sgRNA for editing βIVS-2-654 splicing mutation based on CRISPR / Cas9 technology

Abstract

The present invention discloses a sgRNA, vector and application for editing βIVS-2-654 splicing mutation based on CRISPR / Cas9 technology. The nucleotide sequence thereof is shown in SEQ ID No: 1, SEQ ID No: 2 or SEQ ID No: 3. By microinjecting sgRNA and Cas9 mRNA into β 654 The gene-edited thalassemia mice were obtained from the fertilized eggs of thalassemia mice, in which the abnormal splicing of β-globin mRNA was corrected and the expression of β-globin was restored. 654 The hematological and pathological phenotypes of thalassemia mice were significantly improved. Therefore, the CRISPR system for repairing abnormal splicing has important clinical application value for the precise gene editing treatment of splicing abnormal single gene diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an sgRNA, vector and application for editing βIVS-2-654 splicing mutations based on CRISPR / Cas9 technology. Background Art

[0002] β-thalassemia (abbreviated as β-thalassemia) is a widespread, single-gene genetic disorder. The pathogenesis of β-thalassemia is due to mutations in the β-globin gene, which leads to reduced or deficient β-globin chain synthesis, resulting in an α / β-globin chain imbalance. Excess α-globin chains cannot combine with β-globin chains to produce normal hemoglobin (α2β2). Instead, they form inclusion bodies that damage the membranes of immature red blood cells, causing a large number of them to be destroyed in the bone marrow. The inclusion bodies adhere to the red blood cell membranes of the red blood cells released into the peripheral blood, making them rigid and susceptible to tearing during circulation. This affects red blood cell permeability and shortens cell lifespan. Ineffective hematopoiesis or shortened lifespan leads to hemolytic anemia.

[0003] Currently cured beta 654 The only effective treatment for thalassemia is allogeneic hematopoietic stem cell (HSC) transplantation. However, widespread adoption is severely limited by three key issues: immune rejection, graft-versus-host disease (GVHD), and limited availability of HSCs with matching major histocompatibility antigens. Given the numerous drawbacks of allogeneic HSC transplantation, transplantation of gene-corrected autologous HSCs is the ideal alternative: autologous HSCs are free from donor restrictions, avoid immune rejection and GVHD associated with allogeneic transplantation, and significantly reduce transplantation risks.

[0004] Gene editing for autologous HSCs transplantation therapy 654 Thalassemia provides an effective approach and is currently a research hotspot in the field of inherited blood diseases. Gene editing can target gene mutations for purposeful gene modification, thereby correcting genetic defects and achieving therapeutic effects.

[0005] According to β 654 The pathogenesis of thalassemia, and the root cause of abnormal β-globin splicing, is the IVS-2-654C>T mutation, which leads to the creation of a new splice site and, in turn, an additional abnormal 73bp exon. Deleting the mutation site or the abnormal 73bp exon sequence should theoretically prevent the abnormal splicing of β-globin mRNA. Furthermore, because the mutation is located within the middle sequence of the second intron, deletion of the mutation site or the abnormal exon sequence does not affect the exon sequence of β-globin, and therefore, does not affect the expression and function of β-globin. Summary of the Invention

[0006] The purpose of the present invention is to provide an sgRNA, vector and application for editing βIVS-2-654 splicing mutation based on CRISPR / Cas9 technology.

[0007] A sgRNA for editing a βIVS-2-654 splicing mutation based on CRISPR / Cas9 technology, wherein the nucleotide sequence thereof is shown in SEQ ID No: 1, SEQ ID No: 2 or SEQ ID No: 3.

[0008] A CRISPR / Cas9 expression vector comprising the sgRNA.

[0009] A cell line comprising the CRISPR / Cas9 expression vector.

[0010] A gene editing kit comprising the sgRNA.

[0011] The use of the sgRNA in editing the βIVS-2-654 mutation site.

[0012] A CRISPR / Cas9-based method for editing the βIVS-2-654 splicing mutation involves cloning two sgRNA-targeted DNA fragments containing IVS-2-654C→T and IVS-2-579 into the pSpCas9(BB)-2A-Puro(pX459) backbone vector, respectively. The constructed vectors are then co-transfected into 293T cells and cultured.

[0013] Beneficial effects of the present invention: The present invention designed sgRNAs upstream of the cryptic splicing site 579 and downstream of the mutation site 654, respectively, hoping to remove the abnormal 73bp exon fragment, thereby correcting the abnormal splicing. The present invention demonstrates the use of CRISPR / Cas9 genome editing to remove the abnormal 73bp exon fragment, which contains β 654 Mutated splice sites and cryptic splice sites in mice. This study demonstrated that in gene-edited mice, β-globin gene expression was successfully restored, and thalassemia symptoms disappeared or were alleviated, demonstrating the important clinical application value of the CRISPR system for repairing splicing abnormalities in gene editing for precision treatment of single-gene diseases caused by splicing abnormalities. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Screening of sgRNA and identification of target DNA fragments for targeted deletion;

[0015] Figure: (A) Schematic diagram of the sgRNA that targets the β-globin locus to create an additional 73-nt exonic DNA fragment. The position of the sgRNA is marked with a red line. (B) Gel electrophoresis analysis of PCR products from 293T cells transfected with different CRISPR / Cas9 plasmid pairs shows that the wild-type (WT) amplicon is 616 bp, and the gene-edited amplicon is 480 bp. The deletion efficiency is shown below each lane. Lanes: M, 100 bp DNA marker; 1, non-transfected control; 2, T vector transfected control; 3, Cas9 plasmid transfected alone; 4, G1+G2; 5, G1+G3; (C) Sanger sequencing results of subclones from the G1+G2 PCR product. The sequences in bold represent the sgRNA sequences.

[0016] Figure 2 To identify the editing beta 654 Restoration of the correct splicing pathway for β-globin mRNA in mice;

[0017] In the figure, (A)β 654 PCR analysis of mice; M, 100 bp DNA marker; Lanes 2-9, genomic DNA of gene-edited mice; WT, genomic DNA from wild-type mice; 654, from β 654 Mouse genomic DNA; (B) from edited β 654 Subcloning and Sanger sequencing results of PCR products from mice; (C) Analysis of human β-globin mRNA expression in blood cells by RT-PCR; the 399 bp band indicates the correct splicing pattern, while the 472 bp band indicates abnormal splicing; 1: human. 2: wild-type mouse; 3: β 654 Mouse; 4-10: Gene Editing β 654 Mice; (D) Western Blot analysis of human β-globin expression; 1: human β-globin; 2-3: wild-type mice; 4-5: gene-edited β 654 Mouse; 6-7: β 654 Mouse; α-globin was used as an internal control.

[0018] Figure 3 For gene editing β 654 Figure 3. RBC morphology and histopathological changes in mouse tissues.

[0019] In the figures, (A) Swiss-Giemsa-stained blood smear shows that the number of foreign cells and target cells is significantly reduced in edited mice (400x); (B) Swiss-Giemsa-stained bone marrow smear (400x); (C) Spleen sections stained with hematoxylin-eosin (100x); (D) Spleen sections stained with hematoxylin-eosin (400x); (E) Ferric ferrocyanide staining of liver sections (400x).

[0020] Figure 4 For gene editing β 654 Figure 1 shows spleen weight and size of mice;

[0021] In the figure, (A) gene editing β 654 Spleen size of mice; 1-2: wild-type mice; 3-4: gene-edited β 654 Mouse; 5-6: β 654 Mouse; (B) Gene editing β 654 The spleen coefficient of mice is expressed as spleen mass divided by body weight; * and β 654 There was a statistically significant difference between the mice (P < 0.01).

[0022] Figure 5 For gene editing β 654 Survival rates of F1 and F2 generations of mice;

[0023] In the figure, (A) Survival rate of weaned mice in the F1 generation. (B) Survival rate of weaned mice in the F2 generation. *P<0.05; **P<0.01. DETAILED DESCRIPTION

[0024] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0025] Unless otherwise specified, all reagents mentioned below are commercially available. For the sake of brevity, some operations do not describe in detail the parameters, steps, and instruments used. It should be understood that these are well known and reproducible to those skilled in the art.

[0026] All experimental data described below were analyzed using GraphPad 5. Student's t-test was used for comparisons between groups. P values ​​< 0.05 and 0.01 were considered statistically significant.

[0027] Example 1 Screening of sgRNA and Construction of CRISPR Plasmid

[0028] Based on the predicted high targeting efficiency and low off-target effects determined by the online tool CRISPOR, three sgRNAs were designed as follows:

[0029] G1:TAAATTGTAACTGATGTAAG (SEQ ID No: 1)

[0030] G2:TGCCCTGAAAGAAAGAGATT (SEQ ID No: 2)

[0031] G3:TCCCTAATCTCTTTCTTTCA (SEQ ID No: 3)

[0032] They are located at the 5' upstream and 3' downstream of the 73 bp extra exon sequence ( Figure 1 A).

[0033] Then, two sgRNA-targeting DNA fragments containing IVS-2-654C→T and IVS-2-579 were cloned into the pSpCas9(BB)-2A-Puro(pX459) backbone vector, respectively.

[0034] Example 2 Cell culture and transfection

[0035] 293T cells were cultured in high-glucose DMEM medium supplemented with 10% fetal bovine serum. To analyze the gene editing efficiency of sgRNA, 293T cells were cultured in 12-well plates and mixed with a total of 1 μg of DNA plasmid pairs (0.5 μg of each plasmid) using Lipofectamine 3000 (Invitrogen). After 72 hours, cells were harvested and genomic DNA was extracted.

[0036] The combination of CRISPR plasmid pairs can generate two double-strand breaks, resulting in deletion of the targeted sequence. The deletion efficiency of different CRISPR plasmid pairs was determined by PCR verification ( Figure 1 B). The results showed that the deletion efficiency of the CRISPR plasmid pair (G1+G2) was as high as 55%, which can be used for subsequent experiments. The sequence generated by the gene editing of the plasmid pair was further determined by Sanger sequencing ( Figure 1 C).

[0037] Example 3 Gene Editing β 654 Preparation and screening of mice

[0038] Female C57 mice and male β 654After mouse hybrid fertilization, fertilized eggs were collected from the oviduct of female mice, and sgRNA (50 ng / μL) and Cas9 mRNA (50 ng / μL) were microinjected into their nuclei. Three weeks after birth, PCR amplification analysis was performed using primers beta-L: GACCAAATCACGGTAATTTTGC and beta-R: GGCAGAATCCAGATGCTCAA to identify the gene-edited β 654 mouse.

[0039] A total of 37 newborn mice were obtained, and 12 of them were β-positive by PCR analysis. 654 mice. β-cells obtained by microinjection 654 The weaning rate of mice was 32.4%, which was consistent with the results of β 654 β-cells derived from natural hybridization between mice and wild mice 654 Therefore, microinjection of sgRNA and Cas9 mRNA will not affect β 654 According to PCR analysis, the size of some amplified fragments was significantly smaller than β 654 mouse, suggesting that a deletion may have occurred ( Figure 2 A).

[0040] To further confirm the gene sequence deletion, we performed Sanger sequencing on the PCR products. 654 The mouse's gene sequence was gene-edited. 654 The efficiency of gene editing in mice was 83.3% (10 / 12). 654 We cloned the PCR products of gene-edited mice by TA and identified the gene sequences by Sanger sequencing. The results showed that the genes of 7 mice had different degrees of deletion (60bp-169bp) at the target sequence position ( Figure 2 B).

[0041] Example 4 Gene Editing to Restore β-Globin Gene Expression

[0042] To study β 654 To determine whether gene deletion of the mouse 73bp extra exon could restore β-globin splicing and expression, the inventors analyzed the expression of β-globin genes in the peripheral blood of edited mice. First, total RNA was extracted from the peripheral blood of edited mice and RT-PCR was performed to analyze the expression of human β-globin genes in edited mice. The results showed that correctly spliced ​​β-globin transcripts (399bp) could be detected in edited mice, while β-globin transcripts (399bp) were not detected in β-globin. 654 In mice, only the abnormally spliced ​​fragment (472 bp) was detected ( Figure 2C).

[0043] Western Blot: From gene editing to β 654 Mouse, β 654 Peripheral blood samples were collected from the tails of mice and wild-type mice and washed twice with phosphate-buffered saline (PBS). All blood samples were centrifuged at 3000 rpm / min for 20 min, and the supernatant discarded. Hemolysis was performed by adding two volumes of sterile water, followed by the addition of 0.5 volumes of tetrachloromethane to the hemolyzed blood and vigorous vortexing for 2 min. The hemoglobin supernatant was extracted by adding 0.5 volumes of tetrachloromethane and then centrifuged at 3000 rpm / min for 15 min. The diluted supernatant (including the hemoglobin sample) was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and electrophoretically transferred to a nitrocellulose membrane (Amersham Pharmacia UK, Ltd., Buckinghamshire, UK) and blocked overnight at 4°C with 5% skim milk. The primary antibody used was a monoclonal rabbit anti-human β-globin antibody (1:2000), and the secondary antibody was a horseradish peroxidase-conjugated goat anti-rabbit IgG (1:2000). In all mice tested, human and mouse α-globin were detected by polyclonal rabbit anti-human α-globin (1:2000). 654 Mouse samples were used as negative controls, and human samples were used as positive controls.

[0044] Western blot analysis further confirmed the presence of normal β-globin in edited mice ( Figure 2 D) These results demonstrate that human β-globin expression is restored in edited mice.

[0045] Example 5 Hematological and Histopathological Analysis

[0046] Peripheral blood samples were collected from mice by tail docking for hematological analysis. Hematological parameters measured included red blood cell (RBC) count, hemoglobin (HGB) concentration, hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and reticulocyte count (RET) using a Hematology Analyzer (KX-21, Sysmex, Japan). Separately, 1-2 μL of blood was collected for Swiss-Giemsa-stained blood smears. Small pieces of liver and spleen tissue were embedded in paraffin, cut into 4 μm-thick sections, and stained with hematoxylin and eosin. Bone marrow smears were stained with Swiss-Giemsa.

[0047] The inventors measured hematological parameters every two weeks for three months, and the average data showed that654 Compared with wild-type mice, the levels of RBC, HGB, HCT, MCV, and MCH were significantly increased in the edited mice. Furthermore, the number of reticulocytes was found to decrease from 19.17% to 3.78%. More notably, all hematological parameters examined showed no significant differences compared with wild-type mice (p < 0.01) (Tables 1-2), indicating that anemia symptoms in the gene-edited mice were significantly improved.

[0048] Table 1. Hematological analysis

[0049]

[0050] Values ​​are means ± standard deviation; a P<0.01.

[0051] Table 2. Hematological analysis

[0052]

[0053] Values ​​are means ± standard deviation; a P<0.01.

[0054] β 654 Morphological changes in bone marrow, spleen, and liver after gene editing in mice:

[0055] In β 654 In mice, due to ineffective hematopoiesis, bone marrow hyperplasia is obvious, so in β 654 A significant increase in the proportion of nucleated red blood cells can be observed in the bone marrow smears of mice. 654 Compared with mice, the proportion of nucleated cells in the bone marrow of edited mice was significantly reduced, indicating that abnormal bone marrow proliferation and erythropoiesis were greatly improved ( Figure 3 B).

[0056] To detect the improvement of extramedullary hematopoiesis in edited mice, the inventors performed morphological examinations on the spleen and liver of 7-month-old edited mice and age-matched controls. 654 Compared with mice, the histopathological manifestations of the spleen of edited mice were that the red pulp was significantly reduced and the marginal areas of red and white pulp were obvious ( Figure 3 C) and β 654 Compared with mice, the hemosiderin content in the spleen of edited mice was significantly reduced ( Figure 3 D) In ​​addition, β 654 Significant iron deposition was observed in the livers of mice, whereas almost no iron deposition was observed in the edited mice ( Figure 3 E).

[0057] To investigate the improvement of spleen enlargement in edited mice, the inventors weighed the spleens of edited mice. 654The spleen coefficient of edited mice was significantly reduced compared with wild-type mice, while there was no significant difference between edited mice and wild-type mice ( Figure 4 ).

[0058] To investigate whether the therapeutic effects of gene editing can be stably inherited in the offspring of edited mice, the inventors mated F0-generation edited mice with wild-type mice to obtain the F1 generation, and then mated F1-generation siblings to obtain the F2 generation. PCR and Sanger sequencing were then used to identify the F1 and F2 offspring carrying the edited genotype. According to Mendelian inheritance, the β-actin gene in the F1 and F2 offspring is the most likely to be inherited. 654 The survival rates of the mice were 50% and 75%, respectively. 654 Thalassemia reduces β 654 The survival rates of mice were only 29.0% and 43.4%, respectively. Figure 5 A, Table 3). However, the survival rate of the edited mice F1 generation was 45.6%, and that of the F2 generation was 72.0% ( Figure 5 B, Table 3), indicating that after gene editing, β 654 The survival rate of mice has been greatly improved. 654 Homozygous mice die in the embryonic stage, so mice that would not normally survive survive 654 Homozygous mice. After gene editing therapy, we obtained viable β 654 Homozygous mice. The results of hematological parameter monitoring showed that the gene-edited β 654 Erythrocyte index and β 654 The levels of WT mice were significantly improved compared with those of WT mice (Table 4-5).

[0059] Table 3

[0060]

[0061] Table 4. Gene Editing β 654 Hematological analysis of mouse offspring

[0062]

[0063] Values ​​are means ± standard deviation; a P<0.01.

[0064] Table 5. Gene Editing β 654 Hematological analysis of mouse offspring

[0065]

[0066] Values ​​are means ± standard deviation; a P<0.01.

[0067] Deleting only the cryptic splicing site βIVS-2-579 can also achieve therapeutic effects:

[0068] like Figure 2 As shown in Figure B, mice that deleted only the fragment containing the cryptic splice site (IVS-2-579) showed no difference in treatment effect compared with mice that deleted the 73 bp additional exon fragment. These results indicate that even without correcting β 654 Mutation lacking IVS-2-579 was also sufficient to disrupt the aberrant splicing pathway, thereby restoring β-globin expression.

[0069] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims. Sequence Listing <110> Shanghai Children's Hospital Shanghai Fanyi Biotechnology Co., Ltd. <120> sgRNA for editing βIVS-2-654 splicing mutation based on CRISPR / Cas9 technology <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 taaattgtaa ctgatgtaag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tgccctgaaa gaaagagatt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 tccctaatct ctttctttca 20

Claims

1. A method for editing βIVS-2-654 splicing mutations based on CRISPRCas9 technology, characterized in that: Two sgRNA-targeted DNA fragments containing IVS-2-654 C→T and IVS-2-579 were cloned into the pSpCas9(BB)-2A-Puro(pX459) backbone vector, and the constructed vectors were co-transfected into 293T cells and cultured; The SgRNA targeting DNA fragments are shown in SEQ ID No: 1 and SEQ ID No: 2.

Images