sequence consists of the sequence listed in SEQ ID NO: 1 or SEQ ID NO: 2.

[0683] 35. A method according to any preceding item, wherein the hydrolyzed oligonucleotide is Probe.

[0684] 36. The method according to any of the preceding items, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising about 13 to 40 consecutive nucleotides within the HIV-1 R region sequence listed in SEQ ID NO:1 or a sequence that is at least 70% identical to the consecutive nucleotides, or a sequence consisting of about 13 to 40 consecutive nucleotides within the HIV-1 R region sequence listed in SEQ ID NO:1 or a sequence that is at least 70% identical to the consecutive nucleotides.

[0685] 37. The method according to item 32, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising or consisting of the sequence 5'TAAGCAGTGGGTTCCCT 3' (SEQ ID NO: 3) or a sequence at least 70% identical thereto.

[0686] 38. A method according to item 36 or 37, wherein the oligonucleotide probe comprises or consists of the following sequence: sequence SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48.

[0687] 39. The method according to any of the preceding items, wherein the forward primer is an HIV-1 primer, which comprises the sequence SEQ ID NO: 7 or SEQ ID NO: 29 or a sequence at least 75% identical thereto, or consists of the sequence SEQ ID NO: 7 or SEQ ID NO: 29 or a sequence at least 75% identical thereto.

[0688] 40. The method according to any of the preceding items, wherein the forward primer hybridizes to an HIV-1 R region sequence, the HIV-1 R region sequence comprising or consisting of the sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO: 8) or a sequence at least 75% identical thereto.

[0689] 41. The method according to any of the preceding items, wherein the reverse primer is an HIV-1 primer, and the HIV-1 primer comprises the sequence SEQ ID NO:9 or the sequence SEQ ID NO:30 or a sequence at least 75% identical thereto, or consists of the sequence SEQ ID NO:9 or the sequence SEQ ID NO:30 or a sequence at least 75% identical thereto.

[0690] 42. The method according to any preceding item, wherein the reverse primer hybridizes to an HIV-1 R region sequence comprising or consisting of the sequence 5'GCCTCAATAAAGCTTGCCTTGAGT 3' (SEQ ID NO: 10) or a sequence at least 75% identical thereto.

[0691] 43. A method according to any of the preceding items, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising approximately 17 to 30 consecutive nucleotides in the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides, or a sequence consisting of approximately 17 to 30 consecutive nucleotides in the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides.

[0692] 44. The method according to item 43, wherein the oligonucleotide binds to the following sequence: a sequence comprising or consisting of the sequence 5'GCCTGGGTGTTCCCTGCTAGACTCT 3' (SEQ ID NO: 11) or a sequence at least 70% identical thereto.

[0693] 45. A method according to item 43 or 44, wherein the oligonucleotide probe comprises or consists of the following sequence: sequence SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53.

[0694] 46. ​​A method according to any preceding item, wherein the HIV-2 forward primer comprises a sequence according to SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35, or a sequence at least 75% identical thereto, or consists of a sequence according to SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 35, or a sequence at least 75% identical thereto.

[0695] 47. A method according to any of the preceding items, wherein the forward primer hybridizes to an HIV-2R region sequence, the HIV-2R region sequence comprising the sequence 5'-GAGAACCTCCCAGGGCTC-3' (SEQ ID NO: 15) or a sequence at least 75% identical thereto, or consisting of the sequence 5'-GAGAACCTCCCAGGGCTC-3' (SEQ ID NO: 15) or a sequence at least 75% identical thereto.

[0696] 48. A method according to any preceding item, wherein the HIV-2 reverse primer comprises or consists of the sequence SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34 or SEQ ID NO: 36 or a sequence at least 75% identical thereto.

[0697] 49. A composition for amplifying HIV-1 nucleic acid, comprising a labeled oligonucleotide probe, wherein the labeled oligonucleotide probe comprises or consists of a combination of a probe, a forward primer and a reverse primer, wherein the combination of the probe, the forward primer and the reverse primer is selected from one or more of the following combinations:

[0698] (i) oligonucleotide probe: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48;

[0699] (ii) forward primer: SEQ ID NO: 7 or SEQ ID NO: 29; and

[0700] (iii) Reverse primer: SEQ ID NO: 9 or SEQ ID NO: 30.

[0701] 50. A composition for amplifying HIV-2 nucleic acid, comprising a labeled oligonucleotide, wherein the labeled oligonucleotide comprises or consists of a combination of a probe, a forward primer and a reverse primer, wherein the combination of the probe, the forward primer and the reverse primer is selected from one or more of the following combinations:

[0702] (i) Oligonucleotide probe: SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53;

[0703] (iii) forward primer: SEQ ID NO: 14, SEQ ID NO: 31, SEQ ID NO: 33, or SEQ ID NO: 35;

[0704] (iii) Reverse primer: SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34 or SEQ ID NO: 36.

[0705] 51. A method of treating an HIV-positive subject, comprising detecting or quantifying lentiviral nucleic acid or HIV DNA and / or RNA according to any one of items 1 to 48, and administering ART to the subject.

[0706] 52. A kit for detecting HIV-1 or when used for detecting HIV-1, comprising the composition according to item 49, and suitable reagents and instructions for detecting and quantifying HIV-1 according to any one of items 1 to 48.

[0707] 53. A kit for detecting HIV-2, or when used for detecting HIV-2, comprising the composition according to item 50, and suitable reagents and instructions for detecting and quantifying HIV-2 according to any one of items 1 to 48. Sequence Listing <110> St Vincent's Hospital Sydney Pty Ltd <120> Methods for detecting lentivirus <130> 526207 <141> September 07, 2017 <160> 53 <170> PatentIn Version 3.5 <210> 1 <211> 95 <212> DNA <213> Human immunodeficiency virus type 1 <400> 1 gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact 60 gcttaagcct caataaagct tgccttgagt gcttc 95 <210> 2 <211> 124 <212> DNA <213> Human immunodeficiency virus type 2 <400> 2 ttgagccctg ggaggttctc tccagcacta gcaggtagag cctgggtgtt ccctgctaga 60 ctctcaccag cacttggccg gtgctgggca gacggcccca cgcttgcttg cttaaaaacc 120 tcct 124 <210> 3 <211> 17 <212> DNA <213> Human immunodeficiency virus type 1 <400> 3 taagcagtgg gttccct 17 <210> 4 <211> 17 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequence <400> 4 agggaaccca ctgctta 17 <210> 5 <211> 17 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequence with reporter and quencher <220> <221> misc_feature <222> (1) <223> Adenine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (17) <223> Adenine is linked to Z, where Z is a quencher molecule. <400> 5 agggaaccca ctgctta 17 <210> 6 <211> 17 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequences with locked nucleic acid <220> <221> misc_feature <222> (1) <223> Adenine linked to FAM (carboxyfluorescein) <220> <221> modified_base <222> (3) <223> LDN A <220> <221> modified_base <222> (5) <223> LNA <220> <221> modified_base <222> (7) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (11)..(11) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (13) <223> LDN A <220> <221> misc_feature <222> (17) <223> Adenine linked to BHQ-1 <400> 6 agggaaccca ctgctta 17 <210> 7 <211> 18 <212> DNA <213> Human immunodeficiency virus type 1 <400> 7 gagcctggga gctctctg 18 <210> 8 <211> 18 <212> DNA <213> Human immunodeficiency virus type 1 <400> 8 cagagagctc ccaggctc 18 <210> 9 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> HIV-1 reverse R region primer <400> 9 actcaaggca agctttattg aggc 24 <210> 10 <211> twenty four <212> DNA <213> Human immunodeficiency virus type 1 <400> 10 gcctcaataa agcttgcctt gagt 24 <210> 11 <211> 25 <212> DNA <213> Human immunodeficiency virus type 2 <400> 11 gcctgggtgt tccctgctag actct 25 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence <400> 12 agagtctagc agggaacacc caggc 25 <210> 13 <211> 25 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with reporter and quencher <220> <221> misc_feature <222> (1) <223> Adenine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (25)..(25) <223> Cytosine is linked to Z, where Z is a quencher molecule <400> 13 agagtctagc agggaacacc caggc 25 <210> 14 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-2 forward R region primer <400> 14 gagccctgag aggttctc 18 <210> 15 <211> 18 <212> DNA <213> Human immunodeficiency virus type 2 <400> 15 gagaacctcc cagggctc 18 <210> 16 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> HIV-2 reverse R region primer <400> 16 ggtctttaag caagcaagcg tgg 23 <210> 17 <211> 27 <212> DNA <213> Artificial sequence <220> <223> GAPDH probe oligonucleotide <220> <221> misc_feature <222> (1) <223> Adenine linked to FAM (carboxyfluorescein) <220> <221> misc_feature <222> (27)..(27) <223> Thymine is linked to the quencher molecule BHQ-1 <400> 17 aaggtcggag tcaacggatt tggtcgt 27 <210> 18 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> GAPDH forward primer <400> 18 ggcaacaata tccactttac cag 23 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> GAPDH reverse primer <400> 19 tcgacagtca gccgcatctt 20 <210> 20 <211> 25 <212> DNA <213> Artificial sequence <220> <223> B-actin probe oligonucleotide <220> <221> misc_feature <222> (1) <223> Adenine linked to FAM (carboxyfluorescein) <220> <221> misc_feature <222> (25)..(25) <223> Guanine is linked to the quencher molecule BHQ-1 <400> 20 atgccctccc ccatgccatc ctgcg 25 <210> twenty one <211> 25 <212> DNA <213> Artificial sequence <220> <223> B-actin forward primer <400> twenty one tcaccccacac tgtgcccatc tacga 25 <210> twenty two <211> 25 <212> DNA <213> Artificial sequence <220> <223> B-actin reverse primer <400> twenty two cagcggaacc gctcattgcc aatgg 25 <210> twenty three <211> twenty four <212> DNA <213> Artificial sequence <220> <223> 3' LTR forward primer <400> twenty three ccaaagaaga caagatatcc ttga 24 <210> twenty four <211> 18 <212> DNA <213> Artificial sequence <220> <223> 3' LTR reverse primer <400> twenty four ttgaggctta agcagtgg 18 <210> 25 <211> 29 <212> DNA <213> Artificial sequence <220> <223> 3' LTR probe oligonucleotide <220> <221> misc_feature <222> (1) <223> Thymidine linked to FAM (carboxyfluorescein) <220> <221> misc_feature <222> (29)..(29) <223> Cytosine is linked to the quencher molecule BHQ-1 <400> 25 ttagaccaga tctgagcctg ggagctctc 29 <210> 26 <211> 30 <212> DNA <213> Artificial sequence <220> <223> gag forward primer <400> 26 agtgggggga catcaagcag ccatgcaaat 30 <210> 27 <211> 28 <212> DNA <213> Artificial sequence <220> <223> gag reverse primer <400> 27 tactagtagt tcctgctatg tcacttcc 28 <210> 28 <211> 17 <212> DNA <213> Artificial sequence <220> <223> gag probe oligonucleotide <220> <221> misc_feature <222> (1) <223> Adenine linked to FAM (carboxyfluorescein) <220> <221> modified_base <222> (3) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (4) <223> LNA <220> <221> modified_base <222> (7) <223> LDN A <220> <221> modified_base <222> (13) <223> LDN A <220> <221> modified_base <222> (16) <223> LDN A <220> <221> misc_feature <222> (17) <223> Cytosine is linked to the quencher molecule BHQ-1 <400> 28 atcaatgagg aagctgc 17 <210> 29 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-1 Forward R Region Primer (HIV-1 For 2) <220> <221> misc_feature <222> (6) <223> T or C <220> <221> misc_feature <222> (15) <223> T or C <400> 29 gagccnggga gctcnctg 18 <210> 30 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> HIV-1 Reverse R Region Primer (HIV-1 Rev 2) <400> 30 actcaaggca agctttattg ag 22 <210> 31 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-2 Forward R Region Primer (HIV-2 For 1) <220> <221> misc_feature <222> (9)..(9) <223> G or A <400> 31 gagccctgng aggttctc 18 <210> 32 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> HIV-2 Reverse R Region Primer (HIV-2 Rev 1) <220> <221> misc_feature <222> (4) <223> T or C <400> 32 ggtntttaag caagcaagcg tgg 23 <210> 33 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-2 Forward R Region Primer (HIV-2 For 2) <220> <221> misc_feature <222> (9)..(9) <223> G or A <400> 33 gagccctgng aggttctc 18 <210> 34 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-2 Reverse R Region Primer (HIV-2 Rev 2) <400> 34 agggaacacc caggctct 18 <210> 35 <211> 19 <212> DNA <213> Artificial sequence <220> <223> HIV-2 Forward R Region Primer (HIV 2 For 3) <400> 35 ttgagccctg ggaggttct 19 <210> 36 <211> 18 <212> DNA <213> Artificial sequence <220> <223> HIV-2 Reverse R Region Primer (HIV-2 Rev 3) <400> 36 ggaacaccca ggctctac 18 <210> 37 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence (HIV-2 Pro 2) <400> 37 ctgctagtgc tgga 14 <210> 38 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with reporter and quencher (HIV-2 Pro 2) <220> <221> misc_feature <222> (1) <223> Cytosine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (14)..(14) <223> Adenine is linked to Z, where Z is a quencher molecule <400> 38 ctgctagtgc tgga 14 <210> 39 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with FAM and BHQ-1 (HIV-2 Pro 2) <220> <221> misc_feature <222> (1) <223> Cytosine linked to FAM (carboxyfluorescein) <220> <221> misc_feature <222> (14)..(14) <223> Adenine is linked to the quencher molecule BHQ-1 <400> 39 ctgctagtgc tgga 14 <210> 40 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with locked nucleic acid, FAM and BHQ-1 (HIV-2 Pro2) <220> <221> misc_feature <222> (1) <223> Cytosine linked to FAM (carboxyfluorescein) <220> <221> modified_base <222> (2) <223> Locked Nucleic Acid Thymidine <220> <221> modified_base <222> (4) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (6) <223> LNA <220> <221> modified_base <222> (8) <223> Locked Nucleic Acid Thymidine <220> <221> modified_base <222> (9)..(9) <223> LDN A <220> <221> modified_base <222> (13) <223> LDN A <220> <221> misc_feature <222> (14)..(14) <223> Adenine is linked to the quencher molecule BHQ-1 <400> 40 ctgctagtgc tgga 14 <210> 41 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence (HIV-2 Pro 3) <400> 41 tccagcacta gcag 14 <210> 42 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide (HIV-2 Pro 3) sequence with reporter and quencher <220> <221> misc_feature <222> (1) <223> Thymine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (14)..(14) <223> Guanine is linked to Z, where Z is a quencher molecule <400> 42 tccagcacta gcag 14 <210> 43 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with FAM and BHQ-1 (HIV-2 Pro 3) <220> <221> misc_feature <222> (1) <223> Thymidine linked to FAM (carboxyfluorescein) <220> <221> misc_feature <222> (14)..(14) <223> Guanine is linked to the quencher molecule BHQ-1 <400> 43 tccagcacta gcag 14 <210> 44 <211> 14 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with locked nucleic acid, FAM and BHQ-1 (HIV-2 Pro3) <220> <221> misc_feature <222> (1) <223> Thymidine linked to FAM (carboxyfluorescein) <220> <221> modified_base <222> (2) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (4) <223> LNA <220> <221> modified_base <222> (6) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (8) <223> Locked Nucleic Acid Cytosine <220> <221> modified_base <222> (10)..(10) <223> LNA <220> <221> modified_base <222> (12)..(12) <223> Locked Nucleic Acid Cytosine <220> <221> misc_feature <222> (14)..(14) <223> Guanine is linked to the quencher molecule BHQ-1 <400> 44 tccagcacta gcag 14 <210> 45 <211> 16 <212> DNA <213> HIV-1 R region probe oligonucleotide sequence (HIV-1 Pro 2) <220> <221> misc_feature <222> (1) <223> 5-20 T nucleotides <400> 45 nggaacccac tgctta 16 <210> 46 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequence with reporter and quencher (HIV-1 Pro 2) <220> <221> misc_feature <222> (1) <223> Guanine X-linked, where X is the reporter molecule <220> <221> misc_feature <222> (15) <223> Adenine is linked to Z, where Z is a quencher molecule <400> 46 ggaacccact gctta 15 <210> 47 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequence (HIV-1 Pro 3) <400> 47 agggaaccca ctgct 15 <210> 48 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-1 R region probe oligonucleotide sequence with reporter and quencher (HIV-1 Pro 3) <220> <221> misc_feature <222> (1) <223> Adenine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (15) <223> Thymine Z linkage, where Z is a quencher molecule <400> 48 agggaaccca ctgct 15 <210> 49 <211> 17 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence (HIV-2 Pro 4) <220> <221> misc_feature <222> (1) <223> 5-20 T nucleotides <400> 49 ntccagcact agcaggt 17 <210> 50 <211> 16 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with reporter and quencher (HIV-2 Pro 4) <220> <221> misc_feature <222> (1) <223> Thymine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (16) <223> Thymine is linked to Z, where Z is a quencher molecule <400> 50 tccagcacta gcaggt 16 <210> 51 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence (HIV-2 Pro 5) <400> 51 ctccagcact agcag 15 <210> 52 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with reporter and quencher (HIV-2 Pro 5) <220> <221> misc_feature <222> (1) <223> Cytosine is linked to X, where X is a reporter molecule <220> <221> misc_feature <222> (15) <223> Guanine is linked to Z, where Z is a quencher molecule <400> 52 ctccagcact agcag 15 <210> 53 <211> 15 <212> DNA <213> Artificial sequence <220> <223> HIV-2 R region probe oligonucleotide sequence with locked nucleic acid (HIV-2 Pro-5) <220> <221> misc_feature <222> (2) <223> Locked Nucleic Acid Thymidine <220> <221> misc_feature <222> (5) <223> LNA <220> <221> misc_feature <222> (6) <223> LDN A <220> <221> misc_feature <222> (8) <223> LNA <220> <221> misc_feature <222> (11)..(11) <223> LNA <220> <221> misc_feature <222> (13) <223> Locked Nucleic Acid Cytosine <400> 53 ctccagcact agcag 15

Claims

1. Use of a forward primer and a reverse primer that hybridize to sequences within the R region of the long terminal repeat (LTR) located at the 5' end and the 3' end of human immunodeficiency virus (HIV) in the preparation of a kit for detecting HIV in a subject having HIV or a subject suspected of having HIV infection (AIDS), wherein the kit is used to perform PCR amplification of R region nucleic acid in a biological sample obtained from the subject using the forward primer and the reverse primer, and subsequently detect any amplification, wherein detection of amplification indicates the presence of HIV in the subject, wherein: (i) the forward primer is an HIV-1 primer comprising or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29, and the reverse primer is an HIV-1 primer comprising or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or (ii) the forward primer is an HIV-2 primer comprising or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, and the reverse primer is an HIV-2 primer comprising or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:

36.

2. The use according to claim 1, wherein the detection amplification is performed using a labeled oligonucleotide probe that hybridizes to a sequence within the amplified R region sequence.

3. The method according to any one of claims 1 to 2, wherein the nucleic acid is DNA or reverse transcribed RNA (cDNA).

4. The use according to claim 1, wherein the HIV is HIV-1 or HIV-2.

5. The use according to claim 1, wherein the PCR is real-time PCR. The use according to claim 1 , wherein the PCR is end-point PCR.

7. The use according to claim 2, wherein the forward primer or the reverse primer is labeled with biotin, and the labeled oligonucleotide probe is labeled with digoxigenin (Dig).

8. The method according to claim 2, wherein the labeled oligonucleotide probe comprises or consists of a sequence according to: SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, or SEQ ID NO:

51.

9. Use of a forward primer and a reverse primer that hybridize to sequences within the R region of the long terminal repeat (LTR) located at the 5' end and the 3' end of HIV in the preparation of a kit for quantifying the number of HIV DNA copies in a biological sample from a subject with HIV or a subject suspected of having HIV infection, wherein the kit is used to perform PCR amplification of R region nucleic acid in a biological sample obtained from the subject using the forward primer and the reverse primer, wherein: (i) the forward primer is an HIV-1 primer comprising or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29, and the reverse primer is an HIV-1 primer comprising or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or (ii) the forward primer is an HIV-2 primer comprising or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, and the reverse primer is an HIV-2 primer comprising or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; and The amplified HIV-R region sequence is quantified by referring to the corresponding HIV plasmid standard to obtain the HIV DNA copy number per volume of the biological sample.

10. The use according to claim 9, wherein the amplification is real-time PCR or end-point PCR.

11. The use according to claim 9, further comprising normalizing the HIV DNA copy number against a DNA standard to obtain the HIV DNA copy number per one or more cells in the biological sample.

12. The use according to any one of claims 9 to 11, comprising: (i) obtaining an aliquot of the biological sample from which DNA has been extracted; (ii) contacting the aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA; (iii) contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence; (iv) amplifying the R region sequence by PCR; (v) Extrapolating the signal obtained from the labeled hydrolyzed oligonucleotide probe to a standard curve obtained by corresponding amplification of a serial dilution of an HIV standard to derive the number of HIV-R region DNA copies per volume of DNA in the aliquot.

13. Use of a forward primer and a reverse primer that hybridize to a sequence located within the R region of the long terminal repeat (LTR) of HIV in the preparation of a kit for monitoring antiretroviral therapy (ART) being administered to HIV-positive subjects, wherein the kit is used to quantify the HIV DNA copy number at at least two time points according to the use described in any one of claims 9 to 12, and compare the difference in HIV R region DNA copy number between the at least two time points, wherein a decrease in the HIV R region DNA copy number indicates that the subject is receiving optimal / effective ART.

14. The use according to claim 13, further comprising adjusting the dose or type of ART administered to the subject.

15. The use according to claim 1 or 9, wherein the biological sample is a cell population selected from blood or tissue or any other biological fluid in which HIV infected cells are present.

16. The use according to claim 15, wherein the biological sample is PBMC.

17. The use according to 1 or 9, wherein the R region sequence consists of the sequence listed in SEQ ID NO:1 or SEQ ID NO:

2.

18. The method according to claim 2, wherein the oligonucleotide probe comprises or consists of the following sequence: Sequence SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:

48.

19. The method according to claim 2, wherein the oligonucleotide probe comprises or consists of the following sequence: Sequence SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:

53.

20. A composition for amplifying HIV-1 nucleic acid, comprising a labeled oligonucleotide probe, a forward primer and a reverse primer, wherein the probe, the forward primer and the reverse primer are selected from one or more combinations of the following: (i) an oligonucleotide probe comprising or consisting of the following sequence: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48; (ii) a forward primer comprising or consisting of the sequence SEQ ID NO: 7 or SEQ ID NO: 29; and (iii) a reverse primer comprising or consisting of the sequence SEQ ID NO: 9 or SEQ ID NO:

30.

21. A composition for amplifying HIV-2 nucleic acid, comprising a labeled oligonucleotide probe, a forward primer and a reverse primer, wherein the probe, the forward primer and the reverse primer are selected from one or more combinations of the following: (i) an oligonucleotide probe comprising or consisting of the following sequence: SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53; (iii) a forward primer comprising or consisting of the following sequence: SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID NO:35; (iii) a reverse primer comprising or consisting of the following sequence: SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:

36.

22. A kit for detecting HIV-1 or when used for detecting HIV-1, comprising the composition according to claim 20, and suitable reagents and instructions for detecting and quantifying HIV-1.

23. A kit for detecting HIV-2, or when used for detecting HIV-2, comprising the composition according to claim 21, and suitable reagents and instructions for detecting and quantifying HIV-2.

Images