CRISPR-enabled multiplexed genome engineering

Abstract

Described herein are methods and vectors for the rational, multiplexed manipulation of open reading frames (e.g., in a protein library) in a chromosome, or any segment of a chromosome in a cell or population of cells, using different CRISPR systems.

Description

[0001] This application is a divisional application of a Chinese patent application (PCT application number PCT / US2015 / 015476) with an application date of February 11, 2015, application number 201580018819.3, and invention name “CRISPR-supported multiplexed genome engineering”.

[0002] Related Applications

[0003] This application claims the benefit under 35 USC §119 of U.S. Provisional Application No. 61 / 938,608, filed February 11, 2014, the entire teachings of which are incorporated herein by reference. Background Art

[0004] Rational manipulation of large DNA constructs is a major challenge in current synthetic biology and genome engineering efforts. In recent years, a variety of technologies have been developed to address this challenge and improve the specificity and speed with which mutations can be generated. In addition, adaptive mutations are central drivers of evolution, but their abundance and relative contribution to cellular phenotypes are poorly understood even in most well-studied organisms. This can be largely attributed to the technical challenges associated with observing and reconstructing these genotypes and associating their presence with phenotypes of interest. For example, genome editing methods that rely on random mutagenesis result in complex genotypes containing many mutations, and the relative contribution of each mutation is difficult to resolve. Moreover, due to the lack of information about individual mutations, it is difficult to determine epistatic interactions between alleles. Summary of the invention

[0005] Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) are present in many bacterial genomes and have been found to play an important role in adaptive bacterial immunity. Transcription of these arrays produces CRISPR RNA, which guides the CRISPR / cas complex sequence-specific binding to DNA targets in cells, resulting in gene repression or DNA cleavage. The specificity of these complexes allows novel in vivo applications for strain engineering.

[0006] This article describes a method for rational, multiplexed manipulation of chromosomes within open reading frames (e.g., to generate protein libraries) or multiple genes in any segment of a chromosome, using different CRISPR systems. These methods provide more efficient combinatorial genome engineering than previously available methods.

[0007] Expanding the multiplexing capabilities of CRISPR presents a current technical challenge and will enable the use of these systems to generate rational libraries in a high-throughput format. Such progress has broad implications for the fields of metabolic and protein engineering that seek to reconfigure complex genetic networks for optimal production.

[0008] The method includes introducing components of the CRISPR system into the cell, including the nuclease Cas9 and sequence-specific guide RNA (gRNA) associated with CRISPR, thereby utilizing the ability of the CRISPR system to induce sequence-guided double-strand breaks to cause sequence-guided double-strand breaks. The components of the CRISPR system, including the nuclease Cas9 and sequence-specific guide RNA (gRNA) associated with CRISPR, can be introduced into the cell and encoded on one or more vectors such as plasmids. DNA recombineering box (cassette) or editing oligonucleotides can be rationally designed to include the desired mutations located in the target locus and mutations in common locations outside the target locus that can be recognized by the CRISPR system. The method can be used for many applications, including changing the pathway of interest.

[0009] In one embodiment, the method is a genome engineering method comprising: (a) introducing into a cell a vector encoding: (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in the cell and comprising a mutation of at least one nucleotide relative to the target region (referred to as a desired mutation), such as a mutation of at least one nucleotide in at least one codon relative to the target region, and a protospacer adjacent motif; adjacent motif) (PAM) mutation; (ii) a promoter; and (iii) at least one guide RNA (gRNA), the gRNA comprising: (a) a region (RNA) complementary to a portion of the target region; and (b) a region (RNA) that recruits a Cas9 nuclease, thereby producing a cell comprising the vector; (b) maintaining the cell comprising the vector under conditions for expressing Cas9, wherein the Cas9 nuclease is encoded on the vector, encoded on a second vector, or encoded on the genome of the cell, resulting in the production of cells comprising the vector and not comprising the PAM mutation and cells comprising the vector and the PAM mutation; (c) culturing the product of (b) under conditions suitable for cell viability, thereby producing living cells; (d) obtaining the living cells produced in (c); and (e) sequencing the editing oligonucleotide of the vector of at least one living cell obtained in (d), and identifying the mutation of the at least one codon.

[0010] In another embodiment, the method is a genome engineering method by traceable CRISPR enrichment recombineering, comprising: (a) introducing into a first cell population a vector encoding: (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a pre-spacer adjacent motif (PAM) mutation; (ii) at least one promoter; and (iii) at least one guide RNA (gRNA) comprising: (a) a region homologous to a portion of the target region and comprising a mutation of at least one nucleotide relative to the target region, such as a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a pre-spacer adjacent motif (PAM) mutation; The invention relates to a method for preparing a second cell population comprising the vector and a second vector; a second vector comprising the vector and a second vector comprising the ...

[0011] Any of the above embodiments may further include synthesizing and / or obtaining a population of editing oligonucleotides. Any of the embodiments may further include amplifying the population of editing oligonucleotides. In any of the embodiments, the vector may further include a spacer, at least two priming sites, or both a spacer and at least two priming sites. In some embodiments, the editing box includes a target region that includes a mutation of at least one codon within 100 nucleotides of a PAM mutation.

[0012] Also described is a vector comprising:

[0013] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0014] (ii) a promoter; and

[0015] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region; and (b) a region (RNA) recruiting the Cas9 nuclease.

[0016] A further embodiment is a vector comprising:

[0017] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide in at least one codon relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0018] (ii) a promoter; and

[0019] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region; and (b) a region (RNA) recruiting the Cas9 nuclease.

[0020] A further embodiment is a vector comprising:

[0021] (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation of at least one nucleotide relative to the target region, and (b) a protospacer adjacent motif (PAM) mutation;

[0022] (ii) at least one promoter; and

[0023] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region, and (b) a region (RNA) that recruits the Cas9 nuclease.

[0024] Another embodiment of the vector is a vector comprising:

[0025] (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a protospacer adjacent motif (PAM) mutation;

[0026] (ii) at least one promoter; and

[0027] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region, and (b) a region (RNA) that recruits the Cas9 nuclease.

[0028] In any of the embodiments, the vector may further comprise a spacer; at least two priming sites; or a spacer and at least two priming sites. In those vectors where the mutation is a mutation of at least one nucleotide in at least one codon, the editing cassette may be within 100 nucleotides of a PAM mutation, for example.

[0029] Also described is a library comprising a cell population produced by the methods described herein. The library of the cell population can comprise cells having any of the vectors described herein. For example, the cell population can comprise a vector comprising:

[0030] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0031] (ii) a promoter; and

[0032] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region; and (b) a region (RNA) recruiting the Cas9 nuclease.

[0033] In a further embodiment, the cell population may comprise a vector comprising:

[0034] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide in at least one codon relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0035] (ii) a promoter; and

[0036] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region; and (b) a region (RNA) recruiting the Cas9 nuclease.

[0037] In a further embodiment, the method is a CRISPR-assisted rational protein engineering (combinatorial genome engineering) method, the method comprising:

[0038] (a) constructing a donor library comprising recombinant DNA, such as recombinant DNA in a recombinant chromosome or a plasmid, by introducing into a first cell population (e.g., by co-transformation): (i) one or more editing oligonucleotides, such as rationally designed oligonucleotides, which couple the deletion of a first single protospacer adjacent motif (PAM) with the mutation of at least one codon in a gene adjacent to the PAM (adjacent gene), and (ii) a guide RNA (gRNA) that targets a nucleotide sequence located at the 5' side of an open reading frame of a chromosome, thereby generating a donor library comprising a first cell population, the first cell population comprising a recombinant chromosome having a targeted codon mutation;

[0039] (b) amplifying the donor library constructed in (a), for example by PCR amplification of a recombinant chromosome, using synthetic features from the editing oligonucleotide and simultaneously incorporating a second PAM deletion (destination PAM deletion) at the 3' end of the gene, thereby directly coupling, such as covalently coupling, the targeted codon mutation to the destination PAM deletion, and generating a retrieved donor library carrying the destination PAM deletion and the targeted codon mutation; and

[0040] (c) introducing (e.g., co-transforming) the donor library carrying the endpoint PAM deletion and the targeted codon mutation and the endpoint gRNA plasmid into a second cell population, thereby generating an endpoint library comprising the targeted codon mutation, and the second cell population is usually a naive cell population.

[0041] The first cell population and the second cell population (eg, naive cell population) are typically populations in which the cells are all of the same type, and may be prokaryotes or eukaryotes, such as but not limited to bacteria, mammalian cells, plant cells, insect cells.

[0042] In some embodiments, the method further comprises maintaining the endpoint library under conditions in which protein is produced.

[0043] In some embodiments, the first cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0044] In some embodiments, the editing oligonucleotide is complementary to (one, one or more, at least one) target nucleic acid present in the first cell. In some embodiments, the editing oligonucleotide targets more than one target site or locus in the first cell. In some embodiments, the nucleic acid sequence [required codon] of the editing oligonucleotide comprises one or more substitutions, deletions, insertions, or any combination of substitutions, deletions, and insertions relative to the target nucleic acid. In some embodiments, the editing oligonucleotide is rationally designed; in further embodiments, the editing oligonucleotide is generated by random mutagenesis or by using a degenerate primer oligonucleotide. In some embodiments, the editing oligonucleotide is derived from a collection (library) of nucleic acids.

[0045] In some embodiments, the gRNA is encoded on a plasmid. In some embodiments, the editing oligonucleotide and the gRNA are introduced into the first cell by transformation, for example, by co-transformation of an editing oligonucleotide and a guide (g) RNA. In some embodiments, the editing oligonucleotide and the gRNA are sequentially introduced into the first cell. In other embodiments, the editing oligonucleotide and the gRNA are simultaneously introduced into the first cell.

[0046] In some embodiments, recovering the donor library further comprises (a) screening cells for incorporation of the editing oligonucleotide, and (b) selecting cells that are confirmed to have incorporated the editing oligonucleotide. In some embodiments, recovering the donor library further comprises processing the recovered donor library.

[0047] In some embodiments, the end point cell / naive cell expresses a polypeptide having Cas9 nuclease activity. In some embodiments, the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0048] Also described is a CRISPR-assisted rational protein engineering method comprising:

[0049] (a) introducing (i) a synthetic dsDNA editing cassette comprising editing oligonucleotides and (ii) a vector expressing a guide RNA (gRNA) targeting a genomic sequence just upstream of a gene of interest, under conditions whereby multiplex recombineering of the editing oligonucleotides and selective enrichment by the gRNAs occurs, into a first cell population (e.g., co-transformation), thereby generating a donor library;

[0050] (b) amplifying a donor library having an oligonucleotide lacking a protospacer adjacent motif (PAM) adjacent to the 3' end of the gene of interest (terminal PAM), thereby generating an amplified donor library comprising a dsDNA editing cassette lacking the terminal PAM (having a 3' PAM deletion), a rational codon mutation, and a P1 site;

[0051] (c) treating the amplified donor library with an enzyme such as a restriction enzyme (e.g., BsaI) to remove the P1 site; and

[0052] (d) Co-transforming the naive cell population with the amplified donor library treated in (c) and the endpoint gRNA, thereby generating a co-transformed cell population comprising a dsDNA editing cassette that has deleted the endpoint PAM (having a 3' PAM deletion), a rational codon mutation, and the endpoint gRNA.

[0053] In all embodiments described, mutations can be of any type desired, such as one or more insertions, deletions, substitutions, or any combination of two or three of the foregoing mutations (e.g., insertion and deletion; insertion and substitution; deletion and substitution; substitution and insertion; insertion, deletion and substitution). Insertions, deletions and substitutions can be insertions, deletions and substitutions of any number of nucleotides. They can be in codons (coding regions) and / or in non-coding regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1A and 1B An overview of CRISPR-assisted rational protein engineering (CARPE) is shown. Figure 1A A schematic diagram of donor library construction is shown. Synthetic dsDNA editing cassettes are co-transformed with vectors expressing guide RNA (gRNA) targeting genomic sequences upstream of the gene of interest. The co-transformation generates a donor library via multiplex recombination engineering of editing oligonucleotides, which are selectively enriched by gRNA. The donor library is subsequently amplified using oligonucleotides that mutate (lose) the PAM (end point PAM) adjacent to the 3' end of the gene. Figure 1B A schematic diagram of the final protein library generation is shown. The donor library was treated with BsaI to remove the P1 site, and the library with dsDNA cassettes with 3' PAM deletion and rational codon mutations was co-transformed with the endpoint gRNA to generate the final protein library.

[0055] Figure 2 Shown are DNA sequences of clones generated from the galK donor library construction, confirming the P1 feature of incorporating the editing oligonucleotide with high efficiency as well as mutations at the targeted codon position (underlined). The sequence of P1 is provided by SEQ ID NO:1.

[0056] Figure 3A Primer designs are shown. Figure 3B Expected density relative to primer number is shown.

[0057] Figure 4A Linker and construct results are shown. Figure 4B Ten edits associated with emulsion PCR-based tracking are shown.

[0058] Figure 5 Schematic diagram of rational protein editing for metabolic engineering.

[0059] Figure 6 Schematic diagram of generating CRISPR-enriched rational protein libraries.

[0060] Figure 7 Schematic diagram of the setup and proof of CARPE.

[0061] Figure 8 A strategy for iterative CRISPR co-selection is shown.

[0062] Fig. 9 A strategy for multiplexed protein engineering using CARPE is shown.

[0063] Figure 10 shows the construction of a galK donor library using CARPE.

[0064] Fig.11A A schematic diagram of CRISPR-based multiplex editing using CARPE is shown. Fig. 11B Shown is a schematic diagram of CRISPR-based multiplex editing using genome engineering through traceable CRISPR enrichment recombineering (GEn-TraCER).

[0065] Fig.12 A representative GEn-TraCER vector (construct) is shown, which contains the editing cassette for editing codon 24 of galK, the promoter and the spacer.

[0066] Fig.13 The results of galK editing using GEn-TraCER are shown. The figure above shows the DNA sequencing results of chromosomes and vectors (plasmids) from cells transformed with galK codon 24 editing GEn-TraCER vectors, which show that the editing box (oligonucleotides) on the vector can be sequenced as a "trans barcode" that allows efficient tracking of required genome editing (mutation). The figure below shows the DNA sequencing chromatogram of the cell, which shows an unedited wild-type phenotype (red). The method allows identification of cells with multiple chromosomes that carry both unedited wild-type alleles and edited / mutated alleles.

[0067] Figures 14A-14C A schematic diagram of GEn-TraCER is shown. Fig.14A An overview of the design components is shown. The GEn-TraCER box contains a guide RNA (gRNA) sequence to target a specific site in the cell genome and cause dsDNA cleavage. The homology region complementary to the target region causes mutations in the PAM and other nearby desired sites. Cells undergoing recombination are selectively enriched for high abundance. Sequencing of the GEn-TraCER editing box in the vector enables tracking of genome editing / mutations. Fig. 14BAn exemplary editing cassette design is shown for the E. coli galK gene at codon 145. The PAM is deleted with the nearest available PAM mutation, which can be made for a synonymous change at the nearest available PAM position. This enables mutagenesis with a "silent scar" of 1-2 nucleotides at the PAM deletion site. Fig. 14C It was shown that the GEn-TraCER cassette can be synthesized using an array-based synthesis approach, achieving at least 10 4 -10 6 The parallel synthesis of multiple cassettes allows for the systematic targeting and simultaneous fitness assessment of thousands of mutations on a genome-wide scale.

[0068] Fig.15A An overview of the GEn-TraCER vector is shown. Fig. 15B A portion of a representative GEn-TraCER used to generate the Y145* mutation in the E. coli galK gene is shown, wherein the PAM mutation and the mutated codon are separated by 17 nucleotides. The nucleic acid sequence of this portion of the representative GEn-TraCER is provided by SEQ ID NO: 28, and the reverse complement sequence is provided by SEQ ID NO: 33.

[0069] Figures 16A-16C Controls for the GEn-TraCER design are shown. Fig.16A The effect of the size of the editing cassette on the efficiency of the method is shown. Fig. 16B The effect of the distance between the PAM mutation / deletion and the desired mutation on the efficiency of the method is shown. Fig. 16C The effect of the presence or absence of the MutS system on the efficiency of the method is shown. DETAILED DESCRIPTION

[0070] Bacterial and archaeal CRISPR systems have emerged as powerful new tools for precise genome editing. The type II CRISPR system from Streptococcus pyogenes has been particularly well characterized in vitro, and simple design rules have been established to reprogram its double-stranded DNA (dsDNA) binding activity (Jinek et al. Science (2012) 337(6096):816-821). The use of CRISPR-mediated genome editing methods in a wide variety of organisms is rapidly accumulating in the literature, including bacteria (Cong et al. Science (2013) 339(6121):819-823), Saccharomyces cerevisiae (DiCarlo et al. Nucleic Acids Res. (2013) 41:4336-4343), Caenorhabditis elegans (Waaijers et al. Genetics (2013) 195:1187-1191), and various mammalian cell lines (Cong et al. Science (2013) 339(6121):819-823; Wang et al. Cell (2013) 153:910-918). Like other endonuclease-based genome editing technologies, such as zinc finger nucleases (ZFNs), homing nucleases, and TALENS, the ability of the CRISPR system to mediate precise genome editing stems from the highly specific nature of target recognition. For example, type I CRISPR systems from Escherichia coli and Streptococcus pyogenes require complete complementarity between CRISPR RNA (crRNA) and 14-15 base pairs for target recognition, suggesting that the immune function of the CRISPR system has been naturally adopted (Jinek et al. Science (2012) 337(6096):816-821; Brouns et al. Science (2008) 321:960-964; Semenova et al. PNAS (2011) 108:10098-10103).

[0071] Described herein is a genome editing method that uses an endonuclease, such as a Cas9 nuclease encoded by a cas9 gene, to perform directed genome evolution / produce changes (deletions, substitutions, additions) in DNA, such as genomic DNA. The cas9 gene can be obtained from any source, such as bacteria, such as Streptococcus pyogenes. The nucleic acid sequence of cas9 and / or the amino acid sequence of Cas9 can be mutated relative to the sequence of naturally occurring cas9 and / or Cas9; the mutation can be, for example, one or more insertions, deletions, substitutions, or any combination of two or three of the foregoing. In such an embodiment, the resulting mutant Cas9 can have a nuclease activity that is enhanced or reduced relative to the naturally occurring Cas9.

[0072] Figure 1A , 1B Figures 11 and 11A show a CRISPR-mediated genome editing approach known as CRISPR-assisted rational protein engineering (CARPE). CARPE is a two-stage construction process that relies on the generation of “donor” and “destination” libraries that incorporate targeted mutations from single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) editing cassettes directly into the genome. In the first stage of donor construction ( Figure 1A ), rationally designed editing oligonucleotides are co-transformed into cells with guide RNA (gRNA) that hybridizes to / targets a target DNA sequence, such as a sequence located on the 5' side of an open reading frame or other sequence of interest. The key innovation of CARPE is the design of editing oligonucleotides that couple the deletion or mutation of a single protospacer adjacent motif (PAM) to mutation of one or more desired codons in an adjacent gene, thereby enabling the generation of an entire donor library in a single transformation. The donor library is then retrieved by amplifying the recombinant chromosome, such as by a PCR reaction, using synthetic features from the editing oligonucleotides; simultaneously incorporating a second PAM deletion or mutation at the 3' end of the gene. Thus, this approach directly covalently couples codon-targeted mutations to PAM deletions. In the second phase of CARPE ( Figure 1B ), a PCR-amplified donor library carrying endpoint PAM deletions / mutations and targeted mutations (desired mutations of one or more nucleotides, such as one or more nucleotides in one or more codons) is co-transformed into naive cells with an endpoint gRNA vector to generate a cell population expressing a rationally designed protein library.

[0073] In the CRISPR system, CRISPR transactivation (tracrRNA) and spacer RNA (crRNA) guide the selection of the target region. As used herein, the target region refers to any locus that requires a mutation of at least one nucleotide in the nucleic acid of a cell or cell population, such as a mutation of at least one nucleotide in at least one codon (one or more codons). The target region can be, for example, a genomic locus (target genomic sequence) or an extrachromosomal locus. TracrRNA and crRNA can be expressed as a single chimeric RNA molecule, which is referred to as a single guide RNA, guide RNA or gRNA. The nucleic acid sequence of gRNA includes a first nucleic acid sequence (also referred to as the first region, which is complementary to the region of the target region) and a second nucleic acid sequence (also referred to as the second region, which forms a stem-loop structure and is used to recruit Cas9 to the target region). In some embodiments, the first region of gRNA is complementary to the region upstream of the target genomic sequence. In some embodiments, the first region of gRNA is complementary to at least a portion of the target region. The first region of gRNA can be completely complementary to the target genomic sequence (100% complementary) or include one or more mismatches, provided that it is fully complementary to the target genomic sequence to specifically hybridize / guide and recruit Cas9. In some embodiments, the first region of the gRNA is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or at least 30 nucleotides in length. In some embodiments, the first region of the gRNA is at least 20 nucleotides in length. In some embodiments, the stem-loop structure formed by the second nucleic acid sequence is at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 7, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length. In specific embodiments, the stem-loop structure is 80 to 90 or 82 to 85 nucleotides in length, and in further specific embodiments, the second region of the gRNA forming the stem-loop structure is 83 nucleotides in length.

[0074] In some embodiments, the sequence of the gRNA (of the donor library) introduced into the first cell using the CARPE method is the same as the sequence of the gRNA (of the end point library) introduced into the second cell / immature cell. In some embodiments, more than one gRNA is introduced into the first cell population and / or the second cell population. In some embodiments, the more than one gRNA molecules comprise a first nucleic acid sequence complementary to more than one target region.

[0075] In the CARPE method, the double-stranded DNA box, also referred to as the editing oligonucleotide, used in the method can be obtained or derived from many sources. For example, in some embodiments, the dsDNA box is derived from a nucleic acid library that has been diversified by non-homologous random recombination (NRR); such a library is called an NRR library. In some embodiments, the editing oligonucleotide is synthesized, for example, by array-based synthesis. The length of the editing oligonucleotide may depend on the method used to obtain the editing oligonucleotide. In some embodiments, the editing oligonucleotide is about 50-200 nucleotides, 75-150 nucleotides, or 80-120 nucleotides in length.

[0076] The editing oligonucleotide comprises (a) a region homologous to a target region of a nucleic acid of a cell and comprising a mutation (referred to as a desired mutation) relative to at least one codon of the target region, and (b) a pre-spacer adjacent motif (PAM) mutation. The PAM mutation can be any insertion, deletion or substitution of one or more nucleotides that mutates the sequence of the PAM so that it is no longer recognized by the CRISPR system. Cells containing such PAM mutations can be referred to as being "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region can be an insertion, deletion and / or substitution of one or more nucleotides at at least one codon in the target region.

[0077] For the purpose of illustration only, the CARPE method is described below with reference to bacterial genes. The method can be applied to any gene of interest, including genes from any prokaryotic organism including bacteria and archaea or from any eukaryotic organism, including yeast and mammalian (including human) genes. The CARPE method was performed on the galK gene in the Escherichia coli genome, which is partly due to the availability of activity assays for the gene. The method was performed using the BW23115 parent strain and the pSIM5 vector (Datta et al. Gene (2008) 379: 109-115) to mediate recombineering. The cas9 gene was cloned into the pBTBX-2 backbone under the control of the pBAD promoter to allow the cleavage activity to be controlled by adding arabinose. The ability to selectively incorporate a synthetic dsDNA cassette (127bp) was evaluated using a dsDNA cassette from the NNK library, which was constructed via microarray technology using degenerate primers and / or rationally designed oligonucleotides (oligo) synthesized as part of a library of 27,000 members. In both cases, the oligonucleotides were designed to mutate active site residues of the galK gene product. Highly efficient recovery of the donor strain library was verified based on changes in amplicon size obtained with primers targeting the galK locus. Sequencing of these colony PCR products from the NRR library showed that the synthetic priming site (P1) from the dsDNA cassette was incorporated with an efficiency of approximately 90-100%. This suggests that these libraries can be generated with high efficiency without relying on error-prone mutS knockout strains (Costantino et al. PNAS (2003) 100: 15748-15753; Wang et al. Nature (2009) 460: 894-898), which are commonly used in other editing methods based on recombineering. The efficiency of codon mutations was reduced (approximately 20%), which may be due to mutS correction during allele replacement. Preliminary evaluation of clones in the endpoint library showed that when both stages of the construction were in mutS + When performed against background, the final codon editing efficiency was approximately 10%.

[0078] Comparisons with other recently published co-selectable editing schemes were completed using an alternative approach that does not covalently link the PAM to the codon mutation but instead relies on their proximity to each other during replication (Wang et al. Nat. Methods (2012) 9:591-593). In these non-covalent experiments, the same editing oligonucleotides as above were used, and ssDNA oligonucleotides targeting the same donor / destination PAM site were used in an effort to co-select for their insertion. Colony screening of the resulting mutants revealed a high efficiency of recovery of PAM mutants. However, there did not appear to be strong co-selection for the insertion of the dsDNA editing cassette. This may be due to the huge difference in relative recombineering efficiency between the PAM deletion oligonucleotide and the editing cassette that generates a relatively large chromosomal deletion.

[0079] The ability to improve the final editing efficiency of the CARPE method can be evaluated, for example, by performing donor construction in a mutS-deficient strain before transfer to a wild-type donor strain in an attempt to prevent the loss of mutations during the donor construction stage. In addition, the versatility of the CARPE method can be evaluated, for example, by using CARPE for multiple essential genes including dxs, metA, and folA. Essential genes have been effectively targeted using the gRNA design strategy described. The results also show that despite gene disruption during donor library creation, donor libraries can be efficiently constructed and recovered within 1-3 hours after recombineering.

[0080] Also provided herein is a traceable accurate genome editing method using a CRISPR-mediated system, which is referred to as genome engineering (GEn-TraCER) by traceable CRISPR enrichment recombineering. The GEn-TraCER method uses a single vector encoding editing boxes and gRNA to obtain efficient editing / mutations. When used with parallel DNA synthesis such as array-based DNA synthesis, GEN-TraCER provides thousands of single-step generation of accurate editing / mutations, and makes it possible to locate mutations by sequencing the editing boxes on the vector rather than sequencing the genome (genomic DNA) of the cell. The method has a wide range of applications in protein and genome engineering applications and for mutations such as mutations identified in laboratory evolution experiments.

[0081] The GEn-TraCER method and vector combine an editing cassette containing the desired mutation and a PAM mutation with a gene encoding a gRNA on a single vector, which makes it possible to generate a library of mutations in a single reaction. Fig. 11BAs shown, the method includes introducing a vector comprising an editing box containing a desired mutation and a PAM mutation into a cell or a cell population. In some embodiments, the cell into which the vector is introduced also encodes Cas9. In some embodiments, a gene encoding Cas9 is subsequently introduced into a cell or a cell population. The expression of a CRISPR system including Cas9 and gRNA in the cell or cell population is activated; gRNA recruits Cas9 to the target region, and dsDNA cleavage occurs in the target region. Without wishing to be bound by any particular theory, the homologous region of the editing box complementary to the target region mutates one or more codons in the PAM and target regions. Cells in the cell population that do not integrate PAM mutations experience unedited cell death caused by dsDNA cleavage mediated by Cas9. Cells in the cell population that integrate PAM mutations do not experience cell death; they remain viable and are selectively enriched to high abundance. Living cells are obtained and a library of targeted mutations is provided.

[0082] The traceable genome editing method using GEn-TraCER includes: (a) introducing a vector encoding at least one editing box, a promoter and at least one gRNA into a cell or a cell population, thereby producing a cell or a cell population (a second cell population) containing the vector; (b) maintaining the second cell population under conditions of expressing Cas9, wherein the Cas9 nuclease is encoded on the vector, the second vector or on the genome of the cells of the second cell population, resulting in DNA cleavage and death of cells in the second cell population that do not contain PAM mutations, while cells in the second cell population that contain PAM mutations survive; (c) obtaining living cells; and (d) sequencing the editing box of the vector in at least one cell of the second cell population to identify a mutation in at least one codon.

[0083] In some embodiments, a separate vector encoding cas9 is also introduced into a cell or cell population. The vector can be introduced into a cell or cell population using any method or technique known in the art. For example, the vector can be introduced by standard protocols such as transformation (including chemical transformation and electroporation), transduction, and particle bombardment.

[0084] The editing box comprises (a) a region that recognizes (hybridizes) a target region of a nucleic acid in a cell or cell population, is homologous to the target region of the nucleic acid of the cell and comprises a mutation of at least one nucleotide in at least one codon relative to the target region (referred to as a desired mutation), and (b) a pre-spacer adjacent motif (PAM) mutation. The PAM mutation can be any insertion, deletion or substitution of one or more nucleotides that mutates the sequence of the PAM so that the mutated PAM (PAM mutation) is not recognized by the CRISPR system. Cells containing mutations such as PAM mutations can be referred to as "immune" to CRISPR-mediated killing. The desired mutation relative to the sequence of the target region can be an insertion, deletion and / or substitution of one or more nucleotides at at least one codon in the target region. In some embodiments, the distance between the PAM mutation and the desired mutation on the editing cassette is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides. In some embodiments, the PAM mutation is located at a position at least 9 nucleotides from the end of the editing cassette. In some embodiments, the desired mutation is located at a position at least 9 nucleotides from the end of the editing cassette.

[0085] In some embodiments, the required mutation relative to the sequence in the target region is an insertion of a nucleic acid sequence. The nucleic acid sequence inserted in the target region can be of any length. In some embodiments, the nucleic acid sequence inserted is at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900 or a length of at least 2000 nucleotides. In embodiments where the nucleic acid sequence is inserted into a target region, the editing cassette comprises a region that is at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or at least 60 nucleotides in length and is homologous to the target region.

[0086] The term "GEn-TraCER box" can be used to refer to at least a portion of an editing box, a promoter, a spacer sequence, and a gene encoding a gRNA. In some embodiments, the portion of the gene encoding the gRNA on the GEn-TraCER box is complementary to the target region in the gRNA. In some embodiments, the portion complementary to the target region in the gRNA is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or a length of at least 30 nucleotides. In some embodiments, the portion complementary to the target region in the gRNA is a length of 24 nucleotides. In some embodiments, the GEn-TraCER box further comprises at least two priming sites. In some embodiments, the priming site can be used to amplify the GEn-TraCER box by, for example, PCR. In some embodiments, the portion complementary to the target region in the gRNA is used as a priming site.

[0087] In the GEn-TraCER method, the editing cassette and GEn-TraCER cassette for use in the method can be obtained or derived from many sources. For example, in some embodiments, the editing cassette is synthesized, for example, by array-based synthesis. In some embodiments, the GEn-TraCER cassette is synthesized, for example, by array-based synthesis. The length of the editing cassette and / or GEn-TraCER cassette may depend on the method used to obtain the editing cassette and / or GEn-TraCER cassette. In some embodiments, the editing cassette is about 50-300 nucleotides, 75-200 nucleotides, or 80-120 nucleotides in length. In some embodiments, the GEn-TraCER cassette is about 50-300 nucleotides, 75-200 nucleotides, or 80-120 nucleotides in length.

[0088] In some embodiments, the method further comprises obtaining the GEn-TraCER cassette, for example by array-based synthesis, and constructing the vector. Methods for constructing the vector are known to those of ordinary skill in the art, and may include connecting the GEn-TraCER cassette to the vector. In some embodiments, the GEn-TraCER cassette or a subset (library) of the GEn-TraCER cassette is amplified, for example by PCR, prior to constructing the vector.

[0089] The cells or cell colonies comprising the vector and also encoding Cas9 are maintained or cultured under conditions of expressing Cas9. Cas9 expression can be controlled. The methods described herein include maintaining the cells under conditions where Cas9 expression is activated, which results in the production of Cas9. The specific conditions for expressing Cas9 will depend on factors such as the properties of the promoter used to regulate Cas9 expression. In some embodiments, in the presence of an inducer molecule such as arabinose, Cas9 expression is induced. When a cell or cell colony comprising DNA encoding Cas9 is in the presence of an inducer molecule, expression of Cas9 occurs. In some embodiments, in the presence of a repressor molecule, Cas9 expression is suppressed. When a cell or cell colony comprising DNA encoding Cas9 is in the absence of a molecule that suppresses Cas9 expression, expression of Cas9 occurs.

[0090] Cells that maintain a viable cell population are obtained or separated from cells that undergo unedited cell death caused by Cas9-mediated killing; this can be accomplished, for example, by plating the cell population on a culture surface to allow growth of viable cells that can then be used for assessment.

[0091] Using the GEn-TraCER method, the desired mutation coupled to the PAM mutation is traceable by sequencing the editing box on the vector in the living cells of the population (cells that have integrated the PAM mutation). This allows mutations to be easily identified without the need to sequence the genome of the cell. The method includes sequencing the editing box to identify mutations in one or more codons. The editing box as a component of the vector can be sequenced, or sequencing can be performed after the editing box is separated from the vector and optionally amplified. Any sequencing method known in the art can be used, such as sequencing by Sanger sequencing.

[0092] The methods described herein can be performed in any type of cell (including prokaryotic and eukaryotic cells) in which a CRISPR system can function (e.g., targeting and cleaving DNA). In some embodiments, the cell is a bacterial cell, such as a species of the genus Escherichia (Escherichia spp.) (e.g., Escherichia coli). In other embodiments, the cell is a fungal cell, such as a yeast cell, e.g., a species of the genus Saccharomyces (Saccharomyces spp.). In other embodiments, the cell is an algal cell, a plant cell, an insect cell, or a mammalian cell, including a human cell.

[0093] A "vector" is any one of a variety of nucleic acids that contain a desired sequence or a sequence to be delivered to a cell or expressed in a cell. For example, the desired sequence can be contained in a vector by restriction and ligation or by recombination. Vectors are typically composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to, plasmids, fosmids, phagemids, viral genomes, and artificial chromosomes.

[0094] The vector useful in the GEN-TraCER method comprises at least one editing box as described herein, a promoter, and at least one gene encoding a gRNA. In some embodiments, more than one editing box (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more editing boxes) are included on the vector. In some embodiments, the more than one editing box is homologous to different target regions (e.g., there are different editing boxes, each editing box is homologous to different target regions). Alternatively or in addition, the vector may include more than one gene encoding more than one gRNA (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more gRNAs). In some embodiments, the more than one gRNA contains a region complementary to a portion of different target regions (e.g., there are different gRNAs, each gRNA is complementary to a portion of different target regions).

[0095] In some embodiments, a GEn-TraCER cassette comprising at least one editing cassette, a promoter, and a gene encoding a portion of a gRNA is ligated into a vector encoding another portion of the gRNA. Upon ligation, the portion of the gRNA from the GEn-TraCER cassette is linked to the other portion of the gRNA and forms a functional gRNA.

[0096] The promoter and the gene encoding the gRNA are operably connected. In some embodiments, the method includes introducing a second vector encoding Cas9. In such an embodiment, the vector may further include one or more promoters operably connected to the gene encoding Cas9. As used herein, "operably" connection means that the promoter affects or regulates the transcription of the coding DNA of genes such as the gene encoding the gRNA or the gene encoding Cas9. The promoter can be a natural promoter (a promoter present in the cell introducing the vector). In some embodiments, the promoter is an inducible or repressible promoter (regulating the promoter to allow inducible or repressible transcription of genes such as the gene encoding the gRNA or the gene encoding the Cas9), such as a promoter regulated by the presence or absence of a molecule (e.g., an inducer or a repressor). The properties of the promoter required for expressing the gRNA can vary according to species or cell type, and will be recognized by those of ordinary skill in the art.

[0097] In some embodiments, the method includes introducing a separate vector encoding Cas9 into a cell or cell population before or simultaneously with the introduction of a vector comprising at least one editing box, a promoter, and at least one gRNA as described herein. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell or cell population. The DNA encoding Cas9 may be integrated into the cell genome before the introduction of a vector comprising at least one editing box, a promoter, and at least one gRNA as described herein, or after the introduction of a vector comprising at least one editing box, a promoter, and at least one gRNA as described herein. Alternatively, a nucleic acid molecule, such as DNA encoding Cas9, can be expressed by DNA integrated into the genome. In some embodiments, the gene encoding Cas9 is integrated into the genome of the cell.

[0098] Vectors useful in the GEn-TraCER methods described herein can further comprise a spacer sequence, two or more priming sites, or both a spacer sequence and two or more priming sites. In some embodiments, the presence of priming sites flanking the GEn-TraCER cassette allows for amplification of the editing cassette, promoter, and gRNA nucleic acid sequences.

[0099] The present invention provides embodiments including but not limited to the following:

[0100] 1. A genome engineering method comprising:

[0101] (a) introducing into the cell a vector encoding:

[0102] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in said cell and comprising a mutation of at least one nucleotide relative to the target region, referred to as the desired mutation, and a protospacer adjacent motif (PAM) mutation;

[0103] (ii) a promoter; and

[0104] (iii) at least one guide RNA (gRNA) comprising:

[0105] (a) a region (RNA) complementary to a portion of the target region; and

[0106] (b) a region (RNA) that recruits Cas9 nuclease, thereby generating a cell containing the vector;

[0107] (b) maintaining a cell comprising the vector under conditions that express Cas9, wherein the Cas9 nuclease is encoded on the vector, on a second vector, or on the genome of the cell, resulting in the production of a cell comprising the vector and not comprising the PAM mutation and a cell comprising the vector and the PAM mutation;

[0108] (c) culturing the product of (b) under conditions suitable for cell viability, thereby producing living cells;

[0109] (d) obtaining the living cells produced in (c); and

[0110] (e) sequencing the editing oligonucleotide of the vector of at least one living cell obtained in (d), and identifying a mutation in at least one codon.

[0111] 2. A genome engineering method by traceable CRISPR enrichment recombineering, comprising:

[0112] (a) introducing into a first cell population a vector encoding:

[0113] (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation relative to the target region, and (b) a protospacer adjacent motif (PAM) mutation;

[0114] (ii) at least one promoter; and

[0115] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region, and (b) a region (RNA) that recruits a Cas9 nuclease, thereby generating a second cell population comprising the vector;

[0116] (b) maintaining the second cell population under conditions in which a Cas9 nuclease is expressed, wherein the Cas9 nuclease is encoded on the vector, the second vector, or on the genome of cells of the second cell population, resulting in DNA cleavage in cells that do not comprise the PAM mutation and death of such cells;

[0117] (c) obtaining the living cells produced in (b); and

[0118] (d) identifying a mutation in at least one codon by sequencing the editing oligonucleotide of the vector of at least one cell of the second population of cells.

[0119] 3. The method according to embodiment 1 or embodiment 2, further comprising synthesizing and / or obtaining a population of editing oligonucleotides.

[0120] 4. The method of any one of embodiments 1 to 3, further comprising amplifying the population of editing oligonucleotides.

[0121] 5. The method according to any one of embodiments 1-4, wherein the vector further comprises a spacer and / or at least two priming sites.

[0122] 6. A method according to any one of embodiments 1-5, wherein the editing box comprises a target region comprising a mutation of at least one codon within 100 nucleotides of the PAM mutation.

[0123] 7. A CRISPR-assisted rational protein engineering (combinatorial genome engineering) method comprising:

[0124] (a) constructing a donor library comprising recombinant DNA, such as recombinant DNA in a recombinant chromosome or a plasmid, by introducing into a first cell population (co-transforming the first cell population with the following substances): (i) one or more editing oligonucleotides, such as rationally designed oligonucleotides, which couple the deletion of a first single protospacer adjacent motif (PAM) with the mutation of at least one codon in a gene adjacent to the PAM (adjacent gene), and (ii) a guide RNA (gRNA) that targets a nucleotide sequence located at the 5' side of an open reading frame of a chromosome, thereby generating a donor library comprising a first cell population, the first cell population comprising a recombinant chromosome having a targeted codon mutation;

[0125] (b) recovering the donor library constructed in (a) by amplification (such as PCR amplification) of recombinant DNA (such as recombinant chromosomes), using the synthetic features from the editing oligonucleotide, and simultaneously incorporating a second PAM deletion (end point PAM deletion) at the 3' end of the gene, thereby directly covalently coupling the targeted codon mutation to the end point PAM deletion, and generating a recovered donor library carrying the end point PAM deletion and the targeted codon mutation; and

[0126] (c) co-transforming the recovered donor library carrying the endpoint PAM deletion and targeted codon mutation with the endpoint gRNA plasmid into a naive cell population, thereby generating an endpoint library comprising the targeted codon mutation.

[0127] 8. The method of embodiment 7, further comprising maintaining the endpoint library under conditions for producing protein.

[0128] 9. A method according to embodiment 7 or embodiment 8, wherein the first cell population expresses a polypeptide having Cas9 nuclease activity.

[0129] 10. The method of embodiment 9, wherein the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0130] 11. A method according to embodiment 10, wherein the editing oligonucleotide is complementary to a target nucleic acid present in the first cell.

[0131] 12. A method according to embodiment 11, wherein the editing oligonucleotide targets more than one target site or locus in the first cell.

[0132] 13. A method according to any one of embodiments 7-12, wherein the nucleic acid sequence of the editing oligonucleotide contains one or more substitutions, deletions, or insertions relative to the target nucleic acid.

[0133] 14. A method according to any one of embodiments 7-13, wherein the editing oligonucleotide is rationally designed.

[0134] 15. The method of any one of embodiments 7-14, wherein the editing oligonucleotide is generated using a degenerate primer oligonucleotide.

[0135] 16. A method according to embodiment 7, wherein the editing oligonucleotide is derived from a collection (library) of nucleic acids.

[0136] 17. A method according to embodiment 7, wherein the gRNA is encoded on a plasmid.

[0137] 18. A method according to embodiment 7, wherein the editing oligonucleotide and the gRNA are introduced into the first cell by transformation.

[0138] 19. A method according to embodiment 7, wherein the editing oligonucleotide and the gRNA are introduced into the first cell sequentially.

[0139] 20. A method according to embodiment 7, wherein the editing oligonucleotide and the gRNA are introduced into the first cell simultaneously.

[0140] 21. The method of embodiment 7, wherein recovering the donor library further comprises the following steps: (a) screening cells for incorporation of the editing oligonucleotide, and (b) selecting cells confirmed to have incorporated the editing oligonucleotide.

[0141] 22. The method of embodiment 7, wherein recovering the donor library further comprises processing the recovered donor library.

[0142] 23. A method according to embodiment 7, wherein the endpoint cells / naive cells express a polypeptide having Cas9 nuclease activity.

[0143] 24. A method according to embodiment 23, wherein the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0144] 25. A CRISPR-assisted rational protein engineering method comprising:

[0145] (a) introducing (co-transforming) into a first cell population (i) a synthetic dsDNA editing cassette comprising editing oligonucleotides and (ii) a vector expressing a guide RNA (gRNA) targeting a genomic sequence just upstream of a gene of interest, under conditions whereby multiplex recombineering of the editing oligonucleotides and selective enrichment by the gRNAs occurs, thereby generating a donor library;

[0146] (b) amplifying a donor library having an oligonucleotide lacking a protospacer adjacent motif (PAM) adjacent to the 3' end of the gene of interest (terminal PAM), thereby generating an amplified donor library comprising a dsDNA editing cassette having a 3' PAM deletion, a rational codon mutation, and a P1 site;

[0147] (c) treating the amplified donor library with BsaI to remove the P1 site; and

[0148] (d) Co-transforming the naive cell population with the amplified donor library generated in (c) and the endpoint gRNA, thereby generating a co-transformed cell population comprising a dsDNA editing cassette with a 3' PAM deletion, a rational codon mutation, and the endpoint gRNA.

[0149] 26. The method of embodiment 25, further comprising maintaining the population of co-transformed cells produced in (d) under conditions where protein expression occurs.

[0150] 27. A method according to embodiment 25 or 26, wherein the first cell expresses a polypeptide having Cas9 nuclease activity.

[0151] 28. A method according to embodiment 27, wherein the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0152] 29. A method according to embodiment 25, wherein the editing oligonucleotide is complementary to a target nucleic acid present in the first cell.

[0153] 30. A method according to embodiment 29, wherein the editing oligonucleotide targets more than one target site or locus in the first cell.

[0154] 31. A method according to any one of embodiments 25-30, wherein the nucleic acid sequence of the editing oligonucleotide contains one or more substitutions, deletions, or insertions relative to the target nucleic acid.

[0155] 32. A method according to any one of embodiments 25-31, wherein the editing oligonucleotide is rationally designed.

[0156] 33. A method according to any one of embodiments 25-31, wherein the editing oligonucleotide is generated using a degenerate primer oligonucleotide.

[0157] 34. A method according to embodiment 25, wherein the editing oligonucleotide is derived from a collection (library) of nucleic acids.

[0158] 35. A method according to embodiment 25, wherein the gRNA is encoded on a plasmid.

[0159] 36. A method according to embodiment 25, wherein the editing oligonucleotide and the gRNA are introduced into the first cell by transformation.

[0160] 37. A method according to embodiment 25, wherein the editing oligonucleotide and the gRNA are introduced into the first cell population sequentially.

[0161] 38. A method according to embodiment 25, wherein the editing oligonucleotide and the gRNA are introduced into the first cell simultaneously.

[0162] 39. A method according to embodiment 25, wherein recovering the donor library further comprises the following steps: (a) screening cells for incorporation of the editing oligonucleotide, and (b) selecting cells confirmed to have incorporated the editing oligonucleotide.

[0163] 40. The method of embodiment 25, wherein recovering the donor library further comprises processing the recovered donor library.

[0164] 41. A method according to embodiment 25, wherein the endpoint cells / naive cells express a polypeptide having Cas9 nuclease activity.

[0165] 42. A method according to embodiment 38, wherein the polypeptide having Cas9 nuclease activity is expressed under the control of an inducible promoter.

[0166] 43. A vector comprising:

[0167] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0168] (ii) a promoter; and

[0169] (iii) at least one guide RNA (gRNA) comprising:

[0170] (a) a region (RNA) complementary to a portion of the target region; and

[0171] (b) The region (RNA) that recruits the Cas9 nuclease.

[0172] 44. A vector comprising:

[0173] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide in at least one codon relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0174] (ii) a promoter; and

[0175] (iii) at least one guide RNA (gRNA) comprising:

[0176] (a) a region (RNA) complementary to a portion of the target region; and

[0177] (b) The region (RNA) that recruits the Cas9 nuclease.

[0178] 45. A vector comprising:

[0179] (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation of at least one nucleotide relative to the target region, and (b) a protospacer adjacent motif (PAM) mutation;

[0180] (ii) at least one promoter; and

[0181] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region, and (b) a region (RNA) that recruits the Cas9 nuclease.

[0182] 46. ​​A vector comprising:

[0183] (i) at least one editing cassette comprising: (a) a region homologous to a target region of a nucleic acid and comprising a mutation of at least one nucleotide in at least one codon relative to the target region, and (b) a protospacer adjacent motif (PAM) mutation;

[0184] (ii) at least one promoter; and

[0185] (iii) at least one guide RNA (gRNA) comprising: (a) a region (RNA) complementary to a portion of the target region, and (b) a region (RNA) that recruits the Cas9 nuclease.

[0186] 47. The vector of any one of embodiments 43 to 46, wherein the vector further comprises a spacer; at least two priming sites; or a spacer and at least two priming sites.

[0187] 48. The vector of any one of embodiments 44, 46 or 47, wherein the editing box comprises a target region comprising a mutation of at least one codon within 100 nucleotides of a PAM mutation.

[0188] 49. A library comprising a population of cells produced by the method of any one of embodiments 1-48.

[0189] 50. A library comprising a cell population comprising the vector of any one of embodiments 43-48.

[0190] 51. A cell population comprising a vector comprising:

[0191] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0192] (ii) a promoter; and

[0193] (iii) at least one guide RNA (gRNA) comprising:

[0194] (a) a region (RNA) complementary to a portion of the target region; and

[0195] (b) The region (RNA) that recruits the Cas9 nuclease.

[0196] 52. A cell population comprising a vector, comprising:

[0197] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in a cell and comprising a mutation of at least one nucleotide in at least one codon relative to the target region (referred to as the desired mutation), and a protospacer adjacent motif (PAM) mutation;

[0198] (ii) a promoter; and

[0199] (iii) at least one guide RNA (gRNA) comprising:

[0200] (a) a region (RNA) complementary to a portion of the target region; and

[0201] (b) The region (RNA) that recruits the Cas9 nuclease.

[0202] 53. A genome engineering method comprising:

[0203] (a) introducing into the cell a vector encoding:

[0204] (i) an editing cassette comprising a region homologous to a target region of a nucleic acid in said cell and comprising a mutation of at least one nucleotide in at least one codon relative to the target region, referred to as the desired mutation, and a protospacer adjacent motif (PAM) mutation;

[0205] (ii) a promoter; and

[0206] (iii) at least one guide RNA (gRNA) comprising:

[0207] (a) a region (RNA) complementary to a portion of the target region; and

[0208] (b) a region (RNA) that recruits Cas9 nuclease, thereby generating a cell containing the vector;

[0209] (b) maintaining a cell comprising the vector under conditions that express Cas9, wherein the Cas9 nuclease is encoded on the vector, on a second vector, or on the genome of the cell, resulting in the production of a cell comprising the vector and not comprising the PAM mutation and a cell comprising the vector and the PAM mutation;

[0210] (c) culturing the product of (b) under conditions suitable for cell viability, thereby producing living cells;

[0211] (d) obtaining the living cells produced in (c); and

[0212] (e) sequencing the editing oligonucleotide of the vector of at least one living cell obtained in (d), and identifying a mutation in at least one codon.

[0213] Example

[0214] Example 1: Editing galK using the CARPE method

[0215] The CARPE method was implemented on the galactokinase gene galK in the E. coli genome; there are many assays available to assess the activity of the gene product. Experiments were performed using the E. coli BW23115 parental strain and the pSIM5 vector (Datta et al. Gene (2008) 379: 109-115) to mediate recombineering. The gene encoding Cas9 was cloned into the pBTBX-2 backbone under the control of the pBAD promoter to allow control of Cas9 cleavage activity by adding arabinose to the culture medium.

[0216] First, the ability to selectively incorporate a synthetic dsDNA cassette (127 bp) was tested. The synthetic dsDNA cassette was derived from an NNR library constructed via microarray technology by either degenerate primers or by rationally designed oligonucleotides synthesized as part of a 27,000-member library. In both cases, the oligonucleotides were designed to mutate the active site residues of the galK gene product, as well as contain a synthetic priming site P1 (SEQ ID NO: 1). The highly efficient recovery of the donor strain library was verified based on changes in the size of the amplicon obtained by colony PCR using primers for the galK locus. Sequencing of colony PCR products from the NNR library showed that the synthetic priming site (P1) from the dsDNA cassette was incorporated into the ( Figure 2 ). This surprising and unexpected result shows that libraries can be generated with high efficiency without relying on error-prone mutS-deficient strains (Costantino et al. PNAS (2003) 100: 15748-15753; Wang et al. Nature (2009) 460: 894-898) that are commonly used in other recombineering-based editing methods. However, the efficiency of codon mutation was reduced (about 20%), which may be due to mutS correction during allele replacement. In this work, when both stages of the construction were performed in a mutS+ background, the final codon editing efficiency was about 10%.

[0217] To increase the ultimate editing efficiency and versatility of the CARPE approach, donor construction can be performed in a mutS-deficient strain prior to transfer to a mutS+ donor strain in an attempt to prevent the loss of mutations during the donor construction stage.

[0218] Example 2: Targeting essential genes using the CARPE approach

[0219] To test the versatility of the CARPE approach, the approach was used as described above for a variety of essential genes including dxs, metA, and folA. Essential genes can be targeted using a gRNA design strategy (Figure 3).

[0220] Data from CARPE experiments targeting dxs genes also demonstrated that despite gene disruption during donor library creation, it is possible to efficiently construct and retrieve donor libraries within 1–3 h after recombineering.

[0221] Example 3: Regulating the production of prenol using the CARPE method

[0222] Seeking better biofuels for industrial production via bacterial production requires the ability of prior art genome design, engineering and screening required products. Previously, we have demonstrated the ability to change the expression level of each gene in the Escherichia coli genome alone (Warner et al. Nat. Biotechnol (2010) 28: 856-862). The method (referred to as traceable multiplex recombineering (TRMR)) has produced a library of approximately 8000 genome-modified cells (approximately 4000 overexpressed genes and approximately 4000 knock-down genes). The library was subsequently screened under different conditions, which enables a deeper understanding of the activity of gene products and produces better performing strains under these selections. TRMR allows the protein expression of two levels to be changed (overexpressed and knocked down) but cannot achieve the modification of open reading frames (ORFs). Here, our purpose is to produce a large library of ORF modifications, and the entire metabolic pathway is engineered to optimize the production of biofuels.

[0223] The main difficulty in producing such a rationally designed library (compared to random mutagenesis) is the efficiency of inserting the desired mutation into the target cell. Recombineering, a typical method for genome modification in Escherichia coli, uses recombinant genes from λ phage to promote the insertion of foreign DNA into the host genome. However, this method has low efficiency and can be overcome by adding antibiotic resistance genes and then selecting (as in TRMR) or by recursively inducing recombination events (i.e., by MAGE (Wang et al. Nature (2008) 460: 894-898)). The CARPE method described herein improves the efficiency of recombineering, including the use of a CRISPR system to remove all non-recombinant cells from a population. CRISPR is a recently discovered RNA-based adaptive defense mechanism for bacteria and archaea against invading phages and plasmids (Bhaya et al. Ann. Rev. of Genetics (2011) 45: 273-297). The system has undergone extensive engineering to enable the use of two plasmids to allow sequence-directed double-strand breaks, one plasmid encoding the CRISPR-associated nuclease Cas9, and the second plasmid encoding a sequence-specific guide RNA (gRNA) that guides Cas9 to its unique location (Qi et al. Cell (2013) 45: 273-297). The CARPE method exploits the ability of the CRISPR system to induce DNA breaks and thus cell death in a sequence-dependent manner. We have generated a DNA recombineering cassette that contains mutations in common positions outside the open reading frame of the gene targeted by the CRISPR machinery in addition to the desired mutations within the ORF. This method of linking / coupling the desired mutations to avoid CRISPR-mediated death due to PAM mutations / deletions enables significant enrichment of engineered cells within the entire cell population.

[0224] The method was further illustrated using the DXS pathway. The DSX pathway leads to the production of isopentenyl pyrophosphate (IPP), which leads to the biosynthesis of terpenes and terpenoids. Interestingly, IPP can also be a precursor to lycopene or isopentenol if the required genes are added. Lycopene makes bacterial colonies red and can therefore be easily screened, while isopentenol is considered a 'second generation' biofuel with higher energy density and lower water miscibility than ethanol. The following three proteins were selected for engineering: 1) DSX, the first rate-limiting enzyme of the pathway, 2) IspB, which diverts metabolic flux from the DXS pathway, and 3) NudF, which has been shown to convert IPP to isopentenol in both E. coli and B. subtilis (Withers et al. App. Environ. Microbiol (2007) 73: 6277-6283; Zheng et al. Biotechnol. for biofuels (2013) 6: 57)). A new image analysis tool developed for colony color quantification will be used to screen mutations in the genes encoding DXS and IspB for increased lycopene production. NudF activity is determined directly by measuring prenol levels via GC / MS, and indirectly by prenol auxotrophic cells that will be used as biosensors. This method provides the ability to rationally engineer large mutant libraries into the E. coli genome with high accuracy and efficiency, as well as strains that produce high yields of prenol.

[0225] Example 4: Editing galK using the GEn-TraCER method

[0226] The GEn-TraCER method was used to edit the galK gene, which has been used as a model system for recombineering in E. coli (Yu et al. 2000). The first GEn-TraCER cassette constructed was designed to introduce a stop codon in place of the in-frame PAM at codon 24 of galK and was designated galK_Q24 ( Fig.12 ). Constructs and vectors were designed using custom python scripts to generate necessary mutations in high throughput.

[0227] The control cassette was cloned into the gRNA vector described by Qi et al. Cell (2013) using the circular polymerase cloning (CPEC) method. The backbone was linearized using the following primers: CCAGAAATCATCCTTAGCGAAAGCTAAGGAT (SEQ ID NO: 29) and GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT (SEQ ID NO: 30).

[0228] The GenTRACER cassette was ordered as a gblock and amplified using the following primers: ATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGG (SEQ ID NO: 31), ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 32).

[0229] The components were stitched together using CPEC and transformed into E. coli to generate the vector. The procedure was performed in a multiplexed fashion using the pooled oligonucleotide library with a cloning efficiency of 10 4 -10 5 The order of CFU / μg.

[0230] At 30 ° C, in LB containing 50 μg / mL kanamycin and 34 μg / mL chloramphenicol, Escherichia coli MG1655 cells carrying pSIM5 (λ-RED plasmid) and X2-cas9 plasmid were grown to mid-log phase (0.4-0.7 OD). The recombinant engineering function of the pSIM5 vector was induced at 42 ° C for 15 min, then placed on ice for 10 min. The cells were then precipitated and washed twice with 10 mL of cooling H2O to make the cells electrocompetent cells. The cells were transformed with 100 ng of GEn-TraCER plasmid (also encoding carbenicillin resistance) and recovered at 37 ° C for 3 hr. 50-100 μL of cells were inoculated into a suitable culture medium containing 50 μg / mL kanamycin and 100 μg / ml carbenicillin to selectively enrich for CRISPR edited strains. Red / white screening was used on MacConkey agar supplemented with galactose to calculate the editing efficiency of the galK gene.

[0231] Based on screening on MacConkey agar, the galK_Q24* design was observed to have an editing efficiency of approximately 100%. Interestingly, unlike oligonucleotide-mediated recombineering approaches that require mismatch repair knockout to achieve high efficiency (Li et al. 2003; Sawitzke et al. 2011; Wang et al. 2011), there was no effect in strains with intact or incomplete mismatch repair machinery.

[0232] Chromosomal and vector sequences were subsequently verified by Sanger sequencing.

[0233] As expected, the mutations designed in the vector were reflected on the chromosome ( Fig.13 ), suggesting that the mutation is present in two locations and that the plasmid acts as a trans-acting barcode (trans-barcode) or record of genome editing.

[0234] The design is suitable for generating a novel nucleotide sequence consisting of synonymous PAM mutations ( Fig. 14B , ΔPAM), rationally mutagenizing protein coding frames on a genome-wide scale to “immunize” cells against Cas9-mediated cleavage, while leaving translation products undisturbed. We reasoned that silencing scars could allow for high efficiency co-selection of edits or other features of interest near the codon. The effects of homology arm length and the distance between the PAM mutation / deletion in galK and the desired mutation were assessed and their efficiency was compared ( Fig. 16B When the homology arm length was extended from 80 to 100 nucleotides using the same PAM editing, a significant increase in mutation efficiency at galK position 145 was observed (approximately 5% and 45%, respectively).

[0235] Example 5: Reconstruction of mutations using the GEn-TraCER method

[0236] The GEn-TraCER method is extended to genome scale using customized automated design software that allows the definition of sites around the targeted genome with simple user input. The method is tested by reconstructing all non-synonymous point mutations from a recently reported Escherichia coli heat adaptation study (Tenaillon et al. 2012). The study characterizes a full set of mutations that occur in 115 isolates from independently bred strains. This data set provides a diverse source of mutations, and the individual fitness impact of this source further illustrates the mechanical basis of this complex phenotype. In codon usage and ΔPAM, where possible, each of these mutations is reconstructed with 2 times redundancy to achieve statistical correction of PAM and target codon mutations in downstream fitness analysis.

[0237] Example 6: Modulation of genetic interactions using the GEn-TraCER approach

[0238] Promoter rewiring libraries were generated by integrating a promoter that is dynamically regulated by environmental factors (oxygen levels, carbon source, stress) upstream of each gene in the E. coli genome. The GEn-TraCER method was used to generate strains with rewiring genotypes that may be beneficial, for example, for tolerance to a chemical of interest for production.

Claims

1. A nucleic acid molecule comprising: (i) an editing cassette comprising a region that (a) is homologous to a nucleic acid sequence in a target region of a cell and (b) comprises a mutation in at least one nucleotide relative to the target region and a mutation in a protospacer adjacent motif; and (ii) a region encoding at least one guide RNA, the at least one guide RNA comprising: (a) a region complementary to a portion of the target region; and (b) a region that recruits a CRISPR-associated nuclease; wherein the editing cassette and the region encoding the at least one guide RNA are covalently linked.

2. The nucleic acid molecule of claim 1, wherein cells comprising a mutation in the protospacer-adjacent motif confer immunity to nuclease-mediated editing by the at least one guide RNA.

3. The nucleic acid molecule according to claim 1 or 2, wherein the mutation in at least one nucleotide is in a codon in the target region of the cell.

4. The nucleic acid molecule of claim 1 or 2, wherein the mutation in at least one nucleotide comprises one or more substitutions relative to the target region.

5. The nucleic acid molecule of claim 1 or 2, wherein the mutation in at least one nucleotide comprises one or more insertions relative to the target region.

6. The nucleic acid molecule of claim 5, wherein the one or more insertions are at least 50 nucleotides in length.

7. The nucleic acid molecule of claim 1 or 2, wherein the mutation in at least one nucleotide comprises one or more deletions relative to the target region.

8. The nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid molecule further comprises a trans barcode for identifying cell editing by the nucleic acid molecule.

9. The nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid molecule is part of an RNA vector.

10. A library, which is a library of nucleic acid molecules according to any one of claims 1 to 9, wherein the guide RNAs in the library target at least two different target regions of a cell.

11. The library of claim 10, wherein the guide RNAs encoded by the library target at least ten different target regions of a cell.

12. The library of claim 10, wherein the library is configured to generate thousands of mutations at a genome-wide scale.

13. A nucleic acid molecule encoding an RNA molecule comprising: (i) a first segment comprising a guide RNA sequence comprising (X) a region complementary to a target site within a target region of a target nucleic acid and (Y) a region that recruits a CRISPR-associated nuclease; and (ii) a second segment comprising a sequence that (a) is homologous to a portion of the target region and (b) comprises a mutation in at least one nucleotide relative to the target region and a mutation in the protospacer adjacent motif; wherein the first segment and the second segment are covalently linked.

14. The nucleic acid molecule of claim 13, wherein the second segment comprises a site that confers immunity to nuclease-mediated editing by the guide RNA.

15. The nucleic acid molecule according to claim 13 or 14, wherein the nucleic acid molecule is part of a DNA vector.

16. The nucleic acid molecule according to claim 13 or 14, wherein the mutation in at least one nucleotide is located in a codon in the target region of the target nucleic acid.

17. The nucleic acid molecule of claim 13 or 14, wherein the mutation in at least one nucleotide relative to the target region comprises one or more substitutions relative to the target region.

18. The nucleic acid molecule of claim 13 or 14, wherein the mutation in at least one nucleotide relative to the target region comprises one or more insertions relative to the target region.

19. The nucleic acid molecule of claim 18, wherein the one or more insertions are at least 50 nucleotides in length.

20. The nucleic acid molecule of claim 13 or 14, wherein the mutation in at least one nucleotide relative to the target region comprises one or more deletions relative to the target region.

21. The nucleic acid molecule of claim 13 or 14, wherein the nucleic acid molecule further comprises a trans-barcode for identifying the mutation in the at least one nucleotide relative to the target region.

22. The nucleic acid molecule according to claim 13 or 14, wherein the target nucleic acid is a target bacterial nucleic acid or a target yeast nucleic acid.

23. The nucleic acid molecule of claim 13 or 14, wherein the target nucleic acid is a target mammalian nucleic acid.

24. A library comprising more than one nucleic acid molecule according to any one of claims 13-23.

25. The library of claim 24, wherein the guide RNAs encoded by the library target at least two different target regions of a cell.

26. The library of claim 24, wherein the guide RNAs encoded by the library target at least ten different target regions of a cell.

27. The library of claim 24, wherein the nucleic acid molecules are synthesized by array-based synthesis.

28. A method of genome engineering, comprising: (a) introducing a nucleic acid molecule from any one of claims 1 to 9 into a first cell population, thereby producing a second cell population comprising the nucleic acid molecule; and (b) maintaining the second cell population under conditions where a CRISPR-associated nuclease is expressed, wherein the CRISPR-associated nuclease is encoded on the nucleic acid molecule, on a second nucleic acid molecule, or on genomic DNA of the second cell population, thereby producing a third cell population comprising the mutation in the nucleic acid molecule and the protospacer adjacent motif mutation.

29. The method according to claim 28, further comprising: (c) culturing the product of (b) under conditions suitable for cell survival, thereby producing living cells comprising the endpoint library; (d) obtaining the living cells produced in (c); and (e) identifying a mutation in at least one nucleotide by sequencing.

30. The method of claim 28, further comprising screening or selecting cells having a phenotype of interest.

31. The method of claim 29, wherein sequencing comprises sequencing the editing cassette.

32. The method of claim 28, further comprising inducing death of cells that do not comprise the protospacer-adjacent motif mutation.

33. The method of claim 28, wherein the cell is a prokaryotic cell.

34. The method of claim 28, wherein the cell is a eukaryotic cell.

35. The method of claim 28, wherein the cell is a yeast cell, an algal cell, a plant cell, or a mammalian cell.

36. The method of claim 28, wherein the target region of the nucleic acid molecule is contained within a genomic locus.

37. The method of claim 28, wherein the target region of the nucleic acid molecule is contained within an extrachromosomal locus.

38. The method of claim 28, performed in a multiplexed fashion to generate a library of mutant genomes.

39. The method of claim 38, wherein the library comprises at least two mutant genomes.

40. The method of claim 39, wherein the library comprises at least 8,000 different mutations.

41. The method of claim 40, wherein the library comprises at least 27,000 different rationally designed oligonucleotides.

42. The nucleic acid molecule of any one of claims 1-2 and 13-14, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

43. The library of claim 10, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

44. The library of claim 24, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

45. The method of claim 28, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

46. ​​A method of generating a library of cells having genome editing, the method comprising: More than one synthetic editing oligonucleotide is provided, each individually comprising: (i) an editing cassette comprising a region that (a) is homologous to a nucleic acid sequence in a target region of a cell and (b) comprises a mutation in at least one nucleotide relative to the target region and a mutation in a protospacer adjacent motif; and (ii) a region encoding at least one guide RNA, the at least one guide RNA comprising: (a) a region complementary to a portion of the target region; and (b) a region that recruits a CRISPR-associated nuclease; wherein the editing cassette and the region encoding the at least one guide RNA are covalently linked; transforming the more than one synthetic editing oligonucleotides and the vector backbone into a cell population comprising the target region, maintaining the cell under conditions that express a CRISPR-associated nuclease, wherein the CRISPR-associated nuclease is encoded on genomic DNA within the cell or on a polynucleotide transformed into the cell, and Cells comprising a mutation in at least one nucleotide relative to the target region are enriched.

47. The method of claim 46, wherein the cell is a prokaryotic cell.

48. The method of claim 46, wherein the cell is a eukaryotic cell.

49. The method of any one of claims 46-48, wherein the synthetic editing oligonucleotides are synthesized by array-based synthesis and optionally amplified.

50. The method of any one of claims 46-48, wherein the mutation in at least one nucleotide comprises one or more nucleotide substitutions, deletions, or insertions relative to the target region.

51. A cell comprising the nucleic acid molecule of any one of claims 10-23.

52. A cell, comprising: (A) A nucleic acid comprising: (i) a nucleic acid sequence encoding at least one editing cassette, the at least one editing cassette comprising (a) a region homologous to a target region of a nucleic acid in a cell, (b) a mutation in at least one nucleotide relative to the target region, and (c) mutation of the first protospacer adjacent motif; and (ii) a nucleic acid sequence encoding at least one guide RNA, the at least one guide RNA comprising: (a) a region complementary to a portion of the target region; and (b) regions that interact with CRISPR-associated nucleases, wherein the at least one editing cassette and the at least one guide RNA are covalently linked; and (B) CRISPR-associated nucleases.

53. The cell of claim 52, wherein the editing cassette serves as a trans barcode for subsequent sequencing.

54. The cell of claim 52 or 53, wherein the target region is within a non-coding region.

55. The cell of claim 52 or 53, wherein the target region is located within a gene of interest within the cell.

56. The cell of claim 52 or 53, wherein the mutation in at least one nucleotide is located within at least one codon of a gene of interest within the cell.

57. The cell of claim 52 or 53, wherein the target region of the nucleic acid in the cell is contained within a genomic locus.

58. The cell of claim 52 or 53, wherein the target region of the nucleic acid in the cell is contained within an extrachromosomal locus.

59. The cell of claim 52 or 53, wherein a mutation in at least one nucleotide is identified by sequencing the editing cassette.

60. The method of claim 46, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

61. The cell of claim 52 or 53, wherein the CRISPR-associated nuclease is a Cas9 nuclease.

Images