Antibodies that bind to chondroitin sulfate proteoglycan 5

Abstract

The present invention relates to: an antibody or a fragment of the antibody that binds to chondroitin sulfate proteoglycan 5 (CSPG5), a hybridoma that produces the antibody or the antibody fragment, a nucleic acid containing a base sequence encoding the antibody or the antibody fragment, a transformed cell containing a vector containing the nucleic acid, a method for producing the antibody or the antibody fragment, a composition containing the antibody or the antibody fragment, a method for detecting or measuring an antigen present in the brain by using the antibody or the antibody fragment, a method for diagnosing or treating brain diseases, a method for improving the retention of antibodies in the brain, a method for increasing the amount of antibodies in the brain, and the like.

Description

Technical Field

[0001] The present invention relates to, for example, antibodies or antibody fragments thereof that bind to chondroitin sulfate proteoglycan 5 (CSPG5), hybridomas that produce the antibodies or antibody fragments thereof, nucleic acids comprising nucleotide sequences encoding the antibodies or antibody fragments thereof, transformant cells comprising vectors containing the nucleic acids, methods for producing the antibodies or antibody fragments thereof, compositions comprising the antibodies or antibody fragments thereof, methods for detecting or measuring antigens present in the brain, methods for diagnosing or treating brain diseases, methods for improving the properties of antibodies that accumulate in the brain, and methods for increasing the amount of antibodies in the brain, etc., each of which uses the antibodies or antibody fragments thereof. Background Art

[0002] Many antibody drugs have been developed since the FDA approved the mouse anti-CD3 antibody muromonab-CD3 (OKT3) as the first antibody drug in 1986. In 1994, the chimeric antibody abciximab was approved, in which the variable region of a mouse antibody and the constant region of a human antibody were linked to reduce the antigenicity of the mouse antibody.

[0003] In order to further reduce antigenicity, humanized antibody technology was developed, in which the complementarity determining regions (CDRs) of the mouse antibody variable region, which play an important role in binding to the antigen, were transplanted into the framework regions (FRs) of human antibodies, and the humanized anti-CD20 antibody dacizumab was approved in 1997.

[0004] In addition, phage display technology using human antibody sequence libraries has been used, and the fully human anti-TNF-α antibody adalimumab was approved as the first antibody obtained using phage display technology in 2002. More than 60 antibody drugs targeting antigens such as CD20, CD52, TNF-α, HER2, and EGFR have been approved (NPL 1).

[0005] In this way, antibodies have become a widely accepted drug format. Most of the antibody drugs approved so far are for cancer and immune diseases, accounting for more than 75% of all antibody drugs.

[0006] Biologics, such as antibodies, are becoming increasingly important in the treatment of central nervous system diseases. A monoclonal antibody targeting amyloid beta has been reported for use in Alzheimer's disease, and various types of neurotrophic factors with neuroprotective effects (brain-derived neurotrophic factor (BDNF) and glial cell-derived neurotrophic factor (GDNF)) have demonstrated neuroprotective effects in central nervous system diseases in animal models (NPL 2).

[0007] However, when antibodies are administered peripherally, the amount delivered to the central nervous system is lower than that delivered to other organs, and the antibody mobility (ratio of concentration in cerebrospinal fluid (CSF) to serum concentration) is reported to be 0.1 to 0.3% (NPL 3 to 5).

[0008] The reason for the reduced drug delivery in the central nervous system, which includes the brain and bone marrow, is a mechanism known as the blood-brain barrier (BBB), which restricts the transport of substances between the blood and the interstitial fluid of the brain. The BBB has a physical / nonspecific control mechanism caused by intercellular adhesion of vascular endothelial cells and a substrate-specific efflux mechanism caused by efflux transporters, protecting the central nervous system from the effects of foreign substances or drugs and playing an important role in maintaining homeostasis.

[0009] However, due to the existence of blood-brain barrier, it is not easy to obtain effective concentration in central nervous system when administering, and drug development difficulty.For example, although by to Hurler syndrome (I type mucopolysaccharidosis) intravenous administration α-L-iduronidase or to Hunter syndrome (II type mucopolysaccharidosis) intravenous administration iduronic acid-2-sulfatase, enzyme replacement therapy has been carried out, but the enzyme is not passed through blood-brain barrier due to molecular weight, therefore the effect (NPL 6 to 9) for central nervous system symptoms is not observed. In addition, it is reported that due to a certain amount of recombinase being regularly administered continuously, the generation (NPL10) of side effect such as neutralizing antibodies has been caused.

[0010] In addition, attempts to directly administer biological products into the bone marrow cavity or brain have also been carried out to increase the concentration in the brain. For example, a method of administering iduronate-2-sulfatase to the brain of a patient with Hunter syndrome (mucopolysaccharidosis type II) to prevent the progression of the patient's brain disorder has been reported (PTL 1). However, direct administration into the bone marrow cavity or brain is highly invasive (NPL 11).

[0011] Therefore, various delivery technologies have been studied to increase the concentration of high molecular weight substances such as biological products in the brain. For example, a method has been reported in which a high molecular weight substance is bound to a membrane protein expressed in cerebral vascular endothelial cells to form a complex of the substance and the membrane protein, and the complex is allowed to pass through the blood-brain barrier by endocytosis.

[0012] Most of the reported techniques use receptor-mediated transcytosis (RMT), and receptors expressed in brain vascular endothelial cells serving as targets include, for example, transferrin receptor, insulin receptor, insulin-like growth factor receptor, low-density lipoprotein receptor family (LDLRf), and the like.

[0013] A technology for crossing the blood-brain barrier via the transferrin receptor by producing a fusion protein of an anti-transferrin receptor antibody and nerve growth factor has been reported. Technologies using anti-transferrin receptor antibodies include bispecific antibodies combining an anti-transferrin receptor antibody and an anti-β-secretase (BACE1) antibody (PTLs 2 and 3 and NPLs 12 and 13), and fusion antibodies obtained by fusing a monovalent anti-transferrin receptor antibody to the carboxyl terminus of an anti-amyloid peptide β antibody (PTL 4 and NPL 14).

[0014] It has been reported that for brain delivery of a bispecific antibody using an anti-transferrin receptor antibody and an anti-BACE1 antibody, when the antibody was administered to mice at a dose of 20 mg / kg body weight, the amount of the antibody incorporated into the brain increased approximately 4-fold compared to the control (NPL 13).

[0015] In addition, a technique for allowing a drug to pass through the blood-brain barrier by encapsulating it in liposomes having anti-transferrin receptor antibodies on their surfaces has been reported. It has been reported that the amount incorporated into the rat brain was increased by about 2 to 5 times by a fusion of anti-rat transferrin receptor antibodies and immune micelles (NPL 15).

[0016] Furthermore, a technique for passing the blood-brain barrier via the insulin receptor by producing a fusion protein in which a neurotrophic factor, an enzyme, or an anti-amyloid peptide antibody is fused to the carboxyl terminus of an anti-insulin receptor antibody has been reported (NPL 16 to 19).

[0017] It has been reported that in rhesus monkeys, 2 hours after administration of a labeled anti-human insulin receptor antibody and GDNF fusion antibody, the amount incorporated into the brain was approximately 15 times that of GDNF (NPL 17).

[0018] However, transferrin receptors and insulin receptors are expressed not only in cerebral vascular endothelial cells but also throughout the body, including the liver, and therefore, when the amount of drug delivered to the central nervous system increases with these technologies, the drug is also delivered to the liver, etc. (NPL 20). In addition, since the antigen is expressed throughout the body, the half-life of the antibody in the blood is short (NPL 12).

[0019] In addition, it has been reported that an antibody (Fc5) against TMEM30A, an antigen expressed on the membrane of brain vascular endothelial cells, exhibits RMT-like activity (PTL 5 and NPLs 21 and 22). Fc5 is an antibody derived from the heavy chain variable domain (hereinafter referred to as VHH) of a single-domain heavy chain antibody from a llama, and in vitro BBB models and in vivo rat models have demonstrated that the amount of Fc5 and human Fc fusion delivered to the brain is increased compared to control IgG.

[0020] It was reported that in a rat model, a fusion of an Fc5-derived single-chain antibody (scFv) and a type I metabotropic glutamate receptor (mGluRI) antibody increased CSF exposure compared to a fusion of a control single-chain antibody and an mGluRI antibody, but the increase was approximately 5-fold (NPL 23).

[0021] It has also been reported that IgG antibodies are rapidly excreted from the brain into the circulation via the neonatal Fc receptor (FcRn) (NPLs 24 and 25), and that, for example, in rats, the half-life of IgG in the brain is as short as 48 minutes after administration into the brain (NPL 24).

[0022] CSPG5 is a transmembrane chondroitin sulfate proteoglycan that is found only in central nervous system tissues (NPLs 26, 27, and 28). Immunohistochemical staining confirmed staining of neuropil, neurons (nerve cells), such as dendrites and nerve fibers, and / or astrocytes (NPLs 28, 29, 30, and 36). CSPG5 expression in the rat central nervous system has been observed since the embryonic stage, peaks at 3 weeks after birth, and decreases to approximately half of its peak level in adulthood (NPLs 26 and 30).

[0023] Furthermore, experiments using CSPG5 knockout mice revealed that CSPG5 is required for the maturation of cerebellar gamma-aminobutyric acid (GABA)-gated synapses, but not for the dendritic tree of Purkinje cells (NPL 31). CSPG5 is present in developing central nervous system tissues as a proteoglycan and in mature central nervous system tissues as a non-proteoglycan (NPLs 28 and 30).

[0024] CSPG5 has a core protein of 120 kDa. The core protein is divided into 5 different structures, such as the N-terminal domain bound to the chondroitin sulfate chain, the acidic amino acid cluster, the cysteine-rich domain containing the epidermal growth factor (EGF) sample module, the transmembrane segment and the cytoplasmic domain (NPL 26 and 27). The extracellular domain of CSPG5 binds to tenascin-C and tenascin-R through the acidic amino acid cluster (NPL 29, 32 and 33), and interacts with the ErbB3 fusion protein (NPL 34). In addition, several antibodies that bind to CSPG5 have been reported (PTL 6 and NPL 26 and 35).

[0025] Citation List

[0026] Patent Literature

[0027] PTL 1: WO 2012 / 023623

[0028] PTL 2: WO 2016 / 081640

[0029] PTL 3: WO 2016 / 081643

[0030] PTL 4: WO 2014 / 033074

[0031] PTL 5: Canadian Patent No. 2623841

[0032] PTL 6: WO 2016 / 175307

[0033] Non-patent literature

[0034] NPL 1: Kyla RR. and Richard CC., Biotechnol Adv,pii: S0734-9750(16),30091-X, 2016

[0035] NPL 2: Pardridge WM., Bioconjugate Chem., 19, 1327-1338, 2008

[0036] NPL 3: Wang W. et al., Clin.pharmacol.Ther.,84,548-558,2008

[0037] NPL 4: Garg A. et al., AAPSJ., 11, 553-557, 2009

[0038] NPL 5: Kaj B. et al., Arch. Neurol., 69(8), 1002-1010, 2012

[0039] NPL 6: Wraith JE. et al., J.Pediatr.144(5),581-588,2004

[0040] NPL 7: Muenzer J. et al., Genet Med. 8(8), 465-473, 2006

[0041] NPL 8: Package insert for 2.9 mg Aldurazyme (registered trademark) intravenous infusion solution (July 2016, 8th edition)

[0042] NPL 9: Package insert for 6 mg Elaprase (registered trademark) intravenous infusion (July 2016, 6th edition)

[0043] NPL 10: Brooks, DA et al., Trends Mol. Med. 9, 450-453, 2003

[0044] NPL 11:Sorrentino NC.Endocrine Pediatr Rev.1,630-638,2016

[0045] NPL 12:Couch JA.Science Translational Medicine,5,183ra57,2013

[0046] NPL 13:Yu YJ.Post,Science Translational Medicine,6,261ra154,2014

[0047] NPL 14:Niewoehner J. Neuron.81,49-60,2014

[0048] NPL 15:Jun Y.Sci.,Macromol.Biosci.12,1209-1219,2012

[0049] NPL 16:Pardridge WM.&Boado RJ.,Methods in Enzymology,503,269-292,2012

[0050] NPL 17:Boado RJ.Proceedings,Drug Metab.Dispos.,37(12),2299-2304,2009

[0051] NPL 18:Boado RJ.Proc,J.Pharmacol.Exp.Ther.,333(3),961-969,2010

[0052] NPL 19:Boado RJ.Proceedings,Bioconjugate Chem.,1,97-104,2012

[0053] NPL 20:Yun Zhang.Exp.,J.Pharmacol.Exp.Ther.,313(3),1075-1081,2005

[0054] NPL 21:Abulrob A.C,J Neurochem.,95(4),1201-1214,2005

[0055] NPL 22:Farrington GK.Proc,FASEB J.,28,4764-4778,2014

[0056] NPL 23: Webster CI. et al., FASEB J., 30, 1927 - 1940, 2016

[0057] NPL 24: Zhang Y. et al., J. Neuroimmunol., 114(1 - 2), 168 - 172, 2001

[0058] NPL 25: Philip RC. et al., Brain Research, 1534, 13 - 21, 2013

[0059] NPL 26: Watanabe E. et al., J. Biol. Chem., 270, 26876 - 26882, 1995

[0060] NPL 27: Yasuda Y. et al., Neurosci. Res., 32, 313 - 322, 1998

[0061] NPL 28: Aono S. et al., J. Biol. Chem., 275, 337 - 342, 2000

[0062] NPL 29: Schumacher S. et al., J. Cell Biol., 136, 895 - 906, 1997

[0063] NPL 30: Inatani M. et al., Invest. Ophthalmol. Vis. Sci., 41, 4338 - 46, 2000

[0064] NPL 31: Juttner R. et al., Eur. J. Neurosci., 38, 3270 - 3280, 2013

[0065] NPL 32: Schumacher S. et al., J. Biol. Chem., 276, 7337 - 7345, 2001

[0066] NPL 33: Schumacher S. & Stube E.M., J. Neurochem., 87, 1213 - 1223, 2003

[0067] NPL 34: Kinugasa Y. et al., Biochem. Bioph. Res. Co., 321, 1045 - 1049, 2004

[0068] NPL 35: Aono S. et al., J. Neurosci. Res., 83, 110 - 118, 2006

[0069] NPL 36: Mark A. et al., Nature, 532, 195-200, 2016 Summary of the Invention

[0070] Technical issues

[0071] The present invention relates to, for example, CSPG5-binding molecules that bind to CSPG5 and methods for using the same. Specifically, the present invention provides antibodies or antibody fragments thereof that bind to CSPG5, hybridomas that produce the antibodies or antibody fragments thereof, nucleic acids comprising nucleotide sequences encoding the antibodies or antibody fragments thereof, transformant cells comprising vectors containing the nucleic acids, methods for producing the antibodies or antibody fragments thereof, compositions comprising the antibodies or antibody fragments thereof, methods for detecting or measuring antigens present in the brain, methods for diagnosing or treating brain diseases, methods for improving the properties of antibodies that accumulate in the brain, and methods for increasing the amount of antibodies in the brain, each of which uses the antibodies or antibody fragments thereof.

[0072] Solution to the problem

[0073] As a means for solving the above problems, the present invention provides a CSPG5-binding molecule that binds to CSPG5 and a method of using the molecule, specifically, an antibody or an antibody fragment thereof that binds to CSPG5.

[0074] That is, the present invention relates to the following (1) to (23).

[0075] (1) An antibody or an antibody fragment thereof that binds to chondroitin sulfate proteoglycan 5 (CSPG5).

[0076] (2) The antibody or antibody fragment thereof according to (1), wherein the antibody has a property of accumulating in the brain.

[0077] (3) The antibody or antibody fragment thereof according to (2), wherein the antibody has affinity for neurons and / or astrocytes.

[0078] (4) The antibody or antibody fragment thereof according to any one of (1) to (3), wherein the antibody is selected from the following (a) to (s):

[0079] (a) an antibody, wherein the amino acid sequences of complementarity determining regions (CDRs) 1 to 3 of the heavy chain variable domain (VH) comprise the amino acid sequences represented by SEQ ID NOs: 3, 4, and 5, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of the light chain variable domain (VL) comprise the amino acid sequences represented by SEQ ID NOs: 8, 9, and 10, respectively

[0080] (b) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 13, 14, and 15, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 18, 19, and 20, respectively;

[0081] (c) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 23, 24, and 25, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 28, 29, and 30, respectively;

[0082] (d) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 33, 34, and 35, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 38, 39, and 40, respectively;

[0083] (e) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 43, 44, and 45, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 48, 49, and 50, respectively;

[0084] (f) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 53, 54, and 55, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 58, 59, and 60, respectively;

[0085] (g) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 63, 64, and 65, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 68, 69, and 70, respectively;

[0086] (h) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 73, 74, and 75, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 78, 79, and 80, respectively;

[0087] (i) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 83, 84, and 85, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 88, 89, and 90, respectively;

[0088] (j) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 93, 94, and 95, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 98, 99, and 100, respectively;

[0089] (k) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 103, 104, and 105, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 108, 109, and 110, respectively;

[0090] (1) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 113, 114, and 115, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 118, 119, and 120, respectively;

[0091] (m) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 123, 124, and 125, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 128, 129, and 130, respectively;

[0092] (n) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 133, 134, and 135, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 138, 139, and 140, respectively;

[0093] (o) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 143, 144, and 145, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 148, 149, and 150, respectively;

[0094] (p) an antibody that competes with at least one of the antibodies described in (a) to (o) for binding to CSPG5;

[0095] (q) an antibody that binds to an epitope comprising the epitope to which any one of the antibodies described in (a) to (o) binds;

[0096] (r) an antibody that binds to the same epitope as that bound by any one of the antibodies described in (a) to (o); and

[0097] (s) An antibody comprising an amino acid sequence having 85% or higher homology to the amino acid sequence of any one of the antibodies described in (a) to (o).

[0098] (5) The antibody or antibody fragment thereof according to any one of (1) to (4), wherein the antibody is selected from the following (A) to (P):

[0099] (A) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 2, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 7;

[0100] (B) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 12, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 17;

[0101] (C) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 22, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 27;

[0102] (D) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 32, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 37;

[0103] (E) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 42, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 47;

[0104] (F) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 52, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 57;

[0105] (G) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 62, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 67;

[0106] (H) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 72, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 77;

[0107] (I) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 82, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 87;

[0108] (J) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 92, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 97;

[0109] (K) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 102, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 107;

[0110] (L) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 112, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 117;

[0111] (M) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 122, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 127;

[0112] (N) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 132, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 137;

[0113] (O) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 142, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 147; and

[0114] (P) An antibody comprising an amino acid sequence having 85% or higher homology to the amino acid sequence of any one of the antibodies described in (A) to (O).

[0115] (6) The antibody or antibody fragment thereof according to any one of (1) to (5), wherein the antibody or antibody fragment thereof is a bispecific antibody.

[0116] (7) The bispecific antibody according to (6), wherein the bispecific antibody binds to CSPG5 and an antigen present in the brain.

[0117] (8) The bispecific antibody according to (6) or (7), wherein the bispecific antibody comprises an antigen-binding site that binds to CSPG5 and an antigen-binding site that binds to an antigen present in the brain.

[0118] (9) The antibody fragment according to any one of (1) to (8), wherein the antibody fragment is selected from Fab, Fab', F(ab')2, a single-chain antibody (scFv), a dimerized V region (diabody), a disulfide-stabilized V region (dsFv), a heavy chain variable domain (VHH) of a heavy chain antibody, and a peptide containing CDRs.

[0119] (10) The antibody or antibody fragment thereof according to any one of (1) to (9), wherein the antibody is a genetically recombinant antibody.

[0120] (11) The antibody and antibody fragment thereof according to any one of (1) to (10), wherein the antibody is selected from the group consisting of a mouse antibody, a rat antibody, a rabbit antibody, an alpaca antibody, a camel antibody, a llama antibody, a chimeric antibody, a humanized antibody, and a human antibody.

[0121] (12) A fusion antibody or a fusion antibody fragment thereof, wherein at least one selected from the following (i) to (iii) is linked to the antibody or antibody fragment thereof that binds to CSPG5 according to any one of (1) to (11):

[0122] (i) a hydrophilic polymer;

[0123] (ii) an amphiphilic polymer; and

[0124] (iii) Functional molecules.

[0125] (13) A hybridoma that produces the antibody, antibody fragment thereof, fusion antibody, or fusion antibody fragment thereof according to any one of (1) to (12).

[0126] (14) A nucleic acid comprising a nucleotide sequence encoding the antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12).

[0127] (15) A transformant cell comprising a vector containing the nucleic acid according to (14).

[0128] (16) A method for producing the antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12), the method comprising:

[0129] culturing the hybridoma according to (13) or the transformant cell according to (15), and

[0130] The antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12) is collected from the culture solution.

[0131] (17) A composition comprising the antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12).

[0132] (18) The composition according to (17), which is a composition for detecting or measuring an antigen present in the brain.

[0133] (19) The composition according to (17), which is a composition for diagnosing or treating brain diseases.

[0134] (20) A method for detecting or measuring an antigen present in the brain, the method using the antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12) or the composition according to (17).

[0135] (21) A method for diagnosing or treating a brain disease, the method using the antibody, antibody fragment thereof, fusion antibody or fusion antibody fragment thereof according to any one of (1) to (12) or the composition according to (17).

[0136] (22) A method for improving the property of an antibody, an antibody fragment thereof, a fusion antibody, or a fusion antibody fragment thereof to accumulate in the brain, the method using the antibody, the antibody fragment thereof, the fusion antibody, or the fusion antibody fragment thereof according to any one of (1) to (12) or the composition according to (17).

[0137] (23) A method for increasing the amount of an antibody, an antibody fragment thereof, a fusion antibody, or a fusion antibody fragment thereof in the brain, the method using the antibody, the antibody fragment thereof, the fusion antibody, or the fusion antibody fragment thereof according to any one of (1) to (12) or the composition according to (17).

[0138] Advantageous Effects of the Invention

[0139] The CSPG5 binding molecules of the present invention not only improve the property of the binding molecules themselves accumulating in the brain by specifically binding to CSPG5, but can also be applied to the treatment of brain diseases by modifying the CSPG5 binding molecules with another target molecule and transporting and retaining the target molecule in the brain. As specific CSPG5 binding molecules of the present invention, antibodies or their antibody fragments are exemplified. The antibodies of the present invention or their antibody fragments are antibodies or their antibody fragments that have the property of accumulating in the brain by binding to the CSPG5 in the brain. Therefore, the antibodies of the present invention or their antibody fragments can be used as compositions for detecting or measuring the antigens (CSPG5, or another antigen present in CSPG5 and the brain) present in the brain, compositions for diagnosing brain diseases, and pharmaceutical compositions for treating brain diseases. Sequence Listing <110> Kyowa Hakko Kirin Co., Ltd. Kagoshima University, a national university corporation <120> Antibodies that bind to chondroitin sulfate proteoglycan 5 <130> W527297 <150> JP2018-120476 <151> 2018-06-26 <160> 172 <170> PatentIn version 3.5 <210> 1 <211> 375 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5115 VH excluding signal sequence <400> 1 gaggtccagc tggtgcagtc tggggctgag gtgaagaagc ctggggcctc actgaaggtc 60 tcctgcaagg cttctggata cagcttcact gactatatta tacattgggt gcgccaggcc 120 cccggacaaa gtcttgagtg gatgggatgg atcaacggtg gcagtggtgt cccaaaatat 180 tcagacaagt tccagggcag agtcaccatt accagagaca catccgcgaa cacagcctac 240 atggagattc gtagcctggg atctgaagac acggctgtgt attactgtgc gagagggggg 300 gtttgtagtg gcgataagtg ctactactac ggtatggacg tctggggcca agggaccacg 360 gtcaccgtct cctca 375 <210> 2 <211> 125 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5115 excluding signal sequence <400> 2 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Leu Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 Ile Ile His Trp Val Arg Gln Ala Pro Gly Gln Ser Leu Glu Trp Met 35 40 45 Gly Trp Ile Asn Gly Gly Ser Gly Val Pro Lys Tyr Ser Asp Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Asn Thr Ala Tyr 65 70 75 80 Met Glu Ile Arg Ser Leu Gly Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Gly Val Cys Ser Gly Asp Lys Cys Tyr Tyr Tyr Gly Met 100 105 110 Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 3 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5115 <400> 3 Asp Tyr Ile Ile His 1 5 <210> 4 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5115 <400> 4 Trp Ile Asn Gly Gly Ser Gly Val Pro Lys Tyr Ser Asp Lys Phe Gln 1 5 10 15 Gly <210> 5 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5115 <400> 5 Gly Gly Val Cys Ser Gly Asp Lys Cys Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 6 <211> 315 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5115 VL excluding signal sequence <400> 6 cagtctgtgt tgactcagcc accctcagtg tccgtgtccc caggacagac agccagcatc 60 acctgttctg gagataaatt gggggataaa tatagttggt ggtatcaaca gaagcctggc 120 cagtcccctc tattggtcat ccatcaagat aacaagcggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacagcc actctgacca tcgtcgggac ccaggctatg 240 gatgaggctg actattactg ccaggcgtgg gaccgcggcg tggtattcgg cggagggacc 300 aagctgaccg tccta 315 <210> 7 <211> 105 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5115 excluding the signal sequence <400> 7 Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln 1 5 10 15 Thr Ala Ser Ile Thr Cys Ser Gly Asp Lys Leu Gly Asp Lys Tyr Ser 20 25 30 Trp Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Leu Leu Val Ile His 35 40 45 Gln Asp Asn Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Val Gly Thr Gln Ala Met 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Arg Gly Val Val Phe 85 90 95 Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 <210> 8 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5115 <400> 8 Ser Gly Asp Lys Leu Gly Asp Lys Tyr Ser Trp 1 5 10 <210> 9 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5115 <400> 9 Gln Asp Asn Lys Arg Pro Ser 1 5 <210> 10 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5115 <400> 10 Gln Ala Trp Asp Arg Gly Val Val 1 5 <210> 11 <211> 345 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5120 VH excluding signal sequence <400> 11 gaggtgcagc tggtgcagtc tgggggaggc ttggtccagc ctggggggtc cctcagactc 60 tcctgtgcag cctctggatt cacctttagt aactactgga tgacctgggt ccgccaggct 120 ccaggggagg ggccggagtg ggtggccaac ataaatcaag atggaagtca gaaatactat 180 gtggactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgaat 240 ctgcaaatga acaacctgag agccgaggac acggccctatattactgtgc gaaaagtaat 300 gccatggacg tctggggcca agggaccctg gtcaccgtct cctca 345 <210> 12 <211> 115 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5120 excluding signal sequence <400> 12 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Trp Met Thr Trp Val Arg Gln Ala Pro Gly Glu Gly Pro Glu Trp Val 35 40 45 Ala Asn Ile Asn Gln Asp Gly Ser Gln Lys Tyr Tyr Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Asn 65 70 75 80 Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Lys Ser Asn Ala Met Asp Val Trp Gly Gln Gly Thr Leu Val Thr 100 105 110 Val Ser Ser 115 <210> 13 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5120 <400> 13 Asn Tyr Trp Met Thr 1 5 <210> 14 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5120 <400> 14 Asn Ile Asn Gln Asp Gly Ser Gln Lys Tyr Tyr Val Asp Ser Val Lys 1 5 10 15 Gly <210> 15 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5120 <400> 15 Ser Asn Ala Met Asp Val 1 5 <210> 16 <211> 336 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5120 VL excluding signal sequence <400> 16 gatattgtga tgactcagtc tccactctcc ctgcccgtca ctcctggaga gccggcctcc 60 atctcctgca ggtccagtga gagcctcctg catagtaatg gatacaacta cttgaattgg 120 tacctgcaga agccagggca gtctccacaa ctcctgatct atttgggttc gcatcgggcc 180 tccggggtcc ctgacaggct cagtggcagt ggatcagaca cagatttcac attgaaaatc 240 agcagagtgg aggctgagga tgttggcatt tattactgta tgcaaggtcg acagactccc 300 atcactttcg gcggagggac caagctggag atcaaa 336 <210> 17 <211> 112 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5120 excluding signal sequence <400> 17 Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15 Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Glu Ser Leu Leu His Ser 20 25 30 Asn Gly Tyr Asn Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Leu Gly Ser His Arg Ala Ser Gly Val Pro 50 55 60 Asp Arg Leu Ser Gly Ser Gly Ser Asp Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Ile Tyr Tyr Cys Met Gln Gly 85 90 95 Arg Gln Thr Pro Ile Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 <210> 18 <211> 16 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5120 <400> 18 Arg Ser Ser Glu Ser Leu Leu His Ser Asn Gly Tyr Asn Tyr Leu Asn 1 5 10 15 <210> 19 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5120 <400> 19 Leu Gly Ser His Arg Ala Ser 1 5 <210> 20 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5120 <400> 20 Met Gln Gly Arg Gln Thr Pro Ile Thr 1 5 <210> twenty one <211> 351 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5168 VH excluding signal sequence <400> twenty one gaggtgcagc tggtggagac tgggggagcc ttggttcagc ctggagggtc actgagactc 60 tcctgtgcag gctctggatt tatcttcagt aaatatgaaa tgacctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcaact atcggtagtc ttggtctgaa gaccttttac 180 acagactccg taaagggccg gttcaccacc tccagagaca attccaggga cactttattt 240 ctgcaaatgg acaacctgag agtcgaggac acggccatat atttctgtgt gaaaggcggc 300 atacgtcggg cagattactg gggcaaggga accctggtga ccgtctcctc a 351 <210> twenty two <211> 117 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5168 excluding signal sequence <400> twenty two Glu Val Gln Leu Val Glu Thr Gly Gly Ala Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Ile Phe Ser Lys Tyr 20 25 30 Glu Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Thr Ile Gly Ser Leu Gly Leu Lys Thr Phe Tyr Thr Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Thr Ser Arg Asp Asn Ser Arg Asp Thr Leu Phe 65 70 75 80 Leu Gln Met Asp Asn Leu Arg Val Glu Asp Thr Ala Ile Tyr Phe Cys 85 90 95 Val Lys Gly Gly Ile Arg Arg Ala Asp Tyr Trp Gly Lys Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> twenty three <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5168 <400> twenty three Lys Tyr Glu Met Thr 1 5 <210> twenty four <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5168 <400> twenty four Thr Ile Gly Ser Leu Gly Leu Lys Thr Phe Tyr Thr Asp Ser Val Lys 1 5 10 15 Gly <210> 25 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5168 <400> 25 Gly Gly Ile Arg Arg Ala Asp Tyr 1 5 <210> 26 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5168 excluding signal sequence <400> 26 gaaatagtga tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct 120 ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180 aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240 gaagattttg cagtttatta ctgtcagcag cgtagcaact ggcctctcac tttcggcgga 300 gggaccaagg tggaaatcaa a 321 <210> 27 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5168 excluding signal sequence <400> 27 Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 65 70 75 80 Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 28 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5168 <400> 28 Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala 1 5 10 <210> 29 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5168 <400> 29 Asp Ala Ser Asn Arg Ala Thr 1 5 <210> 30 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5168 <400> 30 Gln Gln Arg Ser Asn Trp Pro Leu Thr 1 5 <210> 31 <211> 348 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5201 VH excluding signal sequence <400> 31 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaaagtgg 300 aatcttttcg actactgggg ccaaggtacg ctggttacgg ttagcagc 348 <210> 32 <211> 116 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5201 excluding signal sequence <400> 32 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Lys Trp Asn Leu Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 33 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5201 <400> 33 Ser Tyr Ala Met Ser 1 5 <210> 34 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5201 <400> 34 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 35 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5201 <400> 35 Lys Trp Asn Leu Phe Asp Tyr 1 5 <210> 36 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5201 excluding signal sequence <400> 36 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttacc gtaggctgcg gttgcctgtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 37 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5201 excluding signal sequence <400> 37 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr Arg Arg Leu 85 90 95 Arg Leu Pro Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 38 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5201 <400> 38 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 39 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5201 <400> 39 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 40 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5201 <400> 40 Ser Ser Tyr Arg Arg Leu Arg Leu Pro Val Leu 1 5 10 <210> 41 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5202 VH excluding signal sequence <400> 41 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaattagt 300 aagacgcagg ggttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 42 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5202 excluding signal sequence <400> 42 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ile Ser Lys Thr Gln Gly Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 43 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5202 <400> 43 Ser Tyr Ala Met Ser 1 5 <210> 44 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5202 <400> 44 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 45 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5202 <400> 45 Ile Ser Lys Thr Gln Gly Phe Asp Tyr 1 5 <210> 46 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5202 excluding signal sequence <400> 46 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttatattact gtcaacaaag tcggacgcgg 300 aggcctacgt tcggtcaagg caccaaagtg gaaatcaaa 339 <210> 47 <211> 113 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5202 excluding signal sequence <400> 47 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Ser Arg Thr Arg Arg Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 48 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5202 <400> 48 Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu 1 5 10 15 Ala <210> 49 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5202 <400> 49 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 50 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5202 <400> 50 Gln Gln Ser Arg Thr Arg Arg Pro Thr 1 5 <210> 51 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5205 VH excluding signal sequence <400> 51 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaactaag 300 ccgaataatg ctttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 52 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5205 excluding signal sequence <400> 52 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Thr Lys Pro Asn Asn Ala Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 53 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5205 <400> 53 Ser Tyr Ala Met Ser 1 5 <210> 54 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5205 <400> 54 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 55 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5205 <400> 55 Thr Lys Pro Asn Asn Ala Phe Asp Tyr 1 5 <210> 56 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5205 VL excluding signal sequence <400> 56 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttatattact gtcaacaaac ggcgactcag 300 ccgcttacgt tcggtcaagg caccaaagtg gaaatcaaa 339 <210> 57 <211> 113 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5205 excluding signal sequence <400> 57 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Thr Ala Thr Gln Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 58 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5205 <400> 58 Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu 1 5 10 15 Ala <210> 59 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5205 <400> 59 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 60 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5205 <400> 60 Gln Gln Thr Ala Thr Gln Pro Leu Thr 1 5 <210> 61 <211> 351 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5206 VH excluding signal sequence <400> 61 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaaagcgg 300 tcgctggcgt tcgactactg gggccaaggt acgctggtta cggttagcag c 351 <210> 62 <211> 117 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5206 excluding signal sequence <400> 62 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Lys Arg Ser Leu Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 63 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5206 <400> 63 Ser Tyr Ala Met Ser 1 5 <210> 64 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5206 <400> 64 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 65 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5206 <400> 65 Lys Arg Ser Leu Ala Phe Asp Tyr 1 5 <210> 66 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5206 excluding signal sequence <400> 66 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttaca atcgtaagag gccgccggtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 67 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5206 excluding signal sequence <400> 67 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr Asn Arg Lys 85 90 95 Arg Pro Pro Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 68 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5206 <400> 68 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 69 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5206 <400> 69 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 70 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5206 <400> 70 Ser Ser Tyr Asn Arg Lys Arg Pro Pro Val Leu 1 5 10 <210> 71 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5207 VH excluding signal sequence <400> 71 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaatgggct 300 cggacttcgc ctttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 72 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5207 excluding signal sequence <400> 72 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Trp Ala Arg Thr Ser Pro Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 73 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5207 <400> 73 Ser Tyr Ala Met Ser 1 5 <210> 74 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5207 <400> 74 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 75 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5207 <400> 75 Trp Ala Arg Thr Ser Pro Phe Asp Tyr 1 5 <210> 76 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5207 excluding signal sequence <400> 76 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttaca cgccgagtag ggcgcgggtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 77 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5207 excluding signal sequence <400> 77 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr Thr Pro Ser 85 90 95 Arg Ala Arg Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 78 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5207 <400> 78 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 79 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5207 <400> 79 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 80 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5207 <400> 80 Ser Ser Tyr Thr Pro Ser Arg Ala Arg Val Leu 1 5 10 <210> 81 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5208 VH excluding signal sequence <400> 81 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaatatacg 300 agggagggga gtttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 82 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5208 excluding signal sequence <400> 82 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Tyr Thr Arg Glu Gly Ser Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 83 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5208 <400> 83 Ser Tyr Ala Met Ser 1 5 <210> 84 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5208 <400> 84 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 85 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5208 <400> 85 Tyr Thr Arg Glu Gly Ser Phe Asp Tyr 1 5 <210> 86 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5208 excluding signal sequence <400> 86 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttattact gtcaacaagc gctggagcgg 300 gcgccgacgt tcggtcaagg caccaaagtg gaaatcaaa 339 <210> 87 <211> 113 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5208 excluding signal sequence <400> 87 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Ala Leu Glu Arg Ala Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 88 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5208 <400> 88 Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu 1 5 10 15 Ala <210> 89 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5208 <400> 89 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 90 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5208 <400> 90 Gln Gln Ala Leu Glu Arg Ala Pro Thr 1 5 <210> 91 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5214 VH excluding signal sequence <400> 91 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaacgcgg 300 aggactacta tgttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 92 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5214 excluding signal sequence <400> 92 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Thr Arg Arg Thr Thr Met Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 93 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5214 <400> 93 Ser Tyr Ala Met Ser 1 5 <210> 94 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5214 <400> 94 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 95 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5214 <400> 95 Thr Arg Arg Thr Thr Met Phe Asp Tyr 1 5 <210> 96 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5214 excluding signal sequence <400> 96 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttaca atccgcatca ttcgggtgtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 97 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5214 excluding signal sequence <400> 97 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr Asn Pro His 85 90 95 His Ser Gly Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 98 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5214 <400> 98 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 99 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5214 <400> 99 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 100 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5214 <400> 100 Ser Ser Tyr Asn Pro His His Ser Gly Val Leu 1 5 10 <210> 101 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of CSPG5219 VH excluding signal sequence <400> 101 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaatgaat 300 tcgtggcgtg cgttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 102 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5219 excluding signal sequence <400> 102 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Met Asn Ser Trp Arg Ala Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 103 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5219 <400> 103 Ser Tyr Ala Met Ser 1 5 <210> 104 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5219 <400> 104 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 105 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5219 <400> 105 Met Asn Ser Trp Arg Ala Phe Asp Tyr 1 5 <210> 106 <211> 324 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5219 excluding signal sequence <400> 106 gaaatcgttc tgacgcaatc tccgggtacg ctgtccctga gtccgggcga acgtgcaacc 60 ctgtcctgtc gcgcttcgca atccgtgagc tctagttatc tggcatggta ccagcaaaaa 120 ccgggtcagg ctccgcgtct gctgatttat ggtgcatcct cacgtgcaac cggtatcccg 180 gatcgctttt cgggcagcgg ttctggcacg gacttcaccc tgacgatttc ccgcctggaa 240 ccggaagatt ttgccgtgta ttactgtcaa caacttcgga ggaaggggtc gaccttcggt 300 cagggcagca aagtggaaat caaa 324 <210> 107 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5219 excluding signal sequence <400> 107 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Leu Arg Arg Lys Gly 85 90 95 Ser Thr Phe Gly Gln Gly Ser Lys Val Glu Ile Lys 100 105 <210> 108 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5219 <400> 108 Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala 1 5 10 <210> 109 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5219 <400> 109 Gly Ala Ser Ser Arg Ala Thr 1 5 <210> 110 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5219 <400> 110 Gln Gln Leu Arg Arg Lys Gly Ser Thr 1 5 <210> 111 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5222 excluding the signal sequence <400> 111 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaattaag 300 cagacggggg ctttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 112 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5222 excluding the signal sequence <400> 112 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ile Lys Gln Thr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 113 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5222 <400> 113 Ser Tyr Ala Met Ser 1 5 <210> 114 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5222 <400> 114 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 115 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5222 <400> 115 Ile Lys Gln Thr Gly Ala Phe Asp Tyr 1 5 <210> 116 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5222 excluding signal sequence <400> 116 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttatattact gtcaacaact tgtgcagggg 300 ccgccgacgt tcggtcaagg caccaaagtg gaaatcaaa 339 <210> 117 <211> 113 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5222 excluding signal sequence <400> 117 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Leu Val Gln Gly Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 118 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5222 <400> 118 Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu 1 5 10 15 Ala <210> 119 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5222 <400> 119 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 120 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5222 <400> 120 Gln Gln Leu Val Gln Gly Pro Pro Thr 1 5 <210> 121 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5227 excluding signal sequence <400> 121 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaactgaag 300 cggactcagg gtttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 122 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5227 excluding signal sequence <400> 122 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Leu Lys Arg Thr Gln Gly Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 123 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5227 <400> 123 Ser Tyr Ala Met Ser 1 5 <210> 124 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5227 <400> 124 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 125 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5227 <400> 125 Leu Lys Arg Thr Gln Gly Phe Asp Tyr 1 5 <210> 126 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5227 excluding signal sequence <400> 126 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttatattact gtcaacaatc gaatcgtctg 300 cctccgacgt tcggtcaagg caccaaagtg gaaatcaaa 339 <210> 127 <211> 113 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5227 excluding signal sequence <400> 127 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Ser Asn Arg Leu Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 128 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5227 <400> 128 Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu 1 5 10 15 Ala <210> 129 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5227 <400> 129 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 130 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5227 <400> 130 Gln Gln Ser Asn Arg Leu Pro Pro Thr 1 5 <210> 131 <211> 351 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5230 excluding signal sequence <400> 131 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaatcgacg 300 ccggcgcggt tcgactactg gggccaaggt acgctggtta cggttagcag c 351 <210> 132 <211> 117 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5230 excluding signal sequence <400> 132 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ser Thr Pro Ala Arg Phe Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 133 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5230 <400> 133 Ser Tyr Ala Met Ser 1 5 <210> 134 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5230 <400> 134 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 135 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5230 <400> 135 Ser Thr Pro Ala Arg Phe Asp Tyr 1 5 <210> 136 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5230 excluding signal sequence <400> 136 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttacc atacgcggcc tgcgactgtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 137 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5230 excluding signal sequence <400> 137 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr His Thr Arg 85 90 95 Pro Ala Thr Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 138 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5230 <400> 138 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 139 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5230 <400> 139 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 140 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5230 <400> 140 Ser Ser Tyr His Thr Arg Pro Ala Thr Val Leu 1 5 10 <210> 141 <211> 354 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5234 excluding the signal sequence <400> 141 gaagtccaac tgctggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tctttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaaggcat 300 agttatgcgc ctttcgacta ctggggccaa ggtacgctgg ttacggttag cagc 354 <210> 142 <211> 118 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VH of CSPG5234 excluding the signal sequence <400> 142 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Arg His Ser Tyr Ala Pro Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 143 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR1 of CSPG5234 <400> 143 Ser Tyr Ala Met Ser 1 5 <210> 144 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR2 of CSPG5234 <400> 144 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 145 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of HCDR3 of CSPG5234 <400> 145 Arg His Ser Tyr Ala Pro Phe Asp Tyr 1 5 <210> 146 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of VL of CSPG5234 excluding signal sequence <400> 146 caatcggctc tgacccaacc ggcaagtgtc tctggttctc cgggtcaatc aatcacgatc 60 tcctgtacgg gtacctctac ggatgtcaac ggctataatt acgtcagctg gtatcagcaa 120 tacgcgggta aagccccgaa actgattatc tttgatgtta gtaaacgtcc gtcgggcgtt 180 agcaaccgct tcagtggctc caaatcaggt gacaccgcct ctctgacgat ttccggtctg 240 caggcagaag atgaagctga ctatcattgc agctcttaca ggccgaaggc taggagtgtc 300 ctgtttggtg gtggcacgaa actgaccgtt ctg 333 <210> 147 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of VL of CSPG5234 excluding the signal sequence <400> 147 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln Tyr Ala Gly Lys Ala Pro Lys Leu 35 40 45 Ile Ile Phe Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asp Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr His Cys Ser Ser Tyr Arg Pro Lys 85 90 95 Ala Arg Ser Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 148 <211> 14 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR1 of CSPG5234 <400> 148 Thr Gly Thr Ser Thr Asp Val Asn Gly Tyr Asn Tyr Val Ser 1 5 10 <210> 149 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR2 of CSPG5234 <400> 149 Asp Val Ser Lys Arg Pro Ser 1 5 <210> 150 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of LCDR3 of CSPG5234 <400> 150 Ser Ser Tyr Arg Pro Lys Ala Arg Ser Val Leu 1 5 10 <210> 151 <211> 660 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of light chain antibody sequence of pCI_CSPG5202-hKG4PE (R409K) excluding signal sequence <400> 151 gacatcgtca tgacgcaaag tccggattca ctggctgtta gtctgggcga acgtgctacg 60 atcaactgta aatcctctca aagtgtgctg tatagctcta acaataaaaa ctatctggca 120 tggtaccagc aaaaaccggg tcagccgccg aaactgctga tttactgggc atctacccgt 180 gaatccggtg tcccggatcg cttttcaggc tcgggtagcg gcacggactt caccctgacg 240 atcagttccc tgcaagcgga agatgtggcc gtttatattact gtcaacaaag tcggacgcgg 300 aggcctacgt tcggtcaagg caccaaagtg gaaatcaaac gtacggtggc tgcaccatct 360 gtcttcatct tcccgccatc tgatgagcag ttgaaatctg gaactgcctc tgttgtgtgc 420 ctgctgaata acttctatcc cagagaggcc aaagtacagt ggaaggtgga taacgccctc 480 caatcgggta actcccagga gagtgtcaca gagcaggaca gcaaggacag cacctacagc 540 ctcagcagca ccctgacgct gagcaaagca gactacgaga aacacaaagt ctacgcctgc 600 gaagtcaccc atcagggcct gagctcgccc gtcacaaaga gcttcaacag gggagagtgt 660 <210> 152 <211> 220 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of the light chain antibody sequence of pCI_CSPG5202-hKG4PE (R409K) excluding the signal sequence <400> 152 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Ser Arg Thr Arg Arg Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp 115 120 125 Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn 130 135 140 Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu 145 150 155 160 Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp 165 170 175 Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr 180 185 190 Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser 195 200 205 Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 215 220 <210> 153 <211> 1335 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: Base sequence of heavy chain antibody sequence of pCI_CSPG5202-hKG4PE (R409K) excluding signal sequence <400> 153 gaagtccaac tgctgggaatc gggtggtggt ctggtgcaac cgggcggctc gctgcgtctg 60 tcatgtgctg cgtcgggctt tacctttagc tcttatgcaa tgtcctgggt gcgtcaggca 120 ccgggtaaag gtctggaatg ggttagcgca attagtggct ccggcggtag cacctattac 180 gccgattctg ttaaaggtcg ttttaccatc tcacgcgaca actcgaaaaa tacgctgtat 240 ctgcagatga acagtctgcg cgcagaagat accgctgtct attactgcgc aaaaattagt 300 aagacgcagg ggttcgacta ctggggccaa ggtacgctgg ttacggttag cagcgctagc 360 accaaggggc catccgtctt ccccctggcg ccctgctcca ggagcacctc cgagagcaca 420 gccgccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 480 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 540 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcacgaa gacctacacc 600 tgcaacgtag atcacaagcc cagcaacacc aaggtggaca agagagttga gtccaaatat 660 ggtcccccat gcccaccatg cccagcacct gagttcgagg ggggaccatc agtcttcctg 720 ttccccccaa aacccaagga cactctcatg atctcccgga cccctgaggt cacgtgcgtg 780 gtggtggacg tgagccagga agaccccgag gtccagttca actggtacgt ggatggcgtg 840 gaggtgcata atgccaagac aaagccgcgg gaggagcagt tcaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960 gtctccaaca aaggcctccc gtcctccatc gagaaacca tctccaaagc caaagggcag ccccgagagc cacaggtgta caccctgccc ccatcccagg aggagatgac caagaaccag gtcagcctga cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtggggag agcaatgggc agccggagaa caactacag accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gctaaccgtg gacaagagca ggtggcagga ggggaatgtc ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacaga gagcctctcc ctgtctctgg gtaaa <210> 154 <211> 445 <212> PRT <213> The snowstorm <220> <223> Description of artificial sequence: amino acid sequence of the heavy chain antibody sequence of pCI_CSPG5202-hKG4PE (R409K) excluding the signal sequence <400> 154 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ile Ser Lys Thr Gln Gly Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 435 440 445 <210> 155<F <211> 648 <212> DNA <213> Synthetic sequence <220> <223> Description of artificial sequence: base sequence of the light chain antibody sequence of pCI_AVM-hLG4PE(R409K)-CSPG5202scFv excluding the signal sequence <400> 155 cagtttgtgc tttctcagcc aaactctgtg tctacgaatc tcggaagcac agtcaaactg 60 tcttgcaagc gcagcactgg taacattgga agcaattatg tgagctggta ccagcagcat 120 gagggaagat ctcccaccac tatgatttat agggatgata agagaccaga tggagttcct 180 gacaggttct ctggctccat tgacagatct tccgactcag ccctcctgac aatcaataat 240 gtgcagactg aagatgaagc tgactacttc tgtcagtctt acagtagtgg tattaatatt 300 ttcggcggtg gaaccaagct cactgtccta ggtcagccca aggccgcccc ctcggtcact 360 ctgttcccgc cctcctctga ggagcttcaa gccaacaagg ccacactggt gtgtctcata 420 agtgacttct acccgggagc cgtgacagtg gcctggaagg cagatagcag ccccgtcaag 480 gcggggagtgg agaccacccac accctccaaa caaagcaaca acaagtacgc ggccagcagc 540 tacctgagcc tgacgcctga gcagtggaag tcccacagaa gctacagctg ccaggtcacg 600 catgaaggga gcaccgtgga gaagacagtg gcccctacag aatgttca 648 <210> 156 <211> 216 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of the light chain antibody sequence of pCI_AVM-hLG4PE(R409K)-CSPG5202scFv excluding the signal sequence <400> 156 Gln Phe Val Leu Ser Gln Pro Asn Ser Val Ser Thr Asn Leu Gly Ser 1 5 10 15 Thr Val Lys Leu Ser Cys Lys Arg Ser Thr Gly Asn Ile Gly Ser Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln His Glu Gly Arg Ser Pro Thr Thr Met 35 40 45 Ile Tyr Arg Asp Asp Lys Arg Pro Asp Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Arg Ser Ser Asp Ser Ala Leu Leu Thr Ile Asn Asn 65 70 75 80 Val Gln Thr Glu Asp Glu Ala Asp Tyr Phe Cys Gln Ser Tyr Ser Ser 85 90 95 Gly Ile Asn Ile Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 100 105 110 Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu 115 120 125 Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr 130 135 140 Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys 145 150 155 160 Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr 165 170 175 Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His 180 185 190 Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys 195 200 205 Thr Val Ala Pro Thr Glu Cys Ser 210 215 <210> 157 <211> 2154 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of heavy chain antibody sequence of pCI_AVM-hLG4PE(R409K)-CSPG5202scFv excluding signal sequence <400> 157 gaggtgcagc tggtggaatc tgggggaggc ttagtgcagc ctggaagatc cctgaaactc 60 tcctgtgcag cctcaggatt cactttcagt aactatgcca tggcttgggt ccgccgggct 120 ccaacgaagg gtctggagtg ggtcgcatcc attagtaatg gtggtggtaa cacttactat 180 cgcgactccg tgaagggccg attcactatc tccagagatg atgcaaaaaa caccctatac 240 ctgcaaatgg acagtctgag gtctgaggac acggccactt attactgtgc aagacacggg 300 aattatatat attatgggtc cttctttgat tactggggcc aaggatcat ggtcacagtc 360 tcctcagcta gcaccaaggg gccatccgtc ttccccctgg cgccctgctc caggagcacc 420 tccgagagca cagccgccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttccccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacg 600 aagacctaca cctgcaacgt agatcacaag cccagcaaca ccaaggtgga caagagagtt 660 gagtccaaat atggtcccccc atgcccacca tgcccagcac ctgagttcga ggggggacca 720 tcagtcttcc tgttcccccc aaaacccaag gacactctca tgatctcccg gacccctgag 780 gtcacgtgcg tggtggtgga cgtgagccag gaagaccccg aggtccagtt caactggtac 840 gtggatggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gttcaacagc 900 acgtaccgtg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa cggcaaggag 960 tacaagtgca aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac catctccaaa 1020 gccaaagggc agccccgaga gccacaggtg tacaccctgc ccccatccca ggaggagatg 1080 accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctaccccag cgacatcgcc 1140 gtggagtggg agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg 1200 gactccgacg gctccttctt cctctacagc aagctaaccg tggacaagag caggtggcag 1260 gaggggaatg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacacag 1320 aagagcctct ccctgtctct gggtggagga ggagggtccg gaggaggagg gtccggtgga 1380 ggtgggtccg aagtccaact gctggaatcg ggtggtggtc tggtgcaacc gggcggctcg 1440 ctgcgtctgt catgtgctgc gtcgggcttt acctttagct cttatgcaat gtcctgggtg 1500 cgtcaggcac cgggtaaagg tctggaatgg gttagcgcaa ttagtggctc cggcggtagc 1560 acctattacg ccgattctgt taaaggtcgt tttaccatct cacgcgacaa ctcgaaaaat 1620 acgctgtatc tgcagatgaa cagtctgcgc gcagaagata ccgctgtcta ttactgcgca 1680 aaaattagta agacgcaggg gttcgactac tggggccaag gtacgctggt tacggttagc 1740 agcgctagca ccggaggcgg tggcagcgga ggaggagggt ccggtggggg cggctcgggc 1800 ggaggtggtt cagacatcgt catgacgcaa agtccggatt cactggctgt tagtctgggc 1860 gaacgtgcta cgatcaactg taaatcctct caaagtgtgc tgtatagctc taacaataaa 1920 aactatctgg catggtacca gcaaaaaccg ggtcagccgc cgaaactgct gatttactgg 1980 gcatctaccc gtgaatccgg tgtcccggat cgcttttcag gctcgggtag cggcacggac 2040 ttcaccctga cgatcagttc cctgcaagcg gaagatgtgg ccgtttatta ctgtcaacaa 2100 agtcggacgc ggaggcctac gttcggtcaa ggcaccaaag tggaaatcaa aggt 2154 <210> 158 <211> 718 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of the heavy chain antibody sequence of pCI_AVM-hLG4PE(R409K)-CSPG5202scFv excluding the signal sequence <400> 158 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Ala Met Ala Trp Val Arg Arg Ala Pro Thr Lys Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Ser Asn Gly Gly Gly Asn Thr Tyr Tyr Arg Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asp Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg His Gly Asn Tyr Ile Tyr Tyr Gly Ser Phe Phe Asp Tyr Trp 100 105 110 Gly Gln Gly Val Met Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 130 135 140 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 145 150 155 160 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 165 170 175 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 180 185 190 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 195 200 205 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 210 215 220 Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Glu Gly Gly Pro 225 230 235 240 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 260 265 270 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285 Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 290 295 300 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 305 310 315 320 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 325 330 335 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 340 345 350 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 355 360 365 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 385 390 395 400 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 405 410 415 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 420 425 430 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 435 440 445 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 450 455 460 Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser 465 470 475 480 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala 485 490 495 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 500 505 510 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 515 520 525 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 530 535 540 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 545 550 555 560 Lys Ile Ser Lys Thr Gln Gly Phe Asp Tyr Trp Gly Gln Gly Thr Leu 565 570 575 Val Thr Val Ser Ser Ala Ser Thr Gly Gly Gly Gly Ser Gly Gly Gly 580 585 590 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met 595 600 605 Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr 610 615 620 Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys 625 630 635 640 Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu 645 650 655 Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe 660 665 670 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu 675 680 685 Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Ser Arg Thr Arg 690 695 700 Arg Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly 705 710 715 <210> 159 <211> 1617 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of human CSPG5 including signal sequence <400> 159 atggggcgag ccgggggcgg gggcccgggc cgggggccgc cgccactgct gctgtttctg 60 ggggccgcgc tggtcctggc ctctggggcc gtgccggcgc gtgaggcggg cagcgcggtt 120 gaggccgaag agctggtgaa gggcagcccg gcgtgggagc cgcctgccaa cgacacgcgg 180 gaagaagccg gcccaccagc ggctggggaa gatgaggcgt cgtggacggc gcccggtggc 240 gagctggccg ggccagaaga ggtgctgcag gagtcggctg cggtgaccgg caccgcctgg 300 ctggaagctg acagcccagg cctgggagga gtgaccgcag aggcgggcag cggcgatgcc 360 caggcccttc cagctacgct ccaggctccc cacgaggtcc tcgggcagtc aatcatgccc 420 cctgccattc ctgaggctac agaggccagc gggccaccct cccccacccc cggcgacaag 480 ctgagcccag cttctgaact ccccaaggag agccccttgg aggtttggct gaacctgggg 540 ggcagcacac ccgaccctca agggccagag ctgacttacc catttcaggg caccctggag 600 ccccaaccgg catcagatat cattgacatc gactacttcg aaggactgga tggtgagggt 660 cgtggcgcag atctggggag cttcccaggg tcaccaggaa cctcagagaa ccaccctgat 720 actgagggag agaccccttc ctggagcctg cttgacttat acgatgattt cacccccttc 780 gatgaatctg atttctaccc caccacatcc ttttatgatg acttggatga agaggaggag 840 gaagaggagg atgacaaaga tgcagtagga ggtggagacc tagagatga aaatgagctt 900 ctagtgccca ctgggaagcc tggtctgggg cccgggacag gccagcccac cagtcggtgg 960 catgctgtcc ctccacagca cactctgggg tcggtccccg gcagcagcat cgccctcagg 1020 ccccgcccag gagagccagg cagggacttg gcctccagtg aaaatggcac tgagtgccgc 1080 agtggctttg tgcggcataa cggctcctgc cggtcagtgt gcgacctctt cccaagttac 1140 tgtcacaatg gcggccagtg ctacctggtg gagaacatag gggccttctg caggtgcaac 1200 acgcaggact acatctggca caaggggatg cgctgcgagt ccatcatcac cgacttccag 1260 gtgatgtgcg tggccgtggg ctcggctgcc ctcgtcctgc tcctgctctt catgatgacg 1320 gtgttctttg ccaagaagct ctacctgctc aagacggaga ataccaagct gcgtaggacc 1380 aacaaattcc ggaccccatc tgagctccac aatgataact tctccctctc caccattgcc 1440 gagggctctc acccaaatga tgatcctagt gctccccaca aaatccagga ggttctcaag 1500 tcctgcctga aagaggagga gtcatttaac atccagaact ccatgtcgcc caaacttgag 1560 ggtggcaaag gtgaccaggc tgacttggat gtgaactgtc ttcagaataa tttaacc 1617 <210> 160 <211> 539 <212> PRT <213> Artificial sequence <220> <223> Description of the artificial sequence: Amino acid sequence of human CSPG5 including the signal sequence <400> 160 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly Arg Gly Pro Pro Pro Leu 1 5 10 15 Leu Leu Phe Leu Gly Ala Ala Leu Val Leu Ala Ser Gly Ala Val Pro 20 25 30 Ala Arg Glu Ala Gly Ser Ala Val Glu Ala Glu Glu Leu Val Lys Gly 35 40 45 Ser Pro Ala Trp Glu Pro Pro Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Pro Pro Ala Ala Gly Glu Asp Glu Ala Ser Trp Thr Ala Pro Gly Gly 65 70 75 80 Glu Leu Ala Gly Pro Glu Glu Val Leu Gln Glu Ser Ala Ala Val Thr 85 90 95 Gly Thr Ala Trp Leu Glu Ala Asp Ser Pro Gly Leu Gly Gly Val Thr 100 105 110 Ala Glu Ala Gly Ser Gly Asp Ala Gln Ala Leu Pro Ala Thr Leu Gln 115 120 125 Ala Pro His Glu Val Leu Gly Gln Ser Ile Met Pro Pro Ala Ile Pro 130 135 140 Glu Ala Thr Glu Ala Ser Gly Pro Pro Ser Pro Thr Pro Gly Asp Lys 145 150 155 160 Leu Ser Pro Ala Ser Glu Leu Pro Lys Glu Ser Pro Leu Glu Val Trp 165 170 175 Leu Asn Leu Gly Gly Ser Thr Pro Asp Pro Gln Gly Pro Glu Leu Thr 180 185 190 Tyr Pro Phe Gln Gly Thr Leu Glu Pro Gln Pro Ala Ser Asp Ile Ile 195 200 205 Asp Ile Asp Tyr Phe Glu Gly Leu Asp Gly Glu Gly Arg Gly Ala Asp 210 215 220 Leu Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro Asp 225 230 235 240 Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp Asp 245 250 255 Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe Tyr 260 265 270 Asp Asp Leu Asp Glu Glu Glu Glu Glu Glu Glu Asp Asp Lys Asp Ala 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Glu Leu Leu Val Pro Thr 290 295 300 Gly Lys Pro Gly Leu Gly Pro Gly Thr Gly Gln Pro Thr Ser Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Ser Val Pro Gly Ser Ser 325 330 335 Ile Ala Leu Arg Pro Arg Pro Gly Glu Pro Gly Arg Asp Leu Ala Ser 340 345 350 Ser Glu Asn Gly Thr Glu Cys Arg Ser Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Gln Val Met Cys Val Ala Val Gly Ser Ala Ala Leu Val 420 425 430 Leu Leu Leu Leu Phe Met Met Thr Val Phe Phe Ala Lys Lys Leu Tyr 435 440 445 Leu Leu Lys Thr Glu Asn Thr Lys Leu Arg Arg Thr Asn Lys Phe Arg 450 455 460 Thr Pro Ser Glu Leu His Asn Asp Asn Phe Ser Leu Ser Thr Ile Ala 465 470 475 480 Glu Gly Ser His Pro Asn Asp Asp Pro Ser Ala Pro His Lys Ile Gln 485 490 495 Glu Val Leu Lys Ser Cys Leu Lys Glu Glu Glu Ser Phe Asn Ile Gln 500 505 510 Asn Ser Met Ser Pro Lys Leu Glu Gly Gly Lys Gly Asp Gln Ala Asp 515 520 525 Leu Asp Val Asn Cys Leu Gln Asn Asn Leu Thr 530 535 <210> 161 <211> 1617 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of mouse CSPG5 including signal sequence <400> 161 atgggccgag ctggaggcgg gggcccggac tggggggccgc cgccagtgct gctgcttctg 60 ggggtcacgc tggtgctcac cgctggggcc gtaccggcac gggaaacagg cagtgcgatc 120 gaggctgaag agctggtgag gagcagcctg gcatgggagt cgcgtgccaa tgacacgcgg 180 gaggaagccg gcctgccagc agctggggaa gatgagacct cgtggacaga gcggggcagt 240 gagatggctg cggtgggccc tggggtcggg ccagaggagg cactagaggc atcggctgca 300 gtgactggca ctgcctggct agaggcagat ggcccaggcc tgggtggagt gactgcagag 360 gctggcagtg gcgacgccca gacccttcca gctacgctcc aggctcctga tgaggccctt 420 gggtcatcta caatgccccc tgccatccct gaggctactg aaaccagtgg acctccctcc 480 cctgctgtcc atgataagcc tagtgtaggc cctgaactcc ctaaagagat ccccttggag 540 gttcggctga acctgggagg cagcacacca gagcccactt ttccccttca gggcactctc 600 gagacccaac cagcctcaga tataattgac attgattact ttgaaggatt ggatagtgag 660 ggtcgtggtg cagacatggg cagcttcccg gggtcaccag gaacctcaga aaatcaccct 720 gataccgaag gagagacccc ttcctggagc ctgcttgatt tgtatgatga cttcacccct 780 tttgatgagt ctgatttcta ccccaccaca tccttctatg atgatttgga agaggaggaa 840 gagaggagg aggatagga tacagtagga ggtggagacc tggagatga aaacgacctt 900 ctcctgccct ctcaaagcc tggtgtgggg cctgggacag vakagcccac CAccggtgg 960 catgctgttc cccacagca tactctgggg atgtacctg gcagcagcat ctctcttagg 1020 ccccgccccg gagatccagg caggacctg gcctcaggag aaatggcac aggtgccg 1080 gttggcttcg tcaggcacaa tggctcctgc cggtcagctct gtgactt tccgagttac 1140 tgtcacaacg gcggccagtg ctacctggtg gagacatag gggctttg caggtgtaac 1200 acccaggact accatctggca cagggatg cgctgtgagt ccatcac ggacttccag 1260 gtgatgtgcg tggccgttgg ctcggctgct ctcgtgctc tcctcctgtt catgatgact 1320 gtgttctttg ccagaagct ctatctgctc aagactgaga ataccaagct gcggaggacc 1380 aaaattcc ggacccatc tgagctccac 1440 gagggctctc atccaatga cgaccccagc gctccccaca aaatccagga cccctcaag 1500 tcccgcctga aggaggaaga gtcctttaac atccagaact ccatgtcacc caaacttgag 1560 ggtggcaaag gtgaccagga tgacttgggg gtgaactgtc tgcagaataa cctaacc 1617 <210> 162 <211> 539 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of mouse CSPG5 including signal sequence <400> 162 Met Gly Arg Ala Gly Gly Gly Gly Pro Asp Trp Gly Pro Pro Pro Val 1 5 10 15 Leu Leu Leu Leu Gly Val Thr Leu Val Leu Thr Ala Gly Ala Val Pro 20 25 30 Ala Arg Glu Thr Gly Ser Ala Ile Glu Ala Glu Glu Leu Val Arg Ser 35 40 45 Ser Leu Ala Trp Glu Ser Arg Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Leu Pro Ala Ala Gly Glu Asp Glu Thr Ser Trp Thr Glu Arg Gly Ser 65 70 75 80 Glu Met Ala Ala Val Gly Pro Gly Val Gly Pro Glu Glu Ala Leu Glu 85 90 95 Ala Ser Ala Ala Val Thr Gly Thr Ala Trp Leu Glu Ala Asp Gly Pro 100 105 110 Gly Leu Gly Gly Val Thr Ala Glu Ala Gly Ser Gly Asp Ala Gln Thr 115 120 125 Leu Pro Ala Thr Leu Gln Ala Pro Asp Glu Ala Leu Gly Ser Ser Thr 130 135 140 Met Pro Pro Ala Ile Pro Glu Ala Thr Glu Thr Ser Gly Pro Pro Ser 145 150 155 160 Pro Ala Val His Asp Lys Pro Ser Val Gly Pro Glu Leu Pro Lys Glu 165 170 175 Ile Pro Leu Glu Val Arg Leu Asn Leu Gly Gly Ser Thr Pro Glu Pro 180 185 190 Thr Phe Pro Leu Gln Gly Thr Leu Glu Thr Gln Pro Ala Ser Asp Ile 195 200 205 Ile Asp Ile Asp Tyr Phe Glu Gly Leu Asp Ser Glu Gly Arg Gly Ala 210 215 220 Asp Met Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro 225 230 235 240 Asp Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp 245 250 255 Asp Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe 260 265 270 Tyr Asp Asp Leu Glu Glu Glu Glu Glu Glu Glu Glu Asp Lys Asp Thr 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Asp Leu Leu Leu Pro Ser 290 295 300 Gln Lys Pro Gly Val Gly Pro Gly Thr Gly Gln Pro Thr Asn Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Met Val Pro Gly Ser Ser 325 330 335 Ile Ser Leu Arg Pro Arg Pro Gly Asp Pro Gly Lys Asp Leu Ala Ser 340 345 350 Gly Glu Asn Gly Thr Glu Cys Arg Val Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Gln Val Met Cys Val Ala Val Gly Ser Ala Ala Leu Val 420 425 430 Leu Leu Leu Leu Phe Met Met Thr Val Phe Phe Ala Lys Lys Leu Tyr 435 440 445 Leu Leu Lys Thr Glu Asn Thr Lys Leu Arg Arg Thr Asn Lys Phe Arg 450 455 460 Thr Pro Ser Glu Leu His Asn Asp Asn Phe Ser Leu Ser Thr Ile Ala 465 470 475 480 Glu Gly Ser His Pro Asn Asp Asp Pro Ser Ala Pro His Lys Ile Gln 485 490 495 Asp Pro Leu Lys Ser Arg Leu Lys Glu Glu Glu Ser Phe Asn Ile Gln 500 505 510 Asn Ser Met Ser Pro Lys Leu Glu Gly Gly Lys Gly Asp Gln Asp Asp 515 520 525 Leu Gly Val Asn Cys Leu Gln Asn Asn Leu Thr 530 535 <210> 163 <211> 1605 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of cynomolgus monkey CSPG5 including signal sequence <400> 163 atggggcgag ccggggcgg gggcccgggc cggggccgc cgccactgct gctgcttctg 60 ggggccgcgc tggtcctggc ctctggggcc gtgccggcgc gtgaggcggg cagcgcggtc 120 gaggccgaag agctggtgaa gggcaggccg gcgtgggagc cgcgtgccaa cgacacgcga 180 gaaagccg gcccaccagc ggctggggaa gatgaggcgt cgtggaccgc gcctggcgg 240 gagctggccg ggccagagga ggtgctgcag gcgaccggca ccgcctggct ggaggctgac 300 aacccaggcc tgggaggat gacctcagag gcgggtagtg gcgatgccca ggcccttcca 360 gctacgctcc aggctcccca cgaggtcctc gggcagtcag tcatgcccc tgccattcct 420 gaggctacag aagccagcgg gccaccctcc cccacccctg gcgacaacct gagcccagct 480 tctgaactcc ccaaggagag ccccttggag gtttggctga acctgggggg cagcacacccc 540 gaccctcaag ggccagagcc gacttacccc tttcagggca ccctggagcc ccaaccggca 600 tcagatatca ttgacatcga ctacttccaa ggattggatg gtgagggtcg tggcgcagac 660 ctggggagct tcccagggtc accaggaacc tcagagaacc accctgatac tgagggagag 720 accccttcct ggagcctgct tgacttatac gatgatttca cccctttga tgaatctgat 780 ttctacccca ccacatcctt tttacgatgac tggatgag yell yell gaaagatg cagtaggagg tggaccta gagatgaaa atgagcttct agtgcccact 900 gggaagcccg gtctggggcc cgggacaggc cagcccaaca gtcgatggca tgctgtccct 960 ccacagcaca ctctggggtc gttccccggc agcagcatcg ccctccggcc ccgcccagga 1020 gagccaggca gggacctggc ctccagtgaa aatggcactg agtgccgcag tggctttgtg 1080 cggcataacg gctcctgccg gtcagtgtgc gacctctcc caagttactg tcacaatggc 1140 ggccagtgct acctggtgga gaacataggg gccttctgca ggtgcacac acaggactac 1200 atctggcaca aggggatgcg ctgcgagtcc atcatcaccg acttccaggt gatgtgcgtg 1260 gccgtgggct cagctgccct cgtcctgctc ctgctctca tgatgacggt gttcttcgcc 1320 aagaagctct accttctca gacggagaac accaagctgc gtaggacca caatttccgg 1380 acccagctg aactccacaa tgataacttc tccctcca ccattgccga gggctctcac 1440 ccaaatgatg atcctagtgc tccccacaaa atccaggagg ctctcaaatc ctgcctgaaa 1500 gaggaggagt catttaacat ccagaactcc atgtcgccca aacttgaggg tggcaaaggt 1560 gaccaggctg acttggatgt gaactgtctt cagaataatt taacc 1605 <210> 164 <211> 535 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: Amino acid sequence of cynomolgus monkey CSPG5 including signal sequence <400> 164 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly Arg Gly Pro Pro Pro Leu 1 5 10 15 Leu Leu Leu Leu Gly Ala Ala Leu Val Leu Ala Ser Gly Ala Val Pro 20 25 30 Ala Arg Glu Ala Gly Ser Ala Val Glu Ala Glu Glu Leu Val Lys Gly 35 40 45 Arg Pro Ala Trp Glu Pro Arg Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Pro Pro Ala Ala Gly Glu Asp Glu Ala Ser Trp Thr Ala Pro Gly Gly 65 70 75 80 Glu Leu Ala Gly Pro Glu Glu Val Leu Gln Ala Thr Gly Thr Ala Trp 85 90 95 Leu Glu Ala Asp Asn Pro Gly Leu Gly Gly Val Thr Ser Glu Ala Gly 100 105 110 Ser Gly Asp Ala Gln Ala Leu Pro Ala Thr Leu Gln Ala Pro His Glu 115 120 125 Val Leu Gly Gln Ser Val Met Pro Pro Ala Ile Pro Glu Ala Thr Glu 130 135 140 Ala Ser Gly Pro Pro Ser Pro Thr Pro Gly Asp Asn Leu Ser Pro Ala 145 150 155 160 Ser Glu Leu Pro Lys Glu Ser Pro Leu Glu Val Trp Leu Asn Leu Gly 165 170 175 Gly Ser Thr Pro Asp Pro Gln Gly Pro Glu Pro Thr Tyr Pro Phe Gln 180 185 190 Gly Thr Leu Glu Pro Gln Pro Ala Ser Asp Ile Ile Asp Ile Asp Tyr 195 200 205 Phe Gln Gly Leu Asp Gly Glu Gly Arg Gly Ala Asp Leu Gly Ser Phe 210 215 220 Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro Asp Thr Glu Gly Glu 225 230 235 240 Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp Asp Phe Thr Pro Phe 245 250 255 Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe Tyr Asp Asp Leu Asp 260 265 270 Glu Glu Glu Glu Glu Glu Glu Asp Asp Lys Asp Ala Val Gly Gly Gly 275 280 285 Asp Leu Glu Asp Glu Asn Glu Leu Leu Val Pro Thr Gly Lys Pro Gly 290 295 300 Leu Gly Pro Gly Thr Gly Gln Pro Asn Ser Arg Trp His Ala Val Pro 305 310 315 320 Pro Gln His Thr Leu Gly Ser Val Pro Gly Ser Ser Ile Ala Leu Arg 325 330 335 Pro Arg Pro Gly Glu Pro Gly Arg Asp Leu Ala Ser Ser Glu Asn Gly 340 345 350 Thr Glu Cys Arg Ser Gly Phe Val Arg His Asn Gly Ser Cys Arg Ser 355 360 365 Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly Gly Gln Cys Tyr 370 375 380 Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn Thr Gln Asp Tyr 385 390 395 400 Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile Thr Asp Phe Gln 405 410 415 Val Met Cys Val Ala Val Gly Ser Ala Ala Leu Val Leu Leu Leu Leu 420 425 430 Phe Met Met Thr Val Phe Phe Ala Lys Lys Leu Tyr Leu Leu Lys Thr 435 440 445 Glu Asn Thr Lys Leu Arg Arg Thr Asn Lys Phe Arg Thr Pro Ala Glu 450 455 460 Leu His Asn Asp Asn Phe Ser Leu Ser Thr Ile Ala Glu Gly Ser His 465 470 475 480 Pro Asn Asp Asp Pro Ser Ala Pro His Lys Ile Gln Glu Ala Leu Lys 485 490 495 Ser Cys Leu Lys Glu Glu Glu Ser Phe Asn Ile Gln Asn Ser Met Ser 500 505 510 Pro Lys Leu Glu Gly Gly Lys Gly Asp Gln Ala Asp Leu Asp Val Asn 515 520 525 Cys Leu Gln Asn Asn Leu Thr 530 535 <210> 165 <211> 1977 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of human CSPG5-FLAG_Fc including signal sequence <400> 165 atggggcgag ccggggcgg gggcccgggc cggggccgc cgccactgct gctgtttctg 60 ggggccgcgc tggtcctggc ctctggggcc gtgccggcgc gtgaggcggg cagcgcggtt 120 gaggccgaag agctggtgaa gggcagcccg gcgtgggagc cgcctgccaa cgacacgcgg 180 gaaagccg gcccaccagc ggctggggaa gatgaggcgt cgtggacgg gcccggtggc 240 gagctggccg ggccagaaga ggtgctctcag gagtcggctg cggtgaccgg caccgcctgg 300 ctggaagctg acagcccagg cctgggagga gtgaccgcag aggcgggcag cggcgatgcc 360 caggcccttc cagctacgct ccaggctccc cacgaggtcc tcgggcagtc aatcatgccc 420 cctgccattc ctgaggctac agaggccagc gggccaccct cccccacccc cggcgacaag 480 ctgagcccag cttctgaact ccccaaggag agccccttgg aggtttggct gaacctgggg 540 ggcagcacac ccgaccctca agggccagag ctgacttacc catttcaggg caccctggag 600 ccccaaccgg catcagatat cattgacatc gactacttcg areactgga tggtgagggt 660 cgtggcgcag atctggggag cttcccaggg tcaccaggaa cctcagaagaa ccaccctgat 720 actgagggag agaccccttc ctggagcctg cttgacttat acgatgattt cacccccttc 780 gatgaatctg atttctaccc caccacatcc tttatgatg acttggatga agagggag 840 gaagaggagg atgacaaaga tgcagtagga ggtggagacc tagagatga aaatgagctt 900 ctagtgccca ctgggaagcc tggtctgggg cccgggacag gccagcccac cagtcggtgg 960 catgctgtcc ctccacagca cactctgggg tcggtccccg gcagcagcat cgccctcagg 1020 ccccgcccag gagagccagg cagggacttg gcctccagtg aaaatggcac tgagtgccgc 1080 agtggctttg tgcggcataa cggctcctgc cggtcagtgt gcgacctctt cccaagttac 1140 tgtcacaatg gcggccagtg ctacctggtg gagaacatag gggccttctg caggtgcaac 1200 acgcaggact acatctggca caaggggatg cgctgcgagt ccatcatcac cgacttctct 1260 agagcagact acaaggacga cgatgacaag actagtgaca aaactcacac atgcccaccg 1320 tgcccagcac ctgaactcct gggggaccg tcagtcttcc tcttcccccc aaaacccaag 1380 gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1440 gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1500 acaaagccgc gggagggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1560 ctgcaccagg actggctgaa tggcaaggag tacaagtgca aggtctccaa caaagccctc 1620 ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1680 tacaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gacctgcctg 1740 gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1800 aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1860 aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1920 catgaggctc tgcacaacca ctacacgcag aagagcctct ccctgtctcc gggtaaa 1977 <210> 166 <211> 659 <212> PRT <213> Artificial sequence <220> <223> Description of the artificial sequence: Amino acid sequence of human CSPG5 including the signal sequence <400> 166 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly Arg Gly Pro Pro Pro Leu 1 5 10 15 Leu Leu Phe Leu Gly Ala Ala Leu Val Leu Ala Ser Gly Ala Val Pro 20 25 30 Ala Arg Glu Ala Gly Ser Ala Val Glu Ala Glu Glu Leu Val Lys Gly 35 40 45 Ser Pro Path Trp Glu Pro Pro Path Asn Asp Thr Arg Glu Glu Path Gly 50 55 60 Pro Pro Ala Ala Gly Glu Asp Glu Ala Ser Trp Thr Ala Pro Gly Gly 65 70 75 80 Glu Leu Ala Gly Pro Glu Glu Val Leu Gln Glu Ser Ala Ala Val Thr 85 90 95 Gly Thr Path Trp Leu Glu Path Asp Ser Pro Gly Leu Gly Gly Val Thr 100 105 110 Ala Glu Ala Gly Ser Gly Asp Ala Gln Ala Leu Pro Ala Thr Leu Gln 115 120 125 Pathway Pro His Glu Val Leu Gly Gln Ser Ile Met Pro Pro Pathway Ile Pro 130 135 140 Glu Ala Thr Glu Ala Ser Gly Pro Pro Ser Pro Thr Pro Gly Asp Lys 145 150 155 160 Leu Ser Pro Path Ser Glu Leu Pro Lys Glu Ser Pro Leu Glu Val Trp 165 170 175 Leu Asn Leu Gly Gly Ser Thr Pro Asp Pro Gln Gly Pro Glu Leu Thr 180 185 190 Tyr Pro Phe Gln Gly Thr Leu Glu Pro Gln Pro Ala Ser Asp Ile Ile 195 200 205 Asp Ile Asp Tyr Phe Glu Gly Leu Asp Gly Glu Gly Arg Gly Ala Asp 210 215 220 Leu Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro Asp 225 230 235 240 Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp Asp 245 250 255 Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe Tyr 260 265 270 Asp Asp Leu Asp Glu Glu Glu Glu Glu Glu Glu Asp Asp Lys Asp Ala 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Glu Leu Leu Val Pro Thr 290 295 300 Gly Lys Pro Gly Leu Gly Pro Gly Thr Gly Gln Pro Thr Ser Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Ser Val Pro Gly Ser Ser 325 330 335 Ile Ala Leu Arg Pro Arg Pro Gly Glu Pro Gly Arg Asp Leu Ala Ser 340 345 350 Ser Glu Asn Gly Thr Glu Cys Arg Ser Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Ser Arg Ala Asp Tyr Lys Asp Asp Asp Asp Lys Thr Ser 420 425 430 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 435 440 445 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 450 455 460 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 465 470 475 480 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 485 490 495 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 500 505 510 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 515 520 525 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 530 535 540 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 545 550 555 560 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 565 570 575 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 580 585 590 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 595 600 605 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 610 615 620 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 625 630 635 640 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 645 650 655 Pro Gly Lys <210> 167 <211> 1977 <212> DNA <213> Artificial Sequence <220> <223> Description of artificial sequence: Base sequence of mouse CSPG5-FLAG_Fc including signal sequence <400> 167 atgggccgag ctggaggcgg gggcccggac tgggggccgc cgccagtgct gctgcttctg 60 ggggtcacgc tggtgctcac cgctggggcc gtaccggcac gggaaacagg cagtgcgatc 120 gaggctgaag agctggtgag gagcagcctg gcatgggagt cgcgtgccaa tgacacgcgg 180 gaggaagccg gcctgccagc agctggggaa gatgagacct cgtggacaga gcggggcagt 240 gagatggctg cggtgggccc tggggtcggg ccagaggagg cactagaggc atcggctgca 300 gtgactggca ctgcctggct agaggcagat ggcccaggcc tgggtggagt gactgcagag 360 gctggcagtg gcgacgccca gacccttcca gctacgctcc aggctcctga tgaggccctt 420 gggtcatcta caatgccccc tgccatccct gaggctactg aaaccagtgg acctccctcc 480 cctgctgtcc atgataagcc tagtgtaggc cctgaactcc ctaagagat cccttggag 540 gttcggctga acctgggagg cagcacacca gagcccactt ttcccttca gggcactc 600 gagacccaac cagcctcaga tataattgac attgattact ttgaaggatt ggatagtgag 660 ggtcgtggtg cagacatggg cagctcccg gggtcaccag gaacctcaga aaatcacct 720 gataccgaag gagagacccc ttcctggagc ctgcttgatt tgtatgatga cttcacccct 780 tttgatgagt ctgatttcta ccccaccaca tccttctatg atgatttgga agaggaggaa 840 gagaggagg aggatagga tacagtagga ggtggagacc tggagatga aaacgacctt 900 ctcctgccct ctcaaagcc tggtgtgggg cctgggacag vakagcccac CAccggtgg 960 catgctgttc cccacagca tactctgggg atgtacctg gcagcagcat ctctcttagg 1020 ccccgccccg gagatccagg agacctg gcctcaggag aaatggcac agagtgccg 1080 gttggcttcg tcaggcacaa tggctcctgc cggtcagctct gtgactt tccgagttac 1140 tgtcacaacg gcggccagtg ctacctggtg gagacatag gggctttg caggtgtaac 1200 acccaggact acatctggca caaggggatg cgctgtgagt ccatcatcac ggacttctct 1260 agagcagact acaaggacga cgatgacaag actagtgaca aaactcacac atgcccaccg 1320 tgcccagcac ctgaactcct gggggaccg tcagtcttcc tcttcccccc aaaacccaag 1380 gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1440 gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1500 acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1560 ctgcaccagg actggctgaa tggcaaggag tacaagtgca aggtctccaa caaagccctc 1620 ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1680 tacaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gacctgcctg 1740 gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1800 aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1860 aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1920 catgaggctc tgcacaacca ctacacgcag aagagcctct ccctgtctcc gggtaaa 1977 <210> 168 <211> 659 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of mouse CSPG5-FLAG_Fc including signal sequence <400> 168 Met Gly Arg Ala Gly Gly Gly Gly Pro Asp Trp Gly Pro Pro Pro Val 1 5 10 15 Leu Leu Leu Leu Gly Val Thr Leu Val Leu Thr Ala Gly Ala Val Pro 20 25 30 Ala Arg Glu Thr Gly Ser Ala Ile Glu Ala Glu Glu Leu Val Arg Ser 35 40 45 Ser Leu Ala Trp Glu Ser Arg Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Leu Pro Ala Ala Gly Glu Asp Glu Thr Ser Trp Thr Glu Arg Gly Ser 65 70 75 80 Glu Met Ala Ala Val Gly Pro Gly Val Gly Pro Glu Glu Ala Leu Glu 85 90 95 Ala Ser Ala Ala Val Thr Gly Thr Ala Trp Leu Glu Ala Asp Gly Pro 100 105 110 Gly Leu Gly Gly Val Thr Ala Glu Ala Gly Ser Gly Asp Ala Gln Thr 115 120 125 Leu Pro Ala Thr Leu Gln Ala Pro Asp Glu Ala Leu Gly Ser Ser Thr 130 135 140 Met Pro Pro Ala Ile Pro Glu Ala Thr Glu Thr Ser Gly Pro Pro Ser 145 150 155 160 Pro Ala Val His Asp Lys Pro Ser Val Gly Pro Glu Leu Pro Lys Glu 165 170 175 Ile Pro Leu Glu Val Arg Leu Asn Leu Gly Gly Ser Thr Pro Glu Pro 180 185 190 Thr Phe Pro Leu Gln Gly Thr Leu Glu Thr Gln Pro Ala Ser Asp Ile 195 200 205 Ile Asp Ile Asp Tyr Phe Glu Gly Leu Asp Ser Glu Gly Arg Gly Ala 210 215 220 Asp Met Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro 225 230 235 240 Asp Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp 245 250 255 Asp Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe 260 265 270 Tyr Asp Asp Leu Glu Glu Glu Glu Glu Glu Glu Glu Asp Lys Asp Thr 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Asp Leu Leu Leu Pro Ser 290 295 300 Gln Lys Pro Gly Val Gly Pro Gly Thr Gly Gln Pro Thr Asn Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Met Val Pro Gly Ser Ser 325 330 335 Ile Ser Leu Arg Pro Arg Pro Gly Asp Pro Gly Lys Asp Leu Ala Ser 340 345 350 Gly Glu Asn Gly Thr Glu Cys Arg Val Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Ser Arg Ala Asp Tyr Lys Asp Asp Asp Asp Lys Thr Ser 420 425 430 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 435 440 445 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 450 455 460 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 465 470 475 480 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 485 490 495 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 500 505 510 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 515 520 525 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 530 535 540 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 545 550 555 560 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 565 570 575 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 580 585 590 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 595 600 605 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 610 615 620 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 625 630 635 640 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 645 650 655 Pro Gly Lys <210> 169 <211> 1947 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of human CSPG5-GST including signal sequence <400> 169 atggggcgag ccgggggcgg gggcccgggc cgggggccgc cgccactgct gctgtttctg 60 ggggccgcgc tggtcctggc ctctggggcc gtgccggcgc gtgaggcggg cagcgcggtt 120 gaggccgaag agctggtgaa gggcagcccg gcgtgggagc cgcctgccaa cgacacgcgg 180 gaagaagccg gcccaccagc ggctggggaa gatgaggcgt cgtggacggc gcccggtggc 240 gagctggccg ggccagaaga ggtgctgcag gagtcggctg cggtgaccgg caccgcctgg 300 ctggaagctg acagcccagg cctgggagga gtgaccgcag aggcgggcag cggcgatgcc 360 caggcccttc cagctacgct ccaggctccc cacgaggtcc tcgggcagtc aatcatgccc 420 cctgccattc ctgaggctac agaggccagc gggccaccct cccccacccc cggcgacaag 480 ctgagcccag cttctgaact ccccaaggag agccccttgg aggtttggct gaacctgggg 540 ggcagcacac ccgaccctca agggccagag ctgacttacc catttcaggg caccctggag 600 ccccaaccgg catcagatat cattgacatc gactacttcg aggactgga tggtgagggt 660 cgtggcgcag atctggggag cttcccaggg tcaccaggaa cctcagagaa ccaccctgat 720 actgagggag agaccccttc ctggagcctg cttgacttat acgatgattt cacccccttc 780 gatgaatctg atttctaccc caccacatcc tttatgatg acttggatga agagggag 840 gaagaggagg atgacaaaga tgcagtagga ggtggagacc tagagatga aaatgagctt 900 ctagtgccca ctgggaagcc tggtctgggg cccgggacag gccagcccac cagtcggtgg 960 catgctgtcc ctccacagca cactctgggg tcggtccccg gcagcagcat cgccctcagg 1020 ccccgcccag gagagccagg cagggacttg gcctccagtg aaaatggcac tgagtgccgc 1080 agtggctttg tgcggcataa cggctcctgc cggtcagtgt gcgacctctt cccaagttac 1140 tgtcacaatg gcggccagtg ctacctggtg gagaacatag gggccttctg caggtgcaac 1200 acgcaggact acatctggca caaggggatg cgctgcgagt ccatcatcac cgacttcggt 1260 accctggaag ttctgttcca ggggcccatg tcccctatac taggttattg gaaaattaag 1320 ggccttgtgc aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat 1380 ttgtatgagc gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag 1440 tttcccaatc ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc 1500 atacgttata tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag 1560 atttcaatgc ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat 1620 agtaaagact ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa 1680 atgttcgaag atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct 1740 gacttcatgt tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat 1800 gccttcccaa aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag 1860 tacttgaaat ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt 1920 ggtggcgacc atcctccaaa atcggat 1947 <210> 170 <211> 649 <212> PRT <213> artificial sequence <220> <223> Artificial sequence Description: Amino acid sequence of human CSPG5-GST including signal sequence <400> 170 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly Arg Gly Pro Pro Pro Leu 1 5 10 15 Leu Leu Phe Leu Gly Ala Ala Leu Val Leu Ala Ser Gly Ala Val Pro 20 25 30 Ala Arg Glu Ala Gly Ser Ala Val Glu Ala Glu Glu Leu Val Lys Gly 35 40 45 Sir Pro Ala Trp Glu Pro Pro Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Pro Pro Ala Ala Gly Glu Asp Glu Ala Ser Trp Thr Ala Pro Gly Gly 65 70 75 80 Glu Leu Ala Gly Pro Glu Glu Val Leu Gln Glu Ser Ala Ala Val Thr 85 90 95 Gly Thr Ala Trp Leu Glu Ala Asp Ser Pro Gly Leu Gly Gly Val Thr 100 105 110 Ala Glu Ala Gly Ser Gly Asp Ala Gln Ala Leu Pro Ala Thr Leu Gln 115 120 125 Ala Pro His Glu Val Leu Gly Gln Ser Ile Met Pro Pro Ala Ile Pro 130 135 140 Glu Ala Thr Glu Ala Ser Gly Pro Pro Ser Pro Thr Pro Gly Asp Lys 145 150 155 160 Leu Ser Pro Ala Ser Glu Leu Pro Lys Glu Ser Pro Leu Glu Val Trp 165 170 175 Leu Asn Leu Gly Gly Ser Thr Pro Asp Pro Gln Gly Pro Glu Leu Thr 180 185 190 Tyr Pro Phe Gln Gly Thr Leu Glu Pro Gln Pro Ala Ser Asp Ile Ile 195 200 205 Asp Ile Asp Tyr Phe Glu Gly Leu Asp Gly Glu Gly Arg Gly Ala Asp 210 215 220 Leu Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro Asp 225 230 235 240 Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp Asp 245 250 255 Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe Tyr 260 265 270 Asp Asp Leu Asp Glu Glu Glu Glu Glu Glu Glu Asp Asp Lys Asp Ala 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Glu Leu Leu Val Pro Thr 290 295 300 Gly Lys Pro Gly Leu Gly Pro Gly Thr Gly Gln Pro Thr Ser Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Ser Val Pro Gly Ser Ser 325 330 335 Ile Ala Leu Arg Pro Arg Pro Gly Glu Pro Gly Arg Asp Leu Ala Ser 340 345 350 Ser Glu Asn Gly Thr Glu Cys Arg Ser Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Gly Thr Leu Glu Val Leu Phe Gln Gly Pro Met Ser Pro 420 425 430 Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu 435 440 445 Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg 450 455 460 Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu 465 470 475 480 Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln 485 490 495 Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly 500 505 510 Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val 515 520 525 Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe 530 535 540 Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys 545 550 555 560 Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His 565 570 575 Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu 580 585 590 Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe 595 600 605 Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser 610 615 620 Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly 625 630 635 640 Gly Gly Asp His Pro Pro Lys Ser Asp 645 <210> 171 <211> 1947 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: base sequence of mouse CSPG5-GST including signal sequence <400> 171 atgggccgag ctggaggcgg gggcccggac tggggggccgc cgccagtgct gctgcttctg 60 ggggtcacgc tggtgctcac cgctggggcc gtaccggcac gggaaacagg cagtgcgatc 120 gaggctgaag agctggtgag gagcagcctg gcatgggagt cgcgtgccaa tgacacgcgg 180 gaggaagccg gcctgccagc agctggggaa gatgagacct cgtggacaga gcggggcagt 240 gagatggctg cggtgggccc tggggtcggg ccagaggagg cactagaggc atcggctgca 300 gtgactggca ctgcctggct agaggcagat ggcccaggcc tgggtggagt gactgcagag 360 gctggcagtg gcgacgccca gacccttcca gctacgctcc aggctcctga tgaggccctt 420 gggtcatcta caatgccccc tgccatccct gaggctactg aaaccagtgg acctccctcc 480 cctgctgtcc atgataagcc tagtgtaggc cctgaactcc ctaaagagat ccccttggag 540 gttcggctga acctgggagg cagcacacca gagcccactt ttccccttca gggcactctc 600 gagacccaac cagcctcaga tataattgac attgattact ttgaaggatt ggatagtgag 660 ggtcgtggtg cagacatggg cagcttcccg gggtcaccag gaacctcaga aaatcaccct 720 gataccgaag gagagacccc ttcctggagc ctgcttgatt tgtatgatga cttcacccct 780 tttgatgagt ctgatttcta ccccaccaca tccttctatg atgatttgga agaggaggaa 840 gagaggagg aggatagga tacagtagga ggtggagacc tggagatga aaacgacctt 900 ctcctgccct ctcaaagcc tggtgtgggg cctgggacag vakagcccac CAccggtgg 960 catgctgttc cccacagca tactctgggg atgtacctg gcagcagcat ctctcttagg 1020 ccccgccccg gagatccagg caggacctg gcctcaggag aaatggcac aggtgccg 1080 gttggcttcg tcaggcacaa tggctcctgc cggtcagctct gtgactt tccgagttac 1140 tgtcacaacg gcggccagtg ctacctggtg gagacatag gggctttg caggtgtaac 1200 acccaggact accatctggca cagggatg cgctgtgagt accatcac ggactcggt 1260 accctggaag ttctgttcca ggggccatg tcccctatac taggttattg gaaaattaag 1320 ggccttgtgc aacccactcg acttctttg gatatcttg aagaaaaata tgaagagcat 1380 ttgtatgagc gcgatgaagg tgaataatgg cgaaacaaaa agtttgaatt gggtttggag 1440 tttcccaatc ttccttatta tattgatgt gatgttaaat taacacagtc tatggccatc 1500 atacgttata tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag 1560 atttcaatgc ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat 1620 agtaaagact ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa 1680 atgttcgaag atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct 1740 gacttcatgt tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat 1800 gcgttcccaa aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag 1860 tacttgaaat ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt 1920 ggtggcgacc atcctccaaa atcggat 1947 <210> 172 <211> 649 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequence: amino acid sequence of mouse CSPG5-GST including signal sequence <400> 172 Met Gly Arg Ala Gly Gly Gly Gly Pro Asp Trp Gly Pro Pro Pro Val 1 5 10 15 Leu Leu Leu Leu Gly Val Thr Leu Val Leu Thr Ala Gly Ala Val Pro 20 25 30 Ala Arg Glu Thr Gly Ser Ala Ile Glu Ala Glu Glu Leu Val Arg Ser 35 40 45 Ser Leu Ala Trp Glu Ser Arg Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 Leu Pro Ala Ala Gly Glu Asp Glu Thr Ser Trp Thr Glu Arg Gly Ser 65 70 75 80 Glu Met Ala Ala Val Gly Pro Gly Val Gly Pro Glu Glu Ala Leu Glu 85 90 95 Ala Ser Ala Ala Val Thr Gly Thr Ala Trp Leu Glu Ala Asp Gly Pro 100 105 110 Gly Leu Gly Gly Val Thr Ala Glu Ala Gly Ser Gly Asp Ala Gln Thr 115 120 125 Leu Pro Ala Thr Leu Gln Ala Pro Asp Glu Ala Leu Gly Ser Ser Thr 130 135 140 Met Pro Pro Ala Ile Pro Glu Ala Thr Glu Thr Ser Gly Pro Pro Ser 145 150 155 160 Pro Ala Val His Asp Lys Pro Ser Val Gly Pro Glu Leu Pro Lys Glu 165 170 175 Ile Pro Leu Glu Val Arg Leu Asn Leu Gly Gly Ser Thr Pro Glu Pro 180 185 190 Thr Phe Pro Leu Gln Gly Thr Leu Glu Thr Gln Pro Ala Ser Asp Ile 195 200 205 Ile Asp Ile Asp Tyr Phe Glu Gly Leu Asp Ser Glu Gly Arg Gly Ala 210 215 220 Asp Met Gly Ser Phe Pro Gly Ser Pro Gly Thr Ser Glu Asn His Pro 225 230 235 240 Asp Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp 245 250 255 Asp Phe Thr Pro Phe Asp Glu Ser Asp Phe Tyr Pro Thr Thr Ser Phe 260 265 270 Tyr Asp Asp Leu Glu Glu Glu Glu Glu Glu Glu Glu Asp Lys Asp Thr 275 280 285 Val Gly Gly Gly Asp Leu Glu Asp Glu Asn Asp Leu Leu Leu Pro Ser 290 295 300 Gln Lys Pro Gly Val Gly Pro Gly Thr Gly Gln Pro Thr Asn Arg Trp 305 310 315 320 His Ala Val Pro Pro Gln His Thr Leu Gly Met Val Pro Gly Ser Ser 325 330 335 Ile Ser Leu Arg Pro Arg Pro Gly Asp Pro Gly Lys Asp Leu Ala Ser 340 345 350 Gly Glu Asn Gly Thr Glu Cys Arg Val Gly Phe Val Arg His Asn Gly 355 360 365 Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr Cys His Asn Gly 370 375 380 Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala Phe Cys Arg Cys Asn 385 390 395 400 Thr Gln Asp Tyr Ile Trp His Lys Gly Met Arg Cys Glu Ser Ile Ile 405 410 415 Thr Asp Phe Gly Thr Leu Glu Val Leu Phe Gln Gly Pro Met Ser Pro 420 425 430 Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg Leu 435 440 445 Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg 450 455 460 Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu 465 470 475 480 Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr Gln 485 490 495 Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu Gly 500 505 510 Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val 515 520 525 Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp Phe 530 535 540 Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu Lys 545 550 555 560 Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His 565 570 575 Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val Leu 580 585 590 Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val Cys Phe 595 600 605 Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr Leu Lys Ser 610 615 620 Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Phe Gly 625 630 635 640 Gly Gly Asp His Pro Pro Lys Ser Asp 645 BRIEF DESCRIPTION OF THE DRAWINGS

[0140] [ Figure 1 ] Figure 1 (A) to (D) show the results of measuring the concentration of each antibody in tissues. Figure 1 (A) shows the antibody concentration in serum 3 days after antibody administration. The vertical axis represents the antibody concentration (ng / mL), and the horizontal axis represents the administered antibody. Figure 1 (B) shows the antibody concentration in brain tissue 3 days after antibody administration. The vertical axis represents the antibody concentration (ng / g brain), and the horizontal axis represents the administered antibody. Figure 1 (C) shows the antibody concentration in serum 9 days after antibody administration. The vertical axis represents the antibody concentration (ng / mL), and the horizontal axis represents the administered antibody. Figure 1 (D) shows the antibody concentration in brain tissue 9 days after antibody administration. The vertical axis represents the antibody concentration (ng / g brain), and the horizontal axis represents the administered antibody.

[0141] [ Figure 2 ] Figure 2 (A) and (B) show the results of measuring the concentration of each antibody in tissues. Figure 2 (A) shows the antibody concentration in serum 7 days after antibody administration. The vertical axis represents the antibody concentration (ng / mL), and the horizontal axis represents the administered antibody. Figure 2 (B) shows the antibody concentration in brain tissue 7 days after antibody administration. The vertical axis represents the antibody elution amount (ng / g brain) and the horizontal axis represents the administered antibody. The antibody concentration is expressed as a value converted from the molar concentration using the molecular weight of the monoclonal antibody (150 kDa).

[0142] [ Figure 3 ] Figure 3 (A) to (D) show the results of measuring the concentration of each antibody in tissues. Figure 3 (A) and (C) each show the antibody concentration in serum 7 days after antibody administration. The vertical axis represents the antibody concentration (ng / mL), and the horizontal axis represents the administered antibody. Figure 3 (B) and (D) each show the antibody concentration in brain tissue 7 days after antibody administration. The vertical axis represents the amount of antibody eluted (ng / g brain) and the horizontal axis represents the administered antibody. The antibody concentration is expressed as a value converted from the molar concentration using the molecular weight of the monoclonal antibody (150 kDa).

[0143] [ Figure 4 ] Figure 4 (A) and (B) show the results of imaging assessment of the migration ability of each antibody in mouse brain. Figure 4 (A) shows imaging images of the brain 9 days after antibody administration. Figure 4 (B) shows the ratio of the amount of fluorescence in the brain corrected for the fluorescence intensity of the administered antibody to the anti-AVM antibody. The vertical axis represents the ratio to the anti-AVM antibody, and the horizontal axis represents the administered antibody.

[0144] [ Figure 5 ] Figure 5 The results of the internalization analysis of CSPG5202 scFv-hG4PE (R409K), CSPG5219 scFv-hG4PE (R409K) and CSPG5234 scFv-hG4PE (R409K) in hCSPG5 / L929#09 are shown. The horizontal axis represents the antibody concentration (ng / mL) and the vertical axis represents the cell viability (%). The dotted line graph shows the anti-AVM antibody as a negative control, and the solid line graph shows the sample. The black triangle mark (▲) shows the data of CSPG5202 scFv-hG4PE (R409K), the diamond mark (◇) shows the data of CSPG5219 scFv-hG4PE (R409K), and the black square mark (■) shows the data of CSPG5234 scFv-hG4PE (R409K).

[0145] [ Figure 6 ] Figure 6 The results of the internalization analysis of CSPG5202 scFv-hG4PE (R409K), CSPG5219 scFv-hG4PE (R409K) and CSPG5234 scFv-hG4PE (R409K) in IMR-32 are shown. The horizontal axis represents the antibody concentration (ng / mL) and the vertical axis represents the cell viability (%). The dotted line graph shows the anti-AVM antibody as a negative control, and the solid line graph shows the sample. The black triangle mark (▲) shows the data of CSPG5202 scFv-hG4PE (R409K), the diamond mark (◇) shows the data of CSPG5219 scFv-hG4PE (R409K), and the black square mark (■) shows the data of CSPG5234 scFv-hG4PE (R409K).

[0146] Description of Implementation

[0147] The present invention relates to antigen-binding molecules that bind to CSPG5. More specifically, the present invention relates to antibodies or antibody fragments thereof that bind to CSPG5.

[0148] The CSPG5 binding molecules of the present invention can be in any molecular form, as long as the molecules specifically bind to CSPG5 and the resulting molecules are retained in the brain, and can be any molecules such as proteins, nucleic acids, or low molecular weight compounds / high molecular weight compounds obtained by organic synthesis. Specifically, the CSPG5 binding molecules can be any one of recombinant proteins, antibodies, aptamers, low molecular weight compounds obtained by low molecular weight screening, etc., but antibodies and antibody fragments thereof are preferably exemplified. The CSPG5 binding molecules are preferably molecules that bind to the extracellular domain of CSPG5.

[0149] CSPG5 is a transmembrane chondroitin sulfate proteoglycan. For example, the full-length human CSPG5, including its signal sequence, consists of 539 amino acids. CSPG5 is primarily found in central nervous system tissues and plays a role in the maturation of cerebellar GABA-gated synapses and in molecular interactions during central nervous system development.

[0150] The animal species of CSPG5 to which the CSPG5-binding molecules of the present invention bind are mice, rats, rhesus monkeys and / or humans, etc., but are not particularly limited to these species, and suitable animal species can be selected according to the use of the antibody. For example, when the antibody of the present invention is used for medical purposes in humans, the antibody is preferably an antibody that binds to at least human CSPG5.

[0151] In the present invention, as human CSPG5, examples are a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 160 or the amino acid sequence of NCBI Accession No. NP_006565.2, a polypeptide consisting of an amino acid sequence in which one or more amino acids in the amino acid sequence represented by SEQ ID NO: 160 or the amino acid sequence of NCBI Accession No. NP_006565.2 are deleted, substituted or added and has the function of human CSPG5, a polypeptide consisting of an amino acid sequence having 60% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more homology with the amino acid sequence represented by SEQ ID NO: 160 or the amino acid sequence of NCBI Accession No. NP_006565.2 and has the function of human CSPG5, etc.

[0152] The polypeptide having an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 160 or the amino acid sequence represented by NCBI Accession No. NP_006565.2 can be produced, for example, by using a site-directed mutagenesis method [Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press (1989); Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997); Nucleic Acids Research, 10, 6487 (1982); Proc. Natl. Acad. Sci. USA, 79, 6409 (1982); Gene, 34, 315 (1985); Nucleic Acids Research, 13, 4431 (1985); Proc. Natl. Acad. Sci. USA, 82, 488 (1985)] can be obtained by introducing site-specific mutations into a DNA encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 160.

[0153] The number of amino acids to be deleted, substituted or added is not particularly limited, but is preferably one to several tens, such as 1 to 20, more preferably one to several, such as 1 to 5 amino acids.

[0154] The same applies to the amino acid sequence of mouse CSPG5 [SEQ ID NO: 162 or NCBI accession number NP_038912.3] and the amino acid sequence of rhesus monkey CSPG5 [SEQ ID NO: 164 or NCBI accession number AFE76329.1].

[0155] In the present invention, as the gene encoding human CSPG5, the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3 is exemplified. The present invention also includes a gene consisting of a nucleotide sequence in which one or more nucleotides are deleted, substituted or added in the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3 and comprising a DNA encoding a polypeptide having the function of CSPG5; a gene consisting of a nucleotide sequence having at least 60% or higher homology, preferably 80% or higher homology, more preferably 95% or higher homology to the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3 and comprising a DNA encoding a polypeptide having the function of CSPG5; or a gene consisting of a DNA which hybridizes under stringent conditions with a DNA comprising the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3 and encoding a polypeptide having the function of CSPG5, etc.

[0156] The DNA that hybridizes under stringent conditions refers to hybridizable DNA obtained by colony hybridization, plaque hybridization, Southern blot hybridization, DNA microarray, etc. using a DNA comprising the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3 as a probe.

[0157] Specifically, there can be exemplified a DNA that can be identified by performing a hybridization method at 65°C in the presence of 0.7 to 1.0 mol / L sodium chloride using a filter or microscope slide on which DNA derived from a colony or plaque to be hybridized, or a PCR product or oligoDNA having the sequence is immobilized [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989); Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997); DNA Cloning 1: Core Techniques, A Practical Approach, 2nd edition, Oxford University (1995)], and then the filter or microscope slide is washed at 65°C using a 0.1 to 2 times concentration saline sodium citrate (SSC) solution (the composition of a 1 times concentration SSC solution consists of 150 mmol / L sodium chloride and 15 mmol / L sodium citrate).

[0158] As the hybridizable DNA, there can be exemplified a DNA having at least 60% or higher homology to the nucleotide sequence represented by SEQ ID NO: 159 or the nucleotide sequence of NCBI Accession No. NM_006574.3, preferably a DNA having 80% or higher homology, more preferably a DNA having 95% or higher homology.

[0159] The same applies to the nucleotide sequence of mouse CSPG5 [SEQ ID NO: 161 or NCBI accession number NM_013884.3] and the nucleotide sequence of rhesus monkey CSPG5 [SEQ ID NO: 163 or NCBI accession number XM_015131074.1].

[0160] Examples of the functions of CSPG5 include participation in the maturation of cerebellar GABA-gated synapses during the development of central nervous tissues as described above, and intermolecular interactions.

[0161] Gene polymorphism is often observed in the nucleotide sequence of protein-encoding genes of eukaryotes. Among them, genes that have undergone small-scale mutations in the nucleotide sequence due to such polymorphism in the genes used in the present invention are also included in the genes encoding CSPG5 in the present invention.

[0162] In the present invention, unless otherwise specified, the numerical value of homology may be a value calculated using a homology search program known to those skilled in the art, however, for nucleotide sequences, examples are values ​​calculated using the default parameters in BLAST [J. Mol. Biol., 215, 403 (1990)] and the like, and for amino acid sequences, examples are values ​​calculated using the default parameters in BLAST2 [Nucleic Acids Res., 25, 3389 (1997), Genome Res., 7, 649 (1997), http: / / www.ncbi.nlm.nih.gov / Education / BLASTinfo / information3.html] and the like.

[0163] Regarding the default parameters, G (cost of opening a gap) is 5 in the case of nucleotide sequences and 11 in the case of amino acid sequences; -E (cost of extending a gap) is 2 in the case of nucleotide sequences and 1 in the case of amino acid sequences; -q (nucleotide mismatch penalty) is -3; -r (nucleotide match reward) is 1, and -e (expectation) is 10; -W (wordlength) is 11 in the case of nucleotide sequences and 3 in the case of amino acid sequences; -y [decay (X) in bits for blast extension] is 20 in the case of blastn and 7 in the case of programs other than blastn; -X (X decay value in bits for gapped alignments) is 15; and -Z (final X decay value in bits for gapped alignments) is 50 in the case of blastn and 25 in the case of programs other than blastn (http: / / www.ncbi.nlm.nih.gov / blast / html / blastcgihelp.html).

[0164] A polypeptide comprising a partial sequence of the amino acid sequence of any one of the various types of CSPG5 mentioned above can be produced by methods known to those skilled in the art. Specifically, the polypeptide can be produced by deleting a portion of the DNA encoding the amino acid sequence of any one of the various types of CSPG5 mentioned above, and culturing a transformant transfected with an expression vector comprising the obtained DNA. In addition, a polypeptide having an amino acid sequence in which one or more amino acids are deleted, replaced or added in the amino acid sequence of any one of the various types of CSPG5 can be obtained in the same manner as described above.

[0165] In addition, polypeptides composed of the amino acid sequence of any one of the various types of CSPG5 or polypeptides having an amino acid sequence in which one or more amino acids are deleted, replaced or added in the amino acid sequence of any one of the various types of CSPG5 can also be produced by chemical synthesis methods such as the fluorenylmethoxycarbonyl (Fmoc) method or the tert-butoxycarbonyl (tBoc) method.

[0166] In the present invention, the extracellular domain of human CSPG5 refers to the amino acid sequence from position 31 to position 423 in the amino acid sequence represented by SEQ ID NO: 160 or NCBI Accession No. NP_006565.2.

[0167] The extracellular domain of mouse CSPG5 refers to the amino acid sequence from position 31 to position 423 in the amino acid sequence represented by SEQ ID NO: 162 or NCBI Accession No. NP_038912.3.

[0168] The extracellular domain of rhesus CSPG5 refers to the amino acid sequence from position 31 to position 414 in the amino acid sequence represented by SEQ ID NO: 164 or NCBI Accession No. AFE76329.1.

[0169] The binding of the antibody of the present invention to the extracellular domain of CSPG5 can be confirmed by measuring the affinity of the antibody of the present invention for cells expressing CSPG5 or recombinant CSPG5 protein using enzyme-linked immunosorbent assay (ELISA), flow cytometry, surface plasmon resonance method, etc. In addition, it can also be confirmed by combining known immunoassay methods [Monoclonal Antibodies - Principles and Practice, 3rd Edition, Academic Press (1996); Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory (1988); Manual for monoclonal antibody experiments, Kodansha scientific books (1987)], etc.

[0170] The CSPG5 binding molecules of the present invention are molecules having the property of accumulating in the brain by specifically binding to the CSPG5 in the brain, and for example, the antibodies of the present invention are antibodies having the property of accumulating in the brain by being combined with the CSPG5 in the brain. In addition, the antibodies of the present invention are antibodies having the property of accumulating in the brain by passing through the blood-brain barrier in the brain from the periphery, migrating to the brain and being combined with the CSPG5 in the brain when the antibodies are administered peripherally to animals. The antibodies of the present invention are preferably antibodies with outstanding properties of accumulating in the brain or antibodies with enhanced properties of accumulating in the brain.

[0171] In the present invention, the "property of accumulating in the brain" refers to a property in which the target agent is retained in the brain when administered to a test animal. In other words, it means that the concentration of the target agent in the brain (or the amount in the brain) increases, or the target agent is present at a fixed concentration, so that it can be detected due to at least one reason selected from the following: increased migration into the brain, increased accumulation in the brain, decreased migration from the inside of the brain to the outside, decreased excretion from the inside of the brain to the outside, and decreased decomposition in the brain.

[0172] In the present invention, “having an excellent property of accumulating in the brain”, “having a high property of accumulating in the brain” or “having an enhanced property of accumulating in the brain” means that when the target substance is administered to a test animal, the concentration of the target substance in the brain (or the amount in the brain) is increased compared to the control after the same number of days from administration, or the target substance is present at a fixed concentration (amount) so that it can be detected in the brain for a long time.

[0173] This phenomenon occurs due to at least any of the following reasons: increased migration of the target substance into the brain, increased accumulation in the brain, decreased migration from the inside to the outside of the brain, decreased efflux from the inside to the outside of the brain, and decreased decomposition in the brain compared to the control.

[0174] In the present invention, “having an excellent property of accumulating in the brain”, “having a high property of accumulating in the brain” or “having an enhanced property of accumulating in the brain” include, for example, when the target subject is administered to a test animal, the concentration (amount) of the target subject in the brain is higher than that of the control 1 to 10 days after administration, preferably 2 to 10 days, 3 to 10 days, more preferably 4 to 10 days after administration, or the concentration of the target subject in the brain (or the amount in the brain) reaches its peak on the 4th day or later, preferably on the 5th day or later, 6th day or later, 7th day or later, 8th day or later, 9th day or later, more preferably 10th day or later after administration, and the like.

[0175] The antibody having an excellent property of accumulating in the brain, the antibody having a high property of accumulating in the brain, or the antibody having an enhanced property of accumulating in the brain may be any antibody as long as the antibody concentration (antibody amount) in the brain is higher than that of a control antibody or the antibody has the characteristic of being able to exist in the brain for a long time.

[0176] For example, examples include antibodies having characteristics that the ability to migrate into the brain and / or the ability to accumulate in the brain is higher than that of a control antibody, characteristics that the ability to migrate from the inside of the brain to the outside, the ability to be excreted, and / or the ability to be degraded in the brain are lower than those of a control antibody, and characteristics that the ability to migrate into the brain and / or the ability to accumulate in the brain is higher than the ability to migrate from the inside of the brain to the outside, the ability to be excreted, and / or the ability to be degraded in the brain, etc.

[0177] Therefore, examples of the antibodies or antibody fragments thereof of the present invention include antibodies or antibody fragments thereof that, when administered to an animal, have a higher antibody concentration (or antibody amount) in the brain than a control antibody after the same number of days have passed from administration, or antibodies or antibody fragments thereof that are able to exist in the brain for a long time, and the like.

[0178] The change in the antibody concentration (or antibody amount) in the brain may be any change, examples of which include a case where, after the antibody concentration in the brain once reaches a peak during the measurement period, the antibody concentration gradually decreases, a case where, after the antibody concentration in the brain has reached a peak, the antibody concentration continues to be maintained, or a case where the antibody concentration in the brain continues to increase after administration of the antibody, and the like.

[0179] Examples of the antibodies or antibody fragments thereof of the present invention include, for example, antibodies whose antibody concentration or antibody amount in the brain is higher than that of a control antibody on the 3rd or 9th day after administration to mice, antibodies whose antibody concentration or antibody amount in the brain is maintained or increased during the period from the 3rd to the 9th day after administration to mice, or antibodies whose presence in the brain can be clearly confirmed even on the 9th day or later after administration to mice, etc., but are not limited thereto.

[0180] The control antibody may be any antibody as long as it is of the same type or subclass as the test antibody, but for example, an anti-avermectin (AVM) antibody can be used.

[0181] In the present invention, examples of “in the brain” include, but are not limited to, in the brain parenchyma, in the cerebral ventricles, in the cerebrospinal fluid, and the like.

[0182] In the immunohistochemical staining of CSPG5, for example, neuropil, neurons (nerve cells) such as dendrites and nerve fibers and / or astrocytes dyeing (NPL 28,29 and 30) were confirmed. Therefore, as a case of CSPG5 binding molecules of the present invention, example is by specifically binding with the CSPG5 on neurons and / or astrocytes and having affinity to neurons and / or astrocytes, thereby having the molecule of the character of accumulation in the brain. As a case of antibody of the present invention, example is by for example by being combined with the CSPG5 on neurons and / or astrocytes and having affinity to neurons and / or astrocytes, thereby having the antibody of the character of accumulation in the brain.

[0183] In the present invention, as a method of administering the antibody to an animal, for example, intravenous administration, intracerebroventricular administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intranasal administration, intrathecal administration and the like are exemplified, but are not limited thereto.

[0184] In the present invention, as a method for measuring the property of accumulation of an antibody in the brain, examples include, for example, a method of collecting brain tissue a few days after administration of the antibody to an animal, followed by homogenization and centrifugation, and then measuring the antibody concentration in the obtained supernatant and calculating the amount of the antibody per unit brain weight, a method of detecting the presence of the antibody by a known immunological method using the collected brain tissue, a method of administering a labeled antibody to an animal and detecting the presence of the antibody over time using an in vivo imaging system, and the like.

[0185] Examples of the antibody of the present invention include antibodies selected from the following (a) to (s): Among them, antibody (e) is preferred from the viewpoint of the property of accumulation in the brain and internalization ability of the antibody.

[0186] (a) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 3, 4, and 5, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 8, 9, and 10, respectively;

[0187] (b) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 13, 14, and 15, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 18, 19, and 20, respectively;

[0188] (c) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 23, 24, and 25, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 28, 29, and 30, respectively;

[0189] (d) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 33, 34, and 35, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 38, 39, and 40, respectively;

[0190] (e) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 43, 44, and 45, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 48, 49, and 50, respectively;

[0191] (f) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 53, 54, and 55, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 58, 59, and 60, respectively;

[0192] (g) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 63, 64, and 65, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 68, 69, and 70, respectively;

[0193] (h) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 73, 74, and 75, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 78, 79, and 80, respectively;

[0194] (i) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 83, 84, and 85, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 88, 89, and 90, respectively;

[0195] (j) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 93, 94, and 95, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 98, 99, and 100, respectively;

[0196] (k) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 103, 104, and 105, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 108, 109, and 110, respectively;

[0197] (1) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 113, 114, and 115, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 118, 119, and 120, respectively;

[0198] (m) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 123, 124, and 125, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 128, 129, and 130, respectively;

[0199] (n) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 133, 134, and 135, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 138, 139, and 140, respectively;

[0200] (o) an antibody, wherein the amino acid sequences of CDR1 to CDR3 of VH comprise the amino acid sequences represented by SEQ ID NOs: 143, 144, and 145, respectively, and wherein the amino acid sequences of CDR1 to CDR3 of VL comprise the amino acid sequences represented by SEQ ID NOs: 148, 149, and 150, respectively;

[0201] (p) an antibody that competes with at least one of the antibodies described in (a) to (o) for binding to CSPG5;

[0202] (q) an antibody that binds to an epitope comprising the epitope to which any one of the antibodies described in (a) to (o) binds;

[0203] (r) an antibody that binds to the same epitope as that bound by any one of the antibodies described in (a) to (o); and

[0204] (s) An antibody comprising an amino acid sequence having 85% or higher homology to the amino acid sequence of any one of the antibodies described in (a) to (o).

[0205] The antibodies of the present invention include antibodies comprising amino acid sequences of VH CDR1 to CDR3 and VL CDR1 to CDR3 of an antibody having 85% or higher, preferably 90% or higher homology to the amino acid sequences of VH CDR1 to CDR3 and VL CDR1 to CDR3 of any of the antibodies described in (a) to (o). The 90% or higher homology is more preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology, etc.

[0206] In the present invention, as one case of the antibodies described in (a) to (o), examples are CSPG5115 antibody, CSPG5120 antibody, CSPG5168 antibody, CSPG5201 antibody, CSPG5202 antibody, CSPG5205 antibody, CSPG5206 antibody, CSPG5207 antibody, CSPG5208 antibody, CSPG5214 antibody, CSPG5219 antibody, CSPG5222 antibody, CSPG5227 antibody, CSPG5230 antibody, and CSPG5234 antibody, each of which is a human anti-CSPG5 monoclonal antibody. Among them, CSPG5202 antibody is preferred from the viewpoint of the property of accumulation in the brain and the internalization ability of the antibody.

[0207] In the present invention, the antibody (p) refers to a second antibody that inhibits binding of any one of the antibodies described in (a) to (o) to CSPG5 when the first antibody is defined as the first antibody.

[0208] In the present invention, the antibody (q) refers to a second antibody that binds to a second epitope including the first epitope when any one of the antibodies described in (a) to (o) is defined as a first antibody and the epitope to which the first antibody binds is defined as a first epitope.

[0209] Furthermore, the antibody (r) of the present invention refers to a second antibody that binds to the first epitope when any one of the antibodies described in (a) to (o) is defined as a first antibody and the epitope to which the first antibody binds is defined as a first epitope.

[0210] Furthermore, specific examples of the antibodies of the present invention include antibodies selected from the following (A) to (P). Among them, antibody (E) is preferred from the viewpoint of the antibody's brain accumulation and internalization ability.

[0211] (A) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 2, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 7;

[0212] (B) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 12, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 17;

[0213] (C) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 22, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 27;

[0214] (D) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 32, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 37;

[0215] (E) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 42, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 47;

[0216] (F) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 52, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 57;

[0217] (G) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 62, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 67;

[0218] (H) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 72, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 77;

[0219] (I) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 82, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 87;

[0220] (J) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 92, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 97;

[0221] (K) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 102, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 107;

[0222] (L) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 112, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 117;

[0223] (M) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 122, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 127;

[0224] (N) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 132, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 137;

[0225] (O) an antibody, wherein the amino acid sequence of VH comprises the amino acid sequence represented by SEQ ID NO: 142, and wherein the amino acid sequence of VL comprises the amino acid sequence represented by SEQ ID NO: 147; and

[0226] (P) An antibody comprising an amino acid sequence having 85% or higher homology to the amino acid sequence of any one of the antibodies described in (A) to (O).

[0227] The antibodies of the present invention include antibodies comprising VH and VL amino acid sequences of an antibody having 85% or greater, preferably 90% or greater homology to the VH and VL amino acid sequences of any of the antibodies described in (A) to (O). The 90% or greater homology is more preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology, etc.

[0228] In the present invention, as one case of the antibodies described in (A) to (O), examples include CSPG5115 antibody, CSPG5120 antibody, CSPG5168 antibody, CSPG5201 antibody, CSPG5202 antibody, CSPG5205 antibody, CSPG5206 antibody, CSPG5207 antibody, CSPG5208 antibody, CSPG5214 antibody, CSPG5219 antibody, CSPG5222 antibody, CSPG5227 antibody, CSPG5230 antibody, and CSPG5234 antibody, each of which is a human anti-CSPG5 monoclonal antibody. Among them, CSPG5202 antibody is preferred from the viewpoint of the property of accumulation in the brain and the internalization ability of the antibody.

[0229] In the present invention, the EU index refers to the position of amino acid residues according to Sequences of Proteins of Immunological Interest, 5th edition (1991). Unless otherwise specified, the positions of amino acid residues shown below refer to the positions of amino acid residues according to the EU index.

[0230] An antibody molecule is also called an immunoglobulin (Ig), and its basic structure is a tetramer having two polypeptides called heavy chains (H chains) and two polypeptides called light chains (L chains).

[0231] Furthermore, each H chain is composed of the corresponding domains of the H chain variable domain (also called VH) and the H chain constant domain (also called CH) from the N-terminal side, and each L chain is composed of the corresponding domains of the L chain variable domain (also called VL) and the L chain constant domain (also called CL) from the N-terminal side.

[0232] As CH, α, δ, ε, γ, and μ chains are known for each subclass. The CH is further composed of the corresponding domains of the CH1 domain, hinge domain, CH2 domain, and CH3 domain from the N-terminal side.

[0233] The domain refers to the functional structural unit of each polypeptide that constitutes the antibody molecule. In addition, the CH2 domain and CH3 domain are collectively referred to as the Fc (crystallizable fragment) region or simply Fc. As CL, C λ Chain and C κ chain.

[0234] The subclasses of antibodies in which CH is an α, δ, ε, γ, and μ chain are called IgA, IgD, IgE, IgG, and IgM, respectively. Each antibody subclass sometimes has isotypes depending on the animal. In humans, there are IgA1 and IgA2 isotypes for IgA, and IgG1, IgG2, IgG3, and IgG4 isotypes for IgG.

[0235] In the present invention, the CH1 domain, hinge domain, CH2 domain, CH3 domain and Fc region can be specified according to the EU index by numbering amino acid residues from the N-terminus.

[0236] Specifically, CH1 is defined as the amino acid sequence at positions 118 to 215 according to the EU index, the hinge is defined as the amino acid sequence at positions 216 to 230 according to the EU index, CH2 is defined as the amino acid sequence at positions 231 to 340 according to the EU index, CH3 is defined as the amino acid sequence at positions 341 to 447 according to the EU index, and the Fc region is defined as the amino acid sequence at positions 231 to 447 according to the EU index.

[0237] As the antibody of the present invention, polyclonal antibodies, monoclonal antibodies and oligoclonal antibodies are all included. The polyclonal antibody refers to a group of antibody molecules secreted by antibody-producing cells of different clones. The monoclonal antibody is an antibody secreted by antibody-producing cells of a single clone, and refers to an antibody that only recognizes one epitope (also referred to as an antigenic determinant), and wherein the amino acid sequence (primary sequence) constituting the monoclonal antibody is homogeneous. The oligoclonal antibody refers to a group of antibody molecules in which a plurality of different monoclonal antibodies are mixed.

[0238] As the monoclonal antibody in the present invention, examples are antibodies produced by hybridomas or genetically recombinant antibodies produced by transformants transformed with an expression vector containing an antibody gene.

[0239] As the epitope, examples are a single amino acid sequence, a conformation constituted by an amino acid sequence, a post-translationally modified amino acid sequence, a conformation constituted by a post-translationally modified amino acid sequence, and the like, each of which is recognized and bound by the monoclonal antibody.

[0240] As the post-translationally modified amino acid sequence, examples are O-linked glycans in which glycans are attached to Tyr and Ser having an OH substituent, N-linked glycans in which glycans are attached to Gln and Asn having an NH2 substituent, and tyrosine-sulfated amino acid sequences in which a sulfate molecule is attached to Tyr having an OH substituent.

[0241] The epitope of CSPG5 to which the antibody of the present invention binds can be identified by performing an antibody binding assay using a deletion variant in which certain domains of CSPG5 are deleted, a mutant in which certain domains of CSPG5 are replaced by a domain derived from another protein, a partial peptide fragment of CSPG5, etc. In addition, the antibody binding assay can also be performed using cells expressing the deletion variant or the mutant.

[0242] Alternatively, the epitope of CSPG5 to which the antibody of the present invention binds can also be identified by adding the antibody of the present invention to a peptide fragment of CSPG5 obtained by protease digestion and performing epitope mapping using known mass spectrometry.

[0243] The antibodies of the present invention also include genetically recombinant antibodies produced by genetic recombination technology, such as mouse antibodies, rat antibodies, hamster antibodies, rabbit antibodies, llama antibodies, camel antibodies, alpaca antibodies, chimeric antibodies, humanized antibodies (also known as "CDR-grafted antibodies") and human antibodies.

[0244] In the present invention, the chimeric antibody refers to an antibody in which VH and VL are derived from an animal species different from CH and CL. An antibody composed of VH and VL of an antibody from an animal other than humans (non-human animals) and CH and CL of a human antibody is called a human chimeric antibody, and an antibody composed of VH and VL of an antibody from an animal other than mice and CH and CL of a mouse antibody is called a mouse chimeric antibody. Other chimeric antibodies are also named in the same way.

[0245] As the non-human animal, any animal such as mouse, rat, hamster, rabbit, llama, camel or alpaca can be used as long as it is an animal capable of producing hybridomas or antibody phage libraries.

[0246] The hybridoma refers to a cell obtained by fusing B cells obtained by immunizing a non-human animal with an antigen with myeloma cells derived from mice or the like, and produces a monoclonal antibody having desired antigen specificity.

[0247] The antibody phage library is a library in which immunoglobulin variable region genes are cloned into phage and antigen-binding molecules are expressed on the surface of the phage. Examples of the phage used are M13 phage, but are not particularly limited.

[0248] The antigen-binding molecules displayed on phages may be in any form, but are preferably antibody fragments such as scFv, Fab, or VHH.

[0249] In the present invention, the antibody phage library can be any of an immune library, a natural library and a synthetic library.

[0250] The immune library refers to an antibody phage library constructed based on antibody genes derived from lymphocytes of animals or patients immunized with antigens. The natural library refers to an antibody phage library constructed based on antibody genes derived from lymphocytes of normal animals or healthy humans. The synthetic library refers to a library in which the CDRs of V genes or reconstructed functional V genes in genomic DNA are replaced by oligonucleotides encoding random amino acid sequences of appropriate length.

[0251] As a method for producing chimeric antibodies, a method for producing human chimeric antibodies will be described below. Other chimeric antibodies can also be produced in the same manner.

[0252] The human chimeric antibody can be produced as follows: cDNAs encoding VH and VL are obtained from a hybridoma derived from non-human animal cells producing a monoclonal antibody, each of the cDNAs is inserted into an expression vector for animal cells having DNA encoding CH and CL of a human antibody, thereby constructing a human chimeric antibody expression vector, and then the vector is introduced into animal cells and the antibody is expressed.

[0253] In addition, the human chimeric antibody can also be produced as follows: genes encoding VH and VL are cloned from an antibody phage library derived from a non-human animal, each of the genes is inserted into an expression vector for animal cells having DNA encoding CH and CL of a human antibody, thereby constructing a human chimeric antibody expression vector, and then the vector is introduced into animal cells to express the antibody.

[0254] The humanized antibody refers to an antibody in which the amino acid sequences of the CDRs of VH and VL of a non-human animal antibody are transplanted into the corresponding CDRs of VH and VL of a human antibody. The regions outside the CDRs of VH and VL are called FRs.

[0255] The humanized antibody can be produced as follows: construct a cDNA encoding the amino acid sequence of VH composed of the amino acid sequence of CDR of VH of a non-human animal antibody and the amino acid sequence of FR of VH of any human antibody, and a cDNA encoding the amino acid sequence of VL composed of the amino acid sequence of CDR of VL of a non-human animal antibody and the amino acid sequence of FR of VL of any human antibody, insert each of the cDNAs into an expression vector for animal cells having DNA encoding CH and CL of a human antibody, thereby constructing a humanized antibody expression vector, and then introduce the vector into animal cells and express the antibody.

[0256] The human antibodies originally refer to antibodies naturally existing in the human body, but also include antibodies obtained from human antibody phage libraries or transgenic animals producing human antibodies.

[0257] The human antibodies can be obtained by immunizing mice with human immunoglobulin genes with the desired antigen (Tomizuka K. et al., Proc Natl Acad Sci USA. 97, 722-7, 2000). In addition, the human antibodies can be obtained by selecting human antibodies with the desired binding activity using a phage display library obtained by amplifying antibody genes from human-derived B cells without using immunization (Winter G. et al., Annu Rev Immunol. 12: 433-55. 1994).

[0258] Furthermore, the human antibodies can be obtained by immortalizing human B cells using Epstein-Barr virus to generate cells that produce human antibodies having the desired binding activity (Rosen A. et al., Nature 267, 52-54. 1977).

[0259] The human antibody phage library is a library of phages expressing antibody fragments such as Fab, scFv or VHH on the surface obtained by inserting antibody genes prepared from lymphocytes of humans (healthy humans or patients) into phage genes. Phages expressing antibody fragments with desired antigen-binding activity can be collected from the library using binding activity to a substrate with an antigen fixed thereon as an indicator. The antibody fragments can also be further converted into human antibody molecules consisting of two complete H chains and two complete L chains using genetic engineering techniques.

[0260] The transgenic animal producing human antibodies refers to an animal in which human antibody genes are incorporated into the chromosomes of the host animal. Specifically, transgenic animals producing human antibodies can be produced by introducing human antibody genes into mouse ES cells, implanting the ES cells into the early embryos of another mouse, and then allowing the embryos to develop into animals.

[0261] Production of human antibodies from the human antibody-producing transgenic animal can be performed by culturing a human antibody-producing hybridoma obtained by a general hybridoma production method using a mammal other than humans to produce and accumulate the human antibody in culture, and purifying the antibody from the culture.

[0262] The antibodies of the present invention include heavy chain antibodies consisting only of heavy chains. The heavy chain antibodies are antibodies obtained from camelids such as llamas, camels and alpacas, or genetically recombinant antibodies generated based on the antibodies.

[0263] In the present invention, the antibody fragment is a fragment of an antibody and refers to a fragment having antigen-binding activity. Examples thereof include Fab, Fab', F(ab')2, scFv, diabodies, dsFv, peptides comprising multiple CDRs, VHH, etc. In addition, the antibody fragment of the present invention also includes any antibody fragment, as long as the antibody fragment comprises a partial fragment of an antibody and has CSPG5 binding activity, for example, an antibody fragment obtained by fusing the full length or a portion of the constant region or Fc of an antibody to the antibody fragment, or an antibody fragment comprising a constant region or Fc.

[0264] The Fab is an antibody fragment obtained by treating an IgG antibody with papain (cleavage at the amino acid residue at position 224 in the H chain), has a molecular weight of about 50,000, and has antigen-binding activity, and in which about half of the H chain and the entire L chain on the N-terminal side are linked by a disulfide bond (SS bond).

[0265] The F(ab')2 is an antibody fragment obtained by treating IgG with pepsin (cleavage at the 234th amino acid residue in the H chain), has a molecular weight of about 100,000 and has antigen-binding activity, and is slightly larger than a molecule obtained by linking Fab via an SS bond in the hinge region.

[0266] The Fab' is an antibody fragment having a molecular weight of about 50,000 and antigen-binding activity, wherein the SS bond in the hinge region of the F(ab')2 is cleaved.

[0267] The scFv is a VH-P-VL or VL-P-VH polypeptide, in which one VH and one VL are linked using a suitable peptide linker (P), for example, a linker peptide obtained by linking any number of linkers consisting of 4 Gly residues and 1 Ser residue (G4S), and is an antibody fragment having antigen-binding activity.

[0268] The diabody is an antibody fragment in which scFvs having the same or different antigen-binding specificities form a dimer, and is an antibody fragment having bivalent antigen-binding activity to the same antigen or antigen-binding activity specifically to different antigens.

[0269] The dsFv is an antibody fragment obtained by linking polypeptides in which one amino acid residue in each of VH and VL is replaced by a cysteine ​​residue through an SS bond between the cysteine ​​residues, and has antigen-binding activity.

[0270] The peptide comprising CDRs is constructed to comprise at least one or more CDR regions of VH or VL and is an antibody fragment with antigen-binding activity. In a peptide comprising multiple CDRs, the CDRs may be connected directly or via a suitable peptide connector. As a peptide comprising CDRs of the present invention, a preferred embodiment is a peptide comprising 6 CDRs derived from an antibody of the present invention.

[0271] The peptide comprising the CDR can be produced by constructing a DNA encoding the CDRs of the VH and VL of the antibody of the present invention, inserting the DNA into an expression vector for prokaryotes or an expression vector for eukaryotes, then introducing the expression vector into the prokaryote or eukaryote and expressing the peptide. Alternatively, the peptide comprising the CDR can be produced by chemical synthesis methods such as the Fmoc method or the tBoc method.

[0272] The VHH is a variable domain of a heavy chain antibody and is also called a nanobody. The antibody fragment of the present invention includes any antibody fragment, as long as the antibody fragment includes any of the above antibody fragments or a partial fragment thereof and has CSPG5 binding activity.

[0273] In the present invention, an antibody or antibody fragment thereof having one antigen binding site is referred to as a monovalent antibody. Examples of monovalent antibody formats include the formats of antibodies or antibody fragments thereof having one antigen binding site described in WO 2014 / 054804, WO 2011 / 090754, WO 2007 / 048037, WO 2012 / 116927, and other formats.

[0274] In the present invention, an antibody or antibody fragment thereof that binds to three or more different antigens or epitopes in one molecule is referred to as a multispecific antibody. In addition, in the present invention, an antibody or antibody fragment thereof that binds to two different antigens or epitopes in one molecule is referred to as a bispecific antibody.

[0275] Examples of formats for multispecific or bispecific antibodies include those described in WO 2009 / 131239; WO 2014 / 054804; WO 01 / 077342; U.S. Patent Application Publication No. 2007 / 0071675; WO 2007 / 024715; Wu et al. [Nature Biotechnology, 2007, 25(11), pp. 1290-1297]; Labrijn et al. [PNAS 2013, vol. 110, no. 13, pp. 5145-5150]; Jong et al. [http: / / dx.doi.org / 10.1371 / journal.pbio.1002344]; Kontermann et al. [mAbs 2012, vol. 4, issue 2, pp. 182-197]; Spiess et al. [Molecular Immunology 67(2015)95-106]; Ridgway et al. [Proteinengineering, 1996 vol.9, no.7, pp.617-621]; WO 2009 / 080251; WO 2010 / 151792; WO 2014 / 033074, etc.

[0276] Specific examples of the bispecific antibody include the following bispecific antibodies and the like.

[0277] (1) A bispecific antibody, wherein amino acid modifications S354C / T366W are introduced into CH3 of one heavy chain (heavy chain A) of the two heavy chains of the antibody, and amino acid modifications Y349C / T366S / L368A / Y407V are introduced into CH3 of the other heavy chain (heavy chain B).

[0278] (2) A bispecific antibody in which an antibody fragment is fused to the C-terminus of the antibody.

[0279] (3) A bispecific antibody in which an antibody fragment is fused to the N-terminus of the antibody.

[0280] The bispecific antibody described in (1) may be a bispecific antibody in which the antigen-binding site comprising VH of heavy chain A binds to CSPG5 and the antigen-binding site comprising VH of heavy chain B binds to an antigen present in the brain, or a bispecific antibody in which the antigen-binding sites bind in exactly opposite manners.

[0281] Examples of the bispecific antibodies described in (2) include a bispecific antibody in which an antibody fragment is linked to the C-terminus of one of the two heavy chains constituting the antibody, a bispecific antibody in which an antibody fragment is linked to the C-terminus of both of the two heavy chains constituting the antibody, a bispecific antibody in which an antibody fragment is linked to the C-terminus of one of the two light chains constituting the antibody, a bispecific antibody in which an antibody fragment is linked to the C-terminus of both of the two light chains constituting the antibody, a bispecific antibody in which an antibody fragment is linked to the C-terminus of each of the two light chains and the C-terminus of the two heavy chains constituting the antibody, etc. Note that a suitable linker may be present between the C-terminus of the antibody and the antibody fragment.

[0282] The antibody fragment contained in the bispecific antibody described in (2) is preferably scFv, Fab, VHH, etc., but is not particularly limited thereto.

[0283] The bispecific antibody described in (2) may be a bispecific antibody in which the antigen binding site at the N-terminus binds to CSPG5 and in which the antigen binding site at the C-terminus binds to an antigen present in the brain, or a bispecific antibody in which the antigen binding sites bind in exactly the opposite manner.

[0284] The bispecific antibody described in (3) is a bispecific antibody in which an antibody fragment is linked to the N-terminus of at least one of the two heavy chains or two light chains constituting the antibody. In addition, a suitable linker may be present between the N-terminus of the heavy chain and / or light chain of the antibody and the antibody fragment. The antibody fragment contained in the bispecific antibody described in (3) is preferably, but not particularly limited to, scFv, Fab, VHH, etc.

[0285] In addition, examples of the bispecific antibody described in (3) include a bispecific antibody having a VH1-CH1-VH2-CH1-hinge-CH2-CH3 structure from the N-terminus of the heavy chain, a bispecific antibody having the above-mentioned heavy chain structure in which VH1 and VH2 each form an antigen-binding site together with VL, etc. VL that forms an antigen-binding site with VH1 and VH2 may have the same amino acid sequence or different amino acid sequences.

[0286] In the present invention, the multispecific antibody or bispecific antibody may be any antibody, as long as the antibody is a multispecific antibody or bispecific antibody that binds to CSPG5. Among these antibodies, multispecific antibodies or bispecific antibodies that bind to CSPG5 and an antigen present in the brain are preferred, and multispecific antibodies or bispecific antibodies comprising an antigen-binding site that binds to CSPG5 and an antigen-binding site that binds to an antigen present in the brain are even more preferred.

[0287] In the present invention, examples of the antigen present in the brain include proteins, polysaccharides, lipids, etc., and among these antigens, the antigen is preferably a protein.

[0288] Examples of proteins present in the brain include prion protein, 5T4, AFP, ADAM10, ADAM12, ADAM17, AFP, AXL, BCAM, BSG, C5, C5R, CA9, CA72-4, CSPG5, CCL11, CCL2, CCR1, CCR4, CCR5, CCR6, CD2, CD3E, CD4, CD5, CD6, CD8, CD11, CD18, CD19, CD20, CD22, CD24, CD25, CD29, CD30, CD32B, CD33, CD37, CD38, CD40, CD40LG, CD44, CD47, CD52, CD55SC1, CD56, CD66E, CD71, CD72, CD74, CD79a, CD79b, CD80, CD86, CD95, CD98, CD137, CD147, CD138, CD168, CD200, CD248, CD254, CD257, CDH2, CDH3, CEA, CEACAM1, CEACAM5, CEACAM6, CEACAM8, Claudin-3, Claudin-4, CSF-1, CSF2RA, CSPG-4, CSPG5, CTLA4, CRF-1, Cripto, CXCR4, CXCR5, DJ-1, DLL4, DR4, DR5, ED-B, EFNA2, E GFR, EGFRvIII, ETBR, ENPP3, EPCAM, EphA2, EphA4, EPOR, ERBB2, ERBB3, ERBB4, FAPα, FAS, FcγRI, FCER2, FGFR1, FGFR2, FGFR3, FGFR4, FLT1, FOLH1, FOLR1, GDF2, GFR, GLP1R, Glycan-3, GPNMB, GRP78, HAPLN4, HB-EGF, HGF, HLA-DRβ, HMGB1, ICAM1, ICAM5, IFNA1, IFNB, IgE, IgE-Fc, IGF1R, IL10, IL12B, I L13, IL15, IL17A, IL1A, IL1B, IL2RA, IL4, IL5, IL5RA, IL6, IL6R, IL9, IL2Rα, IL2Rβ, IL2Rγ, INSR, ITGA2, ITGA2B2, ITGB3, ITGA4, ITGB7, ITGA5, ITGAL, ITGAV, ITGB3, ITGB2, KDR, L1CAM, LAG3, LRP3, mesothelin, MAG, MMP14, MMP15, MOG, MST1R, MSTN, MUC1, MUC4, MUC16, MUC5AC, myostatin, connexin 4, NCAN, NGF, NMDAR,NOTCH, NRG1, NRP, OX40, OX40L, P2Y6, PAR1, PDGFA, PDGFB, PDGFRA, PDGFRB, PD1, PDL1, PLP1, PSCA, PTPRZ, RET, RGMA, SLAM7, SL C44A4, TAG-72, TCR, TGFB1, TGFB2, TGFBR, TIMP2, TLR9, TNF, TNFR, TNFRSF10A, TNFRSF10B, TNFRSF12A, TNFSF13, TNFSF14, TNFS F2, TNFSF7, TREM2, TRAILR2, TRKA, TRKB, TRKC, transferrin, VEGF, VEGFR, VLA-4, CGRP, α-synuclein, TDP-43, Tau, FUS, amyloid peptide-β (Aβ), APP, BACE1, presenilin, LINGO-1, Nogo, Troy, polyQ, androgen receptor, huntingtin protein, spinocerebellar ataxia protein 1, spinocerebellar ataxia protein 2, phosphorylated Tau, phosphorylated α-synuclein, etc., but the proteins are not limited to these proteins.

[0289] Examples of glycans present in the brain include Lewis-x, Lewis-y, CD15, and the like, but the glycans are not limited to these glycans.

[0290] Examples of lipids present in the brain include GD1a, GD2, GD3, GM1, GM2, GM3, phosphatidylserine, and the like, but the lipids are not limited to these lipids.

[0291] The antibodies or antibody fragments thereof of the present invention also include antibodies comprising any post-translationally modified amino acids. Examples of such post-translational modifications include deletion of lysine residues at the C-terminus of the H chain (lysine pruning), conversion of glutamine residues at the N-terminus of the polypeptide to pyroglutamine (pyroGlu), etc. [Beck et al., Analytical Chemistry, 85, 715-736 (2013)].

[0292] In the antibodies or antibody fragments thereof of the present invention, amino acid modifications of the Fc region may be performed. Examples of amino acid modifications of the Fc region include those for stabilizing the antibody or regulating its half-life in blood. Specific examples of amino acid modifications of the Fc region are those described in WO 2006 / 033386, WO 2006 / 075668, WO 2011 / 122011, WO 2009 / 125825, and the like.

[0293] The antibodies or antibody fragments thereof of the present invention also include fusion antibodies or fusion antibody fragments thereof modified by attaching a desired molecule to the antibody or antibody fragment thereof. The method for modifying the antibody is not particularly limited, and any method can be used as long as the method can modify the desired amino acid residues and glycans.

[0294] For example, examples are chemical modification using a chemical reaction [Introduction to Antibody Engineering, Chijinshokan Co., Ltd. (1994); Kolb et al., Angew Chem Int Ed Engl. 40. 2004-21, 2001], modification by genetic engineering technology in which a recombinant protein expression vector is introduced into a suitable host cell for expression using genetic recombination technology, and the like.

[0295] In the present invention, when the antibody or antibody fragment thereof is modified with another molecule by chemical modification, examples of modification sites are the constant region of the antibody or antibody fragment, and specifically, a Cys residue or an SS bond site at the C-terminus is preferred. It is also possible to introduce a residue that can be chemically modified later at any position of the antibody or antibody fragment in advance by genetic engineering techniques.

[0296] Furthermore, when the antibody or antibody fragment thereof is directly modified with another molecule by genetic engineering techniques, as the modification site, the N-terminus or C-terminus of the light chain or heavy chain of the antibody or antibody fragment is exemplified.

[0297] In the present invention, examples of the molecule used to modify the antibody or antibody fragment thereof include hydrophilic polymers, amphiphilic polymers, functional molecules, and the like.

[0298] Examples of the hydrophilic polymer and the amphiphilic polymer include polyoxyalkylene, molecules including polyols or polysaccharides, and the like.

[0299] Examples of the polyoxyalkylene include polyethylene glycol (PEG), polypropylene glycol, polypropylene glycol-ethylene glycol, and the like composed of a straight chain or a branched chain.

[0300] Examples of the molecule containing polyol or polysaccharide include linear or branched polysaccharides in which glucose is polymerized, such as amylose, dextran, pullulan, glycogen, etc. Furthermore, the molecule is not limited to homopolysaccharides but may be heteropolysaccharides.

[0301] The molecular weight of the molecule containing a hydrophilic polymer or an amphiphilic polymer is not particularly limited, but is preferably 100 Da or more, and preferably, for example, 100 Da to 100 kDa.

[0302] Examples of such functional molecules include antigen-binding molecules, fragments of antigen-binding molecules, drugs, bioactive peptides, bioactive proteins, nucleic acids, radiolabeled compounds, polysaccharides, lipids, fluorescent compounds, etc. Molecules that have bispecificity as a result of modification with functional molecules such as antigen-binding molecules are bispecific antibodies.

[0303] Examples of the antigen-binding molecule include antibodies, receptors, ligands, and the like.

[0304] The fragment of the antigen-binding molecule may be any fragment as long as the fragment is a fragment of the antigen-binding molecule and has antigen-binding activity.

[0305] Examples of the drug include anticancer agents such as alkylating agents, nitrosourea agents, antimetabolites, antiviral agents, antibiotics, plant alkaloids, topoisomerase inhibitors, tubulin polymerization inhibitors, hormone therapy agents, hormone antagonists, aromatase inhibitors, P-glycoprotein inhibitors, platinum complex derivatives, M phase inhibitors and kinase inhibitors [Clinicaloncology, Japanese Journal of Cancer and Chemotherapy (1996)], anti-inflammatory agents such as steroidal agents, nonsteroidal agents, immunomodulators, immunosuppressants and antihistamines [Inflammation and anti-inflammatory therapy, Ishiyaku Publishers, Inc. (1982)] and the like.

[0306] More specific examples thereof include mertansine, emtansine, amifostine (Ethyol), cisplatin, dacarbazine (DTIC), dactinomycin, dichloromethyldiethylamine (nitrogen mustard), streptozotocin, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), doxorubicin (Adriamycin), epirubicin, gemcitabine (Gemzar), daunomycin, procarbazine, mitomycin, cytarabine, etoposide, 5-fluorouracil, fluorouracil, vinblastine, vincristine, bleomycin, daunomycin, peplomycin, estramustine, paclitaxel (Taxol), docetaxel, Taxotere, aldesleukin, asparaginase, busulfan, carboplatin, oxaliplatin, nedaplatin, cladribine, camptothecin, 10-hydroxy-7-ethyl-camptothecin (SN38), floxuridine, fludarabine, hydroxyurea, idarubicin, mesna, irinotecan (CPT-11), topotecan, mitoxantrone, topotecan, leuprorelin, megestrol acetate, melphalan, mercaptopurine, hydroxyurea, plicamycin, mitotane, pegaspargase, pentostatin, pipobroman, streptozotocin, tamoxifen, goserelin, leuprorelin, flutamide, teniposide, testolactone, thioguanine, thiotepa, uracil, vinorelbine, chlorambucil, hydrocortisone pine, prednisolone, methylprednisolone, vindesine, nimustine, semustine, capecitabine, raltitrexed, azacitidine, UFT, oxaliplatin, gefitinib (Iressa), imatinib (STI571), erlotinib, FMS-like tyrosine kinase 3 (Flt3) inhibitors, vascular endothelial growth factor receptor (VEGFR) inhibitors, fibroblast growth factor receptor (FGFR) inhibitors, epidermal growth factor receptor (EGFR) inhibitors such as Tarceva, radicicol, 17-allylamino-17-demethoxygeldanamycin, rapamycin, amsacrine, all-trans retinoic acid, thalidomide, lenalidomide, anastrozole, fadrozole , letrozole, exemestane, bucillamine, azathioprine, mizoribine, cyclosporine, rapamycin, hydrocortisone, bexarotene (Targretin), tamoxifen, dexamethasone, progesterone, estrogen, anastrozole (Arimidex), leuprorelin, aspirin, indomethacin, celecoxib, azathioprine, penicillamine, gold thiomalate, chlorpheniramine maleate, chlorpheniramine, clematin, tretinoin, arsenic, bortezomib, allopurinol, calicheamicin, ibritumomab tiuxetan, targretin, ozogamicin, clarithromycin, tetrahydrofolate, ketoconazole, aminoglutethimide, suramin, methotrexate, maytansine alkaloids, etc., and their derivatives may also be included.

[0307] Examples of methods for linking the drug to the antibody or antibody fragment thereof include, in addition to the above methods, a method of linking the drug to an amino group of the antibody via glutaraldehyde, a method of linking the amino group of the drug to a carboxyl group of the antibody via water-soluble carbodiimide, and the like.

[0308] Examples of the biologically active peptides or biologically active proteins include interferon (IFN) -α, IFN-β, IFN-γ, interleukin (IL) -2, IL-12, IL-15, IL-18, IL-21, IL-23, granulocyte colony stimulating factor (G-CSF), granulocyte / macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), cytokines or growth factors that activate immune active cells such as NK cells, macrophages or neutrophils, proteases such as hydratases, lyases or isomerases, enzymes such as acid sphingomyelinase and glucocerebrosidase, toxins including bacterial toxins and plant toxins such as ricin, diphtheria toxin or ONTAK, antimicrobial peptides with cell membrane damaging activity, peptides with cell membrane affinity or cell membrane permeability, derivatives thereof, etc.

[0309] The nucleic acid may be any molecule as long as it is a molecule in which nucleotides or molecules having a function equivalent to that of nucleotides are polymerized, and examples thereof include siRNA, microRNA, antisense RNA / DNA, DNA aptamer, and the like.

[0310] The radioactive labeled compound may be any radioactive labeled compound as long as it is a nuclide used for diagnostic or therapeutic purposes, and examples thereof include 3 H. 14 C. 32 P. 33 P. 35 S. 51 Cr, 57 CO, 18 F. 153 Gd, 159 Gd, 64 Cu, 68 Ge, 166 Ho, 115 In, 113 In, 112 In, 111 In, 131 I. 125 I. 123 I. 121 I. 140 La, 177 Lu, 54 Mn, 99 Mo, 103 Pd,142 Pr, 149 Pm, 186 Re、 188 Re、 211 At 105 Rh, 97 Such as 153 Sm, 47 Sc, 75 Se, 85 Sr. 99 Tc, 201 Ti, 113 Sn, 117 Sn, 133 Xe, 169 Yb, 175 Yb, 90 Y. 65 Zn, etc., or a compound containing any of said nuclides.

[0311] The radiolabeled compound can be directly linked to the antibody by the chloramine T method or the like. In addition, a substance that chelates the radiolabeled compound can be linked to the antibody. Examples of the chelating agent include 1,4,7,10-tetraazacyclododecanetetraacetic acid (DOTA), 1-[2-(4-aminophenyl)ethyl]-1,4,7,10-tetraazacyclododecanetetraacetic acid (PA-DOTA), 1,4,7,10-tetraazacyclotridecanetetraacetic acid (TRITA), diethylenetriaminepentaacetic acid (DTPA), and the like. Antibodies modified with the chelating agent and modified antibodies labeled with the radiolabeled compound via the chelating agent are also included in the antibodies of the present invention.

[0312] Examples of the polysaccharide include monosaccharides, disaccharides, and oligosaccharides, and more specific examples thereof include fucose, mannose, glucose, allose, aldose, gulose, idose, galactose, talose, ribose, arabinose, xylose, lyxose, erythose, erythrose, threose, cellobiose, maltose, isomaltose, lactose, lipoarabinomannan, Lewis X trisaccharide, sialyl Lewis X tetrasaccharide, etc. In addition, the polysaccharide may be a natural product containing a polysaccharide known as an immune adjuvant, examples of which include β (1→3) glucan (lentinan or schizophyllan), α-galactosylceramide (KRN7000), etc.

[0313] Examples of the lipids include simple lipids (neutral lipids), which are esters of fatty acids with any of various types of alcohols or their analogs. Examples include fats (e.g., triacylglycerols), waxes (e.g., fatty acid esters of long-chain alcohols), sterol esters, cholesterol esters, fatty acid esters of vitamins, and the like; complex lipids having polar groups such as phosphoric acid, sugar, sulfuric acid, or amines in addition to fatty acids and alcohols, such as phospholipids (e.g., glycerophospholipids, sphingomyelin, etc.) and glycolipids (e.g., glyceroglycolipids, sphingolipids, etc.); and derivative lipids, which refer to fat-soluble compounds such as fatty acids, long-chain alcohols, fat-soluble vitamins, steroids, sugars, and the like, among compounds produced by hydrolysis of simple lipids or complex lipids.

[0314] Examples of the fluorescent compound include fluorescent dyes, including fluorescein series such as fluorescein isothiocyanate (FITC), rhodamine series such as rhodamine isothiocyanate (RITC), Cy3, Cy5, eosin series, Alexa Fluor series, NBD series, etc., luminescent substances such as acridinium ester or lophan, fluorescent proteins such as green fluorescent protein (GFP), etc.

[0315] The hydrophilic polymer, amphiphilic polymer or functional molecule can be directly or via a suitable linker to the antibody or antibody fragment thereof of the present invention. Examples of the linker include esters, disulfides, hydrazones, dipeptides, and the like.

[0316] When a fusion antibody or fusion antibody fragment is produced by modifying an antibody of the present invention or an antibody fragment thereof using genetic engineering techniques, the fusion antibody or fusion antibody fragment can be produced as follows: cDNA encoding a protein is ligated to cDNA encoding an antibody to thereby construct a DNA encoding the fusion antibody or fusion antibody fragment, the DNA is inserted into an expression vector for prokaryotes or eukaryotes, the expression vector is introduced into a prokaryote or eukaryote, and the fusion antibody or fusion antibody fragment is expressed.

[0317] The composition of the present invention may be any composition, as long as the composition comprises the antibody of the present invention or its antibody fragment. In addition to the antibody or its antibody fragment, the composition may further comprise a suitable carrier or additive such as a stabilizer.

[0318] Examples of the composition of the present invention include compositions for detection or measurement comprising the antibody of the present invention or its antibody fragment, etc. Examples of the composition of the present invention include pharmaceutical compositions (therapeutic agents) comprising the antibody of the present invention or its antibody fragment as an active ingredient, etc., and the composition is formulated into a desired dosage form together with a pharmaceutically acceptable carrier.

[0319] In the present invention, the composition for detecting or measuring may be any composition as long as the composition comprises an antibody of the present invention or an antibody fragment thereof and can detect or measure an antigen that specifically binds to the antibody of the present invention or its antibody fragment. Examples of antigens that specifically bind to the antibody of the present invention or its antibody fragment include CSPG5 or an antigen present in CSPG5 and the brain.

[0320] The antibodies or antibody fragments thereof of the present invention, when administered to animals, have the property of binding to and accumulating CSPG5 in the brain. Therefore, by using a composition for detection or measurement comprising the antibodies or antibody fragments thereof, the antibodies can be maintained in the brain, or the antibody concentration in the brain can be increased, so that CSPG5 or CSPG5 and antigens present in the brain can be detected or measured for a long time, and / or CSPG5 or CSPG5 and antigens present in the brain can also be detected or measured with high sensitivity.

[0321] For example, when the composition for detection or measurement is a composition comprising a bispecific antibody that binds to CSPG5 and an antigen present in the brain, the CSPG5 and the antigen present in the brain bound by the bispecific antibody can be detected or measured for a long time, and / or CSPG5 and the antigen present in the brain can be detected or measured with high sensitivity.

[0322] In addition, for example, when the composition for detection or measurement is a composition comprising a fusion antibody or a fusion antibody fragment thereof labeled with a radioactive labeled compound or a fluorescent dye and binding to CSPG5, CSPG5 can be detected or measured for a long time, and / or CSPG5 can be detected or measured with high sensitivity.

[0323] The pharmaceutical composition (therapeutic agent) comprising the antibody of the present invention or its antibody fragment can be a therapeutic agent for any disease as long as the antigen to which the antibody of the present invention or its antibody fragment specifically binds is expressed in the disease, but is preferably a therapeutic agent for brain diseases.

[0324] Examples of such brain diseases include Alzheimer's disease, a prodromal stage of Alzheimer's disease, Huntington's disease, Parkinson's disease, brain tumors, multiple sclerosis, muscular dystrophy, amyotrophic lateral sclerosis, multiple system atrophy, progressive supranuclear palsy, nigrostriatal degeneration, olivopontocerebellar atrophy, spinal bulbar muscular atrophy, spinocerebellar degeneration, cerebrovascular disorders, epilepsy, migraine, attention deficit hyperactivity disorder, Creutzfeldt-Jakob disease, corticobasal degeneration, lysosomal storage diseases, depression, dystonia, and the like.

[0325] The antibodies or antibody fragments thereof of the present invention have the property of binding to CSPG5 in the brain and accumulating in the brain when administered to animals. Therefore, by using a therapeutic agent comprising the antibody or antibody fragment thereof, the antibody or antibody fragment thereof can be maintained in the brain for a long time and the antibody concentration in the brain can be increased, thereby achieving a therapeutic effect on the above-mentioned diseases.

[0326] For example, when the therapeutic agent is a fusion antibody comprising an anti-CSPG5 antibody of the present invention, the therapeutic effect of the molecule can be exhibited by delivering the fusion molecule to the brain. Specifically, when the therapeutic agent is a fusion antibody comprising a drug, enzyme, or the like fused to an anti-CSPG5 antibody, the therapeutic effect of the drug or enzyme can be exhibited, and when the therapeutic agent is a bispecific antibody that binds to CSPG5 and an antigen present in the brain, the therapeutic effect for brain diseases associated with the antigen present in the brain and bound to the bispecific antibody can be exhibited.

[0327] In addition, for example, when the therapeutic agent is a fusion antibody or fusion antibody fragment modified with a low molecular weight drug and binding to CSPG5, a therapeutic effect on brain diseases targeted by the low molecular weight drug can be demonstrated. In this case, the therapeutic effect is preferably higher when the therapeutic agent of the present invention is used compared to when the low molecular weight drug is used alone.

[0328] The therapeutic agent comprising the antibody of the present invention or its antibody fragment may be a therapeutic agent comprising only the antibody or its antibody fragment as an active ingredient. However, in general, the therapeutic agent is ideally provided as a pharmaceutical preparation produced by mixing with one or more pharmaceutically acceptable carriers using any method known in the art of pharmaceutical technology.

[0329] As the route of administration, the route that is most effective for treatment is preferably used, and examples thereof include oral administration or parenteral administration such as oral, intratracheal, intrarectal, subcutaneous, intradermal, intramuscular, intracerebroventricular, intrathecal, intranasal, intraperitoneal, or intravenous administration, with intravenous or intracerebroventricular administration being particularly preferred. Examples of dosage forms include sprays, capsules, tablets, powders, granules, syrups, emulsions, suppositories, injections, ointments, tapes, and the like.

[0330] The dose or frequency of administration varies depending on the intended therapeutic effect, administration method, duration of treatment, age, body weight, etc., but is usually 10 μg / kg to 20 mg / kg per day for adults.

[0331] Furthermore, the present invention also encompasses methods for retaining antibodies in the brain, methods for enhancing the property of antibodies to accumulate in the brain, and methods for increasing the concentration (or amount) of antibodies in the brain, each of which uses the antibodies of the present invention or antibody fragments thereof.

[0332] In addition, the present invention also relates to a peptide that binds to CSPG5, a nucleic acid comprising a nucleotide sequence encoding the peptide, a transformant cell comprising a vector containing the nucleic acid, a method for producing the peptide comprising culturing the transformant cell and collecting the peptide from the culture solution, a composition comprising the peptide, or a method for detecting or measuring an antigen present in the brain, a method for diagnosing or treating a brain disease, a method for enhancing the property of a peptide to accumulate in the brain, or a method for increasing the amount of the peptide in the brain, each of which uses the peptide or composition.

[0333] The peptides of the present invention include fusion peptides in which the peptides are modified.

[0334] For the definitions of various terms related to the peptides that bind to CSPG5 and the like, the same definitions as those described above for the antibodies that bind to CSPG5 and the like are used unless otherwise specified.

[0335] Hereinafter, methods for producing the antibodies of the present invention or antibody fragments thereof, methods for treating diseases, methods for diagnosing diseases, and the like will be specifically described.

[0336] 1. Methods for producing antibodies

[0337] (1) Preparation of antigens

[0338] CSPG5 serving as an antigen or cells expressing CSPG5 can be obtained by introducing an expression vector containing a cDNA encoding full-length CSPG5 or a partial length thereof into Escherichia coli, yeast, insect cells, animal cells, etc. In addition, CSPG5 can also be obtained by purifying CSPG5 from various types of animal cell lines, animal cells, animal tissues, etc. in which CSPG5 is expressed in large quantities.

[0339] In addition, the animal cell line, animal cells, animal tissues, etc. can also be used as antigens. In addition, synthetic peptides having a partial sequence of CSPG5 are prepared using chemical synthesis methods such as the Fmoc method or the tBoc method, and the synthetic peptides can also be used as antigens.

[0340] A known tag such as FLAG or His can be added to the C-terminus or N-terminus of CSPG5 or a synthetic peptide having a partial sequence of CSPG5.

[0341] The CSPG5 used in the present invention can be produced using the methods described in Molecular Cloning, A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press (1989)), Current Protocols In Molecular Biology (John Wiley & Sons (1987-1997)), etc., for example, by expressing DNA encoding CSPG5 in host cells by the following method.

[0342] First, by inserting the full-length cDNA in the zone of coding CSPG5 in the promoter downstream into the suitable expression vector to produce a recombinant vector. The DNA fragmentation with a suitable length and comprising the zone of the coded polypeptide prepared on the basis of the said full-length cDNA can replace the said full-length cDNA and use. Subsequently, by the recombinant vector obtained being introduced into the host cell that is suitable for the said expression vector, the transformant that produces the said polypeptide can be obtained.

[0343] As the expression vector, any vector can be used, as long as it can replicate autonomously or can be integrated into the chromosome of the host cell to be used, and contains a suitable promoter at a position capable of transcribing the DNA encoding the polypeptide. As the host cell, any cell, such as a microorganism belonging to the genus Escherichia (Escherichia), such as Escherichia coli (E. coli), yeast, insect cells, animal cells, etc., can be used, as long as the target gene can be expressed.

[0344] In the case of using prokaryotic organisms such as escherichia coli as host cell, described expression vector is preferably can autonomously replicate in prokaryotic organisms and also comprises promotor, ribosome binding sequence, comprises the DNA in the zone of coding mankind CSPG5 and the carrier of transcription termination sequence.In addition, although transcription termination sequence is not essential for expression vector, described transcription termination sequence is preferably placed in the downstream near structural gene.In addition, described recombinant vector can comprise the gene of control promoter.

[0345] As the expression vector, a plasmid in which the distance between the Shine-Dalgarno sequence (also called SD sequence) as a ribosome binding sequence and the start codon is adjusted to an appropriate length (eg, 6 to 18 nucleotides) is preferably used.

[0346] Furthermore, in the nucleotide sequence of the DNA encoding CSPG5, nucleotides may be substituted so that codons become optimal for expression in a host, and as a result, the production rate of the target CSPG5 can be increased.

[0347] As the expression vector, any vector can be used as long as it can express its function in the host cell to be used, and examples thereof include pBTrp2, pBTac1, pBTac2 (manufactured by Roche Diagnostics K.K. above), pKK233-2 (manufactured by Pharmacia Corporation), pSE280 (manufactured by Invitrogen, Inc.), pGEMEX-1 (manufactured by Promega Corporation), pQE-8 (manufactured by QIAGEN, Inc.), pKYP10 (JP-A-S58-110600), pKYP200 [Agricultural Biological Chemistry, 48, 669 (1984)], pLSA1 [Agric. Biol. Chem., 53, 277 (1989)], pGEL1 [Proc. Natl. Acad. Sci. USA, 82, 4306 (1985)], pBluescript II SK(-) (manufactured by Stratagene Corporation), pTrs30 [prepared from Escherichia coli JM109 / pTrS30 (FERM BP-5407)], pTrs32 [prepared from Escherichia coli JM109 / pTrS32 (FERM BP-5408)], pGHA2 [prepared from Escherichia coli IGHA2 (FERM BP-400), JP-A-S60-221091], pGKA2 [prepared from Escherichia coli IGKA2 (FERM BP-6798), JP-A-S60-221091], pTerm2 (U.S. Patent No. 4,686,191, U.S. Patent No. 4,939,094 and U.S. Patent No. 160,735), pSupex, pUB110, pTP5, pC194, pEG400 [J. Bacteriol., 172, 2392 (1990)], pGEX (manufactured by Pharmacia Corporation), pET system (manufactured by Novagen, Inc.), pME18SFL3, etc.

[0348] As a promoter, any promoter can be used as long as it can show its function in the host cell to be used. Examples are promoters such as trp promoter (Ptrp), lac promoter, PL promoter, PR promoter or T7 promoter derived from Escherichia coli, bacteriophage, etc. In addition, examples are promoters such as artificially designed and modified promoters such as tandem promoters in which two Ptrp are connected in series, tac promoter, lacT7 promoter or let I promoter, etc.

[0349] Examples of host cells include Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Escherichia coli DH1, Escherichia coli MC1000, Escherichia coli KY3276, Escherichia coli W1485, Escherichia coli JM109, Escherichia coli HB101, Escherichia coli No. 49, Escherichia coli W3110, Escherichia coli NY49, Escherichia coli DH5α, and the like.

[0350] As a method for introducing a recombinant vector into a host cell, any method can be used as long as it is a method for introducing DNA into a host cell to be used, and examples include a method using calcium ions [Proc. Natl. Acad. Sci. USA, 69, 2110 (1972); Gene, 17, 107 (1982); and Molecular & General Genetics, 168, 111 (1979)].

[0351] When animal cells are used as hosts, as an expression vector, any vector can be used as long as it can express its function in animal cells, and examples thereof include pcDNAI, pCDM8 (manufactured by Funakoshi Co., Ltd.), pAGE107 [JP-A-H3-22979; Cytotechnology, 3, 133 (1990)], pAS3-3 (JP-A-H2-227075), pCDM8 [Nature, 329, 840 (1987)], pcDNAI / Amp (manufactured by Invitrogen, Inc.), pcDNA3.1 (manufactured by Invitrogen, Inc.), pREP4 (manufactured by Invitrogen, Inc.), pAGE103 [J. Biochemistry, 101, 1307 (1987)], pAGE210, pME18SFL3, pKANTEX93 (WO 97 / 10354), N5KG1val (U.S. Patent No. 6,001,358), INPEP4 (manufactured by Biogen-IDEC, Inc.), pCI (manufactured by Promega Corporation), transposon vector (WO 2010 / 143698), and the like.

[0352] As the promoter, any promoter can be used as long as it can exhibit its function in animal cells, and examples thereof include cytomegalovirus (CMV) immediate early (IE) gene promoter, SV40 early promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, SRα promoter, and Moloney murine leukemia virus promoter or enhancer. In addition, the human CMV IE gene enhancer can be used together with the promoter.

[0353] Examples of host cells include human leukemia cells Namalwa cells, monkey cells COS cells, and Chinese hamster ovary cells CHO cells [Journal of Experimental Medicine, 108, 945 (1958); Proc. Natl. Acad. Sci. USA, 60, 1275 (1968); Genetics, 55, 513 (1968); Chromosoma, 41, 129 (1973); Methods in Cell Science, 18, 115 (1996); Radiation Research, 148, 260 (1997); Proc. Natl. Acad. Sci. USA, 77, 4216 (1980); Proc. Natl. Acad. Sci. USA, 60, 1275 (1968); Cell, 6, 121 (1975); Molecular Cell Genetics, 18, 115 (1996); Radiation Research, 148, 260 (1997); Proc. Natl. Acad. Sci. USA, 77, 4216 (1980); Proc. Natl. Acad. Sci. USA, 60, 1275 (1968); Cell, 6, 121 (1975); Molecular Cell Genetics, 18, 115 (1996); [Genetics, Appendix I, II (pp. 883-900)], dihydrofolate reductase gene (dhfr)-deficient CHO cells (CHO / DG44 cells) [Proc. Natl. Acad. Sci. USA, 77, 4216 (1980)], CHO-K1 (ATCC CCL-61), DUkXB11 (ATCC CCL-9096), Pro-5 (ATCC CCL-1781), CHO-S (Life Technologies, catalog number 11619), Pro-3, rat myeloma cells YB2 / 3HL.P2.G11.16Ag.20 (or also known as YB2 / 0), mouse myeloma cells NS0, mouse myeloma cells SP2 / 0-Ag14, Syrian hamster cells BHK or HBT5637 (JP-A-S63-000299), etc.

[0354] As a method for introducing an expression vector into a host cell, any method can be used as long as it is a method for introducing DNA into animal cells. Examples thereof include electroporation [Cytotechnology, 3, 133 (1990)], calcium phosphate method (JP-A-H2-227075), lipofection method [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)] and the like.

[0355] CSPG5 can be produced by culturing a transformant derived from a microorganism, an animal cell, or the like obtained as described above and having an expression vector incorporating a DNA encoding CSPG5 in a culture medium so as to produce and accumulate CSPG5 in a culture solution, and then collecting CSPG5 from the culture solution. The method for culturing the transformant in a culture medium can be carried out according to a conventional method for culturing a host.

[0356] When expressed in cells derived from eukaryotic organisms, CSPG5 to which sugars or polysaccharides are added can be obtained.

[0357] When culturing microorganisms transformed with an expression vector using an inducible promoter, an inducer may be added to the culture medium as needed. For example, when culturing microorganisms transformed with an expression vector using the lac promoter, isopropyl-β-D-thiogalactopyranoside or the like may be added to the culture medium, and when culturing microorganisms transformed with an expression vector using the trp promoter, indoleacrylic acid or the like may be added to the culture medium.

[0358] Examples of the culture medium for culturing transformants obtained using animal cells as hosts include commonly used RPMI1640 medium [The Journal of the American Medical Association, 199, 519 (1967)], Eagle's MEM medium [Science, 122, 501 (1952)], Dulbecco's modified MEM medium [Virology, 8, 396 (1959)], medium 199 [Proc. Soc. Exp. Biol. Med., 73, 1 (1950)], Iscove's modified Dulbecco's medium (IMDM), or any of these media supplemented with fetal bovine serum (FBS) or the like. The culture is usually performed at pH 6 to 8 and 30 to 40°C in the presence of 5% CO 2 for 1 to 7 days. In addition, during the culture period, antibiotics such as kanamycin or penicillin may be added to the medium as needed.

[0359] As a method for expressing a gene encoding CSPG5, in addition to direct expression, examples include, for example, secretory production or fusion protein expression methods [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989)].

[0360] Examples of methods for producing CSPG5 include a method for producing CSPG5 in a host cell, a method for secreting CSPG5 outside a host cell, a method for producing CSPG5 on the outer membrane of a host cell, and a suitable method can be selected by changing the host cell to be used or the structure of CSPG5 to be produced.

[0361] When CSPG5 is produced in a host cell or on the outer membrane of a host cell, CSPG5 can be actively secreted outside the host cell using the method of Paulson et al. [J.Biol.Chem., 264, 17619 (1989)], the method of Lowe et al. [Proc.Natl.Acad.Sci., USA, 86, 8227 (1989); Genes Develop., 4, 1288 (1990)] or the method described in JP-A-H05-336963, WO 94 / 23021, etc. In addition, the production of CSPG5 can also be increased by utilizing a gene amplification system using a dihydrofolate reductase gene (JP-A-H2-227075).

[0362] The obtained CSPG5 can be isolated and purified, for example, as follows: When CSPG5 is expressed in a dissolved state in cells, the cells are collected by centrifugation after the culture is completed, suspended in an aqueous buffer solution, and then homogenized using an ultrasonic homogenizer, a French press, a Manton Gaulin homogenizer, a Dyno mill, or the like to obtain a cell-free extract solution. From the supernatant obtained by centrifugation of the cell-free extract solution, a purified preparation can be obtained using methods such as conventional protein separation and purification methods, i.e., solvent extraction, salting-out using ammonium sulfate or the like, desalting, precipitation using an organic solvent, anion exchange chromatography using a resin such as diethylaminoethyl (DEAE)-Sepharose or DIAION HPA-75 (manufactured by Mitsubishi Chemical Corporation), cation exchange chromatography using a resin such as S-Sepharose FF (manufactured by Pharmacia Corporation), hydrophobic chromatography using a resin such as butyl sepharose or phenyl sepharose, gel filtration using molecular sieves, affinity chromatography, chromatofocusing, electrophoresis such as isoelectric focusing electrophoresis, and the like, alone or in combination.

[0363] When CSPG5 is expressed in cells by forming insoluble bodies, the cells are collected, then homogenized in the same manner as above, and then centrifuged, whereby the insoluble bodies of the CSPG5 are collected as sediment fractions. The collected insoluble bodies of the CSPG5 are dissolved with a protein denaturant. By diluting or dialyzing the dissolved solution, CSPG5 returns to its normal conformation, and subsequently a purified preparation of the polypeptide can be obtained by the same separation and purification method as above.

[0364] When CSPG5 or its derivatives, such as sugar-modified forms, are secreted extracellularly, CSPG5 or its derivatives, such as sugar-modified forms, can be collected in the culture supernatant. The culture can be treated in the same manner as described above using a method such as centrifugation to obtain a soluble fraction, and then a purified preparation can be obtained from the soluble fraction using the same separation and purification methods as described above.

[0365] In addition, the CSPG5 used in the present invention can also be produced using a chemical synthesis method such as the Fmoc method or the tBoc method. In addition, chemical synthesis can also be carried out using a peptide synthesizer manufactured by Advanced Chemtech, Inc., PerkinElmer, Inc., Pharmacia Corporation, Protein Technology Instrument, Inc., Synthecell-Vega Biomolecules Corporation, Perceptive, Inc., Shimadzu Corporation, etc.

[0366] (2) Animal immunization and preparation of antibody-producing cells for fusion

[0367] Animals aged 3 to 20 weeks, such as mice, rats, rabbits or hamsters, are immunized with the antigen obtained in (1), and antibody-producing cells are collected from the spleen, lymph nodes or peripheral blood of the animals. In addition, animals such as llamas, alpacas or camels can also be used as animals for immunization.

[0368] The immunization is carried out by administering the antigen to the animal subcutaneously, intravenously or intraperitoneally, for example, together with a suitable adjuvant such as Freund's complete adjuvant, aluminum hydroxide gel or Bordetella pertussis vaccine. When the antigen is a partial peptide, a conjugate of the antigen with a carrier protein such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH) is produced and used as an immunogen.

[0369] When mice or rats are immunized, the antigen is administered 5 to 10 times every 1 to 2 weeks after the first administration. On the 3rd to 7th day after each administration, blood is collected from the venous plexus of the fundus of the eye, and the antibody titer of its serum is measured using an enzyme immunoassay [Antibodies-A Laboratory Manual, Cold Spring Harbor Laboratory (1988)]. Animals whose serum shows sufficient antibody titers against the antigen used for immunization are used as a supply source of antibody-producing cells for fusion.

[0370] On the 3rd to 7th day after the last administration of the antigen, tissues such as the spleen containing antibody-producing cells are removed from the immunized animal and the antibody-producing cells are collected. When splenocytes are used, the spleen is minced and dispersed, then centrifuged, and then the red blood cells are removed to obtain antibody-producing cells for fusion.

[0371] Other animals to be immunized can also be immunized in the same manner, and antibody-producing cells can be obtained. Suitable conditions for the time interval between immunizations and the length of time between the last immunization and tissue removal can be selected according to the animal species to be immunized.

[0372] (3) Preparation of myeloma cells

[0373] As myeloma cells, established cell lines obtained from mice are used, and for example, 8-azaguanine-resistant mouse (BALB / c-derived) myeloma cell line P3-X63Ag8-U1 (P3-U1) [Current Topics in Microbiology and Immunology, 18, 1 (1978)], P3-NS1 / 1-Ag41 (NS-1) [European J. Immunology, 6, 511 (1976)], SP2 / 0-Ag14 (SP-2) [Nature, 276, 269 (1978)], P3-X63-Ag8653 (653) [J. Immunology, 123, 1548 (1979)], P3-X63-Ag8 (X63) [Nature, 256, 495 (1975)] and the like are used.

[0374] The myeloma cells were subcultured in a normal medium [RPM11640 medium supplemented with glutamine, 2-mercaptoethanol, gentamicin, FBS and 8-azaguanine] and then subcultured in a normal medium 3 to 4 days before cell fusion, and on the day of fusion, 2×10 7 More than cells.

[0375] (4) Cell fusion and preparation of hybridomas producing monoclonal antibodies

[0376] The antibody-producing cells for fusion obtained in (2) and the myeloma cells obtained in (3) are thoroughly washed and mixed with minimum essential medium (MEM) or phosphate-buffered saline (PBS: 1.83 g disodium hydrogen phosphate, 0.21 g potassium dihydrogen phosphate, 7.65 g sodium chloride, 1 L distilled water, pH 7.2) so that the cell number becomes as follows: antibody-producing cells for fusion: myeloma cells = 5:1 to 10:1, followed by centrifugation, and then the supernatant is removed.

[0377] After the precipitated cell aggregates were sufficiently dispersed, a mixed solution of polyethylene glycol 1000 (PEG-1000), MEM medium, and dimethyl sulfoxide was added thereto while stirring at 37° C. Furthermore, 1 to 2 mL of MEM medium was added thereto several times every 1 to 2 minutes, and then MEM medium was added thereto to make a total amount of 50 mL.

[0378] After centrifugation, the supernatant was removed. The precipitated cell aggregates were gently disrupted and then gently suspended in HAT medium (normal culture medium supplemented with hypoxanthine, thymidine, and aminopterin). The resulting suspension was cultured in a 5% CO2 incubator at 37°C for 7 to 14 days.

[0379] After the culture, a portion of the culture supernatant is removed and a cell aggregate that reacts with CSPG5 but not with antigens other than CSPG5 is selected by a hybridoma selection method, such as the binding assay described below. Subsequently, cloning is performed by the limiting dilution method, and cells that consistently produce high antibody titers are selected as hybridomas producing monoclonal antibodies.

[0380] (5) Preparation of purified monoclonal antibodies

[0381] The monoclonal antibody-producing hybridoma obtained in (4) was intraperitoneally injected into 8- to 10-week-old mice or nude mice that had been treated with pristane [0.5 mL of 2,6,10,14-tetramethylpentadecane (pristane) was intraperitoneally administered and then housed for 2 weeks]. Within 10 to 21 days, the hybridoma transformed into an ascites tumor.

[0382] Ascites is collected from the mouse, and then the solid is removed by centrifugation, followed by salting out using 40 to 50% ammonium sulfate. Subsequently, purification is performed by caprylic acid precipitation, a DEAE-agarose gel column, a protein A column, or a gel filtration column, and then the IgG or IgM fraction is collected to prepare a purified monoclonal antibody.

[0383] Furthermore, after culturing the monoclonal antibody-producing hybridoma obtained in (4) in RPMI1640 medium supplemented with 10% FBS, etc., the supernatant is removed by centrifugation, and the residue is suspended in hybridoma-SFM medium and then cultured for 3 to 7 days.

[0384] Purified monoclonal antibodies can also be obtained by centrifuging the obtained cell suspension, purifying the obtained supernatant by passing it through a protein A column or a protein G column, and then collecting the IgG fraction. Note that 5% Daigo's GF21 can also be added to the hybridoma-SFM medium.

[0385] Antibody subclassification was performed by enzyme immunoassay using a subclass typing kit. Protein quantification was performed by the Lowry method or by calculation from absorbance at 280 nm.

[0386] (6) Antibody selection

[0387] The selection of antibodies is performed as follows by measuring the affinity of the antibodies for cells expressing CSPG5 using flow cytometry, etc. The cells expressing CSPG5 may be any cells as long as CSPG5 is expressed on the cell surface, and examples thereof include animal cells, animal cell lines, the CSPG5 forced expression cell line obtained in (1), and the like.

[0388] After the cells expressing CSPG5 are distributed into a plate such as a 96-well plate, a test substance such as serum, culture supernatant of a hybridoma, or a purified antibody is distributed therein as a first antibody and allowed to react. After the reaction, the cells are thoroughly washed with PBS containing 1 to 10% BSA (hereinafter referred to as BSA-PBS) or the like, and then an anti-immunoglobulin antibody labeled with a fluorescent reagent or the like as a second antibody is distributed therein and allowed to react. After being thoroughly washed with BSA-PBS or the like, the fluorescence of the labeled antibody is measured using a flow cytometer, thereby selecting an antibody that specifically reacts with cells expressing CSPG5.

[0389] In addition, the selection of antibodies can also be performed by measuring the affinity of monoclonal antibodies to cells expressing CSPG5, CSPG5 protein, etc. using ELISA or surface plasmon resonance as described below. The CSPG5 protein can be a protein composed of certain domains of CSPG5 or a protein to which a tag such as GST is added.

[0390] In ELISA, after the CSPG5-expressing cells or CSPG5 protein are dispensed into a plate, such as a 96-well plate, the wells are blocked with BSA-PBS, and a test substance, such as serum, hybridoma culture supernatant, or purified antibody, is dispensed therein as the primary antibody and allowed to react. Subsequently, after sufficient washing with PBS or the like, an anti-immunoglobulin antibody labeled with a fluorescent reagent or the like is dispensed therein as the secondary antibody and allowed to react.

[0391] Then, after sufficient washing with PBS or the like, a color development solution is added. At the end, the color development reaction is terminated with a reaction termination solution, and the absorbance in each well is measured using a microplate reader to select antibodies that specifically react with the CSPG5-expressing cells or CSPG5 protein.

[0392] In surface plasmon resonance, the affinity of an antibody binding to CSPG5 can be measured by immobilizing the antibody on a suitable sensor chip and using the CSPG5 protein as an analyte using a known protocol.

[0393] The affinity of the antibody obtained can be used to select an antibody with the desired affinity for the CSPG5 protein. In addition, the affinity of the antibody bound to CSPG5 can also be measured by immobilizing the CSPG5 protein on a sensor chip and using the antibody as the analyte.

[0394] In addition, antibodies that compete with the antibodies of the present invention for binding to CSPG5 can be obtained by adding the test antibody to the above-mentioned assay system using flow cytometry or ELISA to induce a reaction. In other words, by screening for antibodies that inhibit the binding of the antibodies of the present invention to CSPG5 when the test antibody is added, antibodies that compete with the antibodies of the present invention for binding to the amino acid sequence or conformation of CSPG5 can be obtained.

[0395] In addition, antibodies that bind to an epitope containing the epitope to which the antibody of the present invention binds can be obtained by identifying the epitope of the antibody obtained by the above-mentioned screening method by a known method, producing a synthetic peptide containing the identified epitope, a synthetic peptide manufactured to mimic the conformation of the epitope, etc., and then using it for immunization.

[0396] In addition, antibodies that bind to the same epitope as the epitope bound by the antibodies of the present invention can be obtained as follows: identify the epitope of the antibody obtained by the above-mentioned screening method, produce a partial synthetic peptide of the identified epitope, a synthetic peptide made to mimic the conformation of the epitope, etc., and then use it for immunization.

[0397] (7) Obtaining antibodies through phage display method

[0398] (7-1) Method for generating antibody phage library

[0399] In the present invention, as antibody phage libraries, immune libraries, natural libraries, and synthetic libraries can be used. The production methods of the corresponding libraries will be described below.

[0400] For the immune library, lymphocytes derived from animals or patients immunized in the same manner as described in (1) above are collected, and for the naive library, lymphocytes derived from normal animals or healthy humans are collected, RNA is extracted from the lymphocytes, and cDNA is synthesized by reverse transcription reaction.

[0401] The antibody gene fragment amplified by PCR using each cDNA as a template is inserted into a phagemid vector and transformed into Escherichia coli with the phagemid vector. When the transformant obtained is infected with a helper phage, an antibody phage library of the antibody gene can be obtained.

[0402] In addition, for synthetic libraries, the CDRs of the V genes in genomic DNA or reconstructed functional V genes are replaced with oligonucleotides encoding random amino acid sequences of appropriate lengths, and E. coli is transformed with a phagemid vector into which the V genes are inserted. When the resulting transformants are infected with helper phage, an antibody phage library can be obtained.

[0403] As the lymphocyte-derived cDNA and antibody phage libraries, commercially available products can also be used.

[0404] As the phagemid vector, pCANTAB 5E (Amersham Pharmacia Biotech, Inc.), pUC118 / pUC119 vector (TaKaRa, Inc.), pBlueScript II phagemid vector (Agilent Technologies, Inc.), pKSTV-02 (Miyazaki et al., Biochem. 158(3), 205-215, 2015), etc. can be used.

[0405] As the helper phage, M13KO7 helper phage (Invitrogen, Inc.), VCSM13 interference-resistant helper phage (Agilent Technologies, Inc.), R408 interference-resistant helper phage (Agilent Technologies, Inc.), etc. can be used.

[0406] Phage display can also use phage vectors. Examples include peptide phage libraries (manufactured by New England Biolabs, Inc., etc.) using filamentous phage g3p as a displayed molecule and methods using g7p, g8p, or g9p as a displayed molecule.

[0407] Phage display using T7 phage can also be used. Examples of display systems on T7 phage include the T7 Select vector (Novagen, Inc.).

[0408] (7-2) Selection of antibody phage clones

[0409] Selection of antibody phage clones from the antibody phage library generated in (7-1) can be performed using the ELISA method shown below.

[0410] CSPG5 is immobilized on an immunotube and blocked with blocking buffer. The antibody phage library produced in (7-1) is added to each well of the tube and allowed to react. Subsequently, the wells are cleaned, fluorescently labeled anti-phage antibodies are added, and allowed to react. Subsequently, the wells are cleaned again and a color developing solution is added. The color development reaction is then stopped with a reaction stop solution, and the absorbance in each well is measured using a microplate reader. In this way, antibody phage clones that bind to CSPG5 are selected.

[0411] 2. Production of genetically recombinant antibodies

[0412] As examples of genetically recombinant antibody production, methods for producing human chimeric and humanized antibodies will be described below. Genetically recombinant mouse, rat, rabbit, hamster, camel, llama, alpaca, and human antibodies, as well as various types of chimeric antibodies and heavy chain antibodies, can also be produced in the same manner.

[0413] (1) Construction of expression vector for genetically recombinant antibodies

[0414] The expression vector for genetically recombinant antibodies is an expression vector for animal cells into which DNAs encoding CH and CL of human antibodies are incorporated, and can be constructed by cloning each of the DNAs encoding CH and CL of human antibodies into an expression vector for animal cells.

[0415] As the constant region (C region) of a human antibody, the CH and CL of any human antibody can be used. For example, the CH of the γ1 subtype and the CL of the κ subtype of a human antibody can be used. As DNA encoding the CH or CL of a human antibody, cDNA is used, but chromosomal DNA composed of exons and introns can also be used.

[0416] As the expression vector for animal cells, any vector can be used as long as it can incorporate a gene encoding the C region of a human antibody and express the gene. For example, pAGE107 [Cytotechnol., 3, 133 (1990)], pAGE103 [J. Biochem., 101, 1307 (1987)], pHSG274 [Gene, 27, 223 (1984)], pKCR [Proc. Natl. Acad. Sci. USA, 78, 1527 (1981)], pSG1bd2-4 [Cytotechnol., 4, 173 (1990)], and pSE1UK1Sed1-3 [Cytotechnol., 13, 79 (1993)] can be used.

[0417] Examples of promoters and enhancers in the expression vector for animal cells include the SV40 early promoter [J. Biochem., 101, 1307 (1987)], Moloney murine leukemia virus LTR [Biochem. Biophys. Res. Commun., 149, 960 (1987)], or the immunoglobulin H chain promoter [Cell, 41, 479 (1985)] and enhancer [Cell, 33, 717 (1983)], etc.

[0418] As the expression vector for genetically recombinant antibodies, from the viewpoints of ease of construction of the expression vector for genetically recombinant antibodies, ease of introduction into animal cells, and balance of expression levels of the antibody H chain and L chain in the animal cells, an expression vector for genetically recombinant antibodies of a type (tandem type) in which the antibody H chain and L chain are present on the same vector is used [J. Immunol. Methods, 167, 271 (1994)], but a type in which the antibody H chain and L chain are present on separate vectors may also be used. As tandem type expression vectors for genetically recombinant antibodies, pKANTEX93 (WO 97 / 10354), pEE18 [Hybridoma, 17, 559 (1998)], etc. are used.

[0419] (2) Obtaining cDNA encoding the variable region (V region) of antibodies derived from animals other than humans and analyzing their amino acid sequences

[0420] Acquisition of cDNA encoding VH and VL of a non-human antibody and analysis of the amino acid sequence can be performed as follows.

[0421] (2-1) When antibodies are obtained by the hybridoma method

[0422] mRNA is extracted from non-human antibody-producing hybridoma cells and cDNA is synthesized. Each of the synthesized cDNAs is cloned into a vector such as a phage or a plasmid, thereby producing a cDNA library.

[0423] Using DNA encoding the C region domain or V region domain of a non-human antibody as a probe, a recombinant phage or recombinant plasmid containing each cDNA encoding VH and VL is isolated from the library. Each complete nucleotide sequence of the target VH or VL of the non-human antibody on the recombinant phage or recombinant plasmid is determined, and the complete amino acid sequence of each VH or VL is deduced from the nucleotide sequence.

[0424] As non-human animals used for producing hybridoma cells producing non-human antibodies, mice, rats, hamsters, rabbits, llamas, camels, alpacas, etc. are used, but any animal can be used as long as it can produce hybridoma cells.

[0425] For preparation of total RNA from hybridoma cells, the guanidine isothiocyanate-cesium trifluoroacetate method [Methods in Enzymol., 154, 3 (1987)] or a kit such as RNeasy kit (manufactured by QIAGEN, Inc.) or the like is used.

[0426] In the preparation of mRNA from total RNA, a cellulose column method immobilized with oligo(dT) is used [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989)] or a kit such as Oligo-dT30 <super>mRNA Purification (registered trademark) Kit (manufactured by Takara Bio, Inc.), etc. In addition, mRNA can also be prepared from hybridoma cells using a kit such as Fast Track mRNA Isolation (registered trademark) Kit (manufactured by Invitrogen, Inc.) or QuickPrep mRNA Purification (registered trademark) Kit (manufactured by Pharmacia Corporation).

[0427] In the synthesis of cDNA and the production of a cDNA library, a known method [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, Supplementary File 1, John Wiley & Sons (1987-1997)] or a kit such as the SuperScript Plasmid System for cDNA Synthesis and Plasmid Cloning (manufactured by Invitrogen, Inc.) or the ZAP-cDNA Synthesis (registered trademark) Kit (manufactured by Stratagene Corporation) or the like is used.

[0428] When producing a cDNA library, as a vector into which cDNA synthesized using mRNA extracted from hybridoma cells as a template is incorporated, any vector can be used as long as it is a vector capable of incorporating the cDNA. For example, ZAP ExPress [Strategies, 5, 58 (1992)], pBluescript II SK (+) [Nucleic Acids Research, 17, 9494 (1989)], λZAPII (manufactured by Stratagene Corporation), λgt 10, λgt 11 [DNA Cloning: A Practical Approach, 1, 49 (1985)], Lambda Blue Mid (manufactured by Clontech Laboratories, Inc.), λExCell, pT7T3-18U (manufactured by Pharmacia Corporation), pCD2 [Mol. Cell. Biol., 3, 280 (1983)], pUC18 [Gene, 33, 103 (1985)], etc. are used.

[0429] As the Escherichia coli into which the cDNA library constructed by phage or plasmid vector is introduced, any Escherichia coli can be used as long as it can introduce, express and maintain the cDNA library. For example, XL1-Blue MRF' [Strategies, 5, 81 (1992)], C600 [Genetics, 39, 440 (1954)], Y1088, Y1090 [Science, 222, 778 (1983)], NM522 [J. Mol. Biol., 166, 1 (1983)], K802 [J. Mol. Biol., 16, 118 (1966)], JM105 [Gene, 38, 275 (1985)] and the like are used.

[0430] To select a cDNA clone encoding VH or VL of a non-human antibody from the cDNA library, colony hybridization or plaque hybridization using an isotope- or fluorescent-labeled probe [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989)] or the like is used.

[0431] Alternatively, cDNA encoding VH or VL can be prepared by preparing primers and performing a polymerase chain reaction (PCR) method using cDNA synthesized from mRNA or a cDNA library as a template [Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, Supplementary File 1, John Wiley & Sons (1987-1997)].

[0432] The selected cDNA is cleaved with an appropriate restriction enzyme or the like, and then cloned into a plasmid such as pBluescript SK(-) (manufactured by Stratagene Corporation), and the nucleotide sequence of the cDNA is determined by a conventional nucleotide sequence analysis method or the like. In the nucleotide sequence analysis method, for example, after performing a reaction such as the dideoxy method [Proc. Natl. Acad. Sci. USA, 74, 5463 (1977)], an automatic nucleotide sequence analyzer such as ABI Prism 3700 (manufactured by PE Biosystems, Inc.) or ALFDN sequencer (manufactured by Pharmacia Corporation) or the like is used.

[0433] (2-2) When antibodies are obtained by phage display method

[0434] Using DNA encoding the vector region or V region domain as a probe, the complete nucleotide sequence of each VH or VL is determined from the plasmid vector of the selected phage clone, and then the complete amino acid sequence of each VH or VL can be deduced from the nucleotide sequence.

[0435] In the hybridoma method or phage display method, the complete amino acid sequences of VH and VL are inferred from the determined nucleotide sequence and compared with the complete amino acid sequences of VH and VL of known antibodies, respectively [Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services (1991)] to confirm whether the obtained cDNA encodes the complete amino acid sequences of VH and VL of the antibody including the secretion signal sequence.

[0436] For the complete amino acid sequences of VH and VL of antibodies containing secretory signal sequences, by comparing them with the complete amino acid sequences of VH and VL of known antibodies [Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services (1991)], the length and N-terminal amino acid sequence of the secretory signal sequences can be inferred, and the subgroup to which they belong can be determined.

[0437] Alternatively, the amino acid sequences of the CDRs of VH and VL can be found by comparing them with the amino acid sequences of VH and VL of known antibodies [Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services (1991)].

[0438] In addition, using the obtained complete amino acid sequences of VH and VL, a homology search can be performed against any database such as SWISS-PROT or PIR-Protein, for example, by the BLAST method [J. Mol. Biol., 215, 403 (1990)] to confirm whether the complete amino acid sequences of VH and VL are novel.

[0439] (3) Construction of human chimeric antibody expression vector

[0440] A human chimeric antibody expression vector can be constructed by cloning cDNA encoding VH or VL of a non-human antibody upstream of the gene encoding CH or CL of a human antibody, respectively, into the expression vector for genetically recombinant antibodies obtained in (1).

[0441] In order to link the 3' terminal side of cDNA encoding VH or VL of a non-human antibody to the 5' terminal side of CH or CL of a human antibody, designed VH and VL cDNAs are produced so that the nucleotide sequence of the linking region encodes appropriate amino acids and becomes a suitable restriction enzyme recognition sequence.

[0442] The generated VH and VL cDNAs are cloned upstream of the CH or CL gene encoding the human antibody, respectively, in the expression vector for genetic recombinant antibodies obtained in (1), so that the cDNA is expressed in a suitable form, thereby constructing a human chimeric antibody expression vector.

[0443] Furthermore, cDNA encoding VH or VL of a non-human antibody, respectively, is amplified by the PCR method using synthetic DNA containing appropriate restriction enzyme recognition sequences at both ends, and can also be cloned into the expression vector for genetically recombinant antibodies obtained in (1).

[0444] (4) Construction of cDNA encoding the V region of humanized antibodies

[0445] cDNA encoding VH or VL of a humanized antibody can be constructed as follows.

[0446] The amino acid sequence of the FR of VH or VL of a human antibody is selected for transplanting the amino acid sequence of the CDR of VH or VL of a non-human antibody. As the amino acid sequence of the FR to be selected, any amino acid sequence can be used as long as it is derived from a human antibody.

[0447] For example, amino acid sequences of human antibody FRs registered in databases such as the Protein Data Bank or amino acid sequences common to each subgroup of human antibody FRs [Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services (1991)] are used. In order to suppress the reduction of antibody binding activity, an amino acid sequence of a FR is selected that has as high a homology as possible (at least 60% or more) to the amino acid sequence of the VH or VL FR of the original antibody.

[0448] Next, the amino acid sequence of the CDR of the original antibody is transplanted into the amino acid sequence of the FR of the VH or VL of the selected human antibody, and the amino acid sequence of the VH or VL of the humanized antibody is designed. The designed amino acid sequence is converted into a DNA sequence by considering the codon usage frequency found in the nucleotide sequence of the antibody gene [Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services (1991)], and the DNA sequence encoding the amino acid sequence of the VH or VL of the humanized antibody is designed.

[0449] Based on the designed DNA sequence, several synthetic DNAs of about 100 nucleotides in length are synthesized, and PCR reaction is performed using the DNA. In this case, taking into account the reaction efficiency of the PCR reaction and the length of the synthesizable DNA, it is preferred to design 6 synthetic DNAs for each of VH and VL.

[0450] Furthermore, by introducing a suitable restriction enzyme recognition sequence at the 5' or 3' end of the synthetic DNA at both ends, the cDNA encoding VH or VL of the humanized antibody can be easily cloned into the expression vector for genetically recombinant antibodies obtained in (1).

[0451] After the PCR reaction, the amplified products are respectively cloned into plasmids such as pBluescript SK(-) (manufactured by Stratagene Corporation), the nucleotide sequence is determined in the same manner as described in (2), and a plasmid having a DNA sequence encoding the amino acid sequence of VH or VL of the desired humanized antibody is obtained.

[0452] Alternatively, full-length VH and full-length VL synthesized as single long-chain DNAs based on the designed DNA sequences can be used instead of the PCR amplification products. In addition, by introducing suitable restriction enzyme recognition sequences at both ends of the synthesized long-chain DNAs, the cDNA encoding the VH or VL of the humanized antibody can be easily cloned into the expression vector for genetically recombinant antibodies obtained in (1).

[0453] (5) Modification of the V region amino acid sequence of humanized antibodies

[0454] Humanized antibodies prepared by merely transplanting the CDRs of VH and VL of a nonhuman antibody into the FRs of VH and VL of a human antibody have reduced antigen-binding activity compared to the original nonhuman antibody [BIO / TECHNOLOGY, 9, 266 (1991)].

[0455] In the humanized antibody, the decreased antigen-binding activity can be improved by identifying amino acid residues directly involved in antigen binding, amino acid residues that interact with amino acid residues in CDR, and amino acid residues that maintain the conformation of the antibody and indirectly participate in antigen binding in the amino acid sequences of FRs of VH and VL of the human antibody, and replacing such amino acid residues with amino acid residues of the original non-human antibody.

[0456] In order to identify the amino acid residues of FR that are involved in the antigen-binding activity, the conformation of the antibody can be established and analyzed using X-ray crystallography [J. Mol. Biol., 112, 535 (1977)] or computer modeling [Protein Engineering, 7, 1501 (1994)], etc. In addition, a humanized antibody having the desired antigen-binding activity can be obtained by generating several types of variants for each antibody and repeatedly examining the correlation with its antigen-binding activity by trial and error.

[0457] The amino acid sequence of the FR of VH and VL of a human antibody can be modified by performing the PCR reaction described in (4) using the synthetic DNA for modification. The nucleotide sequence of the amplified product after the PCR reaction is determined by the method described in (2) to confirm whether the intended modification has been made.

[0458] (6) Construction of humanized antibody expression vector

[0459] A humanized antibody expression vector can be constructed by cloning the cDNA encoding VH or VL of the constructed genetic recombinant vector upstream of the gene encoding CH or CL of a human antibody, respectively, in the expression vector for genetic recombinant antibodies obtained in (1).

[0460] For example, by introducing a suitable restriction enzyme recognition sequence at the 5' or 3' end of the synthetic DNA located at both ends in the synthetic DNA used when constructing VH or VL of any humanized antibody obtained in (4) and (5), the cloning is performed upstream of the gene encoding CH or CL of the human antibody, respectively, in the expression vector for genetic recombinant antibodies obtained in (1), so that the cDNA is expressed in a suitable form.

[0461] (7) Transient expression of genetically recombinant antibodies

[0462] By transiently expressing a genetic recombinant antibody using any of the genetic recombinant antibody expression vectors obtained in (3) and (6) or modified expression vectors thereof, the antigen-binding activity of many types of human chimeric antibodies and humanized antibodies produced can be efficiently evaluated.

[0463] As the host cell into which the expression vector is introduced, any cell can be used as long as it is a host cell capable of expressing a genetically recombinant antibody, for example, COS-7 cells [American Type Culture Collection (ATCC) No. CRL1651] [Methods in Nucleic Acids Res., CRC Press, 283 (1991)] can be used.

[0464] When introducing the expression vector into COS-7 cells, the DEAE-dextran method [Methods in Nucleic Acids Res., CRC Press (1991)], the lipofection method [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)], etc. are used.

[0465] After the expression vector is introduced, the expression level and antigen-binding activity of the genetically recombinant antibody in the culture supernatant are measured using enzyme immunoassay [Monoclonal Antibodies - Principles and Practice, 3rd Edition, Academic Press (1996); Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory (1988); Monoclonal Antibody Experimental Manual, Kodansha scientific books (1987)].

[0466] (8) Obtaining transformants stably expressing genetically recombinant antibodies and preparing genetically recombinant antibodies

[0467] A transformant stably expressing a genetically recombinant antibody can be obtained by introducing any of the genetically recombinant antibody expression vectors obtained in (3) and (6) into a suitable host cell.

[0468] For the introduction of the expression vector into host cells, an electroporation method [JP-A-H2-257891; Cytotechnology, 3, 133 (1990)] or the like is used.

[0469] As the host cell into which the genetically recombinant antibody expression vector is introduced, any cell can be used as long as it is a host cell capable of expressing the genetically recombinant antibody. For example, CHO-K1 (ATCC CCL-61), DUKXB11 (ATCC CCL-9096), Pro-5 (ATCC CCL-1781), CHO-S (Life Technologies, catalog number 11619), rat myeloma cells YB2 / 3HL.P2.G11.16Ag.20 (ATCC No. CRL1662, also known as YB2 / 0), mouse myeloma cells NS0, mouse myeloma cells SP2 / 0-Ag14 (ATCC No. CRL1581), mouse P3X63-Ag8.653 cells (ATCC No. CRL1580), dhfr-deficient CHO cells (CHO / DG44 cells) [Proc. Natl. Acad. Sci. USA, 77, 4216 (1980)], etc. are used.

[0470] In addition, host cells in which the activity of proteins such as enzymes involved in the intracellular synthesis of the sugar nucleotide GDP-fucose, proteins such as enzymes involved in glycan modification so that the 1-position of fucose is α-linked to the 6-position of N-acetylglucosamine at the reducing end of an N-glycoside-linked complex glycan, and proteins involved in the intracellular transport of the sugar nucleotide GDP-fucose to the Golgi apparatus are reduced or deleted can also be used, for example, CHO cells deficient in the α1,6-fucosyltransferase gene (WO 2005 / 035586 and WO 02 / 31140), Lec13 with acquired lectin resistance [Somatic Cell and Molecular Genetics, 12, 55 (1986)], and the like.

[0471] After the expression vector is introduced, transformants stably expressing the genetically recombinant antibody are selected by culturing the transformants in a medium for animal cell culture containing a drug such as G418 sulfate (hereinafter referred to as G418) (JP-A-H2-257891).

[0472] As the medium for animal cell culture, RPMI 1640 medium (manufactured by Invitrogen, Inc.), GIT medium (manufactured by Nippon Pharmaceutical Co., Ltd.), EX-CELL 301 medium (manufactured by JRH Biosciences, Inc.), IMDM medium (manufactured by Invitrogen, Inc.) or Hybridoma-SFM (manufactured by Invitrogen, Inc.) or a medium in which any of various additives such as FBS are added to any of these media is used.

[0473] By the transformant obtained being cultivated in substratum, genetic recombination antibody is expressed and accumulated in culture supernatant. The expression level of genetic recombination antibody and antigen-binding activity can be measured by ELISA method etc. in the culture supernatant. In addition, the expression level of genetic recombination antibody produced by the transformant can be improved using dhfr gene amplification system (JP-A-H2-257891) etc.

[0474] The genetically recombinant antibody is purified from the culture supernatant of the transformant using a protein A column [Monoclonal Antibodies - Principles and Practice, 3rd Edition, Academic Press (1996); Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory (1988)]. In addition, methods for purifying proteins such as gel filtration, ion exchange chromatography, and ultrafiltration can also be combined.

[0475] The molecular weight of the H chain, L chain or entire antibody molecule of the purified genetically recombinant antibody can be measured using polyacrylamide gel electrophoresis [Nature, 227, 680 (1970)] or Western blotting [Monoclonal Antibodies - Principles and Practice, 3rd Edition, Academic Press (1996); Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory (1988)].

[0476] (9) Method for producing antibody fragments

[0477] The antibody fragments of the present invention can be produced according to known methods. The antibody fragments of the present invention can be produced by cleaving the antibodies produced according to the methods described in (1) to (8) above with an enzyme or the like, or can be produced by genetic engineering techniques after preparing a nucleotide sequence encoding the desired antibody fragment.

[0478] (10) Method for producing monovalent antibodies

[0479] In the present invention, the monovalent antibody can be produced by the method described in WO 2014 / 054804, WO 2011 / 090754, WO 2007 / 048037, WO 2012 / 116927, etc., or another method.

[0480] (11) Methods for producing bispecific antibodies or multispecific antibodies

[0481] The bispecific antibody or multispecific antibody of the present invention can be produced according to the above-mentioned method for producing antibodies. For example, the bispecific antibody or multispecific antibody can be used in WO 2009 / 131239, WO 2014 / 054804, WO 01 / 077342, U.S. Patent Application Publication No. 2007 / 0071675, WO 2007 / 024715, Wu et al. [Nature Biotechnology, 2007, 25(11), pp.1290-1297], Labrijn et al. [PNAS 2013, vol.110, no.13, pp.5145-5150], Jong et al. [http: / / dx.doi.org / 10.1371 / journal.pbio.1002344], Kontermann et al. [mAbs 2012, vol.4, issue 2, pp.182-197], Spiess et al. [Molecular Immunology 67(2015)95-106], Ridgway et al. [Protein engineering, 1996vol.9no.7pp.617-621], WO 2009 / 080251, WO 2010 / 151792, WO 2014 / 033074, etc.

[0482] For example, an expression vector for a bispecific antibody in which an scFv that binds to CSPG5 is fused to the C-terminus of an IgG antibody that binds to an antigen present in the brain can be produced by the following method, and the bispecific antibody can be produced according to the above-mentioned method for expressing the antibody and the method for purifying the antibody. In addition, a bispecific antibody in which an antibody fragment is fused to the C-terminus of the antibody can also be produced in the same manner.

[0483] Using a synthetic gene of the heavy chain constant region of an IgG antibody that binds to an antigen present in the brain as a template, a gene fragment of the CH1-hinge-CH2-CH3-connector region is amplified by PCR. Subsequently, using the nucleotide sequence of an antibody that binds to CSPG5 as a template, a nucleotide sequence of an scFv region in which the VH and VL of the antibody are connected with a suitable connector is prepared using PCR methods, etc. The two regions are connected by PCR methods, etc., and the resulting gene fragment is inserted into a suitable vector, such as a pCI vector.

[0484] In addition, gene fragments of the light chain domains (VL and CL) of IgG antibodies that bind to antigens present in the brain and gene fragments of the VH of the antibody were amplified separately by the PCR method using appropriate templates and inserted into appropriate positions of the vector.

[0485] In addition, the bispecific antibodies of the present invention can also be produced by chemically linking an antibody fragment containing an antigen-binding site to an IgG antibody.

[0486] 3. Evaluation of the activity of antibodies or antibody fragments thereof

[0487] In the present invention, the activity of an antibody or an antibody fragment thereof can be evaluated as follows.

[0488] (1) Binding activity to CSPG5

[0489] The binding activity of the antibody or antibody fragment of the present invention to CSPG5 is measured using flow cytometry, ELISA, surface plasmon resonance detection, etc. described in 1-(6) above. Alternatively, the binding activity can be measured using a fluorescent antibody method [Cancer Immunol. Immunother., 36, 373 (1993)].

[0490] When the antibody or antibody fragment of the present invention is a monovalent antibody that binds to CSPG5, the binding activity of the monovalent antibody to CSPG5 can also be measured in the same manner. When the antibody or antibody fragment of the present invention is a bispecific antibody or multispecific antibody that binds to CSPG5 and an antigen present in the brain, the binding activity of the bispecific antibody or multispecific antibody to CSPG5 or an antigen present in the brain can also be measured in the same manner.

[0491] (2) Methods for measuring properties accumulated in the brain

[0492] The brain accumulation property of the antibody of the present invention or its antibody fragment can be measured by the following method.

[0493] Examples include a method in which brain tissue is collected a few days after administration of the antibody or antibody fragment thereof to an animal, the brain tissue is homogenized and centrifuged, the concentration of the antibody or antibody fragment thereof in the resulting supernatant is measured, and the amount of the antibody or antibody fragment thereof per unit brain weight is calculated; a method in which the presence of the antibody or antibody fragment thereof is detected by a known immunological method using the collected brain tissue; and the like. Furthermore, examples include a method in which the antibody or antibody fragment thereof, labeled with a pharmaceutically acceptable marker, is administered to an animal, and the presence of the antibody or antibody fragment thereof is detected over time using an in vivo imaging system.

[0494] As animals for the above-mentioned property of accumulation in the brain, suitable animals can be selected based on the use of the antibodies or antibody fragments thereof of the present invention.

[0495] (3) Measurement methods of antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC)

[0496] The CDC or ADCC of the antibodies or antibody fragments thereof of the present invention against cells expressing human CSPG5 or cells expressing CSPG5 and an antigen present in the brain can be measured by known measurement methods [Cancer Immunol. Immunother., 36, 373 (1993); Chapter 7 of Current protocols in Immunology, Immunologic studies in humans, edited by John E, Coligan et al., John Wiley & Sons, Inc., (1993)].

[0497] 4. Methods for controlling effector activity of antibodies or antibody fragments

[0498] Known methods for controlling the effector activity of the antibodies or antibody fragments of the present invention include: methods for controlling the amount of α1,6-fucose (also known as core fucose) bound to N-acetylglucosamine (GlcNAc) present at the reducing end of an N-linked complex glycan that is bound to asparagine (Asn) at position 297 in the Fc region of the antibody or its Fc-containing antibody fragment (WO 2005 / 035586, WO 2002 / 31140, WO 00 / 61739); methods for controlling the effector activity by modifying amino acid residues in the Fc region of the antibody or its antibody fragment; and the like. The effector activity of the antibodies or antibody fragments of the present invention can be controlled using any of these methods.

[0499] The effector activity refers to an antibody-dependent activity caused by the Fc region of an antibody or an antibody fragment thereof, and known ones include ADCC, CDC, antibody-dependent cellular phagocytosis (ADP) by phagocytes such as macrophages or dendritic cells, and the like.

[0500] As a method for measuring effector activity, for example, target cells, human peripheral blood mononuclear cells (PBMC) as effectors, and target cell-specific antibodies or antibody fragments thereof are mixed and then incubated for about 4 hours, and then the released lactate dehydrogenase (LDH) can be measured as an indicator of cytotoxicity. In addition, effector activity can also be measured by 51 Cr release assay, flow cytometry, etc.

[0501] The effector activity of antibodies or antibody fragments containing Fc can be increased or decreased by controlling the core fucose content in the N-linked complex glycans of the antibody's Fc. As a method for reducing the amount of fucose bound to the N-linked complex glycans bound to the Fc of an antibody or antibody fragment, the antibody or antibody fragment can be expressed using CHO cells deficient in the α1,6-fucosyltransferase gene to obtain a fucose-free antibody or antibody fragment. Such fucose-free antibodies or antibody fragments exhibit high ADCC.

[0502] On the other hand, as a method for increasing the content of fucose bound to N-linked complex glycans bound to the Fc region of an antibody or its antibody fragment, a fucose-bound antibody or its antibody fragment can be obtained by expressing the antibody or its antibody fragment using a host cell into which an α1,6-fucosyltransferase gene has been introduced. The fucose-bound antibody or its antibody fragment has lower ADCC than an antibody or its antibody fragment not bound to fucose.

[0503] In addition, by modifying the amino acid sequence in the Fc region of the antibody or its antibody fragment, ADCC or CDC can be increased or decreased. For example, using the amino acid sequence in the Fc region described in U.S. Patent Application Publication No. 2007 / 0148165, the CDC of the antibody or its antibody fragment can be increased.

[0504] Additionally, ADCC or CDC can be increased or decreased by making amino acid modifications as described in US Patent No. 6,737,056, US Patent No. 7,297,775, or US Patent No. 7,317,091.

[0505] In addition, the antibodies or antibody fragments thereof of the present invention also include antibodies or antibody fragments thereof whose half-life in blood is controlled by controlling reactivity with Fc receptors, and the control is achieved, for example, by amino acid modification or glycan modification in the constant region contained in the above-mentioned antibodies or antibody fragments thereof, by amino acid modification described in JP-A-2013-165716, JP-A-2012-021004, etc.

[0506] Furthermore, by combining and applying the above-mentioned methods to an antibody or an antibody fragment thereof, an antibody or an antibody fragment thereof having controlled effector activity or half-life in blood can be obtained.

[0507] 5. Methods for treating diseases using the antibodies or antibody fragments thereof of the present invention

[0508] The antibodies or antibody fragments thereof of the present invention can be used to treat brain diseases in animals expressing CSPG5 in the brain.

[0509] Examples of such brain diseases include Alzheimer's disease, a prodromal stage of Alzheimer's disease, Huntington's disease, Parkinson's disease, brain tumors, multiple sclerosis, muscular dystrophy, amyotrophic lateral sclerosis, multiple system atrophy, progressive supranuclear palsy, nigrostriatal degeneration, olivopontocerebellar atrophy, spinal bulbar muscular atrophy, spinocerebellar degeneration, cerebrovascular disorders, epilepsy, migraine, attention deficit hyperactivity disorder, Creutzfeldt-Jakob disease, corticobasal degeneration, lysosomal storage diseases, depression, dystonia, and the like.

[0510] Brain diseases that can be treated using the antibodies or antibody fragments thereof of the present invention vary depending on the antigen to which the antibodies or antibody fragments thereof bind, the type of molecule that modifies the fusion antibodies or antibody fragments thereof of the present invention, and the like.

[0511] The therapeutic agent comprising the antibody of the present invention or its antibody fragment may be a therapeutic agent comprising only the antibody or its antibody fragment as an active ingredient, but generally, the therapeutic agent is provided as a pharmaceutical preparation produced by mixing with one or more pharmaceutically acceptable carriers using methods known in the field of pharmaceutical technology.

[0512] Examples of administration routes include oral administration or parenteral administration such as oral, intratracheal, rectal, subcutaneous, intramuscular, intracerebroventricular, intraperitoneal, intradermal, intranasal, intrathecal or intravenous administration. Examples of dosage forms include sprays, capsules, tablets, powders, granules, syrups, emulsions, suppositories, injections, ointments, tapes, etc.

[0513] Examples of preparations suitable for oral administration include emulsions, syrups, capsules, tablets, powders, granules and the like.

[0514] Liquid preparations such as emulsions or syrups are produced using water, sugars such as sucrose, sorbitol or fructose, glycols such as polyethylene glycol or propylene glycol, oils such as sesame oil, olive oil or soybean oil, preservatives such as parabens, flavorings such as strawberry flavor or peppermint, etc. as additives.

[0515] Capsules, tablets, powders, granules, etc. are produced using excipients such as lactose, glucose, sucrose or mannitol, disintegrants such as starch or sodium alginate, lubricants such as magnesium stearate or talc, binders such as polyvinyl alcohol, hydroxypropylcellulose or gelatin, surfactants such as fatty acid esters, plasticizers such as glycerol, etc. as additives.

[0516] Examples of preparations suitable for parenteral administration include injections, suppositories, sprays, etc. Injections are produced using a carrier consisting of a saline solution, a glucose solution, or a mixture of the two solutions, etc. Suppositories are produced using a carrier such as cocoa butter, hydrogenated fat, or carboxylic acid.

[0517] Sprays are produced using a carrier or the like that does not irritate the buccal or airway mucosa of the recipient and disperses the antibody or antibody fragment of the present invention into fine particles to promote its absorption. Examples of such carriers include lactose and glycerol. Sprays can also be produced as aerosols or dry powders. Furthermore, the components exemplified as additives for oral administration formulations can also be added to the parenteral formulations described above.

[0518] 6. Methods for detecting or measuring antigens present in the brain or methods for diagnosing diseases using the antibodies or antibody fragments thereof of the present invention

[0519] B...

Claims

1. An antibody or antibody fragment thereof that binds to chondroitin sulfate proteoglycan 5 (CSPG5), wherein the antibody and the antibody fragment comprise a complementary determining region (CDR) selected from the following (a) to (o): (a) the amino acid sequences of CDR1 to CDR3 of the heavy chain variable domain (VH) are the amino acid sequences represented by SEQ ID NOs: 53, 54 and 55, respectively, and the amino acid sequences of CDR1 to CDR3 of the light chain variable domain (VL) are the amino acid sequences represented by SEQ ID NOs: 58, 59 and 60, respectively; (b) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 3, 4 and 5, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 8, 9 and 10, respectively; (c) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 13, 14 and 15, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 18, 19 and 20, respectively; (d) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 23, 24 and 25, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 28, 29 and 30, respectively; (e) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 33, 34 and 35, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 38, 39 and 40, respectively; (f) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 43, 44 and 45, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 48, 49 and 50, respectively; (g) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 63, 64 and 65, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 68, 69 and 70, respectively; (h) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 73, 74 and 75, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 78, 79 and 80, respectively; (i) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 83, 84 and 85, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 88, 89 and 90, respectively; (j) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 93, 94 and 95, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 98, 99 and 100, respectively; (k) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 103, 104 and 105, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 108, 109 and 110, respectively; (l) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 113, 114 and 115, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 118, 119 and 120, respectively; (m) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 123, 124 and 125, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 128, 129 and 130, respectively; (n) the amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 133, 134 and 135, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 138, 139 and 140, respectively; and (o) The amino acid sequences of CDR1 to CDR3 of VH are the amino acid sequences represented by SEQ ID NOs: 143, 144 and 145, respectively, and the amino acid sequences of CDR1 to CDR3 of VL are the amino acid sequences represented by SEQ ID NOs: 148, 149 and 150, respectively.

2. The antibody or antibody fragment thereof according to claim 1, wherein the antibody and the antibody fragment comprise a VH and a VL selected from the following (A) to (O): (A) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 52, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 57; (B) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 2, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 7; (C) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 12, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 17; (D) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 22, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 27; (E) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 32, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 37; (F) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 42, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 47; (G) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 62, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 67; (H) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 72, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 77; (I) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 82, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 87; (J) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 92, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 97; (K) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 102, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 107; (L) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 112, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 117; (M) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 122, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 127; (N) the amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 132, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO: 137; and (O) The amino acid sequence of VH is the amino acid sequence represented by SEQ ID NO: 142, and the amino acid sequence of VL is the amino acid sequence represented by SEQ ID NO:

147.

3. The antibody or antibody fragment thereof according to claim 1 or 2, wherein the antibody is a bispecific antibody.

4. The antibody or antibody fragment thereof according to claim 3, wherein the bispecific antibody binds to CSPG5 and an antigen present in the brain. 5 . The antibody or antibody fragment thereof according to claim 3 , wherein the bispecific antibody comprises an antigen binding site that binds to CSPG5 and an antigen binding site that binds to an antigen present in the brain.

6. The antibody or antibody fragment thereof according to claim 1 or 2, wherein the antibody fragment is selected from Fab, Fab', F(ab')2, single-chain antibody (scFv), dimerized V region (diabody) and disulfide-stabilized V region (dsFv).

7. The antibody or antibody fragment thereof according to claim 1 or 2, wherein the antibody is a genetically recombinant antibody.

8. The antibody or antibody fragment thereof according to claim 1 or 2, wherein the antibody is selected from the group consisting of mouse antibody, rat antibody, rabbit antibody, alpaca antibody, camel antibody, llama antibody, chimeric antibody, humanized antibody and human antibody.

9. A nucleic acid comprising a nucleotide sequence encoding the antibody or antibody fragment thereof according to any one of claims 1 to 8.

10. A transformed cell comprising a vector containing the nucleic acid according to claim 9.

11. A method for producing the antibody or antibody fragment thereof according to any one of claims 1 to 8, the method comprising: culturing the transformed cell according to claim 10, and The antibody or the antibody fragment thereof according to any one of claims 1 to 8 is collected from the culture solution.

12. A composition comprising the antibody or antibody fragment thereof according to any one of claims 1 to 8.

Images