Porcine epidemic diarrhea virus vaccine

Abstract

The present invention relates to vaccines for protecting pigs against porcine epidemic diarrhea virus-related diseases. The vaccines generally include inactivated / inactivated PEDV (e.g., chemically inactivated PEDV), and / or recombinant PEDV antigens and an adjuvant. Methods for protecting pigs against PEDV-related diseases and methods for producing porcine epidemic diarrhea virus vaccines are also provided.

Description

[0001] This application is a divisional application of Chinese patent application No. 201580029082.5, filed on March 30, 2015, with the invention name “Porcine Epidemic Diarrhea Virus Vaccine”.

[0002] Sequence Listing

[0003] This application contains a Sequence Listing pursuant to 37 CFR 1.821-1.825. The Sequence Listing accompanying this application is incorporated herein by reference in its entirety. Background of the Invention

[0004] Field of the invention:

[0005] The present invention relates to a porcine epidemic diarrhea virus (PEDV) vaccine (specific for isolates currently endemic in the United States) that is capable of reducing clinical signs of disease caused by PEDV. The disease is an economic problem in the U.S. swine industry due to high mortality rates (up to 100%) in piglets less than 10 days old.

[0006] Related technical description:

[0007] Porcine epidemic diarrhea virus is an enveloped, positive-sense, single-stranded RNA virus that causes acute diarrhea, vomiting, and dehydration in pigs. It was first discovered in Europe, but has become an increasing problem in many Asian countries, including South Korea, China, Japan, the Philippines, and Thailand. In April 2013, PEDV appeared in pigs in the Midwestern United States and quickly spread across the country. By October 2013, PEDV had been detected in pig herds in 18 states. The economic impact of PEDV infection has been severe. North American isolates of PEDV have been identified (Huang, et al. 2013; Stevenson et al. 2013), however, there is no fully licensed vaccine available commercially in the United States. Therefore, there is a need for the development of vaccines that can protect pigs against PEDV-related diseases. It would be advantageous to develop an effective vaccine against emerging North American PEDV strains that can be administered via mucosal routes (oral or intranasal) as well as parenteral methods (e.g., intramuscular, subcutaneous, or intravenous).

[0008] PEDV is a member of the genus Alphacoronavirus of the subfamily Coronavirinae (Bridgen et al. 1993) and was first identified in England in 1971 and subsequently in other countries such as Belgium, China, Hungary, Italy, Japan, South Korea, and Thailand (Oldham J. 1972; Pensaert and De Bouck P. 1978; Chen et al. 2008; Nagy et al. 1996; Martelli et al. 2008; Takahashi et al. 1983; Chae et al. 2000; and Puranaveja et al. 2009). Other members of this family include porcine respiratory coronavirus (PRCV), hemagglutinating encephalomyelitis coronavirus (PHE), and transmissible gastroenteritis virus (TGEV). Although PEDV and TGEV are related viruses and have very similar clinical signs, there is no immune cross-protection.

[0009] PEDV is an enveloped virus with an approximately 28 kb, positive-sense, single-stranded RNA genome, with a 5' cap and a 3' polyadenylated tail (Pensaert and De Bouck P. 1978). The genome contains a 5' untranslated region (UTR), a 3' UTR, and at least seven open reading frames (ORFs) encoding four structural proteins (spike (S), envelope (E), membrane (M), and nucleocapsid (N)) and three substructural proteins (replicases 1a and 1b and ORF3); these are arranged on the genome in the order of 5'-replicase (1a / 1b)-S-ORF3-EMN-3' (Oldham J. 1972; and Bridgen et al. 1993). The three earliest characterized North American PEDV genome sequences, Minnesota MN (GenBank: KF468752.1), Iowa IA1 (GenBank: KF468753.1), and Iowa IA2 (GenBank: KF468754.1), have the same size of 28,038 nucleotides (nt), except for the poly-A tail, and share the genome organization with the prototype PEDV CCV777 strain (GenBank: AF353511.1). These three North American PEDV sequences have 99.8 to 99.9% nucleotide identity. Specifically, strains MN and IA2 differ by only 11 nucleotides throughout the genome.

[0010] The S protein of PEDV is a type I glycoprotein composed of 1,383 amino acids (aa). The S protein is divided into S1 (1-789aa) and S2 (790-1,383aa) domains based on its homology with other coronavirus S proteins (Chang et al.; 2002; Cruz et al., 1994; Godet et al. 1994; Jackwood et al. 2001; Sturman and Holmes; 1984; and Sun et al. 2008). The S protein is a surface protein in the coronavirus, where it plays a role in regulating the interaction with the host cell receptor glycoprotein to mediate viral entry, and stimulating the induction of neutralizing antibodies in the natural host. Therefore, the S glycoprotein is the primary target when developing an effective vaccine against PEDV.

[0011] The M protein of PEDV is the most abundant envelope component that plays an important role in the virus assembly process and also induces antibodies that neutralize the virus. Similarly, the N protein of PEDV, which binds to the virion RNA to provide the structural basis for the nucleocapsid, is also important for inducing cell-mediated immunity (Saif, L. 1993).

[0012] The only additional gene in PEDV is ORF3. Although additional genes are generally maintained in wild strains, changes in ORF3 are thought to affect virulence; cell culture adaptation has been used to alter the ORF3 gene to reduce virulence (Song et al. 2003). In fact, through the study of the ORF3 gene, researchers have charted the emergence of new genetic groups of PEDV in vaccinated pig herds in China since 2006. Phylogenetic studies of these strains and the geographical reappearance of PDEV in China have demonstrated that the wild strains that cause devastating enteric disease have ORF3 that is genetically different from European strains and vaccine strains (Park et al. 2011).

[0013] It is well known that different strains of PEDV have varying levels of virulence. In the 1980s and 1990s, PEDV was prevalent throughout Europe, with outbreaks in countries such as Belgium, England, Germany, France, the Netherlands, and Switzerland. The frequency of case reports in Europe subsequently decreased and / or the economic importance of the disease caused by PEDV was not sufficient to initiate commercial development of a vaccine (Song and Park 2012). Although outbreaks of PEDV have been documented in China since the 1980s, the PEDV variant strains associated with large outbreaks of diarrhea that emerged in 2010 were more acute and severe. Therefore, trials for vaccine development have been mainly completed in Asian countries (Song and Park 2012). The variants that emerged in 2010 were reported to have 80-90% morbidity and 50-90% mortality in suckling piglets (Bi et al. 2012; Pan et al. 2012; and Li et al. 1012). Recent evidence suggests that the virulent form of PEDV that emerged in China may be the result of evolution of live vaccine strains (Chen et al. 2010).

[0014] Since the enteric disease affects the intestines of pigs, PEDV is spread through fecal-oral exposure. Contaminated trucks and equipment are common sources of infection for young animals. The clinical signs of PEDV infection are similar to those of transmissible gastroenteritis virus (TGEV) infection (Pijpers et al. 1993). In pigs three weeks old and younger, clinical signs (including extremely watery, diarrhea, vomiting, and dehydration) can appear, leading to 100% mortality, which can be seen as soon as 24 hours after PEDV infection. PEDV-infected feeder and grower pigs, as well as sows and boars, can develop diarrhea and vomiting. Animals may also show signs of anorexia and be lethargic. The full impact on larger pigs remains to be determined, but reduced feeding efficiency, more days required to market, and susceptibility of infected animals to secondary infections are all possible. For sows, reduced body condition can have a negative impact on reproductive performance. There are reports that there are signs that PEDV will prevail in North American herds, causing persistent diarrhea and other attacks.

[0015] Gross and histological changes in the intestines of animals infected with PEDV in the United States are similar to those observed in China; essentially the virus destroys the villi of the pig intestine, making it impossible to absorb nutrients. Huang et al. 2012, reported that animals suffering from the disease in outbreaks in Minnesota and Iowa had gross pathological lesions confined to the small intestine, and the small intestine was characterized by a thin, translucent intestinal wall that was swollen with yellow fluid. Histological evaluation reflected areas of the small intestine with blunting and fusion of villi and minimal lymphoid infiltration of the villi of the lamina propria.

[0016] Huang et al. 2013 characterized three different strains of PEDV from the US outbreak – one from Minnesota and two from Iowa, named MN (GenBank Accession No.: KF468752) and IA1 (GenBank Accession No.: KF468753) and IA2 (GenBank Accession No.: KF48754). Huang's phylogenetic survey grouped PEDV strains into two different genetic groups, named genetic group 1 (G1) and genetic group 2 (G2). Significant changes in the N-terminal domain (NTD) of the spike gene distinguished genetic groups 1 and 2. Huang et al. 2013 proposed that the second deletion region (DR2) of the N-terminal domain (NTD) exhibited a higher degree of antigenic variation than DR1, indicating that the emerging North American strains may have a lower antigenic relationship with the G1a vaccine strain.

[0017] Genetic group 1 includes at least three different clusters 1a, 1b, and R. Subgroup 1a includes early European, Chinese, and Korean isolates, for example, the prototype CV777 strain (Belgium, 1978, GenBank: AF353511.1) and strains LZC (Gansu, China, 2006; GenBank: EF185992) and SM98 (Korea, 1998; GenBank: GU937797.1). Subgroup 1b contains 5 strains - one from Korea (DR13 attenuated vaccine strain, GenBank: JQ023162.1) and the others from China, which are related to each other by the common "genetic tag" 8-aa deletion in nsp3 and the large ORF3 deletion at the C-terminus. Group "R" is related to the recombinants of the other genetic groups. However, newly emerging PEDV strains, including those that have emerged in China since 2010 and those that have emerged in North America since 2013, belong to genogroup G2a. Chinese strain AH2012 (GenBank accession number: KC210145) and North American strains share several unique nucleotide changes that place them in genogroup 2a. Strains MN and IA2 share 99.6% nucleotide identity with AH2012, while strain IA1 shares 99.5% nucleotide identity with AH2012. Researchers speculate that AH2012-like viruses may have spread to eastern China and then moved to the United States, and are most likely the closest ancestors of North American strains. Members of genogroup 2a share only about 96.9% similarity with the prototype PEDV strain CV777 of genogroup 1a (Bridgen, et al. 1993; Huang et al. 2013; GenBank: AF353511.1). Therefore, attenuated PEDV vaccines based on the historical CV777-derived G1a strain or the DR13-derived G1b strain may be less antigenically related to the emerging Chinese and North American G2a PEDV strains and thus may be poor vaccine candidates.

[0018] A closely related North American isolate US / Colorado / 2013 (GenBank Accession No.: KF272920.1) was also reported by Marthaler et al., 2013. Similar to the North American isolates above, the complete PEDV genome of CO / 13 shared 96.5-99.5% nucleotide identity with other complete PEDV genomes available in GenBank, with the highest nucleotide identity (99.5%) being with the Chinese strain AH2012 (GenBank Accession No. KC210145), which is a member of the 2a genotype group. Comparison of the complete genome of CO / 13 with the PEDV reference strain CV777 demonstrated that CO / 13 contained a 1-nt insertion (at position 48) and a deletion of 5 nucleotides in the 5'UTR (at positions 73 and 83 to 86). This North American virus exhibits increased diversity within S1 (genomic positions 20,696 and 21,125), with several insertions / deletions and only 82% nucleotide identity.

[0019] Several PEDV vaccines have been developed, which differ in genome sequence, mode of delivery, and potency. Cell culture adaptations of the European CV777 strain have been adapted for use in Asian countries where PEDV has had severe outbreaks. These have been in use since the 1990s.

[0020] In the early 1980s, Japanese researchers isolated the viral strain 83P-5 that causes PED from infected pigs. Kusanagi et al. 1989 isolated the strain and adapted it in Vero cells. An attenuated virus vaccine of cell culture-adapted PEDV (P-5V) (83P-5) has been used in sows in Japan since 1997. The 100-passage 83P-5 strain was licensed for use as an attenuated PEDV vaccine in Japan by Nisseiken Co., Ltd. (Sato et al. 2011). The adaptation and attenuation of the 83P-5 strain reportedly showed mutations in the extracellular portion of the S protein (sequence with sequence similarity to the attenuated DR13 strain) (Sato et al. 2011; see the 100-passage strain 83P-5 spike gene sequence, GenBank: AB548621.1). Although the latter vaccines are considered effective, not all sows are able to pass on immunity to their piglets (Usami et al. 1998). The Japanese and European strains are members of genetic groups G1a or G1b. As discussed above, these attenuated vaccine strains are less related to the diverse North American strains than the emerging Chinese strains of genetic group 2a.

[0021] Oral vaccines with an attenuated Korean PEDV strain (DR13 (passage level 100) (GenBank: JQ023162.1), a member of genetic group G1b) have been shown to be effective as a vaccine. This virus strain has been licensed and used as an oral vaccine in Korea since 2004, and was registered and commercially available in the Philippines in 2011 (Song and Park 2012). However, attenuated DR13 was reported not to significantly alter the viral shedding period in challenged piglets - suggesting that the immune protection was not complete. Furthermore, oral immunization with highly attenuated PEDV conferred protection only at very high vaccine doses (Song and Park 2012).

[0022] Other known vaccines include PT-100 (ChoongAng Vaccine Laboratories, South Korea, a combination of inactivated PEDV and TGEV vaccines), and PED (inactivated PEDV vaccine). The strain and subtype provided by ChoongAng Vaccine Laboratories are still unknown. There is another Korean company, Komipharm International Co., which provides a series of inactivated, live, and combination vaccines under the trade name Qilu Animal Health Products Factory, China, also sells a combination inactivated vaccine in China that contains PEDV and TGEV (strain and subtype unknown).

[0023] Therefore, what is needed is a PEDV vaccine specific for isolates currently prevalent in North America that is capable of reducing clinical signs of disease caused by PEDV and inducing protective immunity and reduction of viral shedding in immunized animals. SUMMARY OF THE INVENTION

[0024] The present invention provides immunogenic compositions, vaccines, and related methods that overcome deficiencies in the art. The present invention relates to immunogenic compositions comprising an enveloped (+) single-stranded RNA virus (porcine epidemic diarrhea virus, or PEDV) in an inactivated / killed and / or recombinant form. Specifically, the present application provides vaccines for protecting pigs against diseases associated with North American isolates of PEDV. The PEDV isolate BI1251-125-10 of the present invention (referred to herein as "125-10") (SEQ ID NO: 1 and SEQ ID NO: 15) is a virulent North American RNA virus strain having a genetic spectrum similar to other North American PEDVs reported in genotype group 2a.

[0025] The immunogenic compositions and vaccines of the present invention comprise inactivated / killed PEDV (e.g., chemically inactivated PEDV isolate 125-10 (SEQ ID NO: 1 and SEQ ID NO: 15)) and typically also include an adjuvant. The vaccine may also include other components such as preservatives, antimicrobial agents, stabilizers (e.g., stabilizers that can increase the shelf life of the vaccine, emulsions, and antigens against other porcine pathogens.

[0026] The immunogenic compositions and vaccines of the present invention comprise a spike antigen, which in a non-limiting example is expressed in insect cells by a recombinant baculovirus expressing an engineered PEDV spike protein (e.g., an engineered spike nucleic acid sequence (SEQ ID NO: 8) encoding an amino acid sequence (SEQ ID NO: 9)), and typically also include an adjuvant. The vaccine may also include other components such as preservatives, stabilizers, and antigens against other porcine pathogens.

[0027] Preferred spike nucleic acid sequences suitable for use in the present invention are polynucleotides encoding spike polypeptides that have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% similarity to SEQ ID NO: 2, 6, 8, and / or 13, more preferably at least 90%, 91%, 92%, 93%, and 94%, and most preferably at least 95%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 97.1%, 97.2%, 97.9%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 97.1%, 97.2 ...9%, 97.1%, 97.2%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 97.1%, 97.2%, 97.2 %, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.99% sequence identity. As used herein, it is specifically understood that the terms "sequence is identical to SEQ ID NO: X" or "identical SEQ ID NO: X" are equivalent to the terms "sequence identity to SEQ ID NO: X over the length of SEQ ID NO: X" or "sequence is identical to SEQ ID NO: X over the length of SEQ ID NO: X", respectively, wherein "X" in this context is any integer selected from 1, 2, 6, 8, 13 and 15.

[0028] Preferred spike polypeptides suitable for use in the present invention have a polypeptide having a sequence as shown in SEQ ID NO:3, 7, 9 and / or 14, having at least 80% homology to SEQ ID NO:3, 7, 9 and / or 14, for example, having at least 85% homology to SEQ ID NO:3, 7, 9 and / or 14, such as having at least 85% homology to SEQ ID NO:3, 7, 9 and / or 14, such as having at least 90% homology to SEQ ID NO:3, 7, 9 and / or 14, for example, having at least 95%, at least 98% or at least 99% homology to SEQ ID NO:3, 7, 9 and / or 14.

[0029] The terms "vaccine" and "immunogenic composition" are broadly defined herein to refer to any type of biological substance in an administrable form that is capable of stimulating an immune response in an animal vaccinated with the vaccine. Vaccines can generally be based on the virus itself (e.g., inactivated / inactivated or attenuated) or on the immunogenic (antigenic) components of the virus. In one embodiment of the invention, the vaccine (immunogenic composition) preferably includes the viral material in an inactivated / inactivated form, or the antigenic portion of the virus present as a subunit vaccine. As used herein, the term "protection" when used in connection with a vaccine refers to the improvement (partial or complete) of any symptom associated with the disease or disorder in question. Thus, protection of pigs by the PEDV of the vaccine of the present invention generally results in a reduction in viral shedding and / or one or more clinical symptoms associated with PEDV infection (e.g., acute watery diarrhea, acute vomiting, dehydration, anorexia, lethargy, depression, and high mortality (in piglets less than 10 days old)).

[0030] Those skilled in the art will appreciate that the compositions used herein may be incorporated into known injectable, physiologically acceptable sterile solutions. For the preparation of ready-to-use parenteral injection or infusion solutions, aqueous isotonic solutions, such as saline or plasma protein solutions, are readily available. In addition, the immunogenicity and vaccine compositions of the present invention may include veterinary acceptable carriers, diluents, isotonic agents, stabilizers, or adjuvants.

[0031] The methods of the present invention include, but are not limited to, methods of eliciting an immune response against PEDV infection in a subject, comprising the step of administering to the subject an immunogenic composition comprising inactivated / killed PEDV, attenuated PEDV, and / or spike antigens. Preferably, the immune response is elicited against more than one serotype or strain of PEDV. The compositions of the present invention can be used to prevent PEDV infection. Preferably, such an immune response reduces the incidence or severity of one or more clinical signs associated with or caused by infection with one or more PEDV serotypes.

[0032] In this article, suitable subjects or subjects in need of the compositions of the present invention may be administered include animals in need of preventive treatment of virus-related infections, diseases, or conditions. Animals in which immune responses are stimulated by using the compositions or methods of the present invention include livestock such as pigs, cattle, poultry (e.g., chickens, ducks, geese, or turkeys), goats, and sheep, and household animals such as mice, rabbits, dogs, cats, and horses. Preferred animals include swine, rodents, horses, rabbits, and cattle. Most preferably, immune responses are stimulated in pigs.

[0033] The present invention also provides a method for reducing the incidence or severity of one or more clinical signs associated with or caused by PEDV infection, comprising the step of administering an immunogenic composition of the present invention, which comprises an inactivated / killed PEDV vaccine and / or a combination of a spike antigen provided herein and a preferred carrier molecule, thereby reducing the incidence and severity of clinical signs of PEDV infection by at least 10%, preferably at least 20%, more preferably at least 30%, more preferably at least 50%, more preferably at least 70%, and most preferably 100%, compared to a subject not administered with the immunogenic composition provided herein. Such clinical signs include watery diarrhea, vomiting, and dehydration. Any of these clinical signs may be due to infection with PEDV (having genetic group 2a or any other PEDV genetic group including G1a, G1b, or G2b).

[0034] In one embodiment, the immunogenic composition of the present invention includes a chemically inactivated form of PEDV. Vaccines comprising chemically inactivated PEDV (SEQ ID NO: 1 or SEQ ID NO: 15) viruses are particularly desirable. The virus can be inactivated using a number of chemical inactivators known to those skilled in the art. Ethylenimine and related derivatives, such as diethyleneimine ("BEI") and acetylethyleneimine, are examples of suitable chemical inactivators for inactivating PED virus. Other chemical inactivators, for example, β-propiolactone or aldehydes (such as formaldehyde and glutaraldehyde), can also be used to inactivate the virus.

[0035] The immunogenic compositions and / or vaccines of the present invention generally include an adjuvant which is expected to have bioadhesive properties, particularly when the virus is designed to be administered intranasally. Examples of suitable adjuvants include cross-linked ethylenically unsaturated carboxylic acid polymers, such as cross-linked acrylic acid polymers. As used herein, the term "cross-linked acrylic acid polymer" refers to polymers and copolymers formed from a monomer mixture including acrylic acid as the major monomer in the mixture. Examples of suitable cross-linked acrylic acid polymers include those sold under the trade name 934P and 971 (available from BFGoodrich Co., Cleveland, Ohio). A particularly suitable adjuvant for use in the vaccines of the present invention is a cross-linked acrylic acid polymer having a Brookfield viscosity of no more than about 20,000 cPs (measured at 20 rpm as a 1.0 wt. % aqueous solution at pH 7.5). When a bioadhesive adjuvant is desired, it may be advantageous to use a cross-linked acrylic acid polymer having a viscosity of at least about 50 dynes / cm 2 The bioadhesive properties of the adjuvants were determined by the procedure described in US Pat. No. 4,615,697 as measured between two pieces of freshly excised rabbit gastric tissue.

[0036] The present invention also relates to methods of immunizing a subject comprising administering to the subject any of the immunogenic compositions described herein.

[0037] The term "immunization" relates to active immunization by administering an immunogenic composition to a subject to be immunized, thereby eliciting an immunological response against the antigens included in this immunogenic composition.

[0038] Preferably, the immunization results in a reduction in the incidence of a specific PEDV infection in the herd, or in a reduction in the severity of clinical signs caused by or associated with a specific PEDV infection.

[0039] In addition, immunization of a subject in need of an immunogenic composition as provided herein results in protection of the subject from PEDV infection. More preferably, immunization results in an effective, long-lasting immunological response against PEDV infection. It is understood that the period of time will last for more than 2 months, preferably more than 3 months, more preferably more than 4 months, more preferably more than 5 months, more preferably more than 6 months. It is understood that immunization may not be effective in all immunized subjects.

[0040] Preferably, this context is faced with a herd of subjects who, under normal circumstances (i.e., without immunity), would develop clinical signs that would normally be caused by or associated with PEDV infection. Whether a herd of subjects has been effectively immunized can be determined by a person skilled in the art without undue effort. Preferably, immunity is effective if the incidence or severity of clinical signs is reduced by at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and most preferably 100% in at least 20%, at least 30%, ...

[0041] A method for preventing clinical signs caused by PEDV in a subject in need thereof, or a method for protecting pigs against PEDV-related diseases, comprising administering to pigs an immunogenic composition and / or vaccine containing inactivated / killed PEDV and / or spike antigens. The vaccine can be administered using a number of methods, including intranasal, oral and / or parenteral (e.g., intramuscular) administration. In one embodiment of the method, for example, a vaccine containing inactivated PEDV is administered intramuscularly one or more times (e.g., at intervals of 2-4 weeks). In another embodiment of the method, for example, a vaccine containing inactivated PEDV is administered orally one or more times (e.g., at intervals of 2-4 weeks). In another embodiment, oral administration may be followed by and / or preceded by at least one intramuscular administration (e.g., 2-4 weeks after and / or before parenteral administration of the vaccine). Ideally, all pigs in a given herd are vaccinated at prescribed intervals to prevent the spread of disease symptoms.

[0042] Also provided are methods for producing an inactivated / killed PEDV vaccine. The methods generally comprise inoculating ape cells with PED virus, e.g., with PED virus SEQ ID NO: 1 or SEQ ID NO: 15. The inoculated ape cells are incubated, generally at least until CPE is observed (typically at 37°C for 24 to 120 hours), and then the PED virus is harvested from the incubated cells (e.g., by decanting and filtering the culture fluid). The harvested virus-containing fluid can be treated with a chemical inactivator, such as diethyleneimine, to form an inactivated / killed PED virus. Typically, the inactivated virus is further processed, e.g., by concentration and mixing with other components, to produce a commercial preparation. For example, the inactivated virus-containing fluid can be concentrated and mixed with an adjuvant and / or an antigen against one or more other porcine pathogens.

[0043] Also provided are methods for producing a recombinantly expressed spike antigen vaccine, wherein a recombinant baculovirus expressing an engineered PEDV spike protein is produced in insect cells. The method in one exemplary embodiment comprises cloning a PEDV spike coding sequence (SEQ ID NO:7) (engineered to remove the signal peptide, transmembrane domain, and c-terminal domain of the PEDV spike) into a vector (VSVG-PEDVS-VSVG DNA sequence (SEQ ID NO:8)) and co-transfecting Sf9 insect cells. For inactivated recombinant PEDV material, the PEDV baculovirus harvest is inactivated with 5 mM BEI for 24 hours, clarified, and filtered through 0.45 μm. Typically, the inactivated virus is further processed, for example, by concentration and mixing with other components, to produce a commercial preparation. For example, a liquid containing the inactivated virus can be concentrated and mixed with an adjuvant and / or an antigen against one or more other porcine pathogens.

[0044] The present application also relates to a kit comprising a combination of: (1) a dispenser capable of administering a vaccine to a pig; and (2) a vaccine containing chemically inactivated PEDV and / or recombinant spike antigens (capable of providing protection against PEDV-associated diseases). The kit may include a dispenser (capable of dispensing its contents as droplets, e.g., as an aerosol, spray, and / or liquid droplets), and a vaccine form (capable of providing protection against PEDV-associated diseases, e.g., when administered intranasally and / or intramuscularly).

[0045] Throughout this application, text refers to various embodiments of the present composition and / or related methods. The various embodiments described are intended to provide many illustrative examples and should not be construed as species for selection. Rather, it should be noted that the description of the various embodiments provided herein may have overlapping scopes. The embodiments discussed herein are merely illustrative rather than intended to limit the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The following drawings constitute part of this specification, and are included to further illustrate certain aspects of the present invention. The present invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments given herein.

[0047] Figure 1 DNA alignment of the PEDV1251-125-10 (125-10) genome (SEQ ID NO: 1) and the closest Chinese PEDV strain AH2012 (GenBank accession number: KC210145) (SEQ ID NO: 10).

[0048] Figure 2 DNA alignment of the PEDV1251-125-10 (125-10) genome (SEQ ID NO: 1) with the closest North American PEDV strain Colorado 2013 (GenBank Accession No.: KF272920) (SEQ ID NO: 11).

[0049] Figure 3 Amino acid sequence alignment of the PEDV1251-125-10 (125-10) spike protein (SEQ ID NO: 14) and the closest GenBank sequence corresponding to the North American Colorado strain (GenBank Accession No.: AGO58924) (SEQ ID NO: 12).

[0050] Figure 4 Graphical representation of anti-PEDV-IgG ELISA data (group least square mean ± standard error anti-PEDV-IgG S:P ratio for D-1, 14, 28 and 49).

[0051] Figure 5 Graphical representation of anti-PEDV-IgA ELISA data (group least square mean ± standard error anti-PEDV-IgA S:P ratios for D-1, 14, 28, and 49). DETAILED DESCRIPTION OF THE INVENTION

[0052] The present invention provides immunogenic compositions comprising an inactivated / killed form of PEDV and / or a recombinantly expressed PEDV-spike antigen. The vaccines are designed to protect pigs against PEDV-related diseases. The vaccines typically include a chemically inactivated form of PEDV, while those that include chemically inactivated / killed PEDV viruses are particularly desirable. In another embodiment, the vaccine includes a recombinantly expressed spike antigen, which is produced, for example, in insect cells by a recombinant baculovirus (expressing a modified PEDV spike protein).

[0053] One embodiment of the present invention may be a vaccine comprising one or more antigens of PEDV genotype 2a. In a preferred embodiment, the PEDV is of North American origin. More preferably, the PEDV of the North American genotype is any PEDV encoded by SEQ ID NO: 1, or comprising the sequence of SEQ ID NO: 1, and / or comprising the RNA equivalent of SEQ ID NO: 1; whose sequence is at least 99% identical to SEQ ID NO: 1, and / or at least 99% identical to the RNA equivalent of SEQ ID NO: 1; whose spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13; whose spike protein is encoded by a nucleic acid sequence at least 90% identical to SEQ ID NO: 2, 6, 8, or 13; encoded by SEQ ID NO: 15; or whose sequence is at least 99% identical to SEQ ID NO: 15.

[0054] In another embodiment of the present invention, the vaccine is a recombinant vaccine or an inactivated vaccine. In an exemplary embodiment of the present invention, PEDV is chemically inactivated, for example, by treatment with a chemical inactivator, the chemical inactivator comprising a compound selected from the group consisting of ethyleneimine, diethyleneimine, acetylethyleneimine, and mixtures thereof. In a preferred embodiment, PEDV is chemically inactivated by treatment with diethyleneimine.

[0055] In another embodiment of the present invention, the vaccine further comprises an adjuvant. In a preferred embodiment, the adjuvant is based on Oil-in-water emulsion.

[0056] In one embodiment of the present invention, the vaccine is a recombinant vaccine. In a preferred embodiment, the recombinant vaccine comprises one or more immunogenic components selected from the following groups: an isolated nucleic acid encoding a PEDV spike protein, wherein the recombinant spike polypeptide has at least 90% homology with SEQ ID NO: 3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); a recombinant PEDV spike protein encoded by the nucleic acid of a); and / or any combination thereof. Optionally, the recombinant vaccine comprises a pharmaceutically acceptable carrier and / or excipient. In one embodiment, the excipient is one or more adjuvants. Preferably, the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0057] In another aspect of the present invention, the recombinant vaccine further comprises one or more additional antigens. For example, the additional antigen may be structural protein M, E, or N of PEDV.

[0058] In another embodiment, the recombinant vaccine comprises an immunogenic component, which may be an isolated nucleic acid, a vector, a recombinant PEDV spike protein, and / or a combination of at least two of the latter.

[0059] Embodiments of the present invention also include methods for preventing clinical signs and / or for protecting pigs against PEDV-related diseases, comprising administering to the pig any of the inactivated / inactivated and / or recombinant vaccines described herein. For example, the administered vaccine comprises one or more antigens of PEDV of genotype 2a. In a preferred embodiment, the PEDV is of North American origin. More preferably, the PEDV of the North American genotype is any PEDV encoded by or comprising the sequence of SEQ ID NO: 1; its sequence is at least 99% identical to SEQ ID NO: 1; its spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13; and / or its spike protein is encoded by a nucleic acid sequence at least 90% identical to SEQ ID NO: 2, 6, 8, or 13.

[0060] In another embodiment, the method comprises administering a vaccine comprising one or more immunogenic components, wherein the one or more immunogenic components is a PEDV selected from the following group: encoded by SEQ ID NO: 1, or comprising the sequence of SEQ ID NO: 1, and / or comprising an RNA equivalent (SEQ ID NO: 16); its sequence is at least 99% identical to SEQ ID NO: 1, and / or at least 99% identical to the RNA equivalent (SEQ ID NO: 15); its spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13; its spike protein is encoded by a nucleic acid sequence at least 90% identical to SEQ ID NO: 2, 6, 8, or 13; encoded by SEQ ID NO: 15; or its sequence is at least 99% identical to SEQ ID NO: 15.

[0061] In another embodiment, the method comprises administering a vaccine comprising one or more immunogenic components selected from the group consisting of: an isolated nucleic acid encoding a PEDV spike protein, wherein the recombinant spike polypeptide has at least 90% homology to SEQ ID NO: 3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); a recombinant PEDV spike protein encoded by the nucleic acid of a); and any combination thereof.

[0062] Another embodiment of the invention includes a kit for vaccinating pigs against PEDV-associated diseases, comprising: a dispenser capable of administering the vaccine to a pig; and a PEDV vaccine as described herein.

[0063] Embodiments of the present invention include a method for producing the porcine epidemic diarrhea vaccine of claim 5, comprising: (a) inoculating simian cells with PEDV; (b) incubating the inoculated simian cells; (c) collecting PEDV from the incubated cells; and (d) treating the collected cells with a chemical inactivator (preferably with a compound selected from the following group: ethyleneimine, diethyleneimine, acetylethyleneimine or a mixture thereof) to form an inactivated PEDV vaccine. In a preferred embodiment, the method includes a PEDV that comprises a sequence encoded by SEQ ID NO: 1, or a sequence comprising SEQ ID NO: 1, and / or an RNA equivalent of SEQ ID NO: 1; whose sequence is at least 99% identical to SEQ ID NO: 1, and / or at least 99% identical to an RNA equivalent of SEQ ID NO: 1; whose spike protein is encoded by a nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13; whose spike protein is encoded by a nucleic acid sequence at least 90% identical to SEQ ID NO: 2, 6, 8, or 13; encoded by SEQ ID NO: 15; or whose sequence is at least 99% identical to SEQ ID NO: 15.

[0064] In one embodiment, the method comprises a PEDV comprising genetic group 2a of SEQ ID NO: 1 and / or SEQ ID NO: 15. In another embodiment of the method, the inoculated simian cells are Vero cells. In a preferred embodiment of the method, the chemical inactivation agent comprises diethyleneimine. The method may further comprise adding an adjuvant to the PEDV vaccine, preferably, the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0065] Another embodiment of the present invention includes a method for producing a recombinant vaccine, comprising: expressing one or more antigens of PEDV in a host cell; and collecting one or more antigens from cells expressing PEDV. In one such embodiment, the method may include one or more antigens comprising an isolated nucleic acid encoding a PEDV spike protein, wherein the recombinant spike polypeptide has at least 90% homology to SEQ ID NO: 3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); a recombinant PEDV spike protein encoded by the nucleic acid of a); and any combination thereof. In an exemplary embodiment, the one or more antigens of PEDV are expressed by a recombinant baculovirus vector. The method may include one or more antigens of PEDV expressed in insect cells. One embodiment further comprises adding an adjuvant to the PEDV vaccine, preferably wherein the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0066] In more general terms, many chemical inactivators known to those skilled in the art can be used to inactivate the virus. Ethylenimine and related derivatives, such as diethyleneimine (BEI) and acetylethyleneimine, are examples of suitable chemical inactivators for inactivating PED virus. Other chemical inactivators, such as β-propiolactone, aldehydes (such as formaldehyde) and / or detergents (e.g., Detergent, X, or alkyl trimethyl ammonium salts) can also be used for inactivating viruses. Inactivation can be carried out with standard methods known to those skilled in the art. Samples can be taken at periodic time intervals and the residual live virus can be measured. Monitoring cytopathic effects on suitable cell lines and / or fluorescent staining with suitable monoclonal or polyclonal antibodies can be used to monitor the presence of residual live viruses.

[0067] Inactivation with BEI can be achieved by mixing a mother BEI solution (e.g., a solution formed by adding 0.1-0.2M 2-bromo-ethylamine hydrobromide to 0.1-0.2N aqueous NaOH) with a virus solution to a final concentration of about 1-5mM BEI. Inactivation is usually performed by maintaining the BEI-virus mixture at 35-40°C (e.g., 37°C) and mixing continuously for 24-72 hours. Virus inactivation can be stopped by adding a sodium thiosulfate solution to a final concentration exceeding the BEI concentration (e.g., adding sodium thiosulfate at 17% of the BEI volume to neutralize excess BEI) followed by mixing.

[0068] The immunogenic compositions of the invention typically include an adjuvant and, if necessary, one or more emulsifiers such as Detergents, incorporated into the inactivated / killed PEDV. Suitable adjuvants include, for example, vitamin E acetate solubilizers, aluminum hydroxide, aluminum phosphate or aluminum oxide, (mineral) oil emulsions, non-ionic detergents, squalene and saponins. Other adjuvants that can be used include oil-based adjuvants such as Freund's complete adjuvant (FCA), and Freund's incomplete adjuvant (FIA). It has been found that cross-linked ethylenically unsaturated carboxylic acid polymers, such as 971 polymer is a particularly suitable adjuvant for the inactivated PEDV immunogenic composition of the present invention.

[0069] Examples of suitable oil-in-water emulsions are based on Adjuvants such as (Oil-in-water emulsion), with dimethyldioctadecyl ammonium bromide (DDA) (oil-in-water)), with proprietary immune stimulants (oil in water)), cross-linked polymers (oil-in-water dual adjuvant)), and - BCL (oil-in-water emulsion without animal-derived components) (MVP Technologies, Inc. Omaha, Nebr., USA). Pharmaceutical / vaccine compositions comprising inactivated PEDV or recombinant PEDV proteins that have been effectively adjuvanted with an oil-in-water emulsion, preferably with such a The adjuvant is preferably (oil-in-water emulsions free of animal-derived components) and - BCL (oil-in-water emulsion free of components of animal origin).

[0070] It is generally advantageous to formulate the compositions of the present invention in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to physically discrete units suitable as unit dosages for the mammalian subjects to be treated; each unit contains a predetermined quantity of active material (calculated to produce the desired therapeutic effect) in association with the required pharmaceutical carrier. The specifications for the inactivated / killed PEDV and / or recombinantly expressed PEDV antigen in dosage unit form are dictated by and depend on factors including: (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved; (b) the limitations inherent in the art of compounding such active materials for the treatment of disease; and (c) the manner in which the dosage unit form is to be administered.

[0071] The principal active ingredient is typically mixed with a suitable pharmaceutically acceptable carrier for convenient and effective administration in an effective amount (in the form of dosage units disclosed herein). The dosage unit form may, for example, contain an amount of PEDV antigen ranging from 1 to about 5 relative efficacy units ("RPU"). Such an amount of antigen is generally present in from about 1 to about 25 / ml of the carrier. In the case of a composition containing a supplementary active ingredient, the dosage is determined by reference to the usual dosage and mode of administration of the supplementary active ingredient.

[0072] The vaccines of the present invention generally include inactivated PEDV formulated with a pharmaceutically acceptable carrier. Pharmaceutical forms suitable for injectable use generally include sterile aqueous solutions (when water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. It is desirable that the formulation should be sterile and liquid (to the extent that there is easy syringability). The dosage form should be stable under the conditions of manufacture and storage and is generally preserved against the contaminating effects of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. One possible carrier is a physiological saline solution. The solution can be maintained with appropriate fluidity, for example, by using a coating such as lecithin, by maintaining the desired particle size (if in the case of a dispersion), and by using a surfactant. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal (ethymercury thiosalicylate), deomycin, gentamicin, and the like. In many cases, it may be preferable to include isotonic agents, for example, sugars or sodium chloride. If desired, prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0073] Sterile injectable solutions can be prepared by inactivating the virus in a desired amount in a suitable solvent (with various other ingredients listed above as required), followed by filtration sterilization. In general, dispersions can be prepared by incorporating various active ingredients into sterile carriers (which contain the basic dispersion medium and the required ingredients in those listed above). For the case of sterile powders for the preparation of sterile injectable solutions, preferred preparation methods are vacuum drying and freeze-drying techniques, which produce a powder of the active ingredient plus any additional desired ingredients (from its previously aseptically filtered solution).

[0074] Stabilizers can also be advantageously added to the compositions of the present invention to improve the stability of inactivated viruses. Suitable stabilizers include, for example, glycerol / EDTA, carbohydrates (such as sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose), proteins (such as albumin or casein) and protein degradation products (such as partially hydrolyzed gelatin). If necessary, the preparation can be buffered by methods known in the art, wherein reagents such as alkaline metal phosphates are used, such as sodium hydrogen phosphate, sodium dihydrogen phosphate, potassium hydrogen phosphate and / or potassium dihydrogen phosphate. Other reagents, such as ethanol or propylene glycol, can be used to improve the solubility of ingredients in vaccine formulations and / or the stability of solutions. Other additives that can be used for preparations of the present invention include conventional antioxidants and conventional chelating agents, such as ethylenediaminetetraacetic acid (EDTA).

[0075] The compositions and methods of the present invention can be illustrated by the following examples, which are given to illustrate the present invention and to help teach those skilled in the art how to prepare and use the present invention. These examples are not intended to narrow or limit the scope of the present invention in any way.

[0076] The practice of the present invention will utilize, unless otherwise indicated, conventional molecular biology techniques, microbiology techniques, recombinant DNA techniques, protein chemistry and immunology, which are within the capabilities of those skilled in the art. Such techniques are fully explained in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (DN Glover ed. 1985); Oligonucleotide Synthesis (MJ Gait ed. 1984); Nucleic Acid Hybridization (BD Hames & S.J. Higgins eds.1984); Animal CellCulture (RKFreshney ed.1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods InEnzymology (S.Colowick and N.Kaplan eds., Academic Press, Inc.); Proteinpurification methods-a practical approach (ELVHarris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Vols. I-IV (DM Weir and CC Blackwell eds., 1986, Blackwell Scientific Publications).

[0077] It should be understood that the invention is not limited to a particular DNA, RNA, polypeptide sequence, or process parameter, as these will of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments of the invention only and is not intended to be limiting. It should be noted that as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to an "antigen" includes a mixture of two or more antigens; reference to an "excipient" includes a mixture of one or more excipients, and so on.

[0078] definition:

[0079] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art at the time of the present invention. The meaning and scope of the terms should be clear; however, if there is any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In addition, unless the context requires otherwise, singular terms will include plural terms and plural terms will include the singular. In this article, the use of "or" means "and / or" unless otherwise stated. In addition, the use of the term "including", as well as other forms such as "comprising" and "containing" are not restrictive. All patents and publications mentioned herein are incorporated herein by reference.

[0080] "Protection (prevention) against disease", "protective immunity", "functional immunity" and similar expressions mean a response to a disease or condition produced by the administration of one or more therapeutic compositions of the present invention, or a combination thereof, that results in fewer adverse effects than would be expected in an unimmunized subject exposed to the disease or infection. That is, the severity of the adverse effects of the infection is reduced in a vaccinated subject. The infection may be reduced, delayed, or possibly completely prevented (prevented) in a vaccinated subject. In this article, when complete infection is intended, it will be explicitly mentioned. If complete protection against infection is not mentioned, the term includes partial protection.

[0081] As used herein, "reduction in the incidence and / or severity of clinical signs" or "reduction in clinical symptoms" means, but is not limited to, a reduction in the number of infected subjects in a group, a reduction or elimination of the number of subjects showing clinical signs of infection, or a reduction in the severity of any clinical signs present in one or more subjects (compared to wild-type infection). For example, it should refer to a reduction in any pathogen load, a reduction in pathogen shedding, a reduction in pathogen transmission, or a reduction in any clinical sign symptom of PEDV. Preferably, these clinical signs are reduced by at least 10% in one or more subjects receiving the therapeutic composition of the present invention (compared to subjects who did not receive the composition and were infected). More preferably, the clinical signs are reduced by at least 20%, preferably at least 30%, more preferably at least 40%, and more preferably at least 50% in subjects receiving the therapeutic composition of the present invention.

[0082] The term "improved protection" herein means, but is not limited to, a statistically significant reduction in one or more clinical symptoms associated with an infectious agent, preferably PEDV, in a vaccinated subject group versus a non-vaccinated subject control group, respectively. The term "statistically significant reduction in clinical symptoms" means, but is not limited to, that after challenge with an infectious agent, the frequency of occurrence of at least one clinical symptom in the vaccinated subject group is at least 10%, preferably 20%, more preferably 30%, more preferably 50%, and more preferably 70% lower than in the non-vaccinated control group.

[0083] "Long-lasting protection" shall mean "improved efficacy" that lasts for at least 3 weeks, but more preferably at least 3 months, more preferably at least 6 months. In the case of livestock, it is most preferred that the long-lasting protection should last until the average age of the animals for meat.

[0084] "Immunogenic or immunological composition" refers to a composition of matter comprising at least one porcine epidemic diarrhea virus, or an immunogenic portion thereof, which induces an immunological response (a cellular or antibody-mediated immune response to the composition) in a host. In a preferred embodiment of the invention, the immunogenic composition induces an immune response, and more preferably, confers protective immunity against one or more clinical signs of PEDV infection.

[0085] As used herein, the immunogenic composition also refers to a composition comprising any PEDV spike protein described herein. According to another embodiment, such immunogenic composition further comprises at least a portion of a viral vector expressing the PEDV spike protein (preferably a recombinant baculovirus). In addition, the immunogenic composition may comprise i) any PEDV protein described above, preferably at the concentrations described above, ii) at least a portion of a viral vector expressing the PEDV spike protein (preferably a recombinant baculovirus), and iii) a portion of cell culture supernatant.

[0086] Thus, according to one aspect, the present invention relates to a method for reducing the percentage of PEDV infection in a herd of pigs, comprising the step of administering to said pigs an effective amount of a PEDV spike antigen or an immunogenic composition comprising a PEDV antigen, wherein said PEDV antigen is a recombinant PEDV spike antigen, preferably a baculovirus expressing a PEDV spike protein. Preferably, these recombinant or baculoviruses express a PEDV spike having a sequence as described herein.

[0087] "Immune response" or "immunological response" means, but is not limited to, the development of a cellular and / or antibody-mediated immune response to a composition or vaccine of interest. Typically, an immune or immunological response includes, but is not limited to, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and / or cytotoxic T cells to multiple antigens included in the composition or vaccine of interest. Preferably, the host will exhibit a therapeutic or protective immunological (memory) response, which will enhance resistance to new infections and / or reduce the clinical severity of the disease. Such protection will be demonstrated by a reduction in the number of symptoms, a reduction in the severity of symptoms, or the absence of one or more symptoms associated with infection with a pathogen, a delay in the onset of viremia, a reduction in viral persistence, a reduction in overall viral load, and / or a reduction in viral shedding.

[0088] As used herein, "pharmaceutically or veterinarily acceptable carriers" include any or all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, etc. In some preferred embodiments, and particularly those comprising lyophilized immunogenic compositions, stabilizers for use in the present invention include stabilizers for lyophilization or freeze drying.

[0089] In some embodiments, the immunogenic compositions of the present invention contain an adjuvant. "Adjuvant" as used herein may include aluminum hydroxide and aluminum phosphate, saponins such as Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, water-in-oil-in-water emulsions.

[0090] The emulsion may be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oils such as squalane or squalene; oils derived from oligomerization of olefins (in particular isobutylene or decene); esters of acids or alcohols containing linear hydrocarbon radicals, more particularly vegetable oils, ethyl oleate, propylene glycol di-(caprylate / caprate), glyceryl tri-(caprylate / caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearates. The oils are used in combination with emulsifiers to form emulsions. The emulsifier is preferably a nonionic surfactant, in particular esters of sorbitan, esters of mannide (e.g. anhydromannitol oleate), esters of ethylene glycol, esters of polyglycerol, esters of propylene glycol, and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular Pluronic products, especially L121. See Hunter et al. The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, DES), John Wiley and Sons, NY, pp51-94 (1995) and Todd et al. Vaccine 15:564-570 (1997). Exemplary adjuvants are the SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach", edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of the same book.

[0091] Examples of suitable oil-in-water emulsions are based on Adjuvants such as (O / W emulsion), (O / W with dimethyldioctadecyl ammonium bromide (DDA)), (O / W oil-in-water with proprietary immunostimulant), (a dual adjuvant consisting of oil-in-water (o / w) and a cross-linked polymer), and - BCL (oil-in-water emulsion without animal-derived components) (MVP Laboratories, Inc. Omaha, Nebr., USA). Pharmaceutical / vaccine compositions comprising inactivated PEDV or recombinant PEDV protein that have been effectively adjuvanted with an oil-in-water emulsion, preferably with such a adjuvant, more preferably (O / W emulsion) and / or - BCL (oil-in-water emulsion free of components of animal origin).

[0092] Examples of suitable adsorbed aluminum hydroxide gels for use in veterinary vaccines include REHYDRAGEL-LV; REHYDRAGEL-HPA; REHYDRAPHOS (General Chemical, Berkeley Heights, New Jersey, USA).

[0093] Other examples of adjuvants are compounds selected from copolymers of acrylic acid and methacrylic acid and copolymers of maleic anhydride and olefin derivatives. Advantageous adjuvant mixtures are polymers of acrylic acid or methacrylic acid, which are crosslinked (especially with polyalkenyl ethers of sugars or polyols). These compounds are known by the term carbomer (Phameuropa Vol.8, No.2, June 1996). Those skilled in the art can also refer to U.S. Pat. No. 2,909,462, which describes such acrylic acid polymers, crosslinked with polyhydroxylated compounds having at least 3 hydroxyl groups (preferably not more than 8), and the hydrogen atoms of at least 3 hydroxyl groups are substituted by unsaturated aliphatic hydrocarbon groups having at least 2 carbon atoms. Preferred are groups containing 2-4 carbon atoms, such as vinyls, allyls and other ethylenically unsaturated groups. The unsaturated groups themselves may contain other substitutions, such as methyl. Products sold under the name CARBOPOL.RTM (also known as polyacrylic acid); (BF Goodrich, Ohio, USA) are particularly suitable. They are crosslinked with allyl sucrose or crosslinked with allyl pentaerythritol. Among them, CARBOPOL.RTM.974P (also known as polyacrylic acid), CARBOPOL.RTM.934P (also known as polyacrylic acid) and CARBOPOL.RTM.971P (also known as polyacrylic acid) can be mentioned. Most preferably, CARBOPOL.RTM.971P (also known as polyacrylic acid) is used. Among the copolymers of maleic anhydride and alkene derivatives, copolymer EMA (Monsanto) is an ethylene copolymer of maleic anhydride and. Dissolution of these polymers in water results in an acid solution, which will be neutralized to preferably physiological pH in order to provide an adjuvant solution (in which the immunogenic, immunological or vaccine composition will be incorporated).

[0094] Other suitable adjuvants include, but are not limited to, RIBI adjuvant system (Ribi Inc.), Block copolymers (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from Escherichia coli (recombinant or otherwise), cholera toxin, or muramyl dipeptide, etc.

[0095] It is contemplated that the adjuvant may be added in an amount of about 100 μg to about 10 mg per dose, preferably in an amount of about 100 μg to about 10 mg per dose, more preferably in an amount of about 500 μg to about 5 mg per dose, more preferably in an amount of about 750 μg to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant concentration may be about 0.01 to 50%, preferably in a concentration of about 2% to 30%, more preferably in a concentration of about 5% to 25%, more preferably in a concentration of about 7% to 22%, and most preferably in a concentration of about 10% to 20% (based on the volume of the final product).

[0096] "Diluents" may include water, saline, dextrose, ethanol, glycerol, etc. Isotonic agents may include sodium chloride, dextrose, mannitol, sorbitol, and lactose, etc. Stabilizers include albumin and alkaline salts of ethylenediaminetetraacetic acid, etc.

[0097] "Isolated" means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from materials coexisting with its natural state is "isolated," as the term is used herein.

[0098] "Safety" refers to the lack of adverse consequences in vaccinated animals following vaccination, including but not limited to: potential reversion of virus-based vaccines to virulence, clinically significant side effects such as persistent, systemic morbidity, or unacceptable inflammation at the site of vaccine administration.

[0099] The term "vaccination" or "vaccination" or variations thereof, as used herein, means, but is not limited to, a process comprising administering an immunogenic composition of the invention which, when administered to an animal, elicits, or is capable of eliciting (directly or indirectly) an immune response against PEDV in the animal.

[0100] "Mortality," in the context of the present invention, refers to deaths caused by PEDV infection, and includes situations where the infection is so severe that the animal must be sacrificed to avoid suffering and provide a humane end to its life.

[0101] As used herein, "effective dose" means, but is not limited to, the amount of an antigen that elicits, or is capable of elicits, an immune response that produces a reduction in clinical symptoms in an animal to which the antigen is administered.

[0102] As used herein, the term "effective amount" in the context of a composition means an amount of an immunogenic composition sufficient to induce an immune response that reduces the incidence of infection or reduces the severity of infection or reduces the occurrence of disease in an animal. Specifically, an effective amount refers to colony forming units (CFU) per dose. Alternatively, in the context of treatment, the term "effective amount" refers to an amount of treatment sufficient to achieve the following purposes: reduce or alleviate the severity or duration of a disease or disorder (or one or more of its symptoms), prevent the progression of a disease or disorder, cause the degeneration of a disease or disorder, prevent the recurrence, development, onset, or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prevention or efficacy of another treatment or therapeutic agent.

[0103] "Sequence identity" as known in the art refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, i.e., a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing a given sequence to a reference sequence (determined by the match between the sequence strings) after the sequences have been optimally aligned to provide the highest degree of sequence similarity. After such alignment, sequence identity is determined on a position-by-position basis, e.g., if the nucleotide or amino acid residue at a particular position is the same, the sequences are "identical" at that position. The total number of such positional identities is then divided by the total number of nucleotides or residues in the reference sequence to obtain the % sequence identity. Sequence identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AN, ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods for determining sequence identity are designed to give the largest match between the test sequences. Methods for determining sequence identity are optimized in publicly available computer programs for determining sequence identity between given sequences.Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al. Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al. J. Molec. Biol., 215:403-410 (1990). The BLAST program is publicly available from NCBI and other sources (BLAST manual, Altschul, S. et al. NCVI NLM NIH Bethesda, MD 20894, Altschul, SF et al. J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally use default gap weights to align sequences so as to give the highest level of sequence identity between a given and a reference sequence. As an illustration, for a polynucleotide having a nucleotide sequence of at least, for example, 85%, preferably 90%, and more preferably 95% "sequence identity" with a reference nucleotide sequence, that is, the nucleotide sequence of a given polynucleotide is identical to the reference sequence, except that the given polynucleotide sequence may include up to 15, preferably up to 10, and more preferably up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide whose nucleotide sequence is at least 85%, preferably 90%, and more preferably 95% identical to a reference sequence, then up to 15%, preferably 10%, and more preferably 5% of the nucleotides in the reference sequence may be deleted or substituted by another nucleotide, or up to 15%, preferably 10%, and more preferably 5% of the total nucleotides in the reference sequence may be deleted or substituted by another nucleotide. Nucleotides may be inserted into a reference sequence. These mutations of a reference sequence may occur at the 5' or 3' end of the reference sequence, or anywhere between those end positions, interspersed singly between nucleotides in the reference sequence or distributed in one or more consecutive groups within the reference sequence. Similarly, for a polypeptide having an amino acid sequence with a reference amino acid sequence of at least, for example, 85%, preferably 90%, more preferably 95% sequence identity, that is, a given amino acid sequence of the polypeptide is identical to the reference sequence, except that a given polypeptide sequence may include up to 15, preferably up to 10, more preferably up to 5 amino acid changes in every 100 amino acids of the reference sequence. In other words, in order to obtain a polypeptide sequence with at least 85%, preferably 90%, more preferably 95% sequence identity with a reference sequence, up to 15%, preferably up to 10%, more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted by another amino acid, or up to 15%, preferably up to 10%, more preferably up to 5% of the total number of amino acids in the reference sequence may be inserted into the reference sequence.These changes in the reference sequence may occur at the amino or carboxyl termini of the amino acid sequence, or anywhere between those terminal positions, interspersed individually among the residues in the reference sequence or distributed in one or more consecutive groups within the reference sequence. Preferably, residue positions that are not identical are distinguished from conservative amino acid substitutions. However, when determining sequence homology, conservative substitutions are not included in the match.

[0104] "Conservative substitution" refers to the substitution of an amino acid residue with another amino acid residue having similar characteristics or properties (including size, hydrophobicity, etc.) such that the overall functionality is not significantly changed.

[0105] "Sequence homology", as used herein, refers to a method for determining the relatedness between two sequences minus conservative substitutions. To determine sequence homology, two or more sequences are optimally aligned and gaps are introduced if necessary. In other words, in order to obtain a polypeptide having 95% sequence homology with a reference sequence, 85%, preferably 90%, more preferably 95% of the amino acid residues in the reference sequence must match or contain conservative substitutions of another amino acid, or a maximum of 15%, preferably a maximum of 10%, more preferably a maximum of 5% of the total amino acid residues in the reference sequence (excluding conservative substitutions) can be inserted into the reference sequence. Preferably, the homologous sequence contains a segment of at least 50 amino acids, more preferably a segment of 100 amino acids, more preferably a segment of 250 amino acids, more preferably a segment of 500 amino acids.

[0106] The terms "sequence identity" and "percentage identity" are used interchangeably herein. For purposes of the present invention, it is defined herein that in order to determine the percentage identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared for the best comparison purpose (e.g., a gap can be introduced in the sequence of the first amino acid or nucleic acid so as to have the best comparison with the second amino acid or nucleic acid sequence). The amino acid and nucleotide residues at the corresponding amino acid or nucleotide positions are then compared. When the position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, the molecule is identical at that position. The percentage identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = the total number of the number of identical positions / positions (i.e., overlapping positions) x100). Preferably, the two sequences are of the same length. When sequence identity is used for proteins, it is recognized that non-identical residue positions are often distinguished by conservative amino acid substitutions, in which amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the sequence identity is adjusted upward due to the conservative nature of the substitutions. Sequences that differ in conservative substitutions are said to have "sequence similarity" or "similarity."

[0107] Sequence comparison can be carried out on the full length of the two sequences being compared, or on the fragment of the two sequences.Usually, sequence comparison will be carried out on the full length of the two sequences being compared.However, sequence identity can be carried out on the region of, for example, 20, 50, 100 or more amino acid residues.

[0108] The skilled person will note that there are several different computer programs that can be used to determine the homology between two sequences. For example, the comparison of sequences between two sequences and the determination of percent identity can be achieved using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm, which has been incorporated into the GAP program in the Accelrys GCG software package (available from http: / / www.accelrys.com / products / gcg / ), using a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. The skilled person will appreciate that all of these different parameters will produce slightly different results, but that the overall percent identity of the two sequences will not change significantly when different algorithms are used.

[0109] The protein sequence or nucleic acid sequence of the present invention can also be used as a "query sequence" to search against public databases, for example to identify other family members or related sequences. Such searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215: 403-10. BLAST protein searches can be performed using the BLASTP program, score = 50, character length = 3, to obtain amino acid sequences homologous to the protein molecules of the present invention. In order to obtain gapped alignments for comparison purposes, Gapped BLAST can be used, as described in Altschul et al. (1997) Nucleic Acids Res. 25 (17): 3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of each program (e.g., BLASTP and BLASTN) can be used. See the homepage of the National Center for Biotechnology Information http: / / www.ncbi.nlm.nih.gov / .

[0110] The PEDV claimed in the present invention should also cover variants of PEDV isolate 1251-125-10 ("125-10") and variants of subfragments thereof. Such variants have substantially the same immunological properties as those of the Oklahoma strain (SEQ ID NOs 1 and 15). The term "having substantially the same immunological properties" encompasses (but is not limited to) that the variant is substantially effective in treating or preventing clinical signs caused by PEDV (as described below) or is substantially effective in improving efficacy parameters (as described below).

[0111] The term "variant" for sequences SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 14 and 15 (e.g., polypeptide or nucleic acid sequence) is intended to mean substantially similar sequences. For nucleotide sequences comprising an open reading frame, variants include those sequences that encode the same amino acid sequence as the native protein due to the degeneracy of the genetic code. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as, for example, those produced by using site-directed mutagenesis, and for open reading frames, encoding native proteins, as well as encoding polypeptides with amino acid substitutions relative to the native protein for the purpose of codon optimization. In general, the nucleotide sequence variants of the present invention will have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most preferably at least 95%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.1%, 98.9%, 98.1%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 9 ... 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.99% sequence identity (using the alignment program with standard parameters).

[0112] The term "genogroup" as known in the art refers to viruses that are related within a genus; it can also be further subdivided into genetic clusters. Identified PEDV genogroups include the G1 group, which includes subgroups G1a, G1b, R (attenuated / adapted); and the G2 group, which includes subgroups G2a, and G2b. Members of the G2a genogroup include the Chinese strain AH2012 (GenBank Accession No.: KC210145) and the North American strains, sharing several unique nucleotide changes. For AH2012, strains MN and IA2 have 99.6% and strain IA1 has 99.5% nucleotide identity, respectively. Researchers have speculated that AH2012-like viruses may have spread to the eastern Chinese region and then moved to the United States, and are most likely the closest ancestors of the North American strains. Members of genogroup 2a share only about 96.9% similarity to the prototype PEDV strain CV777 of genogroup 1a (Bridgen et al. 1993; Huang et al. 2013; GenBank: AF353511.1). Thus, attenuated PEDV vaccines based on the historical CV777-derived G1a strains or DR13-derived G1b strains are less antigenically related to the emerging Chinese and North American G2a PEDV strains.

[0113] A closely related North American isolate, US / Colorado / 2013 (GenBank Accession No.: KF272920.1), has also been reported by Marthaler et al. 2013. As with the above North American isolates, the complete PEDV genome of CO / 13 has 96.5 to 99.5% nucleotide identity with other complete PEDV genomes available in GenBank, with the highest nucleotide identity (99.5%) with the Chinese strain AH2012 (GenBank Accession No. KC210145). The Chinese strain AH2012 is a member of the 2a genetic group. Comparison of the complete genome of the North American isolate CO / 13 with the PEDV reference strain CV777 showed that CO / 13 contained an insertion of 1 nucleotide (at position 48) and a deletion of 5 nucleotides in the 5′UTR (at positions 73 and 83 to 86), while the spike gene contained an insertion of 16 nucleotides (at positions 20804, 20810 to 20820, 20843, and 21053 to 21055) and a deletion of 7 nucleotides (at positions 20853 and 21118 to 21124).

[0114] The term "PEDV of North American origin" means a PEDV isolate comprising SEQ ID NO: 1 and / or SEQ ID NO: 15, and / or any PEDV isolate having at least 99% sequence identity to SEQ ID NO: 1, and / or at least 99% identity to the RNA equivalent of SEQ ID NO: 1, and / or a PEDV isolate in which the spike protein is encoded by SEQ ID NO: 13, and / or any PEDV isolate in which the spike protein has at least 98% sequence identity to SEQ ID NO: 13, and / or any PEDV isolate in which the spike protein expressed has at least 90% homology to SEQ ID NO: 14.

[0115] The term "clade" as known in the art refers to a group consisting of an ancestor and all its descendants, a single "branch" in a phylogenetic tree. The ancestor can be, for example, an individual, a population, or a species. A genetic group can include multiple clades, for example AH2012 and the North American isolate are in different clades.

[0116] According to further embodiments, the present invention also relates to a vector comprising any of such nucleic acid molecules described herein. In other words, the present invention relates to a vector comprising a coding sequence for any such spike, M, E, N PEDV protein or a portion thereof. Preferably, the vector is an expression vector that allows the expression of any such spike, M, E, and / or N PEDV protein or protein portion. The vectors of the present invention are those suitable for transfection or infection (in vitro or in vivo) of bacteria, yeast or animal cells.

[0117] The vector and method for preparing and / or using the vector (or recombinant) for expression can be the method disclosed in the following or similar thereto: U.S. Patent Nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 382,425, PCT Publication WO 94 / 16716, WO 96 / 39491, WO 95 / 30018; Paoletti, "Applications of poxvirus vectors to vaccination: An update," PNAS USA 93:11349-11353, October 1996; Moss, "Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety," PNAS USA 93:11341-11348, October 1996; Smith et al., U.S. Patent No. 4,745,051 (recombinant baculovirus); Richardson, CD (Editor), Methods in Molecular Biology 39, "Baculovirus Expression Protocols" (1995Humana Press Inc.); Smith et al., "Production of Human Beta Interferon in Insect Cells Infected with aBaculovirus Expression Vector", Molecular and Cellular Biology, December, 1983, Vol. 3, No. 12, p. 2156-2165; Pennock et al., "Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus vector,"Molecular and Cellular Biology March 1984,Vol.4,No.3,p.406; EPA0 370 573; U.S. Patent Application No. 920,197, filed October 16, 1986; EP Patent Application No. 265785; U.S. Patent No. 4,769,331 (recombinant herpes virus); Roizman, "The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors," PNAS USA 93: 11307-11312, October 1996; Andreansky et al., "The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors," PNAS USA 93: 11313-11318, October 1996; Robertson et al., "Epstein-Barr virus vectors for gene delivery to B lymphocytes", PNAS USA 93: 11334-11340, October 1996; Frolov et al., "Alphavirus-based expression vectors: Strategies and applications," PNAS USA 93:11371-11377, October 1996; Kitson et al., J. Virol. 65, 3068-3075, 1991; U.S. Patent Application Nos. 5,591,439, 5,552,143; WO 98 / 00166; U.S. Application Serial Nos. 08 / 675,556, and 08 / 675,566, both filed July 3, 1996 (recombinant adenovirus); Grunhaus et al., 1992,"Adenovirus as cloning vectors," Seminars in Virology (Vol. 3) p. 237-52, 1993; Ballay et al. EMBO Journal, vol. 4, p. 3861-65, Graham, Tibtech 8, 85-87, April, 1990; Prevec et al., J. Gen Virol. 70, 42434; PCT WO 91 / 11525; Felgner et al. (1994), J. Biol. Chem.269, 2550-2561, Science, 259: 1745-49, 1993; and McClements et al., "Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease", PNAS USA 93: 11414-11420, October 1996; and U.S. Patent Application Nos. 5,591,639, 5,589,466, and 5,580,859, and WO 90 / 11092, WO 93 / 19183, WO 94 / 21797, WO 95 / 11307, WO 95 / 20660; Tang et al., Nature, and Furth et al., Analytical Biochemistry, relating to DNA expression vectors, etc. See also WO 98 / 33510; Ju et al., Diabetologia, 41:736-739, 1998 (lentiviral expression system); Sanford et al., U.S. Pat. No. 4,945,050; Fischbachet et al. (Intracel); WO 90 / 01543; Robinson et al., Seminars in Immunology vol. 9, pp. 271-283 (1997), (DNA vector system); Szoka et al., U.S. Pat. No. 4,394,448 (methods for inserting DNA into living cells); McCormick et al., U.S. Pat. No. 5,677,178 (use of cytopathic viruses); and U.S. Pat. No. 5,928,913 (vectors for gene delivery); and other references cited herein. .

[0118] Preferred viral vectors include baculoviruses such as BaculoGold (BD Biosciences Pharmingen, San Diego, Calif.), especially when the production cells are insect cells. Although baculovirus expression systems are preferred, those skilled in the art will appreciate that other systems may also work for the purposes of the present invention, namely, expressing HG into the supernatant of cell culture. Such other expression systems may require the use of a signal sequence in order to cause H5 to be expressed into the culture medium.

[0119] Effective dose:

[0120] The compounds described herein can be administered to a subject at a therapeutically effective dose to prevent PEDV-associated disease. The dose will depend on the host receiving the vaccine, as well as factors such as the size, weight, and age of the host.

[0121] The exact amount of the immunogenic composition of the invention to be applied to the formulation will depend on the route of administration and the nature of the subject (e.g., age, size, stage / level of disease), and should be based on the judgment of the practitioner and the condition of each subject in accordance with standard clinical techniques. An effective immunizing amount is an amount sufficient to treat or prevent PEDV infectious disease in a subject.

[0122] The immunogenicity of the composition can be determined by monitoring the immune response of the test subject using any immunoassay known in the art after immunization with the composition. The production of humoral (antibody) response and / or cell-mediated immunity can be used as an indication of the immune response. The test subject can include animals such as pigs, mice, hamsters, dogs, cats, rabbits, cows, horses, sheep, poultry (e.g., chickens, ducks, geese, and turkeys), and humans.

[0123] The immune response of the test subject can be analyzed by various means, such as: the reactivity of the obtained immune serum to the immunogenic conjugate is determined by known techniques, such as enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, virus neutralization, etc.; or, by protecting the immunized host from infection by the pathogen and / or reducing the symptoms caused by the pathogen infection in the immunized host (determined by any method known in the art) to determine the level of infectious disease substances, such as virus levels (for example, by culturing samples from the subject), or other techniques known in the art. The level of infectious disease substances can also be determined by measuring the level of antigens to which the immunoglobulins are directed. A reduction in the level of infectious disease substances or an improvement in infectious diseases indicates that the composition is effective.

[0124] The therapeutic or prophylactic activity of the therapeutic agents of the invention can be tested in vitro prior to in vivo use in animals. For example, in vitro assays that can be used to determine whether administration of a particular therapeutic agent is indicated include in vitro cell culture assays, in which cells from a cell line or cells cultured from a subject with a particular disease or condition are exposed to or administered a therapeutic agent, and the effect of the therapeutic agent on the cells is observed.

[0125] Alternatively, the therapeutic agent can be assayed by contacting the therapeutic agent with cells (cultured from a subject or from a cultured cell line) that are susceptible to infection by the infectious disease agent but have not yet been infected by the infectious disease agent, exposing the cells to the infectious disease agent, and then determining whether the infection rate of the cells contacted with the therapeutic agent is lower than the infection rate of cells not contacted with the therapeutic agent. Infection of the cells by the infectious disease agent can be assayed by any method known in the art.

[0126] In addition, the therapeutic agent can be evaluated by measuring the level of the molecule to which the antibody is directed in an animal model or in a human subject at appropriate time intervals before, during, or after treatment. Any change in the amount of the molecule, or the lack of change, can be identified and correlated with the effect of the treatment of the subject. The level of the molecule can be determined by any method known in the art.

[0127] After animals are vaccinated with PEDV using the methods and compositions of the invention, any binding assay known in the art can be used to assess the binding between the resulting antibodies and the specific molecule. These assays can also be performed to screen for antibodies that exhibit higher affinity or specificity for a specific antigen.

[0128] Administer to:

[0129] Preferred routes of administration include, but are not limited to, intranasal, oral, intradermal, and intramuscular. The skilled person will appreciate that the compositions of the present invention may also be administered in one, two, or more doses, and administered by other routes. For example, such other routes include: subcutaneous, intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intratracheal, intradermal, intracardiac, intralobular, intramedullary, intrapulmonary, and intravaginal. Depending on the duration and effect of treatment expectations, the compositions of the present invention may be administered once or several times, and intermittently, such as on a daily basis and in different dosages for several days, weeks, or months.

[0130] The following examples are included to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the examples below represent techniques that the inventors have found to work well in the practice of the present invention, and thus can be considered to constitute preferred modes of its practice. However, those skilled in the art, after knowing this disclosure, will appreciate that many changes can be made to the disclosed specific embodiments and still obtain the same or similar results without departing from the spirit and scope of the present invention. Example

[0131] Example 1: Isolation and production of inactivated PEDV strains

[0132] To produce a porcine epidemic diarrhea virus vaccine, an inactivated virus, a master seed culture of PEDV (isolate) is first produced. From this master seed culture of PEDV is grown and subsequently inactivated. The inactivated virus culture is then mixed with an adjuvant to produce a porcine epidemic diarrhea virus vaccine. The following method was used to produce a porcine epidemic diarrhea virus vaccine.

[0133] Animals or tissues from animals that exhibit extreme diarrhea were obtained in 2013. Homogenates from mucosal scrapings were produced from these animals, filtered through a 0.2 micron syringe filter, and the filtrate was used to inoculate African Green Monkey kidney cells (VERO). Viruses were cultured in the presence of PEDV maintenance medium, which contained modified MEM, porcine trypsin, tryptone phosphate solution, yeast extract, and HEPES buffer. The growth of the virus was assessed and visualized by checking for characteristic syncytium formation and fusion of cell monolayers. CPE positive material was sequenced using MiSeq technology based on Illumina.

[0134] To generate a PEDV master seed virus culture ("PEDVMSV"), a porcine epidemic diarrhea virus strain (isolate) (PEDV isolate) was isolated and passaged a total of 19 times in BI VERO cells, and the virus was then grown in 2013EU Vero cells until passage 30. The 30th passage of the virus was diluted and set aside as the master seed virus, designated PEDVKV-1251-125-10-OK.

[0135] Cultures of PEDV (KV-1251-125-10-OK, referred to herein as "125-10") were generated from the primary seed virus by infecting 2013EU Vero cells with PEDV KV-1251-125-10-OK MSV in PEDV maintenance medium containing modified Minimal Essential Media, porcine trypsin (10 μg / ml), tryptone phosphate solution (0.3%), yeast extract (0.02%), and 1 M HEPES buffer (2.5%). PEDV (125-10) MSV was typically used at 10 4 TCID 50 / 850cm 2The 2013EU Vero cells are infected with the lowest dose of a roller bottle. Such cultures can be grown in sterile disposable roller bottles or on microcarrier beads. The culture is incubated at 36°C ± 2°C for 24 to 48 hours until cytopathic effects ("CPE") are observed. Typically, characteristic syncytia can be seen within 12 hours of infection, with syncytia expansion and cell monolayer fusion from 24-48 hours, followed by cell detachment (sloughing). During incubation, PEDV-induced CPE in the culture is monitored to ensure a pure PEDV strain. If atypical CPE is observed or there is any macroscopic or periscopic evidence of contamination, the culture is discarded. Pure virus culture is aseptically collected into sterile polypropylene bottles. The virus is frozen and thawed to release cell-associated virions and clarified by centrifugation or filtration through a 0.45 micron filter followed by a 0.2 micron filter. A large number of virus collection fluids have been tested to ensure that there are no mycoplasmas before inactivation. Uninactivated collection fluids are stored at -70°C or lower.

[0136] The volume of the collected liquid was determined and the temperature of the liquid was brought to 36 ± 2 ° C. A 0.4M solution of 2-bromoethyleneamine (BEA) was mixed with a 0.3N NaOH mother liquor to produce a diethyleneimine (BEI) mother liquor, which was then added to the collected liquid to provide a 5mM BEI final concentration. The liquid was stirred continuously for a minimum of 24 hours. A 1.0M sodium thiosulfate solution was added to provide a 5mM minimum final concentration to neutralize any residual BEI. The inactivated liquid can be stored at -70 ± 3 ° C for long-term storage or at 4 ± 3 ° C for short-term storage.

[0137] After treatment with BEI, the culture is tested for its ability to induce CPE typical of PEDV to ensure inactivation of the virus. This is accomplished by passing the BEI-treated virus fluid through Vero cells and examining the Vero cells for any viral infection. BEI-treated culture fluid is typically stored at -70°C or lower until the inactivation assay has been completed.

[0138] By mixing inactivated PEDV culture with adjuvant The inactivated virus was formulated as an adjuvanted vaccine by mixing thoroughly at 20% inclusion to form a bulk serial. The bulk serial was stored at 2-8°C until contained in vials of 1 to 10 doses (@ 2.0 ml per dose).

[0139] Example 2: Genome sequence of PEDV isolate 1251-125-10 "125-10"

[0140] Sample preparation and analysis: Before extraction, the virus tissue culture was pre-treated with a cocktail of DNase and RNase to remove residual host cell genomic nucleic acid. Then, the viral genomic RNA was extracted from the sample treated with nuclease using Qiagen viral RNA extraction kit (Cat#52906). After extraction, the sample was treated with DNase again to further enrich the viral genomic RNA. Subsequently, the viral genomic RNA was converted into double-stranded cDNA (ds cDNA) through random-guided reverse transcription and Klenow fragment treatment. NextEraXT library preparation kit (Cat#FC-131-1024) was then used to generate a library for sequencing based on Illumina MiSeq using the ds cDNA product. Each sample was barcoded at the 5'- and 3'-ends with unique tags to minimize the possibility of mis-binning of bioinformatics. This library was run on MiSeq using a 500-cycle kit (Cat#MS-102-2003) and the data was analyzed using a combination of NextGene (version 2.3.4) and Sequencher software (version 5.1). High-quality sequences were selected as those containing a median Q-score of more than 25 and trimmed with a cutoff of no more than 3 uncalled bases at the 3'-end or a Q-score of less than 16 for 3 consecutive bases. The sequences were then reassembled (using a standard of 85% or higher on a 35 bp segment) to generate a possible complete PEDV genome for each strain. Each possible complete genome sequence was then verified by template-based alignment to verify single nucleotide polymorphisms (SNPs) or variable small insertions / deletions.

[0141] For sample 1251-125-10, after trimming low-quality data, a total of 570,253 sequences were generated with an average length of 136 bp. Of those sequences; 484,247 (84.9%) were assembled into a single contig of 27,995 bp long, which showed high identity to the single-stranded RNA alphacoronavirus PEDV by BLASTn analysis. A total of 11 positions showed polymorphisms at single nucleotides or small insertions / deletions, which are listed in Table 1.

[0142] Table 1: Polymorphic residues in isolate 1251-125-10 "125-10"

[0143]

[0144] The possible complete / near complete PEDV genome of 1251-125-10 (SEQ ID NO: 1) was aligned with the closest Chinese AH2012 (GenBank Accession No.: KC210145) and North American Colorado 2013 isolates (GenBank Accession No.: AGO58924) of PEDV (see Figure 1 and Figure 2 ). The identity with both isolates exceeded 99.2%, indicating a very close relationship with both strains (both belonging to genotype 2a).

[0145] Next, the immunogenic spike protein sequences were examined for protein identity / similarity to the larger GenBank repository of PEDV spike proteins. Again, the closest GenBank isolate submitted was derived from the North American Colorado 2013 strain deposited at the University of Minnesota Veterinary Diagnostic Laboratory (GenBank Accession No.: AGO58924), exhibiting greater than 99.5% identity (1380 / 1386 identical amino acids) ( Figure 3 ). Of the 6 amino acid changes, 1 is due to a polymorphism at position 23,101, which encodes CGA (Arg) in most cases or CAA (Gln) in a small part at position 838. The North American Colorado 2013 strain contains Gln at this position.

[0146] Example 3: Method for monitoring virus inactivation

[0147] Each batch of PEDV virus or pool was tested for inactivation by passaging in Vero cells. 75cm 2 A 24-hour cell culture was inoculated with 2.0 mL of inactivated PEDV solution and kept at 36 ± 3 ° C for 48 hours. One flask of Vero cells remained uninoculated. As a positive virus control, one Vero cell culture was inoculated with the positive control PEDV. At the end of the incubation period, the cell monolayer was checked for CPE typical of PEDV. The material was frozen and thawed three times, and then 2 ml of each material was inoculated into one-day-old Vero cells. The culture should be kept at 37 ± 2 ° C for 48 hours. After the second passage, a third passage was performed. After incubation and passage, the absence of virus-infected cells in the BEI-treated virus solution (determined by the absence of immunofluorescence staining) constitutes a satisfactory inactivation test. Control cells inoculated with the positive control virus should show CPE typical of PEDV, while uninoculated flasks will not show evidence of PEDV CPE.

[0148] Example 4: Construction of recombinant baculovirus encoding and expressing PEDV spike antigen

[0149] BaculoDisplay-Spike antigens were generated in insect cells by recombinant baculovirus expressing modified PEDV spike protein. Briefly, a nucleic acid sequence (SEQ ID NO: 2) encoding PEDV spike protein (SEQ ID NO: 3) was cloned from a diagnostic sample using specific primers (forward primer: SEQ ID NO: 4 and reverse primer: SEQ ID NO: 5). The cloned PEDV spike coding sequence was modified to remove the PEDV spike signal peptide, transmembrane domain, and c-terminal domain (SEQ ID NO: 6). These domains were replaced with equivalent domains from vesicular stomatitis virus G protein (VSVG) by overlap extension PCR. The VSVG-PEDVS-VSVG coding sequence (SEQ ID NO: 8) was transferred to a baculovirus transfer vector (pVL1393) using complementary restriction sites. The pVL1393 vector expressing the VSVG-PEDV-VSVG spike coding sequence of the engineered spike protein (SEQ ID NO: 9) was used to co-transfect Sf9 insect cells with FlashBAC ULTRA baculovirus DNA. The recombinant baculovirus was amplified and examined for PEDV spike protein expression by IFA and Western blotting (using PEDV-specific serum). The PEDV spike protein was shown to co-pellet with the baculovirus particles after a centrifugation step at 100,000 g, indicating that it was associated with the baculovirus.

[0150] Example 5: Preparation of a pharmaceutical composition (vaccine) containing PEDV spike antigen

[0151] For inactivated PEDV material, PEDV virus harvests were inactivated using 5 mM BEI for a minimum of 24 hours, clarified and filtered through 0.45 μm.

[0152] After neutralization, various adjuvants were added and the following vaccine / drug compositions were produced.

[0153] Example 6: Vaccination of pigs with inactivated PEDV and baculovirus spike vaccines and evaluation of serological responses

[0154] The purpose of this study was to demonstrate the immunogenicity of inactivated PEDV virus for protection of vaccinated pigs. The vaccine used in this study included inactivated PEDV and BaculoDisplay-Spike (Baculo-S) protein constructs. Both the inactivated PEDV vaccine and the BaculoDisplay-Spike (Baculo-S) protein vaccine were used. Adjuvantation. Previous challenge studies have shown a strong positive correlation between clinical protection and IgA and IgG responses measured in the blood 21 days after challenge with PEDV (De Arriba et al. 2002). Therefore, the serological response of each prototype vaccine was evaluated by IgG and IgA ELISA analysis. In addition, virus neutralization assays were completed on sera.

[0155] Experimental design :The experiment was designed to evaluate the serological response to two prototype PEDV vaccines.

[0156] 18 pigs (28±7 days old at D-1) were randomized to three treatment groups (see Table 2) and housed in a single room during this study. Animals were immunized intramuscularly with placebo or one or more PEDV prototype vaccines at D0, 14 and 28. Pigs were monitored daily for clinical signs from D0 to D49. Rectal temperature and injection site were monitored from D0-D4, D14-18, and D28-D32 to evaluate the safety of the vaccine. Feces, oral and nasal swabs, and serum were taken from piglets at D-1, 3, 14, 17, 28, 31 and 49. Serum samples taken at D-1, 14, 28 and 49 were screened for anti-PEDV-IgG by ELISA and for the presence of neutralizing antibodies by FFN assay. Fecal samples and serum collected at D-1, D3, 17 and 31 were evaluated by PCR to confirm that neither prototype could replicate in pigs. Fecal samples from D14, 28 and 49 were stored at -70°C for possible future evaluation. On D49, the animals were humanely sacrificed and necropsy was performed.

[0157] Table 2. Summary of experimental design

[0158]

[0159] Prototype vaccineTable 4a and b describe the prototype vaccine. For placebo treatment, 2 ml of product PBS was administered. In insect cells, the BaculoDisplay-spike antigen was generated by recombinant baculovirus expressing the modified PEDV spike protein. In brief, the coding sequence encoding the PEDV spike protein was cloned from the diagnostic sample using specific primers. The cloned PEDV spike coding sequence was modified to remove the PEDV spike signal peptide, transmembrane domain, and c-terminal domain (SEQ ID NO: 7). These domains were replaced by equivalent domains from vesicular stomatitis virus G protein (VSVG) by overlapping extension PCR (SEQ ID NO: 8). The VSVG-PEDVS-VSVG coding sequence was transferred to a baculovirus transfer vector (pVL1393) using complementary restriction sites. The pVL1393 vector containing the VSVG-PEDV-VSVG spike coding sequence was used to co-transfect Sf9 insect cells with FlashBAC ULTRA baculovirus DNA. Recombinant baculoviruses were amplified and examined for PEDV spike protein expression by IFA and Western blot (using PEDV-specific serum). The PEDV spike protein was shown to co-sediment with baculovirus particles after a centrifugation step at 100,000 g, indicating that it was associated with the baculovirus. For the inactivated PEDV material, the PEDV virus pool was inactivated for 24 hours using 5 mM BEI, clarified and filtered through 0.45 μm.

[0160] Table 4a. Summary of PEDV prototype vaccine materials – inactivated virus pool

[0161]

[0162] Table 4b. Summary of PEDV prototype vaccine materials – BaculoDisplay-Spike

[0163]

[0164] PEDV vaccination : The researchers or designers administered vaccine materials to all pigs on D0, 14, and 28. Each pig received 2 ml of BEI inactivated PEDV vaccine, 1 ml of BaculoDisplay-Spike prototype, or 2 ml of placebo (intramuscularly, using a sterile needle and syringe appropriate for their age). Vaccines were administered to the right neck muscle tissue on D0 and D28 and to the left neck muscle tissue on D14.

[0165] Tissue collectionPigs were evaluated for macroscopic lesions. Abnormalities were recorded on the necropsy form. Fresh samples of small intestine and colon and fixed sections of lung, heart, spleen, kidney, small intestine, colon, and liver were collected. Fresh samples were stored at BIVI-Ames-70°C for a minimum of 6 months after completion of this study. Fixed sections were stored at BIVI-Ames room temperature for a minimum of 6 months after completion of this study.

[0166] Virus assay :PEDVRT-PCR: Samples were screened by RT-PCR as described in Table 3. A quantitative one-step RT-PCR kit (ISCRIPT TM One-Step RT-PCR kit for probes; BioRad, cat No. 170-8895) was used to perform the assay. The sequence information of primers, probes and Ultramer are as follows: PEDV-qPCR-probe, 5'-6-FAM / ACAGAGCCTGTGTTGGTGTATAGTAACAT-3'BHQ_1 (SEQ ID NO: 16); PEDV-qPCR-F, 5'-TATAGTGGGTGTTATTTCTAGTT-3' (SEQ ID NO: 17); PEDV-qPCR-R, 5'-GCCAATACTGCCAGATTTACA-3' (SEQ ID NO: 18), PEDV-ultramer, 5'-TGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGGGAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTATAGTAACATAGGTGTTTGTAAATCTGGCAGTATTGGCTATGTCCCAT-3' (SEQ ID NO: 19). Real-time RT-PCR was performed in a 25 μl reaction containing 2 μl of total extracted nucleic acid, 0.75 μl of probe (4 μM), 0.5 μl of each primer (10 μM), 12.5 μl of 2X RT-PCR mix, 0.5 μl of ISCRIPT TMReverse transcriptase and 8.25 μl of DEPC-treated water. Use CFX96 real-time PCR detection (BioRad) to react under the following conditions: 30 min of initial reverse transcription at 50 ° C, followed by 5 min of initial denaturation at 95 ° C, 15 s of denaturation at 95 ° C for 40 cycles and annealing and extension at 57 ° C for 30 s. Use CFX Manager software (version 2.1, BioRad) to analyze optical data. For each determination, the threshold line is automatically calculated using the regression setting of the cycle threshold (Ct) determination mode. The baseline subtraction is automatically completed using the baseline subtraction mode. The curve with a baseline final value lower than 10 is manually associated. The sample is carried out in a single reaction and the standard curve based on Ultramer is used to determine the quantitative amount and is reported as the number of genome copies per microliter (gc / μl). The sample not detected after 40 cycles is considered to be negative.

[0167] Anti-PEDV-IgG ELISA : The samples were screened by ELISA as described in Table 3. For the assay, the plates were coated with 4 ng / μl of PEDV-1251-125-2 at 37°C for one hour. After washing, the wells were coated with 100 μl of a 1:100 diluted serum sample (for IgG assay) and incubated at 37°C for one hour. After washing, the wells were blocked with 0.05% fat-free milk and incubated at 37°C for one hour. After washing, the wells were coated with 100 μl of a 1:10,000 diluted horseradish peroxidase (HRP)-conjugated-goat-anti-swine-IgG and incubated at 37°C for one hour. After washing, the plates were extended with 3,5,3',5'-tetramethylbenzidine for 5 minutes and the reaction was stopped with 2M H2SO4 before measuring the optical density (OD) at 450 nm. The samples were run in duplicate wells and the results were reported as the average sample to positive (S:P) ratio. Because cutoff values ​​for positive versus negative interpretations of the ELISA have not been generated, samples with an S:P ratio greater than the sum of the two higher standard deviations plus the highest control group mean were considered positive (S:P ratio > 0.28 or > 0.16 for IgG assays).

[0168] PEDV fluorescence focusing assay :PEDV FFN assay runs consisted of duplicate serum dilution series, screened in a 96-well plate format using a virus neutralization assay of a cell culture-adapted PEDV strain. Titers were reported as the maximum serum dilution that showed a 90% reduction in fluorescent focus compared to the negative control. For each sample, duplicate well titers were averaged.

[0169] Statistical analysis of data: Data analysis was performed by monitors using JMP 9.0.3 (SAS Institute, Inc., Cary, North Carolina, USA). For all analyses, p-values ​​below 0.05 were considered significant. For repeated measures of data (serology), multivariate analysis of variance was performed (using time as a repeated variable in the model). If a significant p-value was noted, one-way ANOVA was performed using group as an independent factor; separate analyses were performed every day. If a significant p-value was noted; paired differences between group means were assessed using Wilcoxon adjusted paired comparisons.

[0170] Serology: PEDV fluorescent focus neutralization (FFN) assay: Results for individual animals are shown in Table 5. All animals in the BEI-VH group showed a four-fold increase in neutralization titers, while only two of the seven animals in Group 2 had a similar response. Control animals had no detectable neutralization titers.

[0171] Table 5. PEDV fluorescent focus neutralization assay results for studies D-1, 14, 28, and 49. Underlined cells indicate titers greater than 0

[0172]

[0173] Anti-PEDV-IgG ELISA The sample-to-positive (S:P) ratios for individual animals are listed in Table 6 below. All animals in Group 1 (BEI-VH) had detectable IgG responses at D28 that were at least two standard deviations above the mean S:P ratio for the control group. In contrast, only two animals in Group 2 (Baculo-S) had detectable IgG responses and only after receiving three doses of vaccine. The group least squares S:P ratios ± standard errors were 9.8 ± 1.3 (range, 1-2). Figure 4 At D28, animals in Group 1 (BEI-VH) had significantly higher S:P ratios compared to Groups 2 and 3 (p<0.01, Wilcoxon adjusted pairwise comparisons).

[0174] Table 6. Individual anti-PEDV-IgG S:P ratios at D-1, 14, 28 and 49.

[0175] The highlighted values ​​indicate that the S:P ratio is at least two standard deviations higher than the S:P ratio of the control group D49

[0176]

[0177] PEDV viremia / sheddingTo assess the potential for shedding and viremia after vaccination, serum and fecal samples were screened for the presence of PEDV RNA by RT-PCR on day 4 after immunization (D3, D18, and D31). PEDV RNA was not detected in any sample.

[0178] in conclusion Based on the serological data (IgG and FFN) from the above studies, the three doses of PEDV spike protein expressed by the BacuoloDisplay method, with 866 μg per dose and Adjuvantation does not produce a consistent serological response. In this case, the lack of a response indicates that the vaccine is not immunogenic enough (i.e., the protein is not delivered in sufficient quantities or an inappropriate adjuvant is used) or that the recombinant spike protein is not confirmed to be similar to the wild-type virus.

[0179] In contrast, the anti-PEDV IgG and FFN serology data did not suggest that two or three doses of the BEI inactivated PEDV virus pool (given at 5.6 log / dose and tested) would be sufficient to Adjuvanted) was able to consistently elicit serological responses in young pigs. However, the mean anti-PEDV-IgG S:P ratio in vaccinated animals was lower compared to animals administered the feedback material. Specifically, in 45 animals from one herd that was administered the feedback material prior to sampling, the mean anti-PEDV-IgG S:P ratio (± standard deviation) was found to be 0.90±0.20, compared to 0.69±0.12 in vaccinated animals (data not shown). Additionally, through personal communication with Dr. Eric Nelson, five of the seven vaccinated animals in this study had FFN titers that were lower than those typically seen after feedback administration.

[0180] Example 7: Efficacy of BEI-inactivated PEDV (three doses, various adjuvants)

[0181] (Research 2013131) Troy Kaiser

[0182] The following study evaluated whether vaccination with three 2-mL doses of an inactivated PEDV vaccine, when administered to three-week-old pigs at 14-day intervals, could elicit an immune response. The primary outcome was serology by fluorescent focus neutralization (FFN) testing.

[0183] Study groups included: T01 = PBS (n = 10); T02 = 6.04 log TCID 50 / ml BEI PEDV+20% (n=18); T03=6.04 log TCID 50 / ml BEI PEDV+10% (n=20); T04=6.04log TCID 50 / ml BEI PEDV+15% T05 = 6.04 logTCID 50 / ml BEI PEDV + 5% S:P oil (n=20).

[0184] Table 7. Vaccine formulations and controls

[0185]

[0186] At D0, 2-mL of the treatment was administered intramuscularly in the right neck of the pigs. The second treatment was administered in the left neck at D14, and the third treatment was administered in the right neck for all groups at D28. Blood samples were collected at D-1, D13, D27, D42, and D49. Serum was tested for PEDV neutralizing antibodies using FFN.

[0187] Serology : Seroconversion occurred in 11.2% of pigs after two vaccinations, while 55.6% of pigs seroconverted after three administrations of PEDV vaccine (adjuvanted with 20% Emulsigen BCL) (T02; Table 8). The geometric mean titer of seropositive pigs ≥ 1:20 in all treatment groups is given in Table 8 below. The titer frequency distribution of all pigs according to treatment group is given in Table 9.

[0188] Table 8. Serological response of pigs according to the proportion of seropositive pigs and geometric mean titers of the group

[0189] Group Pigs with ≥1:20 response Geometric mean titer T01 0 / 10(0％) not applicable T02 10 / 18(55.6％) 1 T03 6 / 20(30％) 1 T04 2 / 20(10％) 1 T05 2 / 20(10％) 1

[0190] Table 9. Frequency distribution of titers by group

[0191]

[0192]

[0193] *Maximum potency at D42 or D49

[0194] in conclusion : Seroconversion occurred in 11.2% of T02 pigs after two doses, and in 55.6% of pigs when vaccinated three times with the experimental vaccine, which was formulated at 6.04 log10 TCID50 / mLPEDV, inactivated with diethyleneimine, and adjuvanted with 20% Emulsigen BCL. The data collected in this study indicate that this experimental vaccine elicits an immune response that supports reasonable efficacy expectations.

[0195] Example 8: Efficacy of baculovirus vaccines (two doses, various adjuvants)

[0196] Research 2014236Kara Claxton

[0197] The following study evaluated the serological response to vaccination with two 2-mL doses of an inactivated porcine epidemic diarrhea virus (PEDV) vaccine, or a baculovirus construct vaccine (measured after administration of the vaccine to three-week-old pigs). The primary outcome was serology by fluorescence focus neutralization (FFN) testing (for serum samples collected from treated pigs after vaccination).

[0198] Study groups included: T01 = PBS (n = 10); T02 = 6.93 log TCID 50 / ml BEI PEDV+20% (n=20); T03 = baculovirus with PEDV spike Ag (n=9); 6x concentrated baculovirus with PEDV spike Ag (n=10); trypsin baculovirus with PEDV spike Ag (n=10); and conditionally licensed inactivated positive control vaccine (POS CON) (n=10). On D0, 2-mL of the treatment was administered intramuscularly in the right neck of the pigs. The second treatment was administered to T01-T05 in the left neck on D14 and T06 was administered on D21.

[0199] Table 10: Vaccine formulations and controls

[0200]

[0201] BEI = binary ethyleneimine

[0202] *PEDV spike signal sequence and C-terminal tail were replaced by the equivalent of baculovirus gp64. Recombinant PEDv Spike-Display baculovirus was produced in insect cells. Infected cultures were collected and clarified by centrifugation and 0.2-μm filtration. The clarified pool material was inactivated with 5 mM BEI at 37°C for 72 hours, followed by centrifugation and 0.2-μm filtration.

[0203] SerologyPost-vaccination seroconversion (D28 & D35) occurred in 20% of pigs vaccinated with PEDv vaccine (adjuvanted with 20% Emulsigen BCL) (T02; Table 11) and 60% of pigs vaccinated with trypsin-incubated PEDV spike-baculovirus (T05; Table 11). The geometric mean titers of seropositive pigs ≥ 1:20 in all treatment groups are given in Table 11. The titer frequency distribution of all pigs according to treatment group is given in Table 12.

[0204] Table 11: Serological response of pigs according to the proportion of seropositive pigs and geometric mean titer of the group

[0205] Group Pigs with ≥1:20 response Geometric mean titer T01 0 / 10(0％) not applicable T02 4 / 20(20％) 1:30.7 T03 0 / 9(0％) not applicable T04 0 / 10(0％) not applicable T05 6 / 10(60％) 1:35.5 T06 7 / 10(70％) 1:41.9

[0206] Table 12: Titer frequency distribution by group

[0207]

[0208] Conclusion: Seroconversion occurred in 20% of T02 pigs after two administrations of the experimental vaccine, which was formulated at 6.93 log10 TCID50 / mL, PEDV inactivated with BEI, and adjuvanted with 20% Emulsigen BCL. Seroconversion occurred in 60% of T05 pigs after two administrations of the experimental recombinant trypsin-raised baculovirus vaccine (formulated with PEDV spike glycoprotein).

[0209] Example 9: Efficacy Study

[0210] POC Effectiveness (Research 2014030) Abby Patterson

[0211] The following study was designed to evaluate the efficacy of inactivated and other prototype vaccines in sows. The primary outcome parameter was piglet mortality after challenge with porcine epidemic diarrhea virus (PEDV). The secondary outcome parameter was dam serology. Other parameters measured included: clinical signs (including ISL) in sows after vaccination; PEDV shedding in sows after vaccination (via qRT-PCR); clinical signs in piglets; and PEDV serology in piglets.

[0212] Four weeks and two weeks before farrowing (D0 and D14), 2 mL of one of the following treatments was administered to each pregnant pig through three routes (intramuscular, intranasal and oral): T01 (negative control, NC) phosphate buffered saline; T02 (BEI-VH) adjuvanted with 20% Emulsigen BCL; T03 (strict control, SC) was used as an unvaccinated / unchallenged control. Eight animals were used in each group, except for T06, which used 4 animals. On D35 or D36, pigs were challenged orally with 1 mL of 2.0 log10 TCID50 / mL PEDV virus collection. Clinical signs (vomiting and diarrhea) of pregnant pigs and pigs were observed every day during the challenge phase. Serum was collected from pregnant pigs four weeks and two weeks before farrowing (D0 and D14), the day before the piglets were challenged (D34 or D35), and the day the test ended (D57).

[0213] The PEDV prototype vaccine was administered to sows at D0 and D14. At each vaccination, sows received a total of 6 mL of vaccine, of which 2 mL was administered by intramuscular, intranasal and oral routes. For the intramuscular route of administration, an injection of 2 mL was given into the muscle tissue under the ear of the neck. The neck site for administration was changed during the initial and booster vaccinations. For the oral route of administration, 2 ml was delivered to the caudal oropharynx using an 8 Fr polypropylene catheter (2.7 mm diameter, 254 mm long) attached to a syringe. For the intranasal route, 1 ml was injected into each nostril using a 4.5-inch catheter attached to a syringe.

[0214] Table 13: Experimental vaccines and control products

[0215]

[0216] Table 14: Attack Materials

[0217]

[0218] Vaccine Efficacy: Pig mortality: Pig mortality after challenge with virulent PEDV isolates was the primary outcome parameter for evaluating vaccine efficacy. A summary of group-based mortality during the challenge period is listed below. With 55% mortality in T01 (NC) and all pups affected, the challenge was considered sufficiently virulent. T02 (BEI-VH) demonstrated a numerical reduction in pig mortality compared to T01 (NC), with a PF (95% CI) of 0.20 (-0.550, 0.586). This reduction was not significant as the 95% CI (-0.550, 0.586) included 0.

[0219] Extra-binomial variation was evident in this study, resulting in wide confidence intervals for T02(BEI-VH) PF when the underlying binomial distribution was used. Mortality varied widely between pups in the groups, ranging from 0% to 100% for T02(BEI-VH).

[0220] Intestinal samples or intestinal contents were taken at necropsy and tested for PEDV antigen by qRT-PCR. Of the samples tested from animals during the peak mortality period, PEDV was detected in 55.5% of the samples.

[0221] Table 15:

[0222]

[0223]

[0224] *Based on the proportion of T01(NC) affected.

[0225] **NC = Not Calculated. T02 (BEI-VH) Possible confidence interval based on study design

[0226] Sow serology : Fluorescence Focus Neutralization (FFN) Assay: The FFN assay was used to assess the virus neutralization response of pregnant pigs after vaccination and challenge. The geometric mean titers listed based on the group are given below (for the date of blood collection from the sows).

[0227] After two doses of vaccine, 2 / 8 (25%) sows in T02 (BEI-VH) had detectable levels of neutralizing antibodies. Detectable levels of neutralizing antibodies were not observed in any other group.

[0228] After lateral exposure to PEDV, all sows in the exposed treatment groups had detectable levels of neutralizing antibodies. Animals in the T03 (SC) group remained seronegative throughout the trial. The geometric mean titers at D57 (approximately 21 days after exposure) indicated that vaccination resulted in quantitatively higher titers (compared to T01 (NC)). Sows in the T02 (BEI-VH) group had a GMT of 613, which was approximately three times higher than the GMT of 200 in sows in T01 (NC) (p=0.005). Since multiple samples in the T02 (BEI-VH) group had detectable neutralizing antibodies at the highest dilution tested (1:640), these results are likely to represent conservative estimates of differences between groups.

[0229] Table 16:

[0230]

[0231] When all values ​​were <20, the geometric mean titer was expressed as <20. Otherwise, values ​​<20 were set to 10**D57 for GMT calculations. GMTs for T01 (NC) and T02 (BEI-VH) are back-transformed least squares means.

[0232] Based on S1 ELISA data : An S1-based ELISA was used to evaluate the response of pregnant pigs to PEDV-spike protein after vaccination and challenge. The results of the assays for colostrum, milk, and serum are listed based on the group (for the date the samples were collected).

[0233] When pigs were challenged, sows in T02 (BEI-VH) had significantly higher geometric mean titers in serum compared to sows in T01 (NC) (p=0.0005). After exposure to PEDV, larger significant differences were noted between the two groups (p<0.0001).

[0234] No significant differences in the geometric mean titers of anti-PEDV IgA in colostrum and in milk were observed between T02 (BEI-VH) and T04 (NC).

[0235] Table 17:

[0236]

[0237] *GMT for T01(NC) and T02(BEI-VH) is the least squares mean of the back transformation

[0238] Swine Serology Serum was collected from pigs at necropsy to assess the presence of neutralizing antibodies. The following table gives the geometric mean FFN titer of the positive pigs based on the group. The table also includes the detection frequency (expressed as the number of pigs with a GMT greater than or equal to 20 versus the number of animals tested). All available samples were tested. Samples from many pigs could not be obtained due to the difference in time between death and necropsy.

[0239] Descriptive statistics for FFN titers by mortality status (death: yes / no) and group (overall) are listed in the table below. Overall, a similar proportion of pigs in the vaccinated groups seroconverted (or had maternal antibodies) regardless of the time of necropsy. However, in T01 (NC), a higher percentage of pigs that died before the end of the test had titers (88%) compared to pigs that survived the study (43%).

[0240] When looking at overall pig titers based on group, the mortality proportion estimate was negatively correlated with the overall group FFN percentage for T02(BEI-VH).

[0241] Table 18:

[0242] Group Pig (Death = Yes) Pig (death = no) overall Estimated mortality rate NC 55(28 / 32；88％) 33(9 / 21；43％) 63(37 / 53；59％) 0.55 BEI-VH 44(23 / 42；55％) 50(9 / 16；56％) 64(32 / 58；55％) 0.44

[0243] *GMT (number of animals with titers >20 / total number of pigs tested; percentage); note that sera were not obtained from all pigs

[0244] Clinical observations after challenge: Pig excrement score: The following lists the descriptive statistics of the abnormal period of excrement observed in pigs, based on group and mortality status (death: yes / no). Overall, the median period of abnormal scores of excrement in pigs with the same mortality rate is similar between groups. In dead or sacrificed animals, there is a shorter median period of abnormal scores of excrement in numbers. This trend is most obvious in T01 (NC) pigs, and may be due to the fact that most of these animals died within the first week after the attack.

[0245] Table 19:

[0246]

[0247] The severity of fecal scores in the pigs is summarized in the frequency table below. A high proportion of pigs (>91%) in all treatment groups gave a fecal score of 2 during at least one observation period post-challenge.

[0248] Table 20:

[0249]

[0250] in conclusion: A 20% reduction in pig mortality was observed in T02 (BEI-VH) compared to T01 (NC) group. Three routes of administration were attempted in this study. Although 3 routes were used, it was not expected that routes other than IM would contribute to the efficacy of T02 (BEI-VH) based on the adjuvant and vaccine formulation. Overall, inactivated PEDV (20% Adjuvanted) vaccine, with a minimum pre-inactivation titer of 6.04log TCID50 / ml, showed better immune response induction in piglets and sows. The preferred vaccination regimen is that the IM route of administration is used for 3-week-old or larger piglets, with three 2ml doses at 2-week intervals. Clinical signs in sows after vaccination are not observed in T02 (BEI-VH), and are limited in other treatment groups. The use of vaccination does not seem to affect the percentage of pigs born alive (data not shown).

[0251] Pregnant pig serology was evaluated as a secondary parameter by two separate assays (focused fluorescence neutralization, S1-based ELISA). Both assays showed a significant increase in titers in T02 (BEI-VH) after vaccination and exposure (compared to T01 (NC)). Due to known limitations of the FFN assay, samples were also tested with an S1-based ELISA. This ELISA was chosen because the S1 domain of the spike protein is expected to contain neutralizing epitopes.

[0252] After lateral exposure to PEDV, all animals in the re-exposed treatment groups had detectable levels of neutralizing antibodies. Sows in T02 (BEI-VH) had approximately three times higher titers compared to T01 (NC) animals. This suggests that the use of the vaccine stimulated an initial primary response and resulted in a greater secondary response after exposure to the challenge virus. Since multiple samples in the T02 (BEI-VH) group had detectable neutralizing antibodies at the highest dilution tested (1:640), these results likely represent a conservative estimate of the differences between the groups.

[0253] Table 21: Pig mortality and sow serology data are summarized as follows

[0254]

[0255] All compositions and methods disclosed and claimed herein can be prepared and performed on the basis of the present disclosure without excessive experimentation. Although the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be appreciated by those skilled in the art that the compositions and methods and the steps and the order of the steps in the methods described herein can be changed without departing from the concept, spirit and scope of the present invention. More specifically, certain chemically and physiologically related substances can obviously be used to replace the substances described herein while achieving the same or similar results. All such similar substitutions and modifications known to those skilled in the art are considered to be within the spirit, scope and concept of the present invention as defined by the appended claims.

[0256] This article contains the following scenarios:

[0257] 1. A vaccine comprising one or more antigens of porcine epidemic diarrhea virus (PEDV) genotype 2a.

[0258] 2. The vaccine of claim 1, wherein the porcine epidemic diarrhea virus (PEDV) is of North American origin.

[0259] 3. The vaccine of claim 2, wherein the North American genotype of porcine epidemic diarrhea virus (PEDV) is any PEDV:

[0260] (a) which is encoded by SEQ ID NO: 1, and / or comprises the sequence of SEQ ID NO: 1 and / or comprises the RNA equivalent of SEQ ID NO: 1;

[0261] (b) whose sequence is at least 99% identical to SEQ ID NO: 1 and / or is at least 99% identical to the RNA equivalent of SEQ ID NO: 1;

[0262] (c) the spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13;

[0263] (d) its spike protein is encoded by a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2, 6, 8, or 13;

[0264] (e) which is encoded by SEQ ID NO: 15; or

[0265] (f) whose sequence is at least 99% identical to SEQ ID NO:15.

[0266] 4. The vaccine of scheme 1, wherein the vaccine is a recombinant vaccine or an inactivated vaccine.

[0267] 5. The vaccine of claim 1, wherein the vaccine is an inactivated vaccine.

[0268] 6. The vaccine of claim 5, wherein the porcine epidemic diarrhea virus (PEDV) is any PEDV:

[0269] (a) which is encoded by SEQ ID NO: 1 and / or comprises the sequence of SEQ ID NO: 1, and / or comprises the RNA equivalent of SEQ ID NO: 1;

[0270] (b) whose sequence is at least 99% identical to SEQ ID NO: 1, and / or is at least 99% identical to the RNA equivalent of SEQ ID NO: 1;

[0271] (c) the spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13;

[0272] (d) its spike protein is encoded by a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2, 6, 8, or 13;

[0273] (e) which is encoded by SEQ ID NO: 15; and / or

[0274] (f) whose sequence is at least 99% identical to SEQ ID NO:15.

[0275] 7. The vaccine of claim 5, wherein the porcine epidemic diarrhea virus (PEDV) is chemically inactivated.

[0276] 8. The vaccine of claim 7, wherein the porcine epidemic diarrhea virus (PEDV) is chemically inactivated by treatment with a chemical inactivator comprising a compound selected from the group consisting of ethyleneimine, diethyleneimine, acetylethyleneimine, and mixtures thereof.

[0277] 9. The vaccine of claim 8, wherein the porcine epidemic diarrhea virus (PEDV) is chemically inactivated by treatment with diethyleneimine.

[0278] 10. The vaccine of claim 5, wherein the vaccine further comprises an adjuvant.

[0279] 11. The vaccine of claim 10, wherein the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0280] 12. The vaccine of claim 6, wherein the porcine epidemic diarrhea virus (PEDV) comprises SEQ ID NO: 1, and / or comprises an RNA equivalent of SEQ ID NO: 1.

[0281] 13. The vaccine of claim 4, wherein the vaccine is a recombinant vaccine.

[0282] 14. The vaccine of claim 13, wherein the recombinant vaccine comprises one or more immunogenic components selected from the following groups:

[0283] (a) an isolated nucleic acid encoding an antigen of a porcine epidemic diarrhea virus (PEDV) spike protein, wherein the recombinant spike polypeptide has at least 90% homology to SEQ ID NO: 3, 7, 9 or 14;

[0284] (b) a vector comprising the isolated nucleic acid of a);

[0285] (c) a recombinant PEDV spike protein encoded by the nucleic acid of a); and

[0286] (d) any combination thereof.

[0287] 15. The vaccine of claim 13, wherein the vaccine comprises a pharmaceutically acceptable carrier and / or excipient.

[0288] 16. The vaccine of claim 15, wherein the excipient is one or more adjuvants.

[0289] 17. The vaccine of claim 16, wherein the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0290] 18. The vaccine of claim 13, wherein the vaccine further comprises one or more additional antigens.

[0291] 19. The vaccine of claim 18, wherein the additional antigen is structural protein M, E, or N of porcine epidemic diarrhea virus (PEDV).

[0292] 20. The vaccine of claim 14, wherein the immunogenic component is the isolated nucleic acid.

[0293] 21. The vaccine of claim 14, wherein the immunogenic component is the carrier.

[0294] 22. The vaccine of claim 14, wherein the immunogenic component is a recombinant porcine epidemic diarrhea virus (PEDV) spike protein.

[0295] 23. The vaccine of claim 14, wherein the immunogenic component is a combination.

[0296] 24. A method of protecting a pig from porcine epidemic diarrhea virus (PEDV)-related disease comprising administering the vaccine of Scheme 1 to the pig.

[0297] 25. A method of protecting a pig from porcine epidemic diarrhea virus (PEDV)-related disease comprising administering the vaccine of regimen 5 to the pig.

[0298] 26. A method of protecting a pig from porcine epidemic diarrhea virus (PEDV)-related disease comprising administering the vaccine of regimen 13 to the pig.

[0299] 27. The method of claim 24, wherein the vaccine comprises one or more immunogenic components selected from the group consisting of:

[0300] (a) which is encoded by SEQ ID NO: 1, and / or comprises the sequence of SEQ ID NO: 1, and / or comprises the RNA equivalent of SEQ ID NO: 1;

[0301] (b) whose sequence is at least 99% identical to SEQ ID NO: 1, and / or is at least 99% identical to the RNA equivalent of SEQ ID NO: 1;

[0302] (c) the spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13;

[0303] (d) its spike protein is encoded by a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2, 6, 8, or 13;

[0304] (e) which is encoded by SEQ ID NO: 15; and

[0305] (f) whose sequence is at least 99% identical to SEQ ID NO:15.

[0306] 28. The method of claim 25, wherein the vaccine comprises one or more immunogenic components selected from the group consisting of:

[0307] (a) which is encoded by the sequence of SEQ ID NO: 1 or comprises the sequence of SEQ ID NO: 1;

[0308] (b) whose sequence is at least 99% identical to SEQ ID NO: 1;

[0309] (c) whose spike protein is encoded by the nucleic acid sequence of SEQ ID NO: 2, 6, 8, or 13; and

[0310] (d) its spike protein is encoded by a nucleic acid sequence that is at least 90% identical to SEQ ID NO:2, 6, 8, or 13.

[0311] 29. The method of claim 26, wherein the recombinant vaccine comprises one or more immunogenic components selected from the group consisting of:

[0312] (a) an isolated nucleic acid encoding an antigen of a porcine epidemic diarrhea virus (PEDV) spike protein, wherein the recombinant spike polypeptide has at least 90% homology to SEQ ID NO: 3, 7, 9 or 14;

[0313] (b) a vector comprising the isolated nucleic acid of a);

[0314] (c) a recombinant PEDV spike protein encoded by the nucleic acid of a); and

[0315] (d) any combination thereof.

[0316] 30. A kit for vaccinating pigs against porcine epidemic diarrhea virus (PEDV)-related diseases, comprising:

[0317] (a) a dispenser capable of administering the vaccine to pigs; and

[0318] (b) Vaccine of Scheme 1.

[0319] 31. A kit for vaccinating pigs against porcine epidemic diarrhea virus (PEDV)-related diseases, comprising:

[0320] (a) a dispenser capable of administering the vaccine to pigs; and

[0321] (b) Vaccine of Scheme 5.

[0322] 32. A kit for vaccinating pigs against porcine epidemic diarrhea virus (PEDV)-related diseases, comprising:

[0323] (a) a dispenser capable of administering the vaccine to pigs; and

[0324] (b) Vaccine of Scheme 13.

[0325] 33. A method for producing a porcine epidemic diarrhea vaccine according to Scheme 5, comprising:

[0326] (a) inoculating simian cells with porcine epidemic diarrhea virus (PEDV);

[0327] (b) incubating the inoculated simian cells;

[0328] (c) collecting porcine epidemic diarrhea virus (PEDV) from the incubated cells; and

[0329] (d) treating the collected cells with a chemical inactivation agent, preferably with a compound selected from the following group: ethyleneimine, diethyleneimine, acetylethyleneimine or a mixture thereof, to form an inactivated PEDV vaccine.

[0330] 34. The method of claim 33, wherein the porcine epidemic diarrhea virus (PEDV) comprises:

[0331] (a) a sequence encoded by or comprising the sequence of SEQ ID NO: 1;

[0332] (b) a sequence that is at least 99% identical to SEQ ID NO: 1;

[0333] (c) a spike protein encoded by SEQ ID NO: 2, 6, 8, or 13;

[0334] (d) a spike protein encoded by a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2, 6, 8, or 13.

[0335] 35. The method of claim 34, wherein the porcine epidemic diarrhea virus (PEDV) of genetic group 2a comprises SEQ ID NO: 1 and / or an RNA equivalent of SEQ ID NO: 1.

[0336] 36. The method of claim 33, wherein the simian cells are Vero cells.

[0337] 37. The method of claim 33, wherein the chemical inactivator comprises diethyleneimine.

[0338] 38. The method of claim 33, further comprising adding an adjuvant to the porcine epidemic diarrhea virus (PEDV) vaccine.

[0339] 39. The method of scheme 38, further comprising adding an adjuvant to the porcine epidemic diarrhea virus (PEDV) vaccine, wherein the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0340] 40. A method for producing a recombinant vaccine according to claim 13, comprising:

[0341] (a) expressing one or more antigens of porcine epidemic diarrhea virus (PEDV) in a host cell; and

[0342] (b) collecting the one or more antigens from porcine epidemic diarrhea virus (PEDV) cells.

[0343] 41. The method of claim 40, wherein the one or more antigens comprise:

[0344] (a) an isolated nucleic acid encoding an antigen of a porcine epidemic diarrhea virus (PEDV) spike protein, wherein the recombinant spike polypeptide has at least 90% homology to SEQ ID NO: 3, 7, 9 or 14;

[0345] (b) a vector comprising the isolated nucleic acid of a);

[0346] (c) a recombinant PEDV spike protein encoded by the nucleic acid of a); and

[0347] (b) any combination thereof.

[0348] 42. The method of claim 40, wherein one or more recombinant antigens of porcine epidemic diarrhea virus (PEDV) are expressed by a recombinant baculovirus vector.

[0349] 43. The method of claim 42, wherein one or more recombinant antigens of porcine epidemic diarrhea virus (PEDV) are expressed by insect cells.

[0350] 44. The method of claim 43, further comprising adding an adjuvant to the porcine epidemic diarrhea virus (PEDV) vaccine.

[0351] 45. The method of scheme 44, further comprising adding an adjuvant to the porcine epidemic diarrhea virus (PEDV) vaccine, wherein the adjuvant is based on Adjuvants for oil-in-water emulsions.

[0352] 46. ​​The vaccine of claim 1, wherein the one or more antigens of porcine epidemic diarrhea virus (PEDV) of genotype 2 is porcine epidemic diarrhea virus (PEDV) of genotype 2a.

[0353] 47. One or more antigens of porcine epidemic diarrhea virus (PEDV) of genotype 2a for use as medicine, wherein the one or more antigens of PEDV are preferably selected from the following groups: PEDV of genotype 2a, wherein the PEDV is optionally the PEDV of any one of schemes 2, 3 or 6-9; one or more immunogenic components of PEDV of genotype 2a, wherein the one or more immunogenic components of PEDV are optionally one or more immunogenic components of any one of schemes 27-29 or 46.

[0354] 48. The vaccine of any one of schemes 1-23 or 46, for use in a method of protecting pigs from porcine epidemic diarrhea virus (PEDV)-related diseases.

[0355] 49. Use of one or more antigens of porcine epidemic diarrhea virus (PEDV) of genotype 2a for the preparation of a medicament for protecting pigs from porcine epidemic diarrhea virus (PEDV)-related diseases, wherein the one or more antigens of PEDV are preferably selected from the following groups: PEDV of genotype 2a, wherein the PEDV is optionally the PEDV of any one of Schemes 2, 3 or 6-9; one or more immunogenic components of PEDV of genotype 2a, wherein the one or more immunogenic components of PEDV are optionally one or more immunogenic components of Schemes 27-29 or 46.

[0356] The following references, to the extent they provide exemplary procedural or other details supplementary to those set forth herein, are expressly incorporated herein by reference.

[0357] 1. Bridgen A, Duarte M, Tobler K, Laude H, Ackermann M. 1993. Sequencedetermination of the nucleocapsid protein gene of the porcine epidemiciarrhoea virus confirms that this virus is a coronavirus related to humancoronavirus 229E and porcine transmissible gastroenteritisvirus. J.Gen.Virol.74(Pt 9):1795–1804.

[0358] 2.Duarte M,Gelfi J,Lambert P,Rasschaert D,Laude H.1993.Genomeorganization of porcine epidemic diarrhoea virus.Adv.Exp.Med.Biol.342:55–60

[0359] 3.Tobler K,Bridgen A,Ackermann M.1993.Sequence analysis of thenucleocapsid protein gene of porcine epidemic diarrhoeavirus.Adv.Exp.Med.Biol.342:49–54.

[0360] 4.Oldham J.1972.Letter to the editor.Pig Farming 1972(October suppl):72–73.

[0361] 5.Pensaert MB,de Bouck P.1978.A new coronavirus-like particleassociated with diarrhea in swine.Arch.Virol.58:243–247.

[0362] 6.Chen JF,Sun DB,Wang CB,Shi HY,Cui XC,Liu SW,Qiu HJ,FengL.2008.Molecular characterization and phylogenetic analysis of membraneprotein genes of porcine epidemic diarrhea virus isolates in China.VirusGenes 36:355–364.

[0363] 7.Nagy B,Nagy G,Meder M,Mocsári E.1996.Enterotoxigenic Escherichiacoli,rotavirus,porcine epidemic diarrhoea virus,adenovirus and calici-likevirus in porcine postweaning diarrhoea in Hungary.Acta Vet.Hung.44:9–19.

[0364] 8.Martelli P,Lavazza A,Nigrelli AD,Merialdi G,Alborali LG,PensaertMB.2008.Epidemic of diarrhoea caused by porcine epidemic diarrhoea virus inItaly.Vet.Rec.162:307–310.

[0365] 9.Takahashi K,Okada K,Ohshima K.1983.An outbreak of swine diarrhea ofa new-type associated with coronavirus-like particles in Japan.Nippon JuigakuZasshi 45:829–832.

[0366] 10.Chae C,Kim O,Choi C,Min K,Cho WS,Kim J,Tai JH.2000.Prevalence ofporcine epidemic diarrhoea virus and transmissible gastroenteritis virusinfection in Korean pigs.Vet.Rec.147:606–608

[0367] 11.Puranaveja S,Poolperm P,Lertwatcharasarakul P,Kesdaengsakonwut S,Boonsoongnern A,Urairong K,Kitikoon P,Choojai P,Kedkovid R,Teankum K,Thanawongnuwech R.2009.Chinese-like strain of porcine epidemic diarrheavirus,Thailand.Emerg.Infect.Dis.15:1112–1115.

[0368] 12.Stevenson GW,Hoang H,Schwartz KJ,Burrough ER,Sun D,Madson D,CooperVL,Pillatzki A,Gauger P,Schmitt BJ,Koster LG,Killian ML,YoonKJ.2013.Emergence of porcine epidemic diarrhea virus in the United States:clinical signs,lesions,and viral genomic sequences.J.Vet.Diagn.Invest.25:649–654.

[0369] 13.Kim SH,Kim IJ,Pyo HM,Tark DS,Song JY,Hyun BH.2007.Multiplex real-time RT-PCR for the simultaneous detection and quantification oftransmissible gastroenteritis virus and porcine epidemic diarrheavirus.J.Virol.Methods 146:172–177.

[0370] 14.Hofmann M,Wyler R.1988.Propagation of the virus of porcineepidemic diarrhea in cell culture.J.Clin.Microbiol.26:2235–2239.

[0371] 15.Marthaler D,Jiang Y,Otterson T,Goyal S,Rossow K,CollinsJ.2013.Complete genome sequence of porcine epidemic diarrhea virus strainUSA / Colorado / 2013 from the United States.Genome Announc.1(4):e00555-13.10.1128 / genomeA.00555-13

[0372] 16.Song D,Park B.2012.Porcine epidemic diarrhoea virus:acomprehensive review of molecular epidemiology,diagnosis,and vaccines.VirusGenes 44:167–175.

[0373] 17.Huang YW,Dickerman AW, P,Li L,Fang L,Kiehne R,Opriessnig T,Meng XJ.2013.Origin,evolution,and genotyping of emergent porcine epidemicdiarrhea virus strains in the United States.mBio 4(5):e00737-13.

[0374] 18.Bi J,Zeng S,Xiao S,Chen H,Fang L.2012.Complete genome sequence ofporcine epidemic diarrhea virus strain AJ1102 isolated from a suckling pigletwith acute diarrhea in China.J.Virol.86:10910–10911.

[0375] 19.Chen J,Wang C,Shi H,Qiu HJ,Liu S,Shi D,Zhang X,FengL.2011.Complete genome sequence of a Chinese virulent porcine epidemicdiarrhea virus strain.J.Virol.85:11538–11539.

[0376] 20.Chen J,Liu X,Shi D,Shi H,Zhang X,Feng L.2012.Complete genomesequence of a porcine epidemic diarrhea virus variant.J.Virol.86:3408.10.1128 / JVI.07150-11

[0377] 21.Fan H,Zhang J,Ye Y,Tong T,Xie K,Liao M.2012.Complete genomesequence of a novel porcine epidemic diarrhea virus in southChina.J.Virol.86:10248–10249.

[0378] 22.Gao Y,Kou Q,Ge X,Zhou L,Guo X,Yang H.2013.Phylogenetic analysis ofporcine epidemic diarrhea virus field strains prevailing recently inChina.Arch.Virol.158:711–715.

[0379] 23.Li B,Liu H,He K,Guo R,Ni Y,Du L,Wen L,Zhang X,Yu Z,Zhou J,Mao A,LvL,Hu Y,Yu Y,Zhu H,Wang X.2013.Complete genome sequence of a recombinantporcine epidemic diarrhea virus strain from eastern China.Genome Announc.1(2):e00105-13.10.1128 / genomeA.00105-13

[0380] 24.Luo Y,Zhang J,Deng X,Ye Y,Liao M,Fan H.2012.Complete genomesequence of a highly prevalent isolate of porcine epidemic diarrhea virus insouth China.J.Virol.86:9551–9551.

[0381] 25.Wang XM,Niu BB,Yan H,Gao DS,Huo JY,Chen L,Chang HT,Wang CQ,ZhaoJ.2013.Complete genome sequence of a variant porcine epidemic diarrhea virusstrain isolated in central China.Genome Announc.1(1):e00243-12.10.1128 / genomeA.00243-12

[0382] 26.Wei ZY,Lu WH,Li ZL,Mo JY,Zeng XD,Zeng ZL,Sun BL,Chen F,Xie QM,BeeYZ,Ma J-Y.2012.Complete genome sequence of novel porcine epidemic diarrheavirus strain GD-1 in China.J.Virol.86:13824–13825.

[0383] 27.Zhao M,Sun Z,Zhang Y,Wang G,Wang H,Yang F,Tian F,JiangS.2012.Complete genome sequence of a Vero cell-adapted isolate of porcineepidemic diarrhea virus in eastern China.J.Virol.86:13858–13859.

[0384] 28.S.H.Chang,J.L.Bae,T.J.Kang,J.Kim,G.H.Chung,C.W.Lim,H.Laude,M.S.Yang,Y.S.Jang.2002.Identification of the epitope region capable ofinducing neutralizing antibodies against the porcine epidemic diarrheavirus.Mol.Cells 14,295–299.

[0385] 29.D.J.Cruz,C.J.Kim,H.J.Shin.2008.The GPRLQPY motif(SEQ ID NO:20)located at the carboxy-terminal of the spike protein induces antibodies thatneutralize Porcine epidemic diarrhea virus.Virus Res.132,192–196.

[0386] 30.M.Godet,J.Grosclaude,B.Delmas,H.Laude.1994.Major receptor-bindingand neutralization determinants are located within the same domain of thetransmissible gastroenteritis virus(coronavirus)spike protein.J.Virol.68,8008–8016.

[0387] 31.M.W.Jackwood,D.A.Hilt,S.A.Callison,C.W.Lee,H.Plaza,E.Wade.2001.Spike glycoprotein cleavage recognition site analysis ofinfectious bronchitis virus.Avian Dis.45,366–372.

[0388] 32.L.S.Sturman,K.V.Holmes.1984 Proteolytic cleavage of peplomericglycoprotein E2 of MHV yields two 90K subunits and activates cellfusion.Adv.Exp.Med.Biol.173,25–35.

[0389] 33.D.Sun,L.Feng,H.Shi,J.Chen,X.Cui,H.Chen,S.Liu,Y.Tong,Y.Wang,G.Tong.2008.Identification of two novel B cell epitopes on porcine epidemicdiarrhea virus spike protein.Vet.Microbiol.131,73–81.

[0390] 34.S.J.Park,H.J.Moon,J.S.Yang,C.S.Lee,D.S.Song,B.K.Kang,B.K.Park.2007.Sequence analysis of the partial spike glycoprotein gene ofporcine epidemic diarrhea viruses isolated in Korea.Virus Genes 35,321–332.

[0391] 35.L.J.Saif.1993.Coronavirus immunogens.Vet.Microbiol.285–297.

[0392] 36.S.J.Park,H.K.Kim,D.S.Song,H.J.Moon,B.K.Park.2011 Molecularcharacterization and phylogenetic analysis of porcine epidemic diarrhea virus(PEDV)field isolates in Korea.Arch.Virol.156,577–585.

[0393] 37.D.S.Song,J.S.Yang,J.S.Oh,J.H.Han,B.K.Park.Differentiation of aVero cell adapted porcine epidemic diarrhea virus from Korean field strainsby restriction fragment length polymorphism analysis of ORF 3.2003.Vaccine21,1833–1842.

[0394] 38.D.S.Song,J.S.,B.K.Park.2012 Porcine epidemic diarrhoea virus:acomprehensive review of molecular epidemiology,diagnosis,and vaccines.VirusGenes 44,167-175.

[0395] 39.J.F.Chen,D.B.Sun,C.B.Wang,H.Y.Shi,X.C.Cui,S.W.Liu,H.J.Qiu,L.Feng.2008.Molecular characterization and phylogenetic analysis of membraneprotein genes of porcine epidemic diarrhea virus isolates in China.VirusGenes 36,355–364.

[0396] 40.L.Yuan,S.Y.Kang,L.A.Ward,T.L.To,L.J.Saif.1998 Antibody-secretingcell responses and protective immunity assessed in gnotobiotic pigsinoculated orally or intramuscularly with inactivated humanrotavirus.J.Virol.72,330–338.

[0397] 41.C.H.Kweon,B.J.Kwon,J.G.Lee,G.O.Kwon,Y.B.Kang.1999.Derivation ofattenuated porcine epidemic diarrhea virus(PEDV)as vaccine candidate.Vaccine17,2546–2553.

[0398] 42.Y.Usami,O.Yamaguchi,K.Kumanomido,Y.Matsumura.1998.Antibodyresponse of pregnant sows to porcine epidemic diarrhea virus live vaccine andmaternally-derived antibodies of the piglets.J.Jpn.Vet.Med.Assoc.51,652–655.

[0399] 43.L.A.Ward,L.Yuan,B.I.Rosen,T.L.To,L.J.Saif.1996.Development ofmucosal and systemic lymphoproliferative responses and protective immunity tohuman group A rotaviruses in a gnotobiotic pigmodel.Clin.Diagn.Lab.Immunol.3,342–350.

[0400] 44.A.Pijpers,A.P.van Nieuwstadt,C.Terpstra,J.H.Verheijden.1993.Porcine epidemic diarrhoea virus as a cause of persistentdiarrhoea in a herd of breeding and finishing pigs.Vet.Rec.132,129–131.

[0401] 45.T.Sato,Takeyama,N.,Katsumata,A.,Tuchiya,K.,Kodama,T.,Kusanagi,K.2011.Mutations in the spike gene of porcine epidemic diarrhea virusassociated with growth adaptation in vitro and attenuation of virulence invivo.Virus Genes,43,1,72.

[0402] 46.Park,S.J.,Kim,H.K.,Song,D.S.,An,D.J.and Park,B.K.2012.Completegenome sequences of a Korean virulent porcine epidemic diarrhea virus and itsattenuated counterpart J.Virol.86(10),5964.

[0403] 47.Kusanagi K,Kuwahara H,Katoh T,Nunoya T,Ishikawa Y,Samejima T,Tajima M.1992.Isolation and serial propagation of porcine epidemic diarrheavirus in cell cultures and partial characterization of the isolate.J Vet MedSci.1992 Apr;54(2):313-8.

[0404] 48.Hofmann M,Wyler R.1988.Propagation of the virus of porcineepidemic diarrhea in cell culture.J Clin Microbiol.Nov;26(11):2235-9.

[0405] 49.de Arriba ML,Carvajal A,Pozo J,Rubio P.2002.Mucosal and SystemicIsotype-specific Antibody Responses and Protection in Conventional PigsExposed to Virulent or Attenuated Porcine Epidemic Diarrhoea Virus.VetImmunol Immunopathol.85(1-2):p.85-97.

Claims

1. A recombinant vaccine comprising a spike protein antigen of a genotype 2a porcine epidemic diarrhea virus of North American origin, wherein the spike protein antigen is encoded by the nucleic acid sequence shown in SEQ ID NO: 9 or by SEQ ID NO:

8.

2. The recombinant vaccine of claim 1, wherein the recombinant vaccine comprises a pharmaceutically acceptable carrier and / or excipient.

3. The recombinant vaccine of claim 2, wherein the excipient is one or more adjuvants.

4. The recombinant vaccine of claim 3, wherein the adjuvant is an adjuvant based on EMULSIGEN® oil-in-water emulsion.

5. A method for producing a recombinant vaccine according to any one of claims 1 to 4, comprising: (a) expressing a spike protein antigen of porcine epidemic diarrhea virus in a host cell; and (b) collecting the porcine epidemic diarrhea virus spike protein antigen expressed by the host cell.

6. The method of claim 5, wherein the spike protein antigen of porcine epidemic diarrhea virus is expressed by a recombinant baculovirus vector.

7. The method of claim 5, wherein the spike protein antigen of porcine epidemic diarrhea virus is expressed by insect cells.

8. The method of claim 5, further comprising adding an adjuvant to the porcine epidemic diarrhea virus vaccine.

9. The method of claim 8, wherein the adjuvant is an adjuvant based on EMULSIGEN® oil-in-water emulsion.

10. Use of the recombinant vaccine of any one of claims 1 to 4, or the recombinant vaccine produced by the method of any one of claims 5 to 9, in the preparation of an immunogenic composition for protecting pigs from porcine epidemic diarrhea virus infection.

11. A kit for vaccinating pigs against porcine epidemic diarrhea virus infection, comprising: (a) a dispenser capable of administering a vaccine to pigs; and (b) a recombinant vaccine according to any one of claims 1 to 4, or a recombinant vaccine produced by the method according to any one of claims 5 to 9.

Images