Bifunctional genome editing system and uses thereof

Abstract

The present invention relates to the field of genetic engineering. In particular, the present invention relates to a genome editing fusion protein comprising a CRISPR effector protein domain and a deaminase domain, as well as a bifunctional genome editing system comprising said genome editing fusion protein and uses thereof.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering. Specifically, this invention relates to genome editing fusion proteins comprising CRISPR nuclease and deaminase domains, as well as bifunctional genome editing systems comprising said genome fusion proteins and their uses. Background of the Invention

[0002] The CRISPR / Cas9 gene editing system, guided by guide RNA, uses Cas9 to bind to and cleave the double-stranded DNA of the target gene, creating a double-stranded break (DSB). During the organism's repair process, insertions and / or deletions of different fragment lengths are introduced. This system is simple and efficient, and is widely used in gene function research and utilization. However, the editing effect it produces is uncertain, making targeted gene editing difficult. In contrast, the single-base editing system, formed by fusing nCas9 (D10A) with cytosine deaminase, achieves the conversion of cytosine to thymine without creating double-stranded breaks, and has been used for highly efficient targeted gene mutations in plant, animal, and human cells. Both gene editing systems have been widely used in disease treatment research, animal model establishment, and plant genetic breeding. However, these two gene editing systems have different working principles, different applicable ranges, and produce different editing results.

[0003] In plant genetic improvement and even biomedical research, it is often necessary to simultaneously edit multiple genes or different regions of a single gene to produce knockouts (indels) of specific gene fragments and substitutions of specific nucleotides. Based on existing gene editing tools, there are two strategies to achieve this result. One is co-transformation of systems used for knockout and base substitution (sgRNA, SpCas9, and nCas9-APOBEC1 or A3A-PBE). This method requires a large amount of exogenous DNA per transformation, which is challenging for the transformation process, and the large amount of exogenous DNA is highly toxic to cells. Furthermore, obtaining target plants containing both base substitution and indel mutations is inefficient, and the screening workload is enormous. The other method is batch transformation. First, sgRNA and Cas9 are transformed for gene knockout, and mutant plants containing the target gene indel are obtained through tissue culture screening. Then, using the mutant plants containing the target gene indel as recipient material, a second transformation is performed using a single-base editing system. This method requires two genetic transformation operations, resulting in a large workload, high cost, and long cycle.

[0004] To date, no gene editing system can simultaneously achieve efficient base substitution and indels. A bifunctional system, through a single transformation experiment, can simultaneously achieve efficient C-to-T substitutions and indels at specific locations in multiple species, including plants. Guide RNAs of varying lengths control the editing results at target genomic sites, generating diverse mutations in both coding and non-coding regions. This is particularly beneficial for crop varieties that are difficult to transform or have long transformation cycles, significantly shortening the cycle and accelerating the breeding process. Bifunctional systems can also be used to study the interaction between promoter regions and regulatory elements; they can also be used in disease treatment research, as many diseases are caused by a combination of single nucleotide mutations and deletion / insertion mutations in gene sequences, and bifunctional gene editing can provide a rapid and readily available solution for treating these diseases. In conclusion, developing a bifunctional gene editing system is essential and has broad application prospects in disease treatment, animal model establishment, and plant genetic breeding. Brief description of the attached diagram

[0005] Figure 1 Schematic diagrams of the APOBEC1-nCas9-UGI, APOBEC3A-eSpCas91.1-UGI, APOBEC3A-nCas9-UGI, and APOBEC3A-Cas9-UGI constructs.

[0006] Figure 2 This study compared the frequencies of C-to-T base substitutions in APOBEC3A-eSpCas91.1-UGI, APOBEC3A-nCas9-UGI, and APOBEC1-nCas9-UGI when using sgRNAs containing guide sequences of different lengths. Data were obtained from the OsCDC48 gene target site in rice protoplasts, with untreated protoplast samples used as controls. Data were obtained from three independent biological replicates (n=3), and each frequency was calculated (mean ± standard error).

[0007] Figure 3 This study compared the indel generation efficiency of APOBEC3A-eSpCas91.1-UGI ​​using sgRNAs with different guide sequences and that of pJIT-163-Ubi-Cas9 using sgRNAs with a 20nt guide sequence. Data were obtained from the OsCDC48 gene target site in rice protoplasts, with untreated protoplast samples used as controls. Data were obtained from three independent biological replicates (n=3), and each frequency was calculated (mean ± standard error).

[0008] Figure 4This study compared the frequencies of C-to-T base substitutions in APOBEC3A-eSpCas91.1-UGI, APOBEC3A-nCas9-UGI, and APOBEC1-nCas9-UGI when using sgRNAs containing guide sequences of different lengths. Data were obtained from the OsNRT1.1B gene target site in rice protoplasts, with untreated protoplast samples used as controls. Data were obtained from three independent biological replicates (n=3), and each frequency was calculated (mean ± standard error).

[0009] Figure 5 This study compared the indel generation efficiency of APOBEC3A-eSpCas91.1-UGI ​​and pJIT-163-Ubi-Cas9 when using sgRNAs containing guide sequences of different lengths. Data were obtained from the OsNRT1.1B gene target site in rice protoplasts, with untreated protoplast samples used as controls. Data were obtained from three independent biological replicates (n=3), and each frequency was calculated (mean ± standard error). Detailed Implementation

[0010] I. Definition

[0011] In this invention, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. For example, the standard recombinant DNA and molecular cloning techniques used in this invention are well known to those skilled in the art and are described more fully in the following literature: Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). Meanwhile, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0012] The term "genome," as used in this article, encompasses not only chromosomal DNA located in the cell nucleus but also organelle DNA located in subcellular components of the cell, such as mitochondria and plastids.

[0013] As used herein, “organism” includes any organism suitable for genome editing, preferably eukaryotes. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants including monocots and dicots such as rice, corn, wheat, sorghum, barley, soybeans, peanuts, and Arabidopsis thaliana.

[0014] "Genetically modified organism" or "genetically modified cell" refers to an organism or cell whose genome contains exogenous polynucleotides or modified genes or expression regulatory sequences. For example, exogenous polynucleotides can be stably integrated into the genome of an organism or cell and inherited across generations. Exogenous polynucleotides can be integrated into the genome alone or as part of a recombinant DNA construct. Modified genes or expression regulatory sequences are sequences in the genome of an organism or cell that contain single or multiple deoxynucleotide substitutions, deletions, and additions.

[0015] In relation to a sequence, “exogenous” means a sequence that originates from a foreign species, or, if from the same species, a sequence whose composition and / or loci have been significantly altered from its natural form through deliberate human intervention.

[0016] The terms “polynucleotide,” “nucleic acid sequence,” “nucleotide sequence,” or “nucleic acid fragment” are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0017] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.

[0018] As used in this invention, "expression construct" refers to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in an organism. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to generate mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein.

[0019] The "expression construct" of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, a translatable RNA (such as mRNA).

[0020] The "expression construct" of the present invention may contain regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a manner different from those normally found in nature.

[0021] "Regulatory sequence" and "regulatory element" are used interchangeably, referring to nucleotide sequences located upstream (5' non-coding sequence), in the middle, or downstream (3' non-coding sequence) of a coding sequence that affect the transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0022] A "promoter" refers to a nucleic acid fragment that controls the transcription of another nucleic acid fragment. In some embodiments of the present invention, a promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it originates from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.

[0023] "Constraint promoters" refer to promoters that generally cause gene expression in most cell types and under most conditions. "Tissue-specific promoters" and "tissue-preferred promoters" are used interchangeably and refer to promoters that are primarily, but not necessarily, expressed specifically in one tissue or organ, and may also be expressed in a specific cell type. "Developmental regulatory promoters" are promoters whose activity is determined by developmental events. "Inducible promoters" selectively express manipulated DNA sequences in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0024] Examples of promoters include, but are not limited to, polymerase (pol) I, pol II, or pol III promoters. Examples of pol I promoters include the chicken RNA pol I promoter. Examples of pol II promoters include, but are not limited to, the cytomegalovirus Immediate Early (CMV) promoter, the Rous sarcoma virus long terminal repeat (RSV-LTR) promoter, and the simian virus 40 (SV40) Immediate Early promoter. Examples of pol III promoters include the U6 and H1 promoters. Inducible promoters such as metallothionein promoters can be used. Other examples of promoters include the T7 phage promoter, the T3 phage promoter, the β-galactosidase promoter, and the Sp6 phage promoter. When used for plants, promoters can be the cauliflower mosaic virus 35S promoter, the maize Ubi-1 promoter, the wheat U6 promoter, the rice U3 promoter, and the rice actin promoter.

[0025] As used herein, the term "operably linked" refers to the linking of a regulatory element (e.g., but not limited to, promoter sequences, transcription termination sequences, etc.) to a nucleic acid sequence (e.g., coding sequences or open reading frames) such that transcription of the nucleotide sequence is controlled and regulated by the transcriptional regulatory element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art.

[0026] "Introducing" nucleic acid molecules (such as plasmids, linear nucleic acid fragments, RNA, etc.) or proteins into an organism refers to transforming the cells of an organism with the nucleic acid or protein, enabling the nucleic acid or protein to function within the cell. The term "transformation" as used in this invention includes both stable transformation and transient transformation.

[0027] "Stable transformation" refers to the introduction of a foreign nucleotide sequence into the genome, resulting in the stable inheritance of the foreign gene. Once stable transformation occurs, the foreign nucleic acid sequence is stably integrated into the genome of the organism and its subsequent generations.

[0028] "Transient conversion" refers to the introduction of nucleic acid molecules or proteins into cells to perform their functions without the foreign gene being stably inherited. In transient conversion, the foreign nucleic acid sequence does not integrate into the genome.

[0029] II. Bifunctional Genome Editing Fusion Protein

[0030] The inventors have surprisingly discovered that a genome editing fusion protein composed of a CRISPR effector protein with nuclease activity and a deaminase can simultaneously achieve base editing and insertion / deletion (indel) at different genomic loci in cells by using guide RNAs of different lengths.

[0031] Therefore, in a first aspect, the present invention provides a genome editing fusion protein comprising a CRISPR effector protein domain and a deaminase domain having nuclease activity.

[0032] As used herein, the term "CRISPR effector protein" generally refers to nucleases present in the naturally occurring CRISPR system, as well as their modified forms, variants, and catalytically active fragments. The term encompasses any CRISPR-based effector protein capable of achieving gene targeting within cells (e.g., gene editing, gene-targeted regulation).

[0033] "CRISPR effector protein with nuclease activity" means that the CRISPR effector protein can cut double-stranded genomic DNA, thereby forming a double-strand break (DSB).

[0034] Examples of “CRISPR effector proteins” include Cas9 nucleases or variants thereof. The Cas9 nuclease can be a Cas9 nuclease from a different species, such as spCas9 from *Streptococcus pyogenes* or SaCas9 derived from *Staphylococcus aureus*. “Cas9 nuclease” and “Cas9” are used interchangeably herein to refer to RNA-guided nucleases comprising the Cas9 protein or fragments thereof (e.g., proteins containing the active DNA-cutting domain of Cas9 and / or the gRNA-binding domain of Cas9). Cas9 is a component of the CRISPR / Cas (clustered, regularly spaced short palindromic repeats and related systems) genome editing system, capable of targeting and cleaving DNA target sequences to form DNA double-strand breaks (DSBs) under the guidance of guide RNA.

[0035] In some embodiments, the CRISPR effector protein with nuclease activity is derived from *Streptococcus pyogenes* Cas9. In some embodiments, the CRISPR effector protein with nuclease activity comprises the amino acid sequence shown in SEQ ID NO:1 (SpCas9). In some specific embodiments of the invention, the CRISPR effector protein with nuclease activity comprises the amino acid sequence shown in SEQ ID NO:2 (eSpCas9(1.0)), SEQ ID NO:3 (eSpCas9(1.1)), or SEQ ID NO:4 (SpCas9-HF1). In some preferred embodiments, the CRISPR effector protein with nuclease activity comprises the amino acid sequence shown in SEQ ID NO:3 (eSpCas9(1.1)).

[0036] Examples of “CRISPR effector proteins with nuclease activity” may also include Cpf1 nucleases or variants thereof, such as highly specific variants. The Cpf1 nuclease may be a Cpf1 nuclease from a different species, such as Cpf1 nucleases from Francisellanovicida U112, Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium ND2006.

[0037] In some embodiments of the present invention, the deaminase is a cytidine deaminase, such as an apolipoprotein B mRNA editing complex (APOBEC) family deaminase. The cytidine deaminase of the present invention is particularly a cytidine deaminase that can accept single-stranded DNA as a substrate. Examples of cytidine deaminases usable in the present invention include, but are not limited to: APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, APOBEC3A, or CDA1. In the present invention, the cytidine deaminase in the fusion protein can deaminate cytidine from the single-stranded DNA generated during the formation of the fusion protein-guide RNA-DNA complex, converting it to U, and then achieving C-to-T base substitution through base mismatch repair.

[0038] In some embodiments of various aspects of the present invention, the APOBEC3A deaminase is a human APOBEC3A deaminase. In some preferred embodiments, the human APOBEC3A deaminase comprises the amino acid sequence shown in SEQ ID NO:5.

[0039] In some embodiments, the cytidine deaminase is located at the N-terminus of the CRISPR effector protein having nuclease activity.

[0040] In cells, uracil DNA glycosylase catalyzes the removal of U from DNA and initiates base excision repair (BER), resulting in the repair of U:G to C:G. Therefore, without any theoretical limitations, in the case that the deaminase in the fusion protein is a cytidine deaminase, including a uracil DNA glycosylase inhibitor in the genome editing fusion protein of the present invention will be able to increase the efficiency of base editing.

[0041] Therefore, in some embodiments of the present invention involving a cytidine deaminase as the deaminase in the fusion protein, the genome editing fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI). In some specific embodiments, the uracil DNA glycosylase inhibitor comprises the amino acid sequence shown in SEQ ID NO:6.

[0042] In some embodiments of the present invention, the deaminase is an adenine deaminase. Naturally occurring adenine deaminases typically use RNA as a substrate to convert adenosine on single-stranded RNA into inosine (I) via deamination. Recently, through directed evolution, a DNA-dependent adenine deaminase based on the E. coli tRNA adenine deaminase TadA has been obtained, capable of converting deoxyguanosine on single-stranded DNA into inosine (I) using single-stranded DNA as a substrate. See Nicole M. Gaudelli et al., doi: 10.1038 / nature24644, 2017. In some embodiments, the deaminase is a DNA-dependent adenine deaminase.

[0043] In this invention, the DNA-dependent adenine deaminase in the fusion protein can deaminate adenosine in the single-stranded DNA generated during the formation of the fusion protein-guide RNA-DNA complex, converting it into inosine (I). Since DNA polymerase treats inosine (I) as guanine (G), A-to-G substitution can be achieved through base mismatch repair. Therefore, when the deaminase in the fusion protein is a DNA-dependent adenine deaminase, one or more A bases in the genomic target sequence can be replaced with G bases.

[0044] In some embodiments of the invention, the adenine deaminase is a variant of *E. coli* tRNA adenine deaminase TadA (ecTadA), particularly a variant that can accept single-stranded DNA as a substrate. In some embodiments, the adenine deaminase comprises the amino acid sequence shown in SEQ ID NO:7.

[0045] In some embodiments of the present invention, the deaminase and the CRISPR effector protein with nuclease activity are fused via a linker. The linker may be a non-functional amino acid sequence of 1-50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 20-25, 25-50) or more amino acids without secondary or higher structures. For example, the linker may be a flexible linker, such as GGGGS, GS, GAP, (GGGGS)x3, GGS, and (GGS)x7. In some specific embodiments, the linker is an XTEN linker. In some specific embodiments, the linker is 32 amino acids long. In some specific embodiments, the amino acid sequence of the linker is: SGGSSGGSSGSETPGTSESATPESSGGSSGGS.

[0046] In some embodiments of the present invention, the genome editing fusion protein further comprises nuclear localization sequences (NLS). Generally, one or more NLS in the genome editing fusion protein should have sufficient strength to drive the accumulation of the genome editing fusion protein in the nucleus of the cell to achieve its genome editing function. Generally, the strength of nuclear localization activity is determined by the number and location of the NLS in the genome editing fusion protein, the use of one or more specific NLS, or a combination of these factors.

[0047] In some embodiments of the present invention, the NLS of the genome editing fusion protein of the present invention may be located at the N-terminus and / or the C-terminus. In some embodiments, the genome editing fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. In some embodiments, the genome editing fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the N-terminus. In some embodiments, the genome editing fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the C-terminus. In some embodiments, the genome editing fusion protein comprises a combination of these, such as one or more NLS at the N-terminus and one or more NLS at the C-terminus. When more than one NLS is present, each can be selected to be independent of the other NLS. In some preferred embodiments of the present invention, the genome editing fusion protein comprises two NLS, for example, the two NLS are located at the N-terminus and the C-terminus, respectively.

[0048] Generally, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, but other types of NLS are also known. Non-limiting examples of NLS include KKRKV, PKKKRKV, or SGGSPKKKRKV.

[0049] Furthermore, depending on the location of the DNA to be edited, the genome editing fusion protein of the present invention may also include other localization sequences, such as cytoplasmic localization sequences, chloroplast localization sequences, mitochondrial localization sequences, etc.

[0050] In some preferred embodiments, the genome editing fusion protein comprises the amino acid sequence shown in SEQ ID NO:8.

[0051] III. Dual-function genome editing system

[0052] In another aspect, the present invention provides a bifunctional genome editing system, the system comprising the genome editing fusion protein of the present invention and / or an expression construct containing a nucleotide sequence encoding the genome editing fusion protein of the present invention, and

[0053] i) at least one guide RNA for base substitution and / or an expression construct comprising a nucleotide sequence encoding said at least one guide RNA for base substitution, and / or

[0054] ii) at least one guide RNA for insertion and / or deletion and / or an expression construct containing a nucleotide sequence encoding said at least one guide RNA for insertion and / or deletion.

[0055] As used herein, "gRNA" and "guide RNA" are used interchangeably and refer to RNA molecules capable of forming complexes with CRISPR effector proteins and targeting the target sequence by means of the complementary nature of the target sequence. In some embodiments of the present invention, the guide RNA is a single-stranded guide RNA (sgRNA). gRNA typically consists of a scaffold sequence and a guide sequence (also called a spacer sequence). The scaffold sequence of the gRNA varies depending on its corresponding CRISPR effector protein. Those skilled in the art understand the gRNA scaffold sequences required for different CRISPR effector proteins. The present invention does not impose any particular limitation on the gRNA scaffold sequence, but only on the CRISPR effector protein used. For example, for Cas9 (especially spCas9), its sgRNA scaffold sequence may be encoded by the following sequence: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt.

[0056] The guide sequence (also called the spacer sequence) of gRNA is a sequence that is the same as or complementary to the target sequence. It achieves specific targeting by hybridizing with the target sequence or its complementary sequence. For example, for the nuclease activity of Cas9, the optimal gRNA guide sequence length is 20 nucleotides.

[0057] The inventors have surprisingly discovered that when the gRNA guide sequence is 20 nucleotides long, the genome editing fusion protein of this invention primarily performs insertions and / or deletions (indels) at the target sites; when the gRNA guide sequence is not 20 nucleotides long, the genome editing fusion protein primarily performs base substitutions at the target sites. Therefore, by introducing gRNAs containing different guide sequence lengths, it is possible to simultaneously and efficiently introduce base substitutions and insertions and / or deletions (indels) at a wide range of endogenous genomic sites.

[0058] In some implementations, the guide RNA for insertion and / or deletion contains a guide sequence of 20 nucleotides in length.

[0059] In some embodiments, the guide RNA for base substitution comprises a guide sequence of <20 or >20 nucleotides in length. In some preferred embodiments, the guide RNA for base substitution comprises a guide sequence of 19 nucleotides in length.

[0060] In some implementations, guide RNAs for insertion and / or deletion and guide RNAs for base substitution target different genomic sites. For example, guide RNAs for insertion and / or deletion target the coding sequence of a gene requiring loss of function, potentially causing insertion and / or deletion in the coding sequence, thereby resulting in loss of gene function. Alternatively, guide RNAs for base substitution target a target sequence requiring point mutation, causing one or more base substitutions in the target sequence.

[0061] In order to achieve effective expression in an organism, in some embodiments of the present invention, the nucleotide sequence encoding the fusion protein is codon-optimized for the organism to be edited.

[0062] Codon optimization refers to methods of modifying nucleic acid sequences to enhance expression in host cells of interest by replacing at least one codon of the natural sequence with codons that are used more frequently or most frequently in the gene in the host cell (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons while maintaining the natural amino acid sequence). Different species exhibit specific preferences for certain codons of specific amino acids. Codon preference (differences in codon use between organisms) is often associated with the translation efficiency of messenger RNA (mRNA), which is thought to depend on the nature of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of selected tRNAs in a cell generally reflects the codons most frequently used for peptide synthesis. Therefore, genes can be customized to achieve optimal gene expression in a given organism based on codon optimization. Codon utilization tables are readily available, for example, in the Codon Usage Database (“Codon UsageDatabase”) available at www.kazusa.orjp / codon / , and these tables can be adapted in various ways. See Nakamura. Y. et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000.5 Nucl. Acids Res., 28:292 (2000).

[0063] In some embodiments of the present invention, in the expression construct, the nucleotide sequence encoding the genome editing fusion protein and / or the nucleotide sequence encoding the guide RNA are operatively linked to expression regulatory elements such as promoters.

[0064] In some implementations, depending on the promoter used, the precise guide sequence of the sgRNA usable in this invention is obtained by means of the self-cleavage of tRNA (Zhang et al. (2017) Genome Biology, 2017, 18: 191).

[0065] III. Methods for producing genetically modified organisms

[0066] In another aspect, the present invention provides a method for producing genetically modified organisms, comprising introducing the bifunctional genome editing system of the present invention into the cells of an organism.

[0067] In some embodiments, the guide RNA for insertion and / or deletion targets the genome editing fusion protein to at least one target sequence in the genome to be inserted and / or deleted. In some embodiments, the guide RNA for base substitution targets the genome editing fusion protein to at least one target sequence in the genome to be substituted. In some embodiments, the guide RNA for insertion and / or deletion and the guide RNA for base substitution target the genome editing fusion protein to at least one target sequence in the genome and at least one target sequence to be inserted and / or deleted.

[0068] In some embodiments, the method performs insertions and / or deletions within at least one target sequence of the genome of the somatic cell, and base substitutions within at least another target sequence of the genome of the somatic cell.

[0069] In this invention, the target sequence to be modified can be located anywhere in the genome, such as within a functional gene like a protein-coding gene, or in a gene expression regulatory region such as a promoter region or an enhancer region, thereby achieving modification of the gene function or modification of gene expression.

[0070] In some embodiments of the method described in this invention, screening for organisms such as plants with desired nucleotide substitutions is also included. Nucleotide substitutions in organisms such as plants can be detected by T7EI, PCR / RE, or sequencing methods, see, for example, Shan, Q., Wang, Y., Li, J. & Gao, C. Genome editing in rice and wheat using the CRISPR / Cas system. Nat. Protoc. 9, 2395-2410 (2014).

[0071] In the method of this invention, the bifunctional genome editing system can be introduced into cells using various methods well known to those skilled in the art. Methods for introducing the genome editing system of this invention into cells include, but are not limited to: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, adeno-associated virus, lentivirus, and other viruses), gene gun method, PEG-mediated protoplast transformation, and Agrobacterium-mediated transformation.

[0072] Cells that can be genome edited using the methods of this invention can be derived from, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, such as rice, corn, wheat, sorghum, barley, soybeans, peanuts, and Arabidopsis thaliana. In some preferred embodiments, the organism is a plant.

[0073] The method of the present invention is particularly suitable for producing genetically modified plants, such as crop plants. In the method of producing genetically modified plants of the present invention, the bifunctional genome editing system can be introduced into the plant using various methods well known to those skilled in the art. Methods that can be used to introduce the bifunctional editing system of the present invention into plants include, but are not limited to: gene gun method, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube pathway method, and ovary injection method. Preferably, the bifunctional system is introduced into the plant via transient transformation.

[0074] In the method of this invention, modification of the target sequence can be achieved simply by introducing or generating the bifunctional editing fusion protein and guide RNA in plant cells, and the modification can be stably inherited without the need to stably transform the bifunctional editing system into plants. This avoids the potential off-target effects of a stably existing bifunctional editing system and also avoids the integration of exogenous nucleotide sequences into the plant genome, thus providing higher biosafety.

[0075] In some preferred embodiments, the introduction is performed without selection pressure, thereby avoiding the integration of exogenous nucleotide sequences into the plant genome.

[0076] In some embodiments, the introduction includes transforming the bifunctional genome editing system of the present invention into isolated plant cells or tissues, and then regenerating the transformed plant cells or tissues into complete plants. Preferably, the regeneration is performed without selection pressure, i.e., without using any selection agents targeting the selection genes carried on the expression vector during tissue culture. Not using selection agents can improve the regeneration efficiency of the plants, resulting in modified plants free of exogenous nucleotide sequences.

[0077] In other embodiments, the bifunctional genome editing system of the present invention can be applied to specific parts of an intact plant.

[0078] Examples include leaves, stem tips, pollen tubes, young spikelets, or hypocotyls. This is particularly suitable for the transformation of plants that are difficult to regenerate through tissue culture.

[0079] In some embodiments of the present invention, in vitro expressed proteins and / or in vitro transcribed RNA molecules are directly transformed into the plant. The proteins and / or RNA molecules enable gene editing in plant cells and are subsequently degraded by the cells, avoiding the integration of exogenous nucleotide sequences into the plant genome.

[0080] Therefore, in some embodiments, using the methods of the present invention to genetically modify and breed plants can yield plants without the integration of exogenous DNA, i.e., non-transgene-free modified plants. Furthermore, the bifunctional genome editing system of the present invention exhibits high specificity (low off-target rate) when performing base editing in plants, which also improves biosafety.

[0081] Plants that can be gene-edited using the methods of this invention include both monocotyledonous and dicotyledonous plants. For example, the plants can be crop plants such as wheat, rice, corn, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, or potato.

[0082] In some embodiments of the invention, the target sequence is associated with plant traits such as agronomic traits, thereby the base editing results in the plant having altered traits relative to the wild-type plant. In this invention, the target sequence to be modified can be located anywhere in the genome, for example, within a functional gene such as a protein-coding gene, or, for example, within a gene expression regulatory region such as a promoter region or enhancer region, thereby achieving modification of gene function or modification of gene expression.

[0083] In some embodiments of the invention, the method further includes obtaining offspring of the genetically modified plant. In another aspect, the invention also provides genetically modified plants, their offspring, or portions thereof, wherein the plants are obtained by the method described above. In some embodiments, the genetically modified plants, their offspring, or portions thereof are non-GMO.

[0084] In another aspect, the present invention also provides a plant breeding method, comprising crossing a genetically modified first plant obtained by the method described above with a second plant that does not contain the genetic modification, thereby introducing the genetic modification into the second plant.

[0085] Example

[0086] To facilitate understanding of the present invention, a more complete description will be given below with reference to specific embodiments and accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0087] Example 1: Mutation efficiency of a bifunctional gene editing system in rice protoplasts

[0088] The protoplasts used in this invention are derived from the japonica rice variety Zhonghua 11.

[0089] To test the effectiveness of the bifunctional editing system eSpCas91.1-A3A in editing endogenous genes, gRNAs of different lengths were designed at target sites in rice genes OsCDC48 and OsNRT1.1B (Table 1). APOBEC3A-nCas9-UGI, APOBEC1-nCas9-UGI, and wild-type SpCas9 were used as controls. After co-transforming rice protoplasts with the gRNAs, next-generation sequencing (NGS) was used to analyze the efficiency of generating C-to-T base substitutions and indel mutations.

[0090] Table 1. Description of sgRNA target sites and sequences

[0091] sgRNA Target sequence OsCDC48–sgRNA-17nt CAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-18nt CCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-19nt ACCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-20nt GACCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-21nt TGACCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-22nt CTGACCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-23nt GCTGACCAGCCAGCGTCTGGCGCCGG OsCDC48–sgRNA-24nt CGCTGACCAGCCAGCGTCTGGCGCCGG OsNRT1.1B–sgRNA-15nt TGGCGCCCGCGGCGGCGG OsNRT1.1B–sgRNA-16nt ATGGCGCCCGCGGCGGCGG OsNRT1.1B–sgRNA-17nt CATGGCGCCCGCGGCGGCGG OsNRT1.1B–sgRNA-18nt CCATGGCGCCCGCGGCGGCGG OsNRT1.1B–sgRNA-19nt GCCATGGCGCCCGCGGCGGCGG OsNRT1.1B–sgRNA-20nt GGCCATGGCGCCCGCGGCGGCGGCG

[0092] Note: PAM motifs in each target sequence are shown in bold.

[0093] Next-generation sequencing (NGS) was used to evaluate the efficiency of C-to-T base editing and indels at the OsCDC48 gene target site in protoplasts. The APOBEC3A-eSpCas91.1-UGI ​​system was ultimately found to have the highest C-to-T editing frequency (18.99%) at an sgRNA length of 19 nt. Figure 2The positive control APOBEC3A-nCas9-UGI achieved an average editing efficiency of 35.03% when the sgRNA length was 19 nt, and the highest efficiency of 42.56% was achieved when the sgRNA length was 20 nt.

[0094] Comparison of knockout and / or insertion efficiency: The APOBEC3A-eSpCas91.1-UGI ​​system produced an indel editing frequency of 2.45% when the sgRNA length was 20 nt. Figure 3 Wild-type pJIT-163-Ubi-Cas9, with an sgRNA length of 20 nt, produced the highest editing efficiency of 2.96% (). Figure 3 ).

[0095] Similarly, next-generation sequencing (NGS) was used to evaluate the efficiency of C-to-T base editing and indels at the OsNRT1.1B gene target site in protoplasts. Ultimately, the APOBEC3A-eSpCas91.1-UGI ​​system was found to have the highest C-to-T editing frequency (12.15%) at an sgRNA length of 19 nt. Figure 4 The positive control APOBEC3A-nCas9-UGI achieved an average editing efficiency of 32.00% with an sgRNA length of 19 nt, and the highest efficiency (34.81%) was observed with an sgRNA length of 20 nt. The APOBEC3A-eSpCas91.1-UGI ​​system produced an indel editing frequency of 2.27% with an sgRNA length of 20 nt. Figure 5 Wild-type pJIT-163-Ubi-Cas9, with an sgRNA length of 20 nt, produced the highest editing efficiency of 2.49% (…). Figure 5 ).

[0096] Taking all factors into consideration, APOBEC3A-eSpCas91.1-UGI ​​can serve as a bifunctional system. When the sgRNA length is 19 nt, it produces highly efficient C-to-T editing but with very low indel generation efficiency. When the sgRNA length is 20 nt, it produces indels with higher efficiency, almost comparable to wild-type Cas9, and can be used for gene knockout. It can simultaneously transform multiple sgRNAs of different lengths, enabling the simultaneous implementation of single-base substitutions, knockouts, and / or insertions in multiple genes as needed. sequence list <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> Bifunctional genome editing systems and their applications <130> I2019TC3379CB <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 1368 <212> PRT <213> Artificial sequence <220> <223> SpCas9 <400> 1 Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 45 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915,920,925 Lys Tyr Asp Ser Arg Met Asn Thr Lys Tyr Asp 930,935,940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965,970,975 Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val 980,985,990 Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu With Arg Lys Arg Pro Leu Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Light Light Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 <210> 2 <211> 1401 <212> PRT <213> Artificial sequence <220> <223> eSpCas9(1.0) <400> 2 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser 20 25 30 Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys 35 40 45 Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu 50 55 60 Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg 65 70 75 80 Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile 85 90 95 Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp 100 105 110 Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys 115 120 125 Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala 130 135 140 Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val 145 150 155 160 Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala 165 170 175 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn 180 185 190 Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr 195 200 205 Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp 210 215 220 Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu 225 230 235 240 Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly 245 250 255 Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn 260 265 270 Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr 275 280 285 Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala 290 295 300 Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser 305 310 315 320 Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala 325 330 335 Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu 340 345 350 Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe 355 360 365 Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala 370 375 380 Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met 385 390 395 400 Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu 405 410 415 Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His 420 425 430 Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro 435 440 445 Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg 450 455 460 Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala 465 470 475 480 Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu 485 490 495 Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met 500 505 510 Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His 515 520 525 Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val 530 535 540 Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu 545 550 555 560 Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val 565 570 575 Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 580 585 590 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 595 600 605 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu 610 615 620 Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 625 630 635 640 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr 645 650 655 Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg 660 665 670 Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg 675 680 685 Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 690 695 700 Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr 705 710 715 720 Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser 725 730 735 Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys 740 745 750 Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met 755 760 765 Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn 770 775 780 Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg 785 790 795 800 Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His 805 810 815 Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Ala Leu Tyr Leu Tyr Tyr 820 825 830 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 835 840 845 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu 850 855 860 Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 865 870 875 880 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met 885 890 895 Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg 900 905 910 Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu 915,920,925 Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 930,935,940 Thr Lys Tyr On Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr 945 950 955 960 Asp Glu Asn Asp Lys With Arg Glu Val Lys Val With Thr Lys 965,970,975 Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val 980,985,990 Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala 995 1000 1005 Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Ala Leu Glu Ser 1010 1015 1020 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1025 1030 1035 I Ile Lys Sere Glu Gln Glu Ile Gly Lys Ike Thr Ike Lys Tyr 1040 1045 1050 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1055 1060 1065 Leu Ala Asn Gly Glu Ile Arg Lys Ala Pro Leu Ile Glu Thr Asn 1070 1075 1080 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1085 1090 1095 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1100 1105 1110 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1115 1120 1125 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1130 1135 1140 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1145 1150 1155 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1160 1165 1170 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1175 1180 1185 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1190 1195 1200 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1220 1225 1230 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1235 1240 1245 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1250 1255 1260 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1265 1270 1275 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1280 1285 1290 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1295 1300 1305 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1310 1315 1320 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1325 1330 1335 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1340 1345 1350 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1355 1360 1365 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1370 1375 1380 Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1385 1390 1395 Lys Lys Lys 1400 <210> 3 <211> 1401 <212> PRT <213> Artificial sequence <220> <223> eSpCas9(1.1) <400> 3 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser 20 25 30 Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys 35 40 45 Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu 50 55 60 Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg 65 70 75 80 Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile 85 90 95 Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp 100 105 110 Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys 115 120 125 Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala 130 135 140 Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val 145 150 155 160 Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala 165 170 175 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn 180 185 190 Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr 195 200 205 Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp 210 215 220 Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu 225 230 235 240 Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly 245 250 255 Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn 260 265 270 Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr 275 280 285 Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala 290 295 300 Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser 305 310 315 320 Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala 325 330 335 Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu 340 345 350 Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe 355 360 365 Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala 370 375 380 Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met 385 390 395 400 Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu 405 410 415 Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His 420 425 430 Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro 435 440 445 Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg 450 455 460 Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala 465 470 475 480 Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu 485 490 495 Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met 500 505 510 Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His 515 520 525 Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val 530 535 540 Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu 545 550 555 560 Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val 565 570 575 Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 580 585 590 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 595 600 605 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu 610 615 620 Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 625 630 635 640 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr 645 650 655 Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg 660 665 670 Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg 675 680 685 Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 690 695 700 Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr 705 710 715 720 Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser 725 730 735 Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys 740 745 750 Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met 755 760 765 Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn 770 775 780 Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg 785 790 795 800 Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His 805 810 815 Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr 820 825 830 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 835 840 845 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu 850 855 860 Ala Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 865 870 875 880 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met 885 890 895 Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg 900 905 910 Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu 915 920 925 Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 930 935 940 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr 945 950 955 960 Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys 965 970 975 Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val 980 985 990 Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala 995 1000 1005 Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Ala Leu Glu Ser 1010 1015 1020 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1025 1030 1035 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr 1040 1045 1050 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1055 1060 1065 Leu Ala Asn Gly Glu Ile Arg Lys Ala Pro Leu Ile Glu Thr Asn 1070 1075 1080 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1085 1090 1095 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1100 1105 1110 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1115 1120 1125 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1130 1135 1140 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1145 1150 1155 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1160 1165 1170 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1175 1180 1185 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1190 1195 1200 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1220 1225 1230 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1235 1240 1245 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1250 1255 1260 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1265 1270 1275 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1280 1285 1290 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1295 1300 1305 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1310 1315 1320 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1325 1330 1335 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1340 1345 1350 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1355 1360 1365 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1370 1375 1380 Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1385 1390 1395 Lys Lys Lys 1400 <210> 4 <211> 1401 <212> PRT <213> Artificial sequence <220> <223> SpCas9‑HF1 <400> 4 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser 20 25 30 Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys 35 40 45 Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu 50 55 60 Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg 65 70 75 80 Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile 85 90 95 Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp 100 105 110 Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys 115 120 125 Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala 130 135 140 Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val 145 150 155 160 Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala 165 170 175 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn 180 185 190 Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr 195 200 205 Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp 210 215 220 Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu 225 230 235 240 Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly 245 250 255 Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn 260 265 270 Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr 275 280 285 Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala 290 295 300 Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser 305 310 315 320 Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala 325 330 335 Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu 340 345 350 Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe 355 360 365 Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala 370 375 380 Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met 385 390 395 400 Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu 405 410 415 Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His 420 425 430 Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro 435 440 445 Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg 450 455 460 Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala 465 470 475 480 Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu 485 490 495 Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met 500 505 510 Thr Ala Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His 515 520 525 Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val 530 535 540 Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu 545 550 555 560 Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val 565 570 575 Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 580 585 590 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 595 600 605 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu 610 615 620 Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 625 630 635 640 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr 645 650 655 Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg 660 665 670 Tyr Thr Gly Trp Gly Ala Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg 675 680 685 Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 690 695 700 Phe Ala Asn Arg Asn Phe Met Ala Leu Ile His Asp Asp Ser Leu Thr 705 710 715 720 Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser 725 730 735 Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys 740 745 750 Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met 755 760 765 Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn 770 775 780 Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg 785 790 795 800 Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His 805 810 815 Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr 820 825 830 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 835 840 845 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu 850 855 860 Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 865 870 875 880 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met 885 890 895 Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg 900 905 910 Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu 915 920 925 Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Ala Ile 930 935 940 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr 945 950 955 960 Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys 965 970 975 Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val 980 985 990 Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala 995 1000 1005 Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser 1010 1015 1020 Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1025 1030 1035 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr 1040 1045 1050 Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr 1055 1060 1065 Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn 1070 1075 1080 Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala 1085 1090 1095 Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys 1100 1105 1110 Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu 1115 1120 1125 Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp 1130 1135 1140 Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr 1145 1150 1155 Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys 1160 1165 1170 Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg 1175 1180 1185 Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly 1190 1195 1200 Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser 1220 1225 1230 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys 1235 1240 1245 Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys 1250 1255 1260 Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1265 1270 1275 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe 1280 1285 1290 Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu 1295 1300 1305 Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala 1310 1315 1320 Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro 1325 1330 1335 Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr 1340 1345 1350 Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser 1355 1360 1365 Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly 1370 1375 1380 Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1385 1390 1395 Lys Lys Lys 1400 <210> 5 <211> 199 <212> PRT <213> Artificial sequence <220> <223> Human APOBEC3A deaminase amino acid sequence <400> 5 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn 195 <210> 6 <211> 83 <212> PRT <213> Artificial sequence <220> <223> UGI amino acid sequence <400> 6 Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val 1 5 10 15 Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile 20 25 30 Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu 35 40 45 Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr 50 55 60 Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile 65 70 75 80 Lys Met Leu <210> 7 <211> 167 <212> PRT <213> Artificial sequence <220> <223> adenine deaminase amino acid sequence <400> 7 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala 35 40 45 Ile Gly Leu His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp 165 <210> 8 <211> 1701 <212> PRT <213> Artificial sequence <220> <223> Bifunctional genome editing fusion protein APOBEC3A-eSpCas91.1-UGI ​​amino acid sequence <400> 8 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Leu Lys Asp Lys Lys Tyr Ser Ile Gly 210 215 220 Leu Asp Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu 225 230 235 240 Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg 245 250 255 His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly 260 265 270 Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr 275 280 285 Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn 290 295 300 Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser 305 310 315 320 Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly 325 330 335 Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr 340 345 350 His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg 355 360 365 Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe 370 375 380 Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu 385 390 395 400 Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro 405 410 415 Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu 420 425 430 Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu 435 440 445 Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu 450 455 460 Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu 465 470 475 480 Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala 485 490 495 Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu 500 505 510 Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile 515 520 525 Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His 530 535 540 His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro 545 550 555 560 Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala 565 570 575 Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile 580 585 590 Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys 595 600 605 Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly 610 615 620 Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg 625 630 635 640 Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile 645 650 655 Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 660 665 670 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr 675 680 685 Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala 690 695 700 Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn 705 710 715 720 Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val 725 730 735 Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys 740 745 750 Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu 755 760 765 Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr 770 775 780 Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu 785 790 795 800 Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile 805 810 815 Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu 820 825 830 Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile 835 840 845 Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met 850 855 860 Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg 865 870 875 880 Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu 885 890 895 Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 900 905 910 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln 915 920 925 Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala 930 935 940 Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val 945 950 955 960 Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val 965 970 975 Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn 980 985 990 Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly 995 1000 1005 Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln 1010 1015 1020 Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met 1025 1030 1035 Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp 1040 1045 1050 Val Asp His Ile Val Pro Gln Ser Phe Leu Ala Asp Asp Ser Ile 1055 1060 1065 Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser 1070 1075 1080 Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr 1085 1090 1095 Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 1100 1105 1110 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 1115 1120 1125 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 1130 1135 1140 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 1145 1150 1155 Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1160 1165 1170 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe 1175 1180 1185 Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala 1190 1195 1200 Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro 1205 1210 1215 Ala Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp 1220 1225 1230 Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala 1235 1240 1245 Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys 1250 1255 1260 Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Ala Pro Leu 1265 1270 1275 Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly 1280 1285 1290 Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val 1295 1300 1305 Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys 1310 1315 1320 Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg 1325 1330 1335 Light Light Asp Trp Asp Pro Light Light Tyr Gly Gly Phe Asp Ser Pro 1340 1345 1350 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1355 1360 1365 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr 1370 1375 1380 Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu 1385 1390 1395 Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1400 1405 1410 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg 1415 1420 1425 Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala 1430 1435 1440 Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr 1445 1450 1455 Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu 1460 1465 1470 Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln 1475 1480 1485 Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu 1490 1495 1500 Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile 1505 1510 1515 Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn 1520 1525 1530 Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp 1535 1540 1545 Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu 1550 1555 1560 Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu 1565 1570 1575 Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1580 1585 1590 Gly Gln Ala Lys Lys Lys Lys Thr Arg Asp Ser Gly Gly Ser Thr 1595 1600 1605 Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val 1610 1615 1620 Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val 1625 1630 1635 Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr 1640 1645 1650 Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala 1655 1660 1665 Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly 1670 1675 1680 Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Pro Lys Lys Lys 1685 1690 1695 Arg Lys Val 1700 <210> 9 <211> 1737 <212> PRT <213> Artificial sequence <220> <223> APOBEC1‑nCas9‑UGI amino acid sequence <400> 9 Met Pro Lys Lys Lys Arg Lys Val Ser Ser Glu Thr Gly Pro Val Ala 1 5 10 15 Val Asp Pro Thr Leu Arg Arg Arg Ile Glu Pro His Glu Phe Glu Val 20 25 30 Phe Phe Asp Pro Arg Glu Leu Arg Lys Glu Thr Cys Leu Leu Tyr Glu 35 40 45 Ile Asn Trp Gly Gly Arg His Ser Ile Trp Arg His Thr Ser Gln Asn 50 55 60 Thr Asn Lys His Val Glu Val Asn Phe Ile Glu Lys Phe Thr Thr Glu 65 70 75 80 Arg Tyr Phe Cys Pro Asn Thr Arg Cys Ser Ile Thr Trp Phe Leu Ser 85 90 95 Trp Ser Pro Cys Gly Glu Cys Ser Arg Ala Ile Thr Glu Phe Leu Ser 100 105 110 Arg Tyr Pro His Val Thr Leu Phe Ile Tyr Ile Ala Arg Leu Tyr His 115 120 125 His Ala Asp Pro Arg Asn Arg Gln Gly Leu Arg Asp Leu Ile Ser Ser 130 135 140 Gly Val Thr Ile Gln Ile Met Thr Glu Gln Glu Ser Gly Tyr Cys Trp 145 150 155 160 Arg Asn Phe Val Asn Tyr Ser Pro Ser Asn Glu Ala His Trp Pro Arg 165 170 175 Tyr Pro His Leu Trp Val Arg Leu Tyr Val Leu Glu Leu Tyr Cys Ile 180 185 190 Ile Leu Gly Leu Pro Pro Cys Leu Asn Ile Leu Arg Arg Lys Gln Pro 195 200 205 Gln Leu Thr Phe Phe Thr Ile Ala Leu Gln Ser Cys His Tyr Gln Arg 210 215 220 Leu Pro Pro His Ile Leu Trp Ala Thr Gly Leu Lys Ser Gly Ser Glu 225 230 235 240 Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Leu Lys Asp Lys Lys 245 250 255 Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val 260 265 270 Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Phe Lys Val Leu Gly 275 280 285 Asn Thr Asp Arg His Ser Ile Lys Lys Asn Ile Gly Ala Leu 290,295,300 Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala 305 310 315 320 Arg Arg Thr Thr Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu 325 330 335 Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg 340 345 350 Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His 355 360 365 Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr 370 375 380 Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp Ser Thr Asp Lys 385 390 395 400 Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe 405 410 415 Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp 420 425 430 Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe 435 440 445 Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu 450 455 460 Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln 465 470 475 480 Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu 485 490 495 Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu 500 505 510 Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp 515 520 525 Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala 530 535 540 Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val 545 550 555 560 Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg 565 570 575 Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg 580 585 590 Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys 595 600 605 Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe 610 615 620 Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu 625 630 635 640 Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr 645 650 655 Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His 660 665 670 Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn 675 680 685 Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val 690 695 700 Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys 705 710 715 720 Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys 725 730 735 Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys 740 745 750 Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 755 760 765 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu 770 775 780 Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile 785 790 795 800 Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu 805 810 815 Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile 820 825 830 Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp 835 840 845 Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn 850 855 860 Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp 865 870 875 880 Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp 885 890 895 Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly 900 905 910 Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly 915 920 925 Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn 930 935 940 Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile 945 950 955 960 Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile 965 970 975 Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr 980 985 990 Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro 995 1000 1005 Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln 1010 1015 1020 Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu 1025 1030 1035 Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 1040 1045 1050 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 1055 1060 1065 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 1070 1075 1080 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 1085 1090 1095 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1100 1105 1110 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val 1115 1120 1125 Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu 1130 1135 1140 Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly 1145 1150 1155 Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu 1160 1165 1170 Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp 1175 1180 1185 Arg Met Thr Lys Tyr Asp Glu Asn Asp Lys With Arg 1190 1195 1200 Glu Val Lys Val Ile Thr Leu Lys For Lys Leu Val For Asp Phe 1205 1210 1215 Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr 1220 1225 1230 His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala 1235 1240 1245 Leu Glu Ser Glu Phe Val Tyr Gly 1250 1255 1260 Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu 1265 1270 1275 Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1280 1285 1290 I Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1295 1300 1305 With Arg Lys Arg Pro Leu with Glu Thr Asn Gly Glu Thr Gly Glu 1310 1315 1320 Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val 1325 1330 1335 Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1340 1345 1350 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser 1355 1360 1365 Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr 1370 1375 1380 Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val 1385 1390 1395 Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys 1400 1405 1410 Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys 1415 1420 1425 Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys 1430 1435 1440 Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu 1445 1450 1455 Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln 1460 1465 1470 Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu 1475 1480 1485 Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp 1490 1495 1500 Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu 1505 1510 1515 Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1520 1525 1530 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1535 1540 1545 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His 1550 1555 1560 Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr 1565 1570 1575 Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1580 1585 1590 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr 1595 1600 1605 Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro 1610 1615 1620 Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Thr Arg 1625 1630 1635 Asp Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu 1640 1645 1650 Thr Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro 1655 1660 1665 Glu Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile 1670 1675 1680 Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met 1685 1690 1695 Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val 1700 1705 1710 Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly 1715 1720 1725 Gly Ser Pro Lys Lys Lys Arg Lys Val 1730 1735 <210> 10 <211> 1701 <212> PRT <213> Artificial sequence <220> <223> APOBEC3A-nCas9-UGI amino acid sequence <400> 10 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Leu Lys Asp Lys Lys Tyr Ser Ile Gly 210 215 220 Leu Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu 225 230 235 240 Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg 245 250 255 His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly 260 265 270 Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr 275 280 285 Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn 290 295 300 Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser 305 310 315 320 Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly 325 330 335 Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr 340 345 350 His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg 355 360 365 Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe 370 375 380 Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu 385 390 395 400 Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro 405 410 415 Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu 420 425 430 Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu 435 440 445 Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu 450 455 460 Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu 465 470 475 480 Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala 485 490 495 Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu 500 505 510 Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile 515 520 525 Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His 530 535 540 His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro 545 550 555 560 Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala 565 570 575 Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile 580 585 590 Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys 595 600 605 Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly 610 615 620 Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg 625 630 635 640 Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile 645 650 655 Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 660 665 670 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr 675 680 685 Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala 690 695 700 Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn 705 710 715 720 Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val 725 730 735 Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys 740 745 750 Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu 755 760 765 Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr 770 775 780 Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu 785 790 795 800 Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile 805 810 815 Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu 820 825 830 Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile 835 840 845 Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met 850 855 860 Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg 865 870 875 880 Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu 885 890 895 Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 900 905 910 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln 915 920 925 Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala 930 935 940 Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val 945 950 955 960 Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val 965 970 975 Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn 980 985 990 Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly 995 1000 1005 Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln 1010 1015 1020 Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met 1025 1030 1035 Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp 1040 1045 1050 Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile 1055 1060 1065 Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser 1070 1075 1080 Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr 1085 1090 1095 Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 1100 1105 1110 Asp Asn With Thr Lys Ala Glu Arg Gly Gly With Ser Glu With Asp 1115 1120 1125 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 1130 1135 1140 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 1145 1150 1155 Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1160 1165 1170 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe 1175 1180 1185 Tyr Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala 1190 1195 1200 Tyr Leu Asn Wing Val Val Gly Thr Wing Leu Ile Lys Lys Tyr Pro 1205 1210 1215 Lys Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp 1220 1225 1230 Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala 1235 1240 1245 Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys 1250 1255 1260 Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu 1265 1270 1275 Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly 1280 1285 1290 Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val 1295 1300 1305 Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys 1310 1315 1320 Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg 1325 1330 1335 Light Light Asp Trp Asp Pro Light Light Tyr Gly Gly Phe Asp Ser Pro 1340 1345 1350 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1355 1360 1365 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr 1370 1375 1380 Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu 1385 1390 1395 Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1400 1405 1410 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg 1415 1420 1425 Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala 1430 1435 1440 Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr 1445 1450 1455 Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu 1460 1465 1470 Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln 1475 1480 1485 Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu 1490 1495 1500 Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile 1505 1510 1515 Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn 1520 1525 1530 Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp 1535 1540 1545 Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu 1550 1555 1560 Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu 1565 1570 1575 Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1580 1585 1590 Gly Gln Ala Lys Lys Lys Lys Thr Arg Asp Ser Gly Gly Ser Thr 1595 1600 1605 Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val 1610 1615 1620 Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val 1625 1630 1635 Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr 1640 1645 1650 Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala 1655 1660 1665 Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly 1670 1675 1680 Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Pro Lys Lys Lys 1685 1690 1695 Arg Lys Val 1700

Claims

1. A bifunctional genome editing system, the system comprising a genome editing fusion protein and / or an expression construct containing a nucleotide sequence encoding said genome editing fusion protein, and i) at least one guide RNA for base substitution and / or an expression construct comprising a nucleotide sequence encoding said at least one guide RNA for base substitution, and ii) At least one guide RNA for insertion and / or deletion and / or an expression construct containing a nucleotide sequence encoding said at least one guide RNA for insertion and / or deletion, The genome editing fusion protein described therein comprises a CRISPR effector protein domain and a deaminase domain with nuclease activity. The guide RNA used for insertion and / or deletion is a guide sequence of 20 nucleotides in length; The guide RNA used for base substitution is a guide sequence of 19 nucleotides in length; The genome editing fusion protein described therein contains the amino acid sequence shown in SEQ ID NO:

8.

2. A method for producing a genetically modified organism, comprising introducing the bifunctional genome editing system of claim 1 into monocotyledonous plant cells.

3. The method of claim 2, wherein the guide RNA for insertion and / or deletion and the guide RNA for base substitution target the genome editing fusion protein to at least one target sequence to be substituted and at least one target sequence to be inserted and / or deleted in the genome.

4. The method of claim 3, wherein the method performs insertion and / or deletion in at least one target sequence of the genome of the monocotyledonous plant cell, and base substitution in at least another target sequence of the genome of the monocotyledonous plant cell.

Images