Cell culture methods, engineered antibodies, cell culture media, cell products, and uses thereof
By modifying antibodies to reduce their affinity for Fc receptors, the problems of low purity and viability in cell culture have been solved, enabling efficient cell culture and clinical applications, simplifying the operation process, and improving the purity and viability of cell products.
Patent Information
- Application Number
- CN202010230370.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-03-27
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2040-03-27
AI Technical Summary
Existing cell culture methods often result in low cell purity and viability, leading to complexity and uncertainty in scientific research and clinical applications. In particular, it is difficult to control the function of non-target cells during large-scale culture, affecting the reproducibility of studies and the safety of treatments.
The modified antibody is used, which reduces the affinity of the antibody for the Fc receptor through protein modification, including sequence substitution, point mutation, and sequence insertion. This weakens the binding of the antibody to the Fc receptor and makes it suitable for cell culture systems, thereby improving the stability and utilization of the antibody.
It improves the purity and viability of target cells in cell culture, simplifies the operation process, expands the application scope of scientific research, and enhances the safety and effectiveness of clinical applications.
Smart Images

Figure CN111411079B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular biology and cell biology, in particular to a cell culture method, an engineered antibody, a cell culture medium, a cell product and application thereof. BACKGROUND
[0002] At present, the commonly used cell culture method in vitro applies a cell culture antibody to bind to a specific receptor molecule on the surface of target cells in order to achieve the purpose of activating or blocking a signal pathway, so as to promote the directional differentiation, continuous expansion or apoptosis of the target cells. In small-scale culture, the antibody is usually coated on the surface of a culture dish or cross-linked to a magnetic bead. In large-scale culture, in order to avoid a long and uncontrollable coating process or to save the cost of magnetic beads and avoid the introduction of exogenous substances or for other purposes of process optimization, the antibody is usually directly added to the culture medium. However, the final product obtained in this way generally has the problems of low purity and low activity.
[0003] Low purity of target cells means that there are too many other types of cells in the final product. The functions of these non-target cells are different from those of the target cells, and the components thereof are usually difficult to control, which greatly increases the complexity of scientific experiments, especially animal and human in vivo experiments, and seriously affects the repeatability of the research.
[0004] Similarly, in the clinical treatment application, in view of safety and effectiveness, it is also necessary to obtain a cell product with as high purity and activity as possible for cell therapy. SUMMARY
[0005] Therefore, it is necessary to provide a cell culture method capable of improving the purity and activity of cells.
[0006] The present application discloses a cell culture method, comprising the following steps: adding an engineered antibody to a culture system; the engineered antibody is a cell culture antibody whose region other than a complementarity determining region is subjected to protein engineering, and the affinity of the engineered antibody to an Fc receptor is lower than that of a cell culture antibody without protein engineering to the Fc receptor.
[0007] The present application also discloses an engineered antibody, which is a cell culture antibody whose region other than a complementarity determining region is subjected to protein engineering, and the affinity of the engineered antibody to an Fc receptor is lower than that of a cell culture antibody without protein engineering to the Fc receptor.
[0008] The present application also discloses a cell culture medium comprising a basic culture medium and the engineered antibody.
[0009] The application also discloses a cell product obtained by the cell culture method.
[0010] The application also discloses application of the cell product in preparation of a medicine and a reagent with a killing effect on tumor cells.
[0011] The application also discloses a medicine for cancer treatment, which comprises the cell product.
[0012] The application also discloses a medicine for allogeneic cell treatment, which comprises the cell product.
[0013] Based on the technical scheme, the application has the following beneficial effects:
[0014] The application is suitable for an established cell culture process, does not change the original mechanism of the antibody for cell culture, and does not need to make great changes to the culture process. In particular, the application is suitable for the case that the antibody for cell culture is directly added to the culture medium in the widely used large-scale cell culture process, and the operation is simple.
[0015] The application can improve the stability of the antibody for cell culture in the cell culture system, and also improves the utilization rate of the antibody. By optimizing the culture process, the use amount of the raw material antibody can be reduced.
[0016] The application avoids the ADCP / ADCC effect of immune cells, in particular macrophages, monocytes and NK cells, etc. in the starting raw material cells on the target cells in the primary cell culture, improves the survival rate and the final yield of the target cells. In particular, when the target cells to be cultured and expanded are immune cells such as macrophages, monocytes and NK cells, the purity and the viability of the target cells in the final product are improved more obviously.
[0017] The application can provide target cell products with higher purity and higher viability, expand the application of the cell products in scientific research, and improve the safety and effectiveness of the cell products in clinical application. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 A schematic diagram for modification of the heavy chain of the mouse IgG1 monoclonal antibody 3G8 against human CD16 in modification example 1;
[0019] Figure 2 A UV absorption curve diagram for cleaning and elution steps of Protein A column chromatography in modification example 1;
[0020] Figure 3 A reduced SDS-PAGE electrophoresis detection diagram of the target protein in modification example 1;
[0021] Figure 4Figure 1 is a schematic diagram of the modification of the heavy chain of the humanized IgGl type Campath-1H monoclonal antibody against human CD52 in Modification Example 1;
[0022] Figure 5 Figure 2 is a reduced SDS-PAGE electrophoretogram of the target protein in Modification Example 1;
[0023] Figure 6 Figure 3 is a schematic diagram of the modification of the mouse IgG2a monoclonal antibody OKT3 against human CD3 in Modification Example 3;
[0024] Figure 7 Figure 4 is a reduced SDS-PAGE electrophoretogram of the target protein in Modification Example 3;
[0025] Figure 8 Figure 5 is a graph of the viability fitting curve of the T cell expansion by the prototype antibody OKT3 and the aCD3-SH prepared in Modification Example 3 in Culture Example 1;
[0026] Figure 9 Figure 6 is a graph of the NKT cell expansion by the prototype antibody OKT3 and the aCD3-SH prepared in Modification Example 3 in Culture Example 2;
[0027] Figure 10 Figure 7 is a flow cytometry analysis graph of the cells expanded by the modified antibody group and the cells expanded by the prototype antibody group in Culture Example 3;
[0028] Figure 11 Figure 8 is a graph of the killing test results of the Raji cells by the test group NK cell product and the control group NK cell product in Application Example 1;
[0029] Figure 12 Figure 9 is a graph of the killing test results of the BT-474 cells by the test group NK cell product and the control group NK cell product in Application Example 1;
[0030] Figure 13 Figure 10 is a graph of the killing test results of the MCF7 cells by the test group NK cell product and the control group NK cell product in Application Example 1;
[0031] Figure 14 Figure 11 is a graph of the tumor imaging signal intensity of the two groups of mice in Application Example 2;
[0032] Figure 15 Figure 12 is a survival curve graph of the mice in each group in Application Example 3;
[0033] Figure 16 Figure 13 is a tumor imaging graph of the mice in each group in Application Example 3. DETAILED DESCRIPTION
[0034] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0036] The terms used in this invention are explained as follows:
[0037] Antibodies for cell culture: refers to antibodies used in the process of cell culture.
[0038] Prototype antibody: refers to commonly used commercially available cell culture antibodies that have not been modified as described in this invention.
[0039] Modified antibody: Specifically refers to the antibody obtained by modifying the protein of the original antibody in this invention, which has a lower affinity for the Fc receptor than the original antibody.
[0040] A culture system generally refers to a collection of components including culture medium, growth factors, antibodies for cell culture, cells (target cells and non-target cells), serum (with or without), antibiotics (with or without), and other additives, but it is not limited to this. The composition of a culture system varies depending on different needs.
[0041] Antibody receptors on cell surface, antibody clearance and antibody dependent killing
[0042] Certain cells, such as lymphocytes, dendritic cells (DCs), macrophages, granulocytes, platelets, and mast cells, express various Fc receptors (FcRs) on their surface that can bind to the Fc portion of different immunoglobulin isotypes. These include FcαR, FcγR, and FcεR. FcγR is further divided into FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), primarily binding to IgG. FcγR exhibits different affinities for different subtypes of human and mouse IgG. Generally, the affinity for IgG1 and IgG3 is higher than that for IgG2 and IgG4.
[0043] During cell culture, the concentration of the antibody for cell culture is continuously reduced in the culture medium. This is not only related to the inactivation of the antibody (natural degradation, degradation by proteases released from cells, aggregation and precipitation, etc.), receptor-mediated endocytosis after the antibody binds to the target receptor, but also directly related to the Fc receptor expressed on the surface of some cells in the culture system, which can bind and remove the antibody (FcR dependent endocytosis).
[0044] The antibody for culture is usually IgG1 subtype derived from mouse hybridoma screening, such as mouse anti-human CD3 antibody UCHT1, mouse anti-human CD16 antibody 3G8, and mouse anti-human CD28 antibody CD-28. In addition, for the purpose of improving yield and expanding product application, IgG1 subtype is usually selected for humanization of mouse-derived antibodies, such as humanized Campath-1H monoclonal antibody derived from rat anti-human CD52. The problem of rapid decrease of effective concentration of these IgG1 antibodies in the culture system is more serious.
[0045] Even after the antibody binds to the target cell, it can also stimulate the attack of some effector cells expressing Fc receptors. This includes antibody-dependent cellular phagocytosis (ADCP) by macrophages expressing FcγRII and antibody-dependent cellular cytotoxicity (ADCC) by NK cells expressing FcγRIII. When immune cells such as macrophages, monocytes, NK cells, etc. are present in the culture system, such specific ADCP / ADCC can rapidly reduce the viability and purity of the target cells. In particular, if the target cells for culture are immune cells such as macrophages, monocytes, NK cells, etc., such self-ADCP / ADCC can rapidly reduce the viability, purity and activity of the target cells, and make the target cells enter the exhaustion phase in advance.
[0046] Principles and methods of antibody engineering
[0047] The site on IgG that binds to FcγR is concentrated in the hinge and Fc-C H 2 domain, and the modification of the antibody mainly involves this region. The modification methods include one or more of sequence substitution, point mutation, sequence insertion, sequence deletion, glycosylation modification and chemical modification.
[0048] For example, the hinge region and Fc segment of the cell culture antibody are replaced with those of an antibody subtype having relatively weak binding ability to the Fc receptor, or the amino acid residues of the key binding sites in the hinge region and Fc segment of the cell culture antibody are mutated, or the complementarity-determining regions (CDRs) of the cell culture antibody are inserted into the framework of another subtype antibody having relatively weak binding ability to the Fc receptor, and the like. It is understood that the above-mentioned various modification means can be used in combination, for example, the CDRs of the cell culture antibody are inserted into the framework of another subtype antibody subjected to point mutation.
[0049] Since the present application is applied to the in vitro culture of cells, the selection criteria for the modified antibody are different from those for other purposes (e.g., therapeutic antibodies for human input). The present application thus proposes a more optimal modification strategy.
[0050] Sequence substitution
[0051] In some embodiments, the above-mentioned sequence replacement is replacement of the hinge region and Fc segment derived from the IgGl, IgG3 antibody subtype with the corresponding sequence of IgG2 or IgG4. In a preferred embodiment, the sequences are replaced with the corresponding sequence of IgG4. For example, the hinge region and Fc segment of the mouse monoclonal antibody UCHTl against human CD3, the mouse monoclonal antibody 3G8 against human CD16 and MEM-154, the mouse monoclonal antibody CD-28 against human CD28, the mouse monoclonal antibody 4C1A9 against human CD137, and the like are replaced with the corresponding sequence of murine IgG4. In a more preferred embodiment, the sequences are replaced with the corresponding sequence of human IgG4. Preferably, in the replacement of the hinge region and Fc segment, the IgGl-C H 1 - a section as close as possible to the C-terminal end in the hinge region and IgG4-C H 1 - the same sequence is replaced in the hinge to maintain the function of the Fab segment as much as possible. H 1 and V H 1 - the interaction, and maintain the function of the Fab segment.
[0052] Point mutation
[0053] In some embodiments, the above-mentioned point mutation is mutation of the amino acid of one or more sites of the key binding sites in the hinge region and Fc segment of the cell culture antibody.
[0054] In some embodiments, the antibody for cell culture is of the IgGl subtype, and the point mutations are mutations of one or more of the amino acids at positions 228, 233, 234, 235, 236, 239, 250, 252, 254, 256, 257, 311, 318, 320, 322, 326, 327, 329, 330, 331, 332, 333, 428, 433, and 434 of the antibody for cell culture. In some embodiments, the mutations are also made to the amino acids adjacent to the above-mentioned positions.
[0055] Of these positions, the backbone and side chain groups of L234 and L235 of hlgGl are involved in binding to hFcyRIII, particularly the side chain of L235 is involved in hydrophobic interactions with FcyRIII. In some preferred embodiments, mutating L235 to other amino acids, particularly charged amino acids (glutamic acid, Glu, aspartic acid, Asp, arginine, Arg, lysine, Lys) or bulky side chain amino acids (phenylalanine, Phe, etc.) that present steric hindrance, reduces the binding of the antibody to the Fc receptor. In some preferred embodiments, mutating L234 to other amino acids, particularly amino acids that affect the conformation of the backbone (glycine, Gly, proline, Pro), reduces the binding of the antibody to the Fc receptor. P329 of hlgGl is involved in binding to hFcyRIII, particularly in hydrophobic interactions with FcyRIII. In some preferred embodiments, mutating P329 to other amino acids, particularly charged amino acids or uncharged polar amino acids (serine, Ser, threonine, Thr, etc.), reduces the binding of the antibody to the Fc receptor. In a more preferred embodiment, hlgGl is mutated with L234A, L235R, P329D, and A330S.
[0056] Sequence insertion
[0057] In some embodiments, the sequence insertion is the insertion of CDRs from an IgGl, IgG3 antibody into the framework of an IgG2 or IgG4 antibody. In a preferred embodiment, the CDRs are inserted into the framework of an IgG4 antibody. In a preferred embodiment, the CDRs are inserted into the framework of an antibody that has been otherwise engineered to have reduced affinity for an Fc receptor. In a more preferred embodiment, the CDRs are inserted into the framework of an IgGl antibody that has been engineered with the point mutations described above.
[0058] Other methods
[0059] In some embodiments, the affinity of the antibody to the Fc receptor can also be reduced by other sequence deletion, glycosylation modification, and chemical modification.
[0060] In a preferred embodiment, the antibody expression sequence is modified to express and purify the Fab fragment of the antibody.
[0061] In a preferred embodiment, the N297 in the antibody expression sequence is mutated to obtain a non-glycosylated heavy chain (NGHC) modified antibody.
[0062] In a preferred embodiment, the antibody is treated with endoglycosidase to obtain an antibody with missing or rearranged sugar groups.
[0063] In a preferred embodiment, the antibody is treated with chemical conjugation to obtain a side chain modified or conjugated antibody with a steric hindrance group.
[0064] It can be understood that the modified antibody method of the present application is not limited to the above-mentioned sequence substitution, point mutation, sequence insertion, sequence deletion, glycosylation modification, and chemical modification. Any method that reduces the affinity to the Fc receptor through protein modification and does not affect the binding force to the target molecule is also included.
[0065] Scope of antibody engineering
[0066] In some embodiments, the antibody for cell culture is an anti-CD3 antibody, an anti-CD16 antibody, an anti-CD28 antibody, an anti-CD52 antibody, or an anti-CD137 antibody. For example, the mouse anti-human CD3 antibody UCHT1, the mouse anti-human CD16 antibody 3G8, the mouse anti-human CD28 antibody CD-28, the humanized Campath-1H monoclonal antibody of the mouse anti-human CD52, and the mouse monoclonal antibody 4C1A9 of the anti-human CD137.
[0067] In some embodiments, the heavy chain amino acid sequence of the modified antibody is as shown in SEQ ID NO. 1; or the heavy chain amino acid sequence of the modified antibody is as shown in SEQ ID NO. 2; or the heavy chain amino acid sequence of the modified antibody is as shown in SEQ ID NO. 3, and the light chain amino acid sequence is as shown in SEQ ID NO. 4.
[0068] It can be understood that the modified antibody of the present application is not limited to the above-mentioned several methods. Any antibody for cell culture that is reduced in affinity to the Fc receptor through protein modification is also included.
[0069] Cell culture
[0070] The cell culture method of one embodiment of the present application comprises the following steps: adding the engineered antibody to the culture system; the engineered antibody is a cell culture antibody with protein engineering in regions other than the complementarity determining region, and the affinity of the engineered antibody to the Fc receptor is lower than that of the cell culture antibody without protein engineering to the Fc receptor.
[0071] In some embodiments, the cell type is one or more of lymphocytes, granulocytes, mast cells, DC cells, macrophages, monocytes and platelets. The cells are derived from human blood, tissues, surgically removed human solid tumors, ascites. They can be freshly collected venous blood, umbilical cord blood, or cryopreserved PBMC cells. It can be understood that the cell type is not limited to this, as long as part of the cells in the culture system express Fc receptors on the surface.
[0072] In some embodiments, cell biology tests are designed to quantitatively detect the functional activity of the engineered antibody against target cells in a specific starting material cell population, including cell expansion tests, cytotoxicity tests, cell killing tests, cell migration tests, etc. In a specific example, the engineered antibody is used to stimulate the proliferation of T cells (CD3+) in human PBMCs, and the activity of the antibody is quantitatively determined, i.e. the half effective dose (ED 50 ) of the antibody. This activity data can be used for other cell culture methods that require stimulation of T cells (CD3+) in human PBMCs. In some embodiments, higher activity engineered antibodies can also be obtained through screening.
[0073] Culture medium
[0074] In some embodiments, the cell culture medium comprises a basal medium and the engineered antibody described above. In some preferred embodiments, after the activity of the engineered antibody is quantitatively determined, a standardized medium or kit can be prepared to meet the needs of specific cell culture.
[0075] Cell product
[0076] In some embodiments, the cell product is a cell product obtained according to the above-mentioned cell culture method. This includes one or more of lymphocytes, granulocytes, mast cells, DC cells, macrophages, monocytes and platelets.
[0077] In some embodiments, immune cell products such as T cells, NKT cells, NK cells, CTL cells, TIL cells, etc. can be obtained. In some embodiments, cell transduction and culture can be continued to obtain CAR-T cells, CAR-NK cells, etc. cell products.
[0078] Cell product application
[0079] In some embodiments, the above-mentioned cell products can be used in in vitro cell killing tests, in vivo animal killing tests, and human tests.
[0080] In some embodiments, the above-mentioned cell products, including DC cells, T cells, NKT cells, NK cells, CTL cells, TIL cells, CAR-T cells, CAR-NK cells, and other immune cell products, can recognize and kill viruses invading the human body, host cells transformed by viruses, and tumor cells, and can be used for antiviral therapy and targeted tumor therapy. Since exogenous immune cells first gather in the lungs and then in the liver after being intravenously input into the human body, in some preferred embodiments, the above-mentioned immune cell products are used for the treatment of lung cancer and liver cancer.
[0081] NK cells are rich in FcγRIII (CD16) on the cell surface and are the main effector cells for ADCC. In some embodiments, NK cells can be combined with therapeutic antibodies for ADCC killing studies. In some preferred embodiments, NK cell products can be combined with the therapeutic antibody Rituximab for the treatment of lymphoma. In some preferred embodiments, NK cell products can be combined with the therapeutic antibody Trastuzumab for the treatment of breast cancer and gastric cancer. In some preferred embodiments, NK cell products can be combined with the therapeutic antibody Cetuximab for the treatment of head and neck cancer and colorectal cancer.
[0082] NK cells can also recognize and kill targets through non-self or missing-self effect. This cell killing is non-MHC-restricted (Non-MHC-Restricted Cytotoxicity), and does not cause graft-versus-host disease (GVHD), so NK cells can be applied to allogeneic transplantation therapy. In some more preferred embodiments, the above-mentioned high-purity NK cell products and CAR-NK cell products are used for human homologous allogeneic cell therapy, but it can be understood that the cell products used for homologous allogeneic cell therapy are not limited thereto.
[0083] The present application is further described in detail by specific examples below, but the embodiments of the present application are not limited thereto.
[0084] I. Antibody modification
[0085] Modification Example 1
[0086] Engineering of anti-human CD 16 cell culture antibodies
[0087] This embodiment uses V, which expresses the mouse IgG1 monoclonal antibody 3G8 against human CD16. H -C H A sequence segment related to the C expression of human IgG4 H 2-C H The three sequences were spliced together and then expressed and purified together with the light chain sequence of antibody 3G8 to obtain the modified antibody aCD16-SH.
[0088] Select mouse IgG1-C H 1. Previous paragraph (T) 214 KVDK 218 ) and human IgG4-C H The same sequence on 1 is used to splice antibody sequences, that is, on T... 214 The previous sequence was the mouse IgG1-3G8 sequence, in K 218 The subsequent sequence is the human IgG4 sequence. The signal peptide sequence of human CD33 was also used.
[0089] First, such as Figure 1 As shown, the mouse 3G8 antibody heavy chain expression DNA sequence was amplified using primer pair Primer1-1F / Primer1-1R to obtain its V... H -C H 1 segment sequence ( Figure 1 A). Then, the human IgG4 heavy chain expression DNA sequence was amplified using primer pair Primer1-2F / Primer1-2R to obtain its Hinge-C. H 2-C H 3-segment sequence ( Figure 1 B). Then, overlap-PCR is used to splice the two sequences. Figure 1 C) The specific method is as follows: After mixing the purified two PCR products in equal molar amounts, perform 5 PCR cycles at 60℃ annealing temperature, then add Primer1-3F and Primer1-2R, and perform 30 PCR cycles at 72℃ annealing temperature. The primer sequences are shown in the table below.
[0090] Primer 1-1 F ATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCTcaggttactctgaaagagtctg Primer 1-1 R CTCAACTCTcttgtccaccttggtgctgctggc Primer 1-2 F gccagcagcaccaaggtggacaagAGAGTTGAG Primer 1-2 R GGGCTT GCCGGC CGTCGCACtcatttacccagagacaggga]]> Primer 1-3 F CTATCGATT GAATTC CACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACT]]>
[0091] The purified PCR product was treated with restriction endonucleases EcoRI (GAATTC) and NaeI (GCCGGC) and then inserted into an expression plasmid (based on pMD18-T, containing expression elements such as the CMV promoter and polyA Tail) to obtain the heavy chain expression plasmid pM-3G8-HC-M1. Figure 1 D). Sequencing confirmed that the pM-3G8-HC-M1 sequence was correct.
[0092] The plasmid pM-3G8-LC for expressing 3G8 light chain was mixed with the plasmid pM-3G8-HC-M1 for expressing the modified 3G8 heavy chain in equal molar amounts, and co-transfected into 293F cells in logarithmic growth phase with linear polyethylenimine (PEI). After 5 days of culture at 37°C in 5% CO2, the culture medium was collected by centrifugation. The target antibody protein was purified by Protein A affinity chromatography, and the ultraviolet absorption curves of the washing and elution steps are shown in Figure 2 . The samples were subjected to electrophoresis examination, and the results are shown in Figure 3 , where M is a molecular weight marker (MW Ladder), Lane 1 and 2 are samples of the column washing part, and Lane 3 and 4 are samples of the elution peak. After ion exchange chromatography and desalting column chromatography, a high-purity antibody product was obtained, named aCD16-(3G8-Fab)-(hIgG4-Fc), abbreviated as aCD16-SH, and the sequence of its heavy chain is shown in SEQ ID NO. 1.
[0093] Modification Example 2
[0094] Engineering of anti-human CD 52 cell culture antibodies
[0095] In this example, the sequence of the humanized IgG1 type Campath-1H monoclonal antibody expressing anti-human CD52 was mutated, and then expressed and purified to obtain the modified antibody aCD52-SH.
[0096] As shown in Figure 4 , the sequence expressing the heavy chain of Campath-1H monoclonal antibody ( Figure 4 A) was used as a template, and three fragments were obtained by PCR using primer pairs Primer2-3F / Primer2-ARR, Primer2-ARF / Primer2-DSR, and Primer2-DSF / Primer2-3R, respectively, and then spliced by overlap PCR. The sequences of the primer pairs are shown in the following table.
[0097]
[0098]
[0099] As shown in Figure 4 B, the purified PCR product was treated with restriction endonucleases EcoRI (GAATTC) and NaeI (GCCGGC) and then inserted into an expression plasmid to obtain a plasmid for expressing the heavy chain (pMA-C1H-HC). The sequence has completed the L234A, L235R, P329D, and A330S mutations. Sequencing confirmed that the sequence of pMA-C1H-HC is correct.
[0100] The plasmid pM-C1H-LC for expressing the light chain of Campath-1H was mixed with the plasmid pMA-C1H-HC for expressing the modified heavy chain of Campath-1H in equal molar amounts, and co-transfected into 293F cells in logarithmic growth phase with PEI. After 5 days of culture at 37°C in 5% CO2, the culture medium was collected by centrifugation. High-purity antibody product was obtained by Protein A affinity chromatography, ion exchange chromatography, and desalting column chromatography, and named aCD52-(C1H-Fab)-(FcA), abbreviated as aCD52-SH, with the heavy chain sequence shown in SEQ ID NO. 2. The product was subjected to electrophoresis examination, and the results are shown in FIG. 1, where M is the molecular weight marker (MW Ladder), and Lane 1 and 2 are the target antibody. Figure 5
[0101] Modification Example 3
[0102] Engineering of anti-human CD 3 cell culture antibodies
[0103] In this example, the CDR sequences of the mouse IgG2a monoclonal antibody OKT3 against human CD3 were inserted into the IgG1 skeleton of Modification Example 2, and then expressed and purified to obtain the modified antibody aCD3-SH.
[0104] The protein sequences of the light chain and the heavy chain of OKT3 were respectively aligned with the sequences of hIgG1-kappa (K) light chain and hIgG1 heavy chain (A, B), and the 6 CDR sequences were confirmed. The CDR expression DNA sequences after codon optimization were chemically synthesized, spliced by gene engineering methods such as overlap PCR, to obtain the plasmid pM-OKT3h-LC (C) for expressing the light chain and the plasmid pMA-OKT3h-HC (D) for expressing the heavy chain containing the 4 point mutations in Modification Example 2. Figure 6 Figure 6 Figure 6
[0105] In 293F cells, high-purity antibody product was obtained by Protein A affinity chromatography, ion exchange chromatography, and desalting column chromatography, and named aCD3-(OKT3h-Fab)-(FcA), abbreviated as aCD3-SH, with the heavy chain sequence and the light chain sequence shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively. The product was subjected to electrophoresis examination, and the results are shown in FIG. 2, where M is the molecular weight marker (MW Ladder), and Lane 1 and 2 are the target antibody. Figure 7
[0106] II. Cell culture and antibody activity detection
[0107] Culture Example 1
[0108] T cell culture and detection of expansion activity of anti-human CD 3 antibodies
[0109] The test was used to stimulate the proliferation of T cells (CD3+) in human PBMC with the modified antibody aCD3-SH and its prototype antibody OKT3 obtained in Modification Example 3, respectively, and the activity of the antibody, i.e. the half effective dose (ED50) was quantitatively determined by staining the cells with MTS (CAS# 138169-43-4). 50
[0110] Materials
[0111] Human venous blood, human peripheral blood lymphocyte separation medium (Tianjin Haoyang, LTS1077), IL-2 (Beijing Shuanglu, recombinant human interleukin-2 for injection), basal medium X-VIVO5 (Lonza, 04-418Q), complete medium (X-VIVO5, IL-2 1000 IU / mL), CellTiter 96® AQueous One Solution (Promega, G3580, MTS solution), OKT3 (Takara Bio, T210).
[0112] Preparation of antibody concentration gradient
[0113] Take a 96-well flat-bottomed cell culture plate, add 100 μL of complete medium to the wells. Dilute the antibody to 6.40 μg / mL with complete medium, add 100 μL to each well in column 1, and mix well. Perform serial dilution from column 1 to column 11, i.e. transfer 100 μL, mix well, and continue to the next column. Finally, each well contains 100 μL of complete medium, and a 1:2 dilution gradient of the antibody is formed, from 1.60 μg / mL in column 1 to 1.56 ng / mL in column 11.
[0114] Cell culture
[0115] Separate human PBMC cells with leukocyte separation medium, and adjust the density to 3E5 / mL with basal medium. Add 100 μL of cell suspension to each well in columns 1 to 11 of the 96-well plate, and mix well. Finally, each well contains 200 μL of complete medium and 3E4 cells, and a 1:2 dilution gradient of the antibody is formed, from 800 ng / mL in column 1 to 0.781 ng / mL in column 11. Incubate at 37°C, 5% CO2 for 5 days.
[0116] Data acquisition and processing
[0117] Add 20 μL of MTS solution to each well. Incubate the plates in a cell culture incubator for 6 hours. Read the absorbance at 490 nm using a microplate reader. Calculate the average of the readings and subtract the blank (the average of the 12th column readings). Plot a semi-log curve using antibody concentration / OD and calculate the ED using a four-parameter logistic regression method. 50 .
[0118] Results Discussion
[0119] aCD3-SH's ED 50 It was 18.9 ng / mL. Figure 8 (Hollow circle), the ED of the prototype antibody OKT3 50 130 ng / mL Figure 8 The solid circles indicate that the target T cells are more sensitive to aCD3-SH. Furthermore, at saturated antibody concentrations, the maximum amplification signal of aCD3-SH is significantly stronger than that of OKT3. The results show that the modified antibody aCD3-SH has significantly higher activity in stimulating T cell proliferation.
[0120] Cultivation Example 2
[0121] NKT cell culture and detection of expansion activity of anti-human CD 3 antibodies
[0122] In this test, the modified antibody aCD3-SH obtained in Example 3 and its prototype antibody OKT3 were used to stimulate the proliferation of NKT cells (CD3+CD56+) in human PBMCs, and the viability was compared by counting the cells.
[0123] Material
[0124] Human venous blood, basal culture medium GT-T551 (TaKaRa, WK551T), amplification culture medium (GT-T551, IL-2 1000 IU / mL), cell culture flasks T75 (CORNING, 430720) / T175 (CORNING, 431080), IFN-γ (Shanghai Kaimao, recombinant human interferon γ gamma for injection).
[0125] Cell culture and detection methods
[0126] PBMC cells were isolated from human blood using Ficoll-Paque Plus (Amersham Pharmacia Biotech, Uppsala, Sweden) and adjusted to 2E6 / mL in basal medium and placed in culture flasks. After 2 hours incubation at 37°C in 5% CO2, the non-adherent cells were collected and adjusted to 1E6 / mL in basal medium. Recombinant human IFN-γ (1000 IU / mL) was added and incubated for 24 hours at 37°C in 5% CO2. Anti-human CD3 antibody (30 ng / mL) and IL-2 (1000 IU / mL) were added and incubated for another 48 hours. Expansion medium was added at a 1:1 volume ratio and incubated for another 48 hours. The cells were counted every 48 hours and adjusted to 0.7E6 / mL in expansion medium and incubated. The cells were harvested between day 12 and day 20 and counted.
[0127] Results and discussion
[0128] In a 12-day experiment, the PBMC of Donor 1 were expanded 146.9-fold (A, open circles) with aCD3-SH and 50.4-fold (A, solid circles) with OKT3. In a 19-day expansion experiment of the PBMC of Donor 2, the expansion was 491-fold and 251-fold (B), respectively. The results show that the engineered antibody aCD3-SH has a higher activity to stimulate the expansion of NKT cells. Figure 9 A, open circles), while OKT3 expanded the cells 50.4-fold (A, solid circles). In a 19-day expansion experiment of the PBMC of Donor 2, the expansion was 491-fold and 251-fold (B), respectively. The results show that the engineered antibody aCD3-SH has a higher activity to stimulate the expansion of NKT cells. Figure 9 Figure 9 Culture Example 3
[0129] Culture Example 3
[0130] NK cell specific expansion and purity detection
[0131] The blood samples from donors were separated into PBMC and divided into two equal parts. One part was incubated with the engineered antibodies aCD3-SH, aCD16-SH and aCD52-SH (test group) and the other part was incubated with the prototype antibodies OKT3, aCD16-3G8 and Campath-1H (control group). The antibodies were used to stimulate the proliferation of NK cells (CD3-CD16+CD56+) in human PBMC and the function of the antibodies was compared by analyzing the cell composition.
[0132] Materials
[0133] Human venous blood, basal medium X-VIVO 15 (Lonza, 04-418Q), expansion medium (X-VIVO 15, IL-2 1000 IU / mL), human serum (Genimi, 100-512).
[0134] Cell culture and detection methods
[0135] PBMCs were isolated and their density adjusted to 1E6 / mL using basal medium. Antibodies, IL-2 (1000 IU / mL), and 5% human serum were added to either the experimental or control groups. Cells were cultured at 37°C and 5% CO2 for 72 hours. An equal volume of amplification medium was added, and the cells were cultured for another 48 hours. Samples were taken every 48 hours thereafter for cell counting, and the cells were diluted to 0.7E6 / mL with amplification medium and cultured further. Cells were harvested on day 14 and analyzed by flow cytometry using the fluorescent antibodies PerCP Mouse Anti-Human-CD3 (BD Biosciences, 552851), APC-Cy7 Mouse Anti-Human-CD16 (BD Biosciences, 557758), and PE Mouse Anti-Human-CD56 (BD Biosciences, 555516).
[0136] Results Discussion
[0137] The percentage of CD3-CD56+ NK cells in the cells obtained from the experimental group was 97.6%. Figure 10 A), higher than the 71.8% obtained in the control group ( Figure 10 B). In this cell group, CD3-CD16+CD56+ NK cells accounted for 96.2% ( Figure 10 C) and 71.7% Figure 10 D). Therefore, in the total cell population, the CD3-CD16+CD56+ NK cells obtained using the experimental group amplification reached 93.9% of the total cells, which was superior to the 51.5% obtained using the control group. The results show that the NK cell product obtained using the experimental group antibody had higher purity.
[0138] III. Application of Cell Products
[0139] Application Example 1
[0140] In vitro killing activity detection of NK cell products on tumor cells
[0141] In this test, the NK cell products obtained from the experimental group (experimental group) and the NK cell products obtained from the control group (control group) in culture example 3 were used to perform direct killing and ADCC killing experiments on the lymphoma cell line Raji, the breast cancer cell line BT-474, and the breast cancer cell line MCF7, respectively. The activity of the modified antibody and the original antibody was compared by analyzing the activity of the final product.
[0142] Materials: Raji cells (ATCC, CCL-86), BT-474 cells (ATCC, CRL-3247), MCF7 cells (ATCC, HTB-22), CytoTox assay kit Non-Radioactive Cytotoxicity Assay (Promega, G1780), Medium RPMI 1640 (ThermoFisher, 11879020), Rituximab, Trastuzumab.
[0143] Detection method
[0144] Tumor cells were sub-cultured and collected, then adjusted to 1E5 / mL with medium and added 100 μL to each well of a 96-well plate. NK cells were collected and adjusted to 1E5 / mL or 5E5 / mL with medium and added 100 μL to the corresponding wells. Rituximab was adjusted to 2 mg / mL with medium and added 5 μL to the corresponding wells. Trastuzumab was adjusted to 2 mg / mL with medium and added 5 μL to the corresponding wells. Cell spontaneous release wells (containing only Raji, BT-474, MCF7 or NK cells), target cell maximum release wells (containing only Raji, BT-474 or MCF7 cells), and volume correction wells (containing no cells) were prepared according to the kit instructions.
[0145] Target cell killing test wells (Raji + NK, BT-474 + NK, or MCF7 + NK), ADCC killing test wells (Raji + NK + Rituximab, BT-474 + NK + Trastuzumab, MCF7 + NK + Trastuzumab) were prepared. For the killing test of Raji cells, 100 μL of NK cells at 1E5 / mL were added, i.e. E / T = 1:1. For the killing test of BT-474 and MCF7, 100 μL of NK cells at 5E5 / mL were added, i.e. E / T = 5:1. Incubation was carried out at 37°C, 5% CO2 for 3 hours. 20 μL of lysis solution was added to the target cell maximum release wells and volume correction wells. Incubation was continued for 45 minutes.
[0146] 50 μL of supernatant was transferred from each well to a new 96-well plate, and the substrate solution was prepared according to the kit instructions. 50 μL of substrate solution was added to each well, and after incubation at room temperature for 30 min, 50 uL of stop solution was added to each well. The absorbance value at 490 nm was read on a plate reader (Molecular Devices, SpectraMax M5 Microplate Readers).
[0147] The killing rate was calculated according to the following formula:
[0148] Killing ratio = (Killing test signal - Effector cell spontaneous release signal - Target cell spontaneous release signal) / (Target cell maximum release signal - Target cell spontaneous release signal) x 100%
[0149] Results and discussion
[0150] The results of the killing test on Raji cells are shown in Table 1. Figure 11 It can be seen that the NK cells have a basic direct killing on Raji cells at E / T = 1:1, but the killing rates of the two groups are not much different. After the addition of Rituximab, the NK cells are activated, and the killing rate of the test group NK is increased from 14.7% to 85.0%. The control group NK is also activated, but only from 12.5% to 56.2%, which is significantly different from the test group. The ADCC killing is specific, and when Trastuzumab is added, the NK cells will not be activated, and the direct killing rates of the two groups of NK cells under this condition are not much different.
[0151] The results of the killing test on BT-474 and MCF7 cells are shown in Tables 2 and 3. Figure 12 and Figure 13 It can be seen that the killing rate of the test group NK cells on BT-474 cells is significantly superior to that of the control group, whether it is direct killing or ADCC killing. Similarly, the killing rate of the test group NK cells on MCF7 cells is significantly superior to that of the control group, whether it is direct killing or ADCC killing.
[0152] Application Example 2
[0153] In vivo direct killing activity detection of NK cell products on tumor cells in animals
[0154] The NK cell product obtained by expanding the test group in Example 3 was used in the test to determine the in vivo activity of the NK cells in the Raji-Luc myeloma model of mice.
[0155] Materials
[0156] NSG mice (6-8 weeks old), Raji-Luc cells (Raji cells stably transfected with luciferase).
[0157] Detection method
[0158] Raji-Luc cells were subcultured, and after the cells were collected, the density was adjusted to 5E6 / mL with PBS, and 100 μL was injected into each NSG mouse via the tail vein. After 48 hours, the mice were randomly divided into 2 groups according to body weight, and 100 μL of normal saline (control group) and NK cells 1E7 (test group) were injected into the tail vein. The tumor growth was measured on an in vivo imaging instrument (PerkinElmer, IVIS Lumina LT InVivo Imaging System), and the imaging signal graph and signal intensity were collected.
[0159] Results and Discussion
[0160] In a 19-day experiment, the average imaging signal intensity of the control group mice increased to 9.16E6 p / sec / cm 2 / sr, while that of the test group was 1.63E6 p / sec / cm 2 / sr, which was 17.8% of the control group. Figure 14 The results showed that the NK cells had obvious in vivo killing activity.
[0161] Application Example 3
[0162] In vivo ADCC killing activity detection of NK cell products on tumor cells in animals
[0163] This test used the NK cell product obtained by expanding the test group in Example 3 and a therapeutic antibody to perform an in vivo ADCC killing test on a mouse Raji-Luc hemangiosarcoma model to determine the in vivo activity of the NK cells.
[0164] Materials
[0165] NSG mice (6-8 weeks old), Raji-Luc cells (Raji cells stably transfected with luciferase), and rituximab.
[0166] Detection Method
[0167] After the mouse Raji-Luc hemangiosarcoma model was established according to the method of Application Example 2, the mice were divided into 4 groups and injected with normal saline (G1, blank group), rituximab (G2), NK cells (G3), and a combination of the two (G4, i.e., rituximab and NK cells were injected simultaneously). The mice were continued to be raised, and the tumor growth was measured regularly, and the growth and survival status of the animals were observed.
[0168] Results and Discussion
[0169] From the survival results of the mice in each group Figure 15 and the tumor imaging results Figure 16As can be seen in Figure 6, the fluorescent signal from the tumor cells gradually increased, and the mice gradually died. The median survival time of the G1 group was 26 days, and all the mice died at 30 days. In the G2 group, the median survival time was 51 days, and 2 mice were still alive at the end of the experiment at 75 days. In the G3 group, 3 mice were still alive at 75 days. In the G4 group, all 6 mice were still alive at the last imaging detection at 61 days, and 5 mice were still alive at 75 days.
[0170] In terms of overall survival rate and tumor imaging signal, the treatment effect data of the combination group were obviously better than those of the blank group and the single-drug group. This shows that the in vivo ADCC killing effect of the combination of rituximab and the NK cells obtained by the application is obvious.
[0171] Application Example 4
[0172] Clinical study of NK cell products on hepatocellular carcinoma treatment
[0173] In this study, patients with advanced hepatocellular carcinoma (HCC) were selected, and NK cell products prepared according to the expansion method in Culture Example 3 were inputted, and the short-term and long-term reactions of the patients were observed to preliminarily explore the safety and effectiveness of the treatment regimen of allogeneic high-purity human NK cells.
[0174] Materials
[0175] After the NK cells were collected and washed, the NK cells were prepared into a cell product, the cell viability was greater than 90%, and the purity of the NK cells was greater than 90%.
[0176] Research Methods
[0177] After the patients passed the inclusion and exclusion screening, 1-2 NK cell treatment courses were started, and each course was separated by 1-3 months. Each course included 2 NK cell treatments, and the interval was 5-10 days. 1-2E9 NK cells were inputted each time, and the changes in the patient's physical signs and self-reports before and after the input were recorded. After the first course, follow-up was started, and the follow-up was continued until 2 years after the treatment or the patient withdrew from the study for various reasons.
[0178] Results and Discussion
[0179] In a clinical trial reviewed by a clinical trial ethics review committee, 33 people were treated for a total of 38 courses. After the NK cell input, most of the patients had no discomfort, and a small number of patients (4 times, accounting for 5.3% of the total) had a fever reaction, which recovered the next day after antipyretic treatment. The results show that the high-purity NK cell product obtained by the application can ensure the safety of allogeneic cell therapy, and at the same time has the potential to solve the dilemma of low patient immunity.
[0180] Any technical features in the above-described embodiments can be combined in any manner, and for the sake of brevity, not all possible combinations are described, but it is understood that the scope of the present specification includes all possible combinations.
[0181] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims. SEQUENCE LISTING <110> Beijing Shiheng Biotechnology Co., Ltd. <120> Cell culture method, engineered antibody, cell culture medium, cell product and application thereof <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 444 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 1 Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Arg Thr Ser 20 25 30 Gly Met Gly Val Gly Trp Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu 35 40 45 Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Arg Tyr Asn Pro Ala 50 55 60 Leu Lys Ser Arg Leu Thr lie Ser Lys Asp Thr Ser Ser Asn Gin Val 65 70 75 80 Phe Leu Lys lie Ala Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr 85 90 95 Cys Ala Gin lie Asn Pro Ala Trp Phe Ala Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro 115 120 125 Leu Ala Pro Gly Ser Ala Ala Gin Thr Asn Ser Met Val Thr Leu Gly 130 135 140 Cys Leu Val Lys Gly Tyr Phe Pro Gin Pro Val Thr Val Thr Trp Asn 145 150 155 160 Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr 180 185 190 Trp Pro Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser 195 200 205 Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro 210 215 220 Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe 225 230 235 240 Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val 245 250 255 Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe 260 265 270 Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 275 280 285 Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 290 295 300 Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 305 310 315 320 Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala 325 330 335 Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln 340 345 350 Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly 355 360 365 Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro 370 375 380 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser 385 390 395 400 Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu 405 410 415 Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 420 425 430 Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 435 440 <210> 2 <211> 451 <212> PRT <213> Artificial Sequence <400> 2< Phe Ser Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Ser Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser 115 120 125 Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala 130 135 140 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 145 150 155 160 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala 165 170 175 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val 180 185 190 Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His 195 200 205 Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys 210 215 220 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Ala Arg Gly 225 230 235 240 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 245 250 255 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 260 265 270 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 275 280 285 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 290 295 300 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 305 310 315 320 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Asp Ser Pro Ile 325 330 335 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 340 345 350 Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser 355 360 365 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 370 375 380 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 385 390 395 400 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 405 410 415 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 420 425 430 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 435 440 445 Pro Gly Lys 450 <210> 3 <211> 449 <212> PRT <213> Artificial Sequence <400> 3 Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr 20 25 30 Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gin Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Tyr Tyr Asp Asp His Tyr Cys Leu Asp Tyr Trp Gly Gin Gly 100 105 110 Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gin Pro Ser Val Phe 115 120 125 Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu 130 135 140 Gly Cys Leu Val Lys Asp Tyr Phe Pro Gin Pro Val Thr Val Ser Trp 145 150 155 160 Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu 165 170 175 Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 180 185 190 Ser Ser Leu Gly Thr Gin Thr Tyr He Cys Asn Val Asn His Lys Pro 195 200 205 Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys 210 215 220 Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Ala Arg Gly Gly Pro 225 230 235 240 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 260 265 270 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 290 295 300 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 305 310 315 320 Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Asp Ser Pro Ile Glu Lys 325 330 335 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 340 345 350 Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 355 360 365 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 385 390 395 400 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 405 410 415 Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 420 425 430 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 435 440 445 Lys <210> 4 <211> 213 <212> PRT <213> Artificial Sequence <400> 4 Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr 35 40 45 Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr 85 90 95 Phe Gly Ala Gly Thr Lys Leu Glu Ile Asn Arg Thr Val Ala Ala Pro 100 105 110 Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr 115 120 125 Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys 130 135 140 Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu 145 150 155 160 Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser 165 170 175 Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala 180 185 190 Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe 195 200 205 Asn Arg Gly Glu Cys 210
Claims
1. A method of culturing cells, characterized by, The method comprises the following steps: adding a modified antibody to a culture system; wherein the heavy chain amino acid sequence of the modified antibody is shown as SEQ ID NO. 1, and the light chain of the modified antibody is the light chain of a mouse IgG1 monoclonal antibody 3G8 against human CD16; or the heavy chain amino acid sequence of the modified antibody is shown as SEQ ID NO. 2, and the light chain of the modified antibody is the light chain of a humanized IgG1 type Campath-1H monoclonal antibody against human CD52; or the heavy chain amino acid sequence of the modified antibody is shown as SEQ ID NO. 3, and the light chain amino acid sequence of the modified antibody is shown as SEQ ID NO. 4; part of the cells in the culture system have Fc receptors on the surface.
2. The cell culture method of claim 1, wherein, The cells with Fc receptors on the surface are selected from one or more of lymphocytes, granulocytes, mast cells, DC cells, macrophages and monocytes.
Citation Information
Patent Citations
Modified antigen binding molecules with altered cell signaling activity
CN101291954A
Passive antibody dependent cell-mediated activation
CN110536699A
Methods for tumor treatment using CD3xcd20 bispecific antibody
US20180194841A1
Protein applied to culture of NK cells, culture medium component combination and preparation method
CN109627342A
Antibodies Comprising Chimeric Constant Domains
US20180371090A1