Improvement of clinical parameters by expression of factor viii

Abstract

Constructs for liver-specific expression of transgenes are described herein.

Description

[0001] Cross-referencing of related patent applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 714,553, filed August 3, 2018; U.S. Provisional Patent Application No. 62 / 826,887, filed March 29, 2019; and U.S. Provisional Patent Application No. 62 / 869,445, filed July 1, 2019, the entire contents of which are incorporated herein by reference.

[0003] sequence list

[0004] This application contains a sequence list, which has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on August 1, 2019, and is named 1147465_SL.txt, with a size of 28207 bytes. Background of the Invention

[0006] Gene therapy can be used to genetically modify cells to have one or more inactivated genes and / or to make the cells express products that the cells did not previously produce (e.g., through transgenic insertion and / or through endogenous sequence correction). Examples of the use of transgenic insertion include inserting one or more genes encoding one or more novel therapeutic proteins, inserting sequences encoding proteins lacking in cells or individuals, inserting wild-type genes into cells containing mutated gene sequences, and / or inserting sequences encoding structural nucleic acids (e.g., microRNAs or siRNAs). Examples of useful applications of “correction” of endogenous gene sequences include alterations to disease-related gene mutations, alterations to sequences encoding splice sites, alterations to regulatory sequences, and / or directed alterations to sequences encoding structural features of proteins.

[0007] Liver gene transfer provides an effective means of delivering transgenes to subjects to treat and / or prevent various conditions, including hemophilias and lysosomal storage disorders. See, for example, U.S. Patent No. 9,150,847 and U.S. Publications 20130177983 and 20140017212. Specific vectors for liver-directed gene therapy have also been described. See, for example, WO 2014064277; WO 2009130208; EP2451474B1, Chuah et al., (2014) Molecular Therapy, 22, 1605-1613; and Nair et al. (2014) Blood 123:3195-3199. These vectors may include wild-type mouse parvovirus (MVM) intron sequences. See, for example, Haut and Pintel (1998) J.Virol. 72: 1834-1843; Haut and Pintel (1998) Virol. 258: 84-94.

[0008] Hemophilia, such as hemophilia A and hemophilia B, is a hereditary disorder of the blood clotting system characterized by bleeding into joints and soft tissues, as well as excessive bleeding into any site of trauma or surgery. Clinically, hemophilia A is indistinguishable from hemophilia B, but hemophilia A lacks or does not contain factor VIII (FVIII or F8), while hemophilia B lacks or does not contain factor IX (FIX or F.IX). The F8 gene encodes a plasma glycoprotein that circulates in an inactive form associated with von Wilebrand factor. Upon surface damage, the inherent coagulation cascade is initiated, and FVIII is released from the complex and activated. The activated form, along with factor IX, activates factor X to become activated Xa, ultimately leading to the conversion of fibrinogen to fibrin and inducing a blood clot. See Levinson et al. (1990) Genomics 7(1):1-11. 40-50% of hemophilia A patients have a chromosomal inversion involving intron 22 of F8 (also known as IVS22). This inversion is caused by an intrachromosomal recombination event between a 9.6 kb sequence within intron 22 of the F8 gene and one of two closely related reverse-directed sequences located approximately 300 kb distal to the F8 gene, resulting in an inversion of exons 1-22 about exons 23-26. See [further details omitted]. Textbook of HemophiliaLee et al. (eds) 2005, Blackwell Publishing. Other hemophilia A patients have F8 deficiency, including active site mutations, as well as nonsense and missense mutations.

[0009] Clinically, hemophilia A patients are assessed and stratified based on the frequency and duration of bleeding episodes. Both characteristics are directly dependent on the amount of FVIII protein in the patient's blood. Patients with severe hemophilia typically have 1% less FVIII than normal, experience bleeding after injury, and often bleed spontaneously to joints. Moderate patients have 1-5% of normal FVIII, while mild patients have 6% or more of normal FVIII and only experience bleeding events after severe injury, trauma, or surgery (Kulkami et al. (2009) Haemophilia 15:1281-90). Hemophilia A patients are treated with alternative FVIII proteins derived from human plasma or recombinantly produced (commonly referred to as "factors"), with the frequency of treatment depending on the bleeding pattern and severity of the hemophilia. Patients with severe hemophilia A receive regular prophylactic treatment to prevent bleeding, while those with milder cases receive treatment only as needed after injury.

[0010] Gene therapies for patients with hemophilia A or B have been described, including the introduction of plasmids and other vectors (e.g., AAV) encoding functional FVIII or F.IX proteins. (See, for example, U.S. Patent Nos. 6,936,243; 7,238,346 and 6,200,560; Shi et al. (2007) J Thromb Haemost. (2):352-61; Lee et al. (2004) Pharm. Res. 7:1229-1232; Graham et al. (2008) Genet Vaccines Ther. 3:6-9; Manno et al. (2003) Blood 101 (8):2963-72; Manno et al. (2006) Nature Medicine 12 (3):342-7; Nathwani et al. (2011) Mol Ther 19 (5):876-85; Nathwani et al. (2011); N Engl J Med. 365 (25):2357-65 and Mcintosh et al.) al. (2013) Blood 121(17):3335-44). Invention Overview

[0012] The invention discloses AAV vectors expressing factor VIII and treatments for hemophilia, among other aspects. In some embodiments, methods for administering factor VIII (FVIII) protein to humans are provided. In some embodiments, the method includes administering one or more doses of 6x10... 11 Up to 1x10 13 Or 3x10 13 1x10 13 Up to 1x10 14 Or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13 Administration of vg / kg of the adenovirus-associated virus (AAV) vector as described herein, wherein administration of the AAV vector results in the production of human factor VIII protein. In some embodiments, the dose is 9 × 10⁻⁶. 11 vg / kg, 2×10 12 vg / kg, 1×10 13 vg / kg, 2×10 13 vg / kg, 3×10 13 vg / kg or 4×10 13 vg / kg. In some embodiments, the AAV vector has an AAV6 serotype comprising a nucleotide sequence including an AAV2 inverted terminal repeat sequence flanking an expression cassette containing a liver-specific enhancer and a promoter operatively linked to a polynucleotide encoding SEQ ID NO: 1.

[0013] In some implementations, the method further includes measuring FVIII protein in human blood before and after administration.

[0014] In some implementations, for example, with 1x10 13 vg / kg up to 3x10 13 Or 1x10 13 Up to 1x10 14 or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13 Administering the AAV carrier at a dose of vg / kg resulted in a clinically relevant increase in FVIII activity ranging from 5% to 150% or higher relative to the patient's pre-administration assessment of circulating FVIII activity. In some embodiments, such as at 3 × 10⁻⁶ g / kg... 13Administration of the AAV carrier at a dose of vg / kg resulted in a clinically relevant increase in FVIII activity ranging from 20% to 150% or greater. In some embodiments, administration resulted in one or zero spontaneous bleeding events in human subjects between 3 and 12 months (or, for example, 3 to 6 months, 3 months–1, 2, 5, or 10 years or longer).

[0015] In some implementations, this document provides a method for increasing factor VIII (FVIII) protein in human subjects, including administering one or more doses of 2x10 to a human subject. 12 vg / kg up to 3x10 13 Or 1x10 13 Up to 1x10 14 or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13 Av / kg of adenovirus-associated virus (AAV) vector encoding the FVIII protein (optionally containing the amino acid sequence of SEQ ID NO: 1), wherein administration of the AAV vector results in a clinically relevant increase in circulating FVIII activity levels, for example, an increase of 5% to 150%; or an increase of 50% to 150%. In some embodiments, one or more doses of factor VIII administered to the patient are in the form of 1 × 10⁻⁶ mg / kg of adenovirus-associated virus (AAV) vector encoding the FVIII protein (optionally containing the amino acid sequence of SEQ ID NO: 1). 13 vg / kg up to 3×10 13 The range is vg / kg. In some embodiments, the AAV vector has the AAV6 serotype. In some embodiments, the AAV vector comprises an expression cassette containing a polynucleotide encoding an FVIII protein operatively linked to a liver-specific enhancer and a promoter. In some embodiments, the liver-specific enhancer is a Serpin 1 enhancer and / or the promoter is a minimal transthyretin promoter. In some embodiments, the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO: 2 and / or the promoter comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence flanking the expression cassette. In some embodiments, the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the human subject has hemophilia.

[0016] In some implementations, this document provides methods for increasing factor VIII (FVIII) protein in human subjects, including administering one or more doses of 2x10 to human subjects. 12 vg / kg up to 3x10 13 Or 1x10 13 Up to 1x10 14 or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13 Av / kg of adenovirus-associated virus (AAV) vector encoding the FVIII protein (optionally containing the amino acid sequence of SEQ ID NO: 1) is administered, wherein administration of the AAV vector results in a reduction in the number of FVIII treatments received by the human subject. In some embodiments, the human subject is not treated with any FVIII for 3–12 months (or, for example, 3–6 months, 3 months–1, 2, 5, or 10 years or longer) following administration. In some embodiments, one or more doses of Factor VIII administered to the patient are in doses of 1 × 10⁻⁶. 13 vg / kg up to 3×10 13 The range is vg / kg. In some embodiments, the AAV vector has the AAV6 serotype. In some embodiments, the AAV vector comprises an expression cassette containing a polynucleotide encoding an FVIII protein operatively linked to a liver-specific enhancer and a promoter. In some embodiments, the liver-specific enhancer is a Serpin 1 enhancer and / or the promoter is a minimal promoter for transthyretin. In some embodiments, the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO: 2 and / or the promoter comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence flanking the expression cassette. In some embodiments, the AAV2 5' ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3' ITR comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the human subject has hemophilia.

[0017] In some implementations, for example, 2x10 12 vg / kg up to 3x10 13 Or 1x10 13 Up to 1x10 14 or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13Dosage administration of the AAV carrier within the range of vg / kg results in a reduction in the use of FVIII treatment, for example, a reduction in the number of times a patient receives FVIII injections weekly or monthly. In some embodiments, FVIII use is reduced by at least 20%. In other embodiments, FVIII use is reduced by at least 50%. In some embodiments, FVIII use is reduced by 90% or more.

[0018] In some implementations, prior to administration, the human has less than 1% of the circulating FVIII activity of a normal human, and at 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48 or 52 weeks after administration, the human has at least 1% of the circulating FVIII activity of a normal human.

[0019] In some implementations, prior to administration, the human has 5% less circulating FVIII activity than normal, and at 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human has at least 5% circulating FVIII activity as normal.

[0020] In some implementations, individuals showed levels less than 1.5 times the upper limit of normal (ULN) for at least one of alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, or albumin at 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration.

[0021] In some implementations, no detectable levels of FVIII inhibitors were observed in individuals at 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration.

[0022] In some implementations, subjects to be administered the AAV carrier undergo prophylactic steroid treatment.

[0023] In some embodiments, the method further includes measuring the levels of at least one of the following before application and at 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after application: von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galactagogue 3-binding protein (GAL3BP), C-reactive protein (CRP), IL-6, and circulating alpha-fetoprotein.

[0024] In some implementations, the levels of von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galactagogue-3 binding protein (GAL3BP), C-reactive protein (CRP), IL-6, and circulating alpha-fetoprotein are not more than 1.5 times the levels in the two weeks prior to administration at 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration.

[0025] In some embodiments, fewer bleeding events are observed in individuals after administration. In some embodiments, individuals experience fewer bleeding events at rates of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% after administration.

[0026] In some embodiments, the human body exhibits a reduced need for treatment with the alternative factor VIII protein. In some embodiments, the human body requires a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction in the need for treatment with the alternative factor VIII protein after administration.

[0027] In some implementation schemes, the person has hemophilia.

[0028] In some embodiments, the nucleotide sequence includes SEQ ID NO: 5. In some embodiments, the AAV2 inverted terminal repeat sequences are SEQ ID NO: 12 and SEQ ID NO: 13. Brief description of the attached diagram

[0030] Figure 1 The FVIII activity data from Example 6 are shown using the chromogenic assay as described in Example 1.

[0031] Figure 2 The FVIII activity data from Example 6 are shown using the chromogenic assay described in Example 1.

[0032] Figure 3 The FVIII activity data from Example 6 are shown using the one-stage coagulation assay as described in Example 1.

[0033] Figure 4 The study shows the FVIII activity over time in ten patients treated with the carrier, based on the one-stage coagulation assay described in Example 1.

[0034] Figure 5The changes in FVIII activity over time after treatment with the carrier in ten patients are shown, based on the chromogenic assay described in Example 1.

[0035] Figure 6 Data on spontaneous bleeding events in patients at least 3 weeks after administration of the indicated dose of the carrier are presented.

[0036] Figure 7 The use of FVIII in patients three weeks or longer after carrier injection is shown.

[0037] Figure 8 An overview of serious adverse events (SAEs) is provided.

[0038] Figure 9 An overview of treatment-related adverse events (AEs) is provided.

[0039] Figure 10 An overview of the results is provided. Invention Details

[0041] introduction

[0042] The inventors have discovered that certain AAV vectors expressing factor VIII (FVIII) can effectively produce increased FVIII activity in humans, including those with hemophilia. For example, it has been found that, in some embodiments, administration of the AAV vector as described herein results in an increase in circulating FVIII activity from less than 1% of normal FVIII activity to at least 1%, and in some embodiments, an increase to at least 2, 3, 4, or 5% of normal FVIII activity. Furthermore, in some embodiments, as described herein, the increase in circulating FVIII activity in humans has little or no side effects on liver function or other biomarkers. For most patients, when the vector is administered at a concentration of 1 x 10⁻⁶, 13 When the concentration is 1 x 10⁻⁶ g / kg or higher, the rate of bleeding events drops to zero 3 weeks (or more) after administration, indicating that the concentration at 1 x 10⁻⁶ g / kg is sufficient to achieve the desired effect. 13 vg / kg or above (e.g., 1x10) 13 vg / kg to 1x10 14 vg / kg, for example 2-4x10 13 (vg / kg) results in highly effective treatment. Therefore, in some implementations, patients receiving the carrier at these concentrations do not require further FVIII infusions, or at least not for 3, 6, 9, or 12 months after carrier administration.

[0043] An adeno-associated virus (AAV) vector encoding FVIII is provided. An exemplary AAV vector is of serotype AAV6 and includes an inverted repeat (ITR) sequence flanking an expression cassette containing a liver-specific enhancer and promoter operatively linked to an intron and a polynucleotide encoding FVIII. An exemplary FVIII is SEQ ID NO: 1. In some embodiments, the ITR sequence is AAV2ITR, and therefore the vector may be referred to as an "AAV2 / 6" vector. For the genomic sequences of AAV serotypes and the discussion of genomic similarity, see, for example, GenBank accession number AF028704.1; GenBank accession number J01901.1; Chiorini et al., J.Vir.71:6823-33 (1997); Srivastava et al., J.Vir.45:555-64 (1983); Chiorini et al., J.Vir.73:1309-1319 (1999); Rutledge et al., J.Vir.72:309-319 (1998); and Wu et al., J.Vir.74:8635-47 (2000). An exemplary AAV2 ITR sequence is:

[0044] AAV2 5'ITR:

[0045] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 12).

[0046] AAV2 3'ITR:

[0047] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 13).

[0048] Exemplary liver-specific enhancers include, for example, wild-type or mutant Serpin1 enhancers, and exemplary promoters are transthyretin minimal (TTRm) promoters. Therefore, in some embodiments, the AAV vector is an AAV2 / 6 vector containing an AAV2 ITR sequence flanking a wild-type or mutant Serpin1 enhancer linked to a TTRm promoter operatively linked to a polynucleotide encoding FVIII (e.g., SEQ ID NO: 1). Exemplary vector sequences are described, for example, in WO 2017 / 074526.

[0049] SEQ ID NO: 1 shows the human FVIII amino acid sequence containing the signal peptide:

[0050]

[0051] The signal peptide portion of SEQ ID NO:1 is MQIELSTCFFLCLLRFCFS (SEQ ID NO:14), which is cleaved during protein secretion.

[0052] For example, an exemplary SERPIN1 enhancer is

[0053] GGGGGAGGCTGCTGGTGAATATTAACCAAGATCACCCCAGTTACCGGAGGAGCAAACAGGGACTAAGTTCACACGCGTGGTACC (SEQ ID NO: 2).

[0054] An exemplary TTRm promoter is

[0055] GTCTGTCTGCACATTTCGTAGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGCAAGGTTCATATTTGTGTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTCACACAGATCCACAAGCTCCTG (SEQ ID NO: 3).

[0056] An exemplary coding sequence for FVIII is:

[0057]

[0058] An example sequence in which the flanks of the expression box are inverted terminal repeat sequences is:

[0059]

[0060]

[0061]

[0062] SEQ ID NO: 5 contains (from 5' to 3') the insulator (spacer) sequence Ins1 (nucleotides 14-32 of SEQ ID NO: 5), the Serpin1 enhancer CRMSBS2 (nucleotides 33-104 of SEQ ID NO: 5), the transthyretin minimum promoter TTRm (nt 117-339 of SEQ ID NO: 5), the SBR intron 3 (nt 340-432 of SEQ ID NO: 5), the FVIII coding sequence hF8 BDD (nt 438-4811 of SEQ ID NO: 5), the poly A sequence synthesized by SPA51 (nt 4818-4868 of SEQ ID NO: 5), and the insulator sequence Ins3 (nt 4869-4885 of SEQ ID NO: 5), as described in PCT Publication No. WO 2017 / 074526.

[0063] The construction of recombinant AAV vectors has been described in numerous publications, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). Efficient gene transfer and stable transgene delivery are characteristic of this vector system due to its integration into the genome of the transduced cell. See, for example, Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996).

[0064] The effective dose of the AAV carrier to be administered can vary from patient to patient. In some embodiments, the effective dose is determined by the physician administering the composition (AAV carrier). Analysis of serum, plasma, or other tissue levels of the therapeutic peptide and comparison with initial levels before administration can determine whether the administered dose is too low, within the correct range, or too high. The appropriate regimen for initial and subsequent administrations is also variable, but is exemplified by the initial administration, optionally followed by subsequent administrations if necessary. Subsequent administrations can be administered at variable intervals, ranging from daily to annually to every few years. In some embodiments, appropriate immunosuppressive techniques may be recommended to avoid inhibition or prevention of transduction by immunosuppression of the carrier delivery. See, for example, Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0065] Administration can be performed in any manner. In vivo and ex vivo methods have been considered. In some embodiments, intravenous injection (e.g., but not limited to, via the portal vein) is the method of administration. In some embodiments, administration is performed via standard intravenous administration. Other in vivo administration methods include, for example, direct injection into the liver lobe or bile duct, and intravenous injection into the distal liver (including via the hepatic artery), direct injection into the liver parenchyma, injection via the hepatic artery, and / or retrograde injection via the bile duct tree. Ex vivo administration methods include in vitro transduction of excised hepatocytes or other liver cells, followed by infusion of the transduced, excised hepatocytes back into the portal vascular system, liver parenchyma, or bile duct tree of a human patient, see, for example, Grossman et al., (1994) Nature Genetics, 6:335-341.

[0066] In some implementations, the exemplary intravenous dose of the AAV carrier described herein can be 6 x 10 11 Up to 1x10 13 Or 3x10 13 Or 1x10 13 Up to 1x10 14 or 1x10 13 Up to 5x10 13 Or 2x10 13 Up to 4x10 13 Between vg / kg, for example from 1x10 12 Or 2x10 12 Up to 3x10 13 Viral genome of human recipients / kg (vg / kg). In some implementations, the dose is 1×10⁻⁶. 11 Up to 1×10 12 vg / kg. In some implementations, the dosage is 1×10 12 Up to 1×10 13 vg / kg or 3×1013 In some implementations, the dose is 2 × 10⁻⁶. 12 Up to 3×10 13 In some implementations, the dose is 5 × 10⁻⁶. 12 Up to 5×10 13 vg / kg. As described above, in some embodiments, the AAV carrier is administered to the recipient as a single dose. In some embodiments, the dose is 6 × 10⁻⁶. 11 9×10 11 1.2×10 12 2×10 12 4×10 12 6×10 12 1×10 13 3×10 13 4×10 13 Or 5×10 13 vg / kg. In some implementations, patients receive a single dose of the AAV carrier.

[0067] Pharmaceutically acceptable carriers may be included as part of the administered formulation. A pharmaceutically acceptable carrier depends in part on the specific composition being administered and the specific method of administration. Therefore, as described below, there are a wide variety of suitable pharmaceutical composition formulations (see, for example, Remington's Pharmaceutical Sciences, 17th edition, 1989).

[0068] Formulations for in vitro and in vivo administration may include suspensions in liquids or emulsions (e.g., genetically modified cells, liposomes, or nanoparticles). The active ingredient may be mixed with pharmaceutically acceptable and compatible excipients. Suitable excipients include, for example, water, saline, dextran, glycerol, ethanol, and combinations thereof. Additionally, the composition may contain small amounts of excipients, such as wetting agents or emulsifiers, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition.

[0069] The recipient of the AAV carrier may be any person. Exemplary recipients include, for example, individuals with hemophilia (e.g., hemophilia A). In some embodiments, the therapeutically effective amount of a method for treating hemophilia A or for reducing bleeding time during a bleeding event in a subject with hemophilia A refers to an amount capable of causing one or more of the following effects: (1) to a certain extent alleviate, suppress, or prevent one or more physiological symptoms of hemophilia A, including, for example, bruising, joint pain or swelling, prolonged headache, vomiting, or fatigue; (2) improve blood clotting ability; (3) reduce the overall bleeding time during a bleeding event; (4) administer an administration that results in a measurable increase in the concentration or activity of functional FVIII protein in the subject's plasma and / or (5) to a certain extent relieve one or more symptoms associated with the condition.

[0070] In some embodiments, an FVIII blood concentration greater than 1% of the factor concentration found in normal individuals is due to the administration of the AAV carrier described herein, thereby altering a severe disease phenotype to a moderate one. The severe phenotype is characterized by joint damage and life-threatening bleeding. In some embodiments, the administration of the AAV carrier as described herein results in an FVIII blood concentration of at least 5% of normal. In some embodiments, an FVIII blood concentration greater than 5% of normal is required to convert a moderate disease phenotype to a mild one. For example, the normal FVIII level is approximately 1.14 ± 0.48 nM plasma by activated partial thromboplastin time (aPTT) staged coagulation assay (see, e.g., Butenas, et al., Thromb Res. (2010 Aug); 126(2):119–123). Therefore, therapeutic effects can be achieved by expressing FVIII, resulting in a total amount of FVIII in the subject / person that is greater than 1% of the FVIII present in the normal subject / person, for example, 1% of 1.14 ± 0.48 nM.

[0071] In some embodiments, prior to administration, the human has 1%, 2%, 3%, 4%, or 5% less than normal circulating FVIII activity, and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the human has at least 1%, 2%, 3%, 4%, or 5% of normal circulating FVIII activity, respectively. In some embodiments, administration of the AAV carrier as described herein results in an increase of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more IU / dl in the plasma of the human recipient compared to the amount of functional FVIII protein activity present in the plasma of the subject prior to administration (e.g., within 14 days prior to administration). In some embodiments, administration of the AAV carrier as described herein results in the expression of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or higher IU / dl of circulating FVIII activity in the subject's plasma. For this purpose, the term "IU" or "International Unit" regarding FVIII activity is the commonly understood term, where 1 IU of FVIII activity is equal to the amount of FVIII in one milliliter of normal human plasma. In some embodiments, normal human FVIII activity is 0.500-1.500 IU / ml plasma. The World Health Organization describes the severity levels of hemophilia as follows:

[0072]

[0073] Plasma FVIII activity can be quantified by a number of well-known and accepted assays, including, for example, the activated partial thromboplastin time (APPT) method (see, for example, Miletich JP: Activated partial thromboplastin time. In Williams Hematology. Fifth Edition. Edited by E Beutler, MA Lichtman, BA Coller, TJ Kipps. New York, McGraw-Hill, 1995, pp. L85-86; Greaves and Preston, Approach to the bleeding patient). Hemostasis and Thrombosis:Basic Principles and Clinical Practice.Fourthedition.Edited by RW Colman, J Hirsh, VJ Marder, et al. Philadelphia, JBLippincott Co, 2001, pp 1197-1234 and Olson et al, Arch. Pathol. Lab. Med. 122: 782-798 (1998)) or chromogenic FXa determination (Harris et al., Thromb. Res. 128(6): 125-129 (2011)).

[0074] In other embodiments, the bleeding time of the subject can be measured using well-known and accepted techniques, including, for example, the Ivy method (see, e.g., Ivy et al., Surg. Gynec. Obstet. 60:781 (1935) and Ivy et al., J. Lab. Clin. Med. 26:1812 (1941)) or the Duke method (see, e.g., Duke et al., JAMA 55:1185 (1910)). A “bleeding event” in a subject refers to an injury that causes bleeding, whether external or internal, and typically includes the time period from the injury to the formation of a blood clot. In some embodiments, the frequency of bleeding events in the subject is reduced after administration of the AAV carrier described herein. In some embodiments, the frequency of bleeding events is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% after administration.

[0075] In some embodiments, the concentration of FVIII protein in human blood is measured before, after, or both before and after administration. The blood concentration of FVIII can be measured using direct or indirect assays. Exemplary indirect methods include, for example, those described in Over, J. (1986) Scand. J. Haematol. 33 (Suool. 41), 13-24; Kemball-Cook, G., et al. (1993) Brit. J. Haematol. 84, 273-278. Direct detection methods include, for example, those described in U.S. Patent No. 8,715,951. In some embodiments, the blood concentration of FVIII is determined within two weeks prior to the initial administration of the AAV carrier to optimally determine the post-administration effect.

[0076] In some embodiments, administration and treatment with the AAV carrier described herein will result in a reduction in the subject's need for treatment with the alternative factor VIII protein. This can be measured by noting the frequency of the need for treatment before administration of the AAV carrier described herein, and then noting the frequency of the need for treatment after administration. In some embodiments, the reduction in the need for treatment is a reduction of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% after administration.

[0077] In some embodiments, administration and treatment with the AAV carrier described herein cause little or no damage to the liver. Liver status can be measured, for example, by measuring one or more biomarkers in an individual's blood. Exemplary biomarkers indicating liver health include, but are not limited to, alanine aminotransferase (ALT) or aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, and albumin. In some embodiments, within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, a person shows no more than 1.0, 1.2, 1.5, 1.7, or 2.0 times the upper limit of normal (ULN) of at least one of alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, or albumin. ULN can generally be determined from a population. For a discussion of ALT, see, for example, Neuschwander-Tetri, B., et al., Arch Intern Med. 2004 Mar 24; 168(6):663–666. In some embodiments, the ULN for ALT is 44 U / L. In some embodiments, the ULN for AST is 39 U / L. In some embodiments, the ULN for bilirubin is 0.1–1.0 mg / dL for total bilirubin, 0.2–0.7 mg / dL for conjugated bilirubin, and 0.1–0.4 mg / dL for unconjugated bilirubin. See, for example, Lisa B, Van Wagner (2015). Journal of American Medical Association (JAMA) 313(5):516–517. In some embodiments, the ULN for alkaline phosphatase is 129 or 133 U / L. See, for example, Gowda, et al., Pan Afr Med J. (2009) 3:17. In some implementations, the normal range for albumin is 35-55 g / L (Burtis and Ashwood (1999)). Tietz Textbook of Clinical Chemistry ,3 rdedition.Saunders Editor).

[0078] In some implementations, administration and treatment with the AAV vector described herein, for example at any one or more time points at weeks 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, and 52 post-administration, do not result in detectable levels of FVIII inhibitors. FVIII inhibitors were detected by the Nijmegen-Bethesda assay (Duncan, et al., Methods Mol Biol. 2013; 992:321-33 and Miller CH, et al. Am J Hematol. 90:871-876 (2015)). The limit of detection for this assay is 0.6 BU. Any result below 0.6 BU is considered undetectable.

[0079] In some embodiments, administration and treatment with the AAV carrier described herein do not significantly affect the expression of certain biomarkers and ideally result in improved biomarker outcomes. Exemplary biomarkers include, for example, von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), galactagogue-3 binding protein (GAL3BP), C-reactive protein (CRP), IL-6, and circulating alpha-fetoprotein. In some embodiments, one or more of the listed biomarkers are measured in the individual's blood before, after, or both of administration. In some embodiments, when measured within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after administration, the blood level of one or more biomarkers does not exceed 1.0, 1.2, 1.5, 1.7, or 2.0 times the level within two weeks prior to administration.

[0080] Overview

[0081] Unless otherwise stated, the practice of the methods disclosed herein, as well as the preparation and use of the compositions, employs conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields, as are available within the scope of this art. These techniques are well explained in the literature. See, e.g., Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; series METHODS IN ENZYMOLOGY, Academic Press, San Francisco. Diego; Wolffe, CHROMATINSTRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS INENZYMOLOGY, Vol. 304, "Chromatin" (PMWassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (PB Becker, ed.) Humana Press, Totowa, 1999.

[0082] definition

[0083] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in linear or cyclic configurations and in single- or double-stranded forms. For the purposes of this disclosure, these terms should not be construed as limiting the length of the polymer. The term may cover known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moieties (e.g., phosphate thioester backbones). Generally, analogs of a particular nucleotide have the same base-pairing specificity; that is, an analog of A will pair with a T base.

[0084] The terms "polypeptide," "peptide," and "protein" are used interchangeably and refer to a polymer of amino acid residues. The term also applies to amino acid polymers, where one or more amino acids are chemical analogs or modified derivatives of the corresponding natural amino acids.

[0085] In any of the methods described herein, the exogenous nucleotide sequence (“expression construct”, “expression cassette”, or “vector”) may contain a sequence homologous to, but not identical to, a genomic sequence in the target region, thereby stimulating homologous recombination to insert a different sequence into the target region. Thus, in some embodiments, a portion of the expression cassette sequence homologous to a sequence in the target region exhibits approximately 80-99% (or any integer between therewith) sequence identity with the substituted genomic sequence. In other embodiments, the homology between the expression cassette and the genomic sequence is greater than 99%, for example, if the homologous region of the expression cassette differs from a genomic sequence of more than 100 consecutive base pairs by only one nucleotide. In some cases, the non-homologous portion of the expression cassette may contain a sequence not present in the target region, thereby introducing a new sequence into the target region. In these cases, the flanking portion of the non-homologous sequence is typically a sequence homologous to or identical to a sequence in the target region of 50-1,000 base pairs (or any integer between therewith) or any number greater than 1,000 base pairs.

[0086] The term "sequence" refers to a nucleotide sequence of any length, which may be DNA or RNA; it may be linear, circular, or branched, and may be single-stranded or double-stranded. The term "transgenic" refers to a nucleotide sequence inserted into the genome. Transgenics can have any length, for example, between 2 and 100,000,000 nucleotides (or any integer value between or above), preferably between about 100 and 100,000 nucleotides (or any integer value between or above), more preferably between about 2,000 and 20,000 nucleotides (or any value between or above), and even more preferably between about 5 and 15 kb (or any value between or above).

[0087] A chromosome is a chromatin complex that contains all or part of a cell's genome. A cell's genome is typically characterized by its karyotype, which is the collection of all chromosomes that make up the cell's genome. A cell's genome may contain one or more chromosomes.

[0088] An episome is a replicating nucleic acid, nucleoprotein complex, or other structure that contains nucleic acids that are not part of the cellular chromosomal karyotype. Examples of episomes include plasmids and certain viral genomes. The liver-specific constructs described herein can be episome-maintained or can be stably integrated into cells.

[0089] "Exogenous" molecules are molecules that are not normally present in cells but can be introduced into cells through one or more genetic, biochemical, or other methods. "Normal presence in cells" is determined by the specific developmental stage of the cell and environmental conditions. Therefore, for example, molecules that exist only during the embryonic development of muscle are exogenous molecules relative to adult muscle cells. Similarly, molecules induced by heat shock are exogenous molecules relative to non-heat-shocked cells. Exogenous molecules can include, for example, functional versions of dysfunctional endogenous molecules or dysfunctional versions of normally functioning endogenous molecules.

[0090] Exogenous molecules can be, in particular, small molecules such as those produced through combinatorial chemistry processes, or large molecules such as proteins, nucleic acids, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides, any modified derivatives of the above molecules, or any complex containing one or more of the above molecules. Nucleic acids include DNA and RNA, which can be single-stranded or double-stranded; linear, branched, or circular; and can be of any length. Nucleic acids include those capable of forming double strands and those capable of forming triple strands. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA-binding proteins, polymerases, methyltransferases, demethylases, acetyltransferases, deacetylases, kinases, phosphatases, ligases, deubiquitinases, integrases, recombinases, ligases, topoisomerases, gyrases, and helicases.

[0091] Exogenous molecules can be molecules of the same type as endogenous molecules, such as exogenous proteins or nucleic acids. For example, exogenous nucleic acids may contain infectious viral genomes, plasmids or episomes introduced into cells, or chromosomes not normally present in cells. Methods for introducing exogenous molecules into cells are known to those skilled in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate coprecipitation, DEAE-glucan-mediated transfer, and viral vector-mediated transfer. Exogenous molecules can also be molecules of the same type as endogenous molecules, but from a different species than the cell source. For example, human nucleic acid sequences can be introduced into cell lines originally derived from mice or hamsters. Methods for introducing exogenous molecules into plant cells are known to those skilled in the art and include, but are not limited to, protoplast transformation, silicon carbide (e.g., WHISKERS) TM Agrobacterium-mediated transformation, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment (e.g., using a "gene gun"), calcium phosphate coprecipitation, DEAE-glucan-mediated transfer, and viral vector-mediated transfer.

[0092] In contrast, "endogenous" molecules are molecules that are typically present in specific cells under specific environmental conditions and at specific developmental stages. For example, endogenous nucleic acids can be the genome of chromosomes, mitochondria, chloroplasts, or other organelles, or naturally occurring accessory nucleic acids. Other endogenous molecules can include proteins, such as transcription factors and enzymes.

[0093] As used herein, the term “product of exogenous nucleic acids” includes both polynucleotide and polypeptide products, such as transcription products (polynucleotides such as RNA) and translation products (polypeptides).

[0094] For the purposes of this disclosure, "gene" includes the DNA region encoding a gene product (see below), as well as all DNA regions that regulate the production of that gene product, whether or not such regulatory sequences are adjacent to coding and / or transcriptional sequences. Therefore, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions.

[0095] "Gene expression" refers to the conversion of information contained in a gene into a gene product. Gene products can be direct transcription products of genes (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozymes, structural RNA, or any other type of RNA) or proteins produced through the translation of mRNA. Gene products also include RNA modified through processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified through processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0096] The “modulation” of gene expression refers to changes in gene activity. Regulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing (e.g., cutting, alteration, inactivation, random mutation) can be used to regulate expression. Gene inactivation refers to any reduction in gene expression compared to cells that do not contain ZFP, TALE, or CRISPR / Cas systems as described herein. Therefore, gene inactivation can be partial or complete.

[0097] "Eukaryotic" cells include, but are not limited to, fungal cells (e.g., yeast), plant cells, animal cells, mammalian cells, and human cells (e.g., T cells), including stem cells (pluripotent and pluripotent).

[0098] The terms "operably linked" and "operably" (or "operably connected") are used interchangeably to refer to the juxtaposition of two or more components (e.g., sequential elements) arranged such that both components function properly and allow at least one component to mediate a function imposed on at least one other component. For example, if a transcriptional regulatory sequence controls the transcriptional level of a coding sequence in response to the presence or absence of one or more transcriptional regulatory factors, then the transcriptional regulatory sequence, such as a promoter, is operably linked to the coding sequence. Transcriptional regulatory sequences are typically cis-operably linked to the coding sequence, but do not necessarily have to be directly adjacent to it. For example, enhancers are transcriptional regulatory sequences operably linked to coding sequences, even if they are not contiguous.

[0099] A “functional fragment” of a protein, polypeptide, or nucleic acid is a protein, polypeptide, or nucleic acid whose sequence differs from the full-length protein, polypeptide, or nucleic acid, but which retains the same function as the full-length protein, polypeptide, or nucleic acid. Functional fragments may have more, fewer, or the same number of residues as the corresponding natural molecule, and / or may contain one or more amino acid or nucleotide substitutions. Methods for determining nucleic acid function (e.g., encoding function, ability to hybridize with another nucleic acid) are well known in the art. Similarly, methods for determining protein function are well known. For example, human factor VIII with a B-domain deletion is a functional fragment of the full-length factor VIII protein.

[0100] Polynucleotide "vectors" or "constructs" are capable of transferring gene sequences to target cells. Generally, "vector construct," "expression vector," "expression construct," "expression cassette," and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a target gene and transferring the gene sequence to target cells. Therefore, the term encompasses cloning and expression vectors, as well as integration vectors.

[0101] The terms "subject" and "patient" are used interchangeably and refer to mammals, such as human patients and non-human primates, as well as laboratory animals, such as rabbits, dogs, cats, rats, mice, and other animals. Therefore, as used herein, the terms "subject" or "patient" refer to any mammalian patient or subject to whom the expression cassette of the present invention may be administered. Subjects of the present invention include subjects suffering from diseases.

[0102] As used herein, the terms “treating” and “treatment” refer to reducing the severity and / or frequency of symptoms, eliminating symptoms and / or underlying causes, preventing the occurrence of symptoms and / or their underlying causes, and improving or remedying damage. Cancer and graft-versus-host disease are non-limiting examples of conditions that can be treated using the compositions and methods described herein. Therefore, “treating” and “treatment” include:

[0103] (i) To prevent the occurrence of disease or condition in mammals, especially when such mammals are susceptible to the condition but have not yet been diagnosed with it;

[0104] (ii) To suppress a disease or condition, that is, to prevent its development;

[0105] (iii) Alleviating the disease or condition, i.e. causing the disease or condition to subside; and / or

[0106] (iv) Relieve or eliminate symptoms caused by the disease or condition, i.e., relieve pain and treat or not treat the underlying disease or condition.

[0107] As used in this article, the terms “disease” and “condition” may be used interchangeably or may be different because a particular disease or condition may not have a known cusative agent (therefore the cause has not been resolved) and therefore it has not been identified as a disease but only as an undesirable condition or syndrome in which a clinician has identified a more or less specific set of symptoms.

[0108] "Pharmaceutical composition" refers to the compounds of the present invention and formulations of media generally accepted in the art for delivering bioactive compounds to mammals, such as humans. Such media include all pharmaceutically acceptable carriers, diluents, or excipients.

[0109] "Effective amount" or "therapeutic effective amount" means the amount of the compound of the present invention that, when applied to a mammal, preferably a human, is sufficient to treat the disease. The amount of the composition of the present invention constituting a "therapeutic effective amount" will vary depending on the compound, the condition and its severity, the method of administration, and the age of the mammal to be treated, but can be determined by one of ordinary skill in the art in consideration of his own knowledge and the conventional application of this disclosure.

[0110] Liver-specific expression construct

[0111] This article also describes expression cassettes (constructors) for guiding transgene expression in hepatocytes, including in vivo after administration of the expression cassette to a subject (e.g., liver delivery). The expression construct can be maintained episomally in a free state and drive transgene expression extrachromosomally, or the expression construct can be integrated into the genome of hepatocytes, for example, through nuclease-mediated targeted integration.

[0112] The polynucleotide expression construct comprises an enhancer sequence, a promoter sequence, and one or more transgenes. Optionally, it includes one or more of the following: intron sequences, polyadenylated sequences, and / or signal peptides. Any enhancer sequence may be used in the expression construct described herein. In some embodiments, the enhancer is a wild-type or modified Serpin1 enhancer (Chuah et al., (2014) Molecular Therapy, 22, 1605-1613; Nair et al., (2014) Blood, 123, 3195-3199).

[0113] It is evident that any transgene can be used in the constructs described herein. Furthermore, the various components of the constructs described herein (promoters, enhancers, insulators, transgenes, etc.) can be mixed and matched in any combination.

[0114] The constructs described herein can be contained within any viral or non-viral vector. The constructs can be maintained in a free state or can be integrated into the genome of a cell (e.g., via nuclease-mediated targeted integration).

[0115] Non-viral vectors include DNA or RNA plasmids, DNA MCs, naked nucleic acids, and nucleic acids complexed with delivery vectors such as liposomes, nanoparticles, or poloxamers. Viral vectors that can be used to carry the expression cassettes described herein include, but are not limited to, retroviruses, lentiviruses, adenoviruses, adeno-associated virus vectors, vaccinia virus vectors, and herpes simplex virus vectors. Integration into the host genome can be facilitated using retroviral, lentiviral, and adeno-associated virus gene transfer methods, as described herein, and can be promoted via nuclease-mediated integration.

[0116] In some embodiments, the construct is contained in an adeno-associated virus (“AAV”) vector or vector system that can be maintained in a free state or integrated into the genome of hepatocytes (e.g., via nuclease-mediated targeted integration). Construction of recombinant AAV vectors is documented in numerous publications, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0117] Therefore, in some embodiments, the expression construct is carried on an AAV construct and further includes the 5' and 3' ITRs flanking the expression construct elements as described herein (e.g., enhancers, promoters, optional introns, transgenes, etc.). Optionally, spacer molecules are also included between one or more components of the expression construct, such as between the 5' ITR and the enhancer and / or between the polyadenylation signal and the 3' ITR. The spacer can serve as a homologous arm to facilitate recombination into a safe harbor locus (e.g., albumin).

[0118] In some embodiments, the AAV vectors described herein can be derived from any AAV. In some embodiments, the AAV vectors are derived from defective and nonpathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from plasmids containing only the 145 bp inverted terminal repeat sequence of the AAV, flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery are key features of this vector system due to integration into the genome of the transduced cell. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh.10, as well as any novel AAV serotype, can also be used according to the invention. In some embodiments, chimeric AAVs are used, wherein the viral origin of the LTR sequence of the viral nucleic acid is heterologous to the viral origin of the capsid sequence. Non-limiting examples include chimeric viruses having an LTR derived from AAV2 and a capsid derived from AAV5, AAV6, AAV8, or AAV9 (AAV2 / 5, AAV2 / 6, AAV2 / 8, and AAV2 / 9, respectively).

[0119] Packaging cells are used to form viral particles capable of infecting host cells. These cells include HEK293 and Sf9 cells, which can be used to package AAV and adenoviruses, and ψ2 or PA317 cells, which can package retroviruses. Viral vectors used in gene therapy are typically produced by producer cell lines that package nucleic acid vectors into viral particles. Vectors typically contain the minimum viral sequence required for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the proteins to be expressed. Missing viral functions are provided trans-by the packaging cell lines. For example, AAV vectors used in gene therapy typically only have inverted terminal repeat (ITR) sequences from the AAV genome, which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing helper plasmids encoding other AAV genes (i.e., rep and cap) but lacking the ITR sequence. This cell line is also infected with adenoviruses as helpers. The helper virus promotes the replication of the AAV vector and the expression of AAV genes from the helper plasmids. Due to the lack of the ITR sequence, there is no large quantity of packaging helper plasmids. Adenovirus contamination can be reduced, for example, by heat treatment, as adenoviruses are more sensitive to heat treatment than AAVs. In some implementations, AAVs are produced using a baculovirus expression system.

[0120] In many gene therapy applications, it is desirable to deliver gene therapy vectors to specific tissue types with high specificity. Therefore, viral vectors can be modified to be specific to a given cell type by expressing a ligand as a fusion protein with a viral capsid protein on the outer surface of the virus. The ligand is selected to have an affinity for a receptor known to be present on the target cell type. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney murine leukemia virus could be modified to express a human modulator protein fused with gp70, and this recombinant virus infected certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses a receptor and the virus expresses a fusion protein containing a cell surface receptor ligand. For example, filamentous phages can be engineered to exhibit antibody fragments (e.g., FAB or Fv) with specific binding affinity to virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that are beneficial for uptake by specific target cells.

[0121] The polynucleotides described herein may include one or more non-natural bases and / or the backbone. In particular, the expression cassettes described herein may include methylated cytosine to achieve a transcriptional quiescent state in the target region.

[0122] Furthermore, the expression constructs described herein may also contain other transcriptional or translational regulatory sequences or other sequences, such as Kozak sequences, other promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites, and / or polyadenylation signals. Additionally, control elements of the target gene can be operatively linked to a reporter gene to generate chimeric genes (e.g., reporter gene expression cassettes).

[0123] deliver

[0124] The constructs described herein can be delivered in vivo or in vitro to any cell type by any suitable means, preferably to the liver (liver delivery). Similarly, when combined with nucleases for targeted integration, the nucleases can be delivered in polynucleotide and / or protein forms, for example using non-viral vectors, viral vectors, and / or RNA forms, for example, as mRNA.

[0125] Conventional viral and nonviral gene transfer methods can be used to introduce nucleic acids encoding engineered gene regulators into cells (e.g., mammalian cells) and target tissues. Such methods can also be used to administer nucleic acids encoding such repressors (or components thereof) to cells in vitro. In some embodiments, the administration of nucleic acids encoding repressors is for in vivo or in vitro gene therapy purposes. Nonviral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids compounded with delivery vectors such as liposomes or poloxamers. Viral vector delivery systems include DNA and RNA viruses that have either a free genome or an integrated genome after delivery to cells. For reviews of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddadada et al., in Current Topics in Microbiology and Immunology Doerfler and (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0126] Any vector system may be used, including but not limited to plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors, herpesvirus vectors, and adeno-associated virus vectors. See also U.S. Patent Nos. 8,586,526; 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, which are incorporated herein by reference in their entirety.

[0127] Non-viral methods for nucleic acid delivery include electroporation, lipid transfection, microinjection, biological projectiles, virions, liposomes, immunoliposomes, other nanoparticles, polycationic or lipid:nucleic acid conjugates, naked DNA, artificial virions, and reagent-enhanced DNA uptake. Sonication using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for nucleic acid delivery. Other exemplary nucleic acid delivery systems include those offered by Amaxa Biosystems (Cologne, Germany), Maxcyte (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA), and Copernicus Therapeutics (see, for example, US6008336).

[0128] In some implementations, the expression construct is an AAV vector. Optional nucleases may be administered in mRNA form or using one or more viral vectors (AAV, Ad, etc.). Administration can be performed by any means of delivering polynucleotides to the desired target cells. In vivo and in vitro methods are considered. Intravenous injection into the portal vein is one possible administration method. Other in vivo administration methods include, for example, direct injection into the liver lobe or bile duct, and intravenous injection into the distal liver (including via the hepatic artery), direct injection into the liver parenchyma, injection via the hepatic artery, and / or retrograde injection via the bile duct tree. In vitro administration methods include in vitro transduction of excised hepatocytes or other liver cells, followed by infusion of the transduced, excised hepatocytes back into the portal vascular system, liver parenchyma, or bile duct tree of a human patient, see, for example, Grossman et al., (1994) Nature Genetics, 6:335-341.

[0129] In systems involving the delivery of more than one polynucleotide (e.g., the constructs and polynucleotide forms of nucleases described herein), two or more polynucleotides may be delivered using one or more identical and / or different vectors. For example, polynucleotide forms of nucleases may be delivered in mRNA form, and the liver-specific constructs described herein may be delivered via other means, such as viral vectors (e.g., AAV), small circular DNA, plasmid DNA, linear DNA, liposomes, nanoparticles, etc.

[0130] Other exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA), and Copernicus Therapeutics Inc. (see, for example, US6008336). Lipid transfection is described, for example, in U.S. Patent Nos. 5,049,386; 4,946,787; and 4,897,355, and lipid transfection reagents are commercially available (e.g., and and RNAiMAX). Suitable for effective receptor recognition of polynucleotides, cationic and neutral lipids transfected with these lipids include those of Felgner, WO 91 / 17424, and WO 91 / 16024. Delivery can be made to cells (ex vivo administration) or target tissues (in vivo administration).

[0131] Lipids: The preparation of nucleic acid complexes, including targeted liposomes, such as immunolipid complexes, is well known to those skilled in the art (see, for example, Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); US Pat. Nos. 4,186,183,4,217,344,4,235,871,4,261,975,4,485,054,4,501,728,4,774,085,4,837,028 and 4,946,787).

[0132] Another delivery method involves packaging the nucleic acid to be delivered into an EnGeneIC delivery vector (EDV). These EDVs are then specifically delivered to the target tissue using a bispecific antibody, where one arm of the antibody is specific to the target tissue and the other arm is specific to the EDV. The antibody carries the EDV to the surface of the target cells, where it is then carried into the cells via endocytosis. Once inside the cells, the contents are released (see MacDiarmid et al. (2009) Nature Biotechnology 27(7):643).

[0133] For applications requiring transient expression, adenovirus-based systems can be used. Adenovirus-based vectors exhibit high transduction efficiency in many cell types and do not require cell division. High titers and high levels of expression have been obtained using such vectors. These vectors can be mass-produced in relatively simple systems. Adeno-associated virus (“AAV”) vectors are also used, for example, in the in vitro production of target nucleic acids and peptides, and in in vivo and in vitro gene therapy procedures, for transducing cells with target nucleic acids (see, for example, West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). The construction of recombinant AAV vectors has been described in numerous publications, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al. al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0134] Recombinant adeno-associated virus vectors (rAAVs) are a promising alternative gene delivery system based on a defective and non-pathogenic parvovirus adeno-associated virus type 2 (AAV). All vectors are derived from plasmids containing only the 145 bp inverted terminal repeat sequence of the AAV cassette. Efficient gene transfer and stable transgene delivery are key features of this vector system due to integration into the genome of transduced cells (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV8.2, AAV9, and AAV rh10, as well as pseudotyped AAVs such as AAV2 / 8, AAV2 / 9, AAV2 / 5, and AAV2 / 6, can also be used according to the invention. According to the present invention, novel AAV serotypes capable of crossing the blood-brain barrier may also be used (see, for example, US20150079038). In some embodiments, AAV6 is used.

[0135] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells for packaging adenoviruses and ψ2 or PA317 cells for packaging retroviruses. Viral vectors used in gene therapy are typically produced by producer cell lines that package nucleic acid vectors into viral particles. Vectors usually contain the minimum viral sequences required for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the proteins to be expressed. Missing viral functions are provided trans-by the packaging cell lines. For example, AAV vectors used in gene therapy typically only have inverted terminal repeat (ITR) sequences from the AAV genome, which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing helper plasmids encoding other AAV genes (i.e., rep and cap) but lacking the ITR sequence. This cell line is also infected with adenoviruses as helpers. The helper virus promotes replication of the AAV vector and expression of AAV genes in the helper plasmids. Due to the lack of the ITR sequence, there is no large quantity of packaging helper plasmids. Adenovirus contamination can be reduced, for example, by heat treatment, as adenovirus is more sensitive to heat treatment than AAV.

[0136] Purifying AAV particles from a 293 or baculovirus system typically involves growing virus-producing cells, then collecting virus particles from the cell supernatant or lysing cells and collecting the virus from the crude lysate. AAV is then purified using methods known in the art, including ion-exchange chromatography (e.g., see U.S. Patents 7,419,817 and 6,989,264), ion-exchange chromatography and CsCl density centrifugation (e.g., PCT Disclosure WO2011094198A10), immunoaffinity chromatography (e.g., WO2016128408), or purification using AVB Sepharose (e.g., GE Healthcare Life Sciences).

[0137] In many gene therapy applications, it is desirable to deliver gene therapy vectors to specific tissue types with high specificity. Therefore, viral vectors can be modified to be specific to a given cell type by expressing a ligand as a fusion protein with a viral capsid protein on the outer surface of the virus. The ligand is selected to have an affinity for a receptor known to be present on the target cell type. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney's mouse leukemia virus could be modified to express a human modulator protein fused with gp70, and this recombinant virus infected certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses a receptor and the virus expresses a fusion protein containing a cell surface receptor ligand. For example, filamentous phages can be engineered to exhibit antibody fragments (e.g., FAB or Fv) with specific binding affinity to virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that are beneficial for uptake by specific target cells.

[0138] Gene therapy vectors can be delivered in vivo by administration to individual patients, typically through systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion, including direct injection into the brain) or local administration, as described below.

[0139] Pharmaceutically acceptable carriers depend in part on the specific composition being administered and the specific method of administration. Therefore, there are a wide variety of suitable formulations of pharmaceutical compositions, as described below (see, for example, Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0140] The effective amount of the expression cassette (and optionally nucleases and / or modified cells) to be administered will vary from patient to patient. Therefore, the effective amount is preferably determined by the physician administering the composition (e.g., cells), and the appropriate dosage can be readily determined by one of those skilled in the art. Analysis of serum, plasma, or other tissue levels of the therapeutic peptide, and comparison with initial levels before administration, can determine whether the administered amount is too low, within the correct range, or too high. The appropriate regimen for initial and subsequent administrations is also variable, but is exemplified by the initial administration followed by subsequent administrations if necessary. Subsequent administrations can be performed at variable intervals, ranging from daily to annually to every few years. Those skilled in the art will understand that appropriate immunosuppressive techniques can be recommended to avoid inhibition or blockage of transduction by immunosuppression of the delivery vector, see, for example, Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0141] Formulations intended for in vitro and in vivo administration include suspensions in liquids or emulsions (e.g., genetically modified cells, liposomes, or nanoparticles). The active ingredient is typically mixed with a pharmaceutically acceptable and compatible excipient. Suitable excipients include, for example, water, saline, dextran, glycerol, ethanol, and combinations thereof. Additionally, the composition may contain small amounts of excipients such as wetting agents or emulsifiers, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition.

[0142] application

[0143] The methods and compositions disclosed herein are used to provide a therapy for any disease by providing a transgenic product that is absent or lacks in the disease or otherwise treating or preventing the disease. Example

[0144] Example 1: Clinical Method

[0145] Quantitative PCR

[0146] qRT-PCR (for human factor VIII mRNA levels): RNA / DNA was isolated from plasma using the AllPrep DNA / RNA Kit, following the manufacturer's instructions (Qiagen, Carlsbad CA). The extracted RNA was then used to prepare cDNA using the Quantitect cDNA Synthesis Kit (Qiagen, Carlsbad CA). Quantitative PCR was then performed on a Biorad CFX 96 using the SsoAdvanced Universal ProbesSupermix (Biorad, Hercules CA) with a labeled primer / probe assay from IDT (Coralville IA). For specific detection of human factor VIII mRNA, the primer / probe assay was custom-made; forward primer (GGAGATGAAGAAGGAGGACTTTG) (SEQ ID NO: 6), probe (ACATCTACGACGAGGACGAGAACCA) (SEQ ID NO: 7), and reverse primer (TCCACAGCAGCAATGAAGTAG) (SEQ ID NO: 8). Quantitative qRT-PCR (not absolute) was used, and each sample was normalized for GAPDH, with the final data analysis reported relative to a single sample set to 1.0. No template control or reverse transcriptase control was run with any samples, and no detectable signal was generated.

[0147] qPCR (for vector genomics, VG, analysis): RNA / DNA was isolated from plasma using the AllPrep DNA / RNA kit according to the manufacturer's instructions (Qiagen, Carlsbad CA). The extracted DNA was used for quantitative PCR on an AB 7300 real-time PCR system (Applied Biosystems, Foster City, CA) with TaqMan Rapid Universal PCR Premix (No AmpErase UNG) (Applied Biosystems, Foster City, CA). For specific detection of human factor VIII, primer / probe assays were custom-made; forward primer (CCTGGGCCAGTTCCTGCT) (SEQ ID NO: 9), probe (TTCTGCCACATCAGCAGCCACCA) (SEQ ID NO: 10), and reverse primer (GGCCTCCATGCCATCATG) (SEQ ID NO: 11). All samples were run without template controls and no detectable signal was generated. The qPCR DNA standard curve was generated from seven consecutive 4-fold dilutions of known amounts of purified, linearized human factor VIII plasmid.

[0148] Immunoassay of total human FVIII antigen. The total human factor VIII B-domain-deficient (hFVIII-BDD) antigen in citric acid-treated human plasma was measured using the hFVIIIBDD immunoassay developed by Sangamo Therapeutics, Inc. The (human recombinant BDD-FVIII) reference material will be used as a calibrator. This will also be used for QC, representing the hFVIII-BDD antigen. The assay is a sandwich ELISA that uses a monoclonal antibody (mAb) as the capture antibody and a biotinylated mAb as the detection antibody, both having the A2 domain of FVIII as an epitope. After coating with the capture mAb (GMA-8023; Green Mountain Antibodies), the plates are blocked and washed. Plasma samples, calibration samples with a minimum required dilution (MRD) of 5, and quality control samples are incubated in the assay plate and then washed. Before adding the streptavidin-horseradish peroxidase (SA-HRP) conjugate, the biotinylated mAb (GMA-8024; Green Mountain Antibodies) is applied to the culture plate and incubated, followed by washing. After SA-HRP incubation and washing, 3,3',5,5'-tetramethylbenzidine (TMB) substrate solution is added for 10 min, followed by quenching the reaction with an acidic stop solution, and then detection is performed at 450 nm. The captured hFVIII-BDD antigen was quantified relative to a linear standard curve, which was regressed using log-log linear fitting in the range of 0.020 IU / mL to 0.500 IU / mL. A concentration of 10.0 IU / mL prepared in concomitant congenital FVIII-deficient plasma (GeorgeKing Bio-Medical or equivalent) was used. Preparation of calibrators using working solutions.

[0149] A nine-point calibration curve was prepared using assay calibrators diluted to applicable levels in the assay diluent (quantitation range 0.500 IU / mL to 0.020 IU / mL, anchor points at 0.010 IU / mL and 0.000 IU / mL). Calibration was performed using a single curve with log-log linear fitting, in duplicate, with total hFVIII-BDD antigen content measured in IU / mL on the x-axis and optical density (OD, measured at 450 nm) on the y-axis. The last two standard levels will serve as anchor points, prepared at 0.010 IU / mL and 0.000 IU / mL; no acceptance standard was accepted. Two assay samples and QC were prepared, and the total hFVIII-BDD antigen (concentration reported as IU / mL) was then determined by back-calculation from the calibration curve.

[0150] Chromogenic factor VIII activity assay. The activity of secreted human factor VIII in plasma was determined according to the manufacturer's protocol using the Diapharma Chromogenic Coamatic Factor VIII assay (West Chester, OH), excluding human factor VIII standards. The human factor VIII standard used in the ELISA assay was recombinant purified human factor VIII (#F0016-06) from US Biologicals (Salem, MA).

[0151] Coagulation activity was measured according to the manufacturer's protocol using the activated partial prothrombin time (aPTT) assay of Diagnostica Stago (Boston MA) to determine the activity of secreted human factor VIII in plasma, excluding human factor VIII standards and human factor VIII-deficient plasma. The human factor VIII standards were the same as those used in the ELISA analysis (recombinant purified human factor VIII, #F0016-06, from US Biologicals, Salem, MA). The deficient FVIII reagent used in the coagulation assay was FVIII-CD <1% FVIII activity (frozen deficient FVIII) from Haematologic Technologies, Inc. (Essex Junction, VT).

[0152] Example 2: Preparation of SB-525

[0153] The final formulation base buffer SBR-0099 was prepared using USP-grade reagents. It consisted of phosphate-buffered saline (PBS) containing CaCl2, MgCl2, and 35 mM NaCl (i.e., 0.90 mM CaCl2, 0.49 mM MgCl2, 2.68 mM KCl, 1.47 mM KH2PO4, 172 mM NaCl, and 8.10 mM Na2HPO4). The target concentration of SB-525Bulk was adjusted to 1.0 x 10⁻⁶ in the final formulation buffer. 13 vg / mL, the final formulation buffer contains PBS containing CaCl2, MgCl2, 35mM NaCl, 1% sucrose, and 0.05% Kolliphor (Poloxamer) P 188.

[0154] The SB-525 vector is an AAV vector containing an AAV6 capsid and SEQ ID NO: 5, with AAV2 ITR SEQ ID NO: 12 and 13 on its flanks at 5' and 3', respectively.

[0155] The SB-525 product was prepared by calculating the volume of the product components by multiplying the dose level (vg / kg) by the subject's body weight (kg) and then dividing by the viral genome concentration (vg / mL). The calculated ratio of saline (NS) volume to SB-525 product was 1:1. The total volume was calculated by adding the volumes of NS and SB-525 product. Table I below shows exemplary doses of the SB-525 product in subjects:

[0156] Table I: Exemplary SB-525 Dosage

[0157] dose level Total SB-525AAV dose (vg / kg) 1 <![CDATA[6.00x10 11 ]]> 2 <![CDATA[9.00x10 11 ]]> 3 <![CDATA[1.20x10 12 ]]> 4 <![CDATA[2.00x10 12 ]]> 5 <![CDATA[4.00x10 12 ]]> 6 <![CDATA[6.00x10 12 ]]> 7 <![CDATA[1.00x10 13 ]]>

[0158] Example 3: Infusion Protocol

[0159] Depending on the dose level and weight of the subject, the total volume is expected to be between 4 mL and 200 mL. If the total volume is less than 50 mL, the infusion product is administered via syringe, while if the volume is greater than 50 mL, the infusion product is administered via infusion bag. A constant-rate infusion pump is used, with an infusion rate of 100 mL / hour for both types of infusions.

[0160] Example 4: Study Objectives and Clinical Endpoints

[0161] Inclusion and Exclusion Criteria: For this study, inclusion criteria included male subjects aged ≥18 years who had been treated or exposed to FVIII concentrate or cryoprecipitate for at least 150 exposure days. Additionally, subjects had to have experienced ≥12 bleeding events in the past 12 months. Exclusion criteria included subjects with neutralizing antibodies against the AAV6 capsid, a history of FVIII inhibitors or similar conditions, hypersensitivity to FVIII, evidence of any bleeding disorder other than hemophilia A, hepatitis markers, and use of systemic (IV or oral) immunomodulators.

[0162] Study Objectives: The primary objective of this study is to assess safety. The primary objective is to examine the safety and tolerability of SB-525 and to assess the temporal distribution of FVIII activity following SB-525 administration. Secondary endpoints include observing changes in baseline use of FVIII replacement therapy (“Factor”) and the frequency and severity of bleeding events, assessing the clinical impact of administration on hemophilia A, and also evaluating immune responses to FVIII and vector shedding of the AAV2 / 6 vector. Exploratory objectives include assessing the concordance between FVIII levels via ELISA and FVIII activity assays, and evaluating any immune responses to SB-525.

[0163] Approximately 20 subjects can participate in this study. The choice of dose and the number of subjects studied at each dose level will be based on safety and the cumulative pharmacodynamic response (kinetics of cyclic FVIII levels) observed in previously administered subjects.

[0164] Approximately seven dose levels may need to be investigated to identify a safe and tolerable treatment range. The potential dose levels are 6 x 10⁻⁶. 11 9x10 11 1.2x10 12 2x10 12 4x10 12 6x10 12 and 1x10 13 vg / kg. In the NHP study, the starting dose level (9 x 10) was [missing value]. 11 The (vg / kg) value was associated with a normal 12% FVIII activity.

[0165] Example 5: Preliminary Results

[0166] Five patients were initially treated. SB-525 was generally well tolerated, with no treatment-related serious adverse events and no need for gradual dose reduction of steroids. One patient treated in cohort (dose level 3) achieved factor VIII expression at a treatment-related level, a level that predicts a significant reduction or elimination of spontaneous bleeding and factor use. Reduced factor use was observed post-treatment in cohort 2 (dose level 2).

[0167] Example 6: Eight patients treated with SB-525 gene therapy showed a dose-dependent increase in FVIII activity, among whom 3x10 13 Two patients treated with a dose of vg / kg achieved normal FVIII levels.

[0168] The Phase 1 / 2 Alta study was an open-label, dose-ranging clinical trial designed to evaluate the safety and tolerability of SB-525 in up to 20 adult patients with severe hemophilia A. Data showed that SB-525 was generally well-tolerated across the four dose groups and demonstrated a dose-dependent increase in factor VIII (FVIII) levels.

[0169] Data from the first eight hemophilia A patients treated with SB-525 gene therapy are encouraging and demonstrate a dose-dependent relationship, evidence of sustained factor levels, and low variability within each patient and group.

[0170] Phase 1 / 2 data include data from four escalation dose groups (9x10). 11 vg / kg, 2x10 12 vg / kg, 1x10 13 vg / kg and 3x10 13 Eight patients were treated with a dose-dependent increase in FVIII levels (vg / kg, two patients per group). Patients demonstrated a clinically relevant increase in FVIII activity in the higher dose group and at 3x10 13 Normal FVIII levels (normal range: 50-150%) were observed in the vg / kg dose group. A dose-dependent decrease in factor VIII replacement therapy was also observed, with a significant decrease observed in the higher dose group. SB-525 is generally well tolerated, with one patient (using 3x10) showing improvement. 13 Treatment-related serious adverse events were reported (vg / kg dose): hypotension and fever, which occurred after carrier infusion and were resolved by treatment within 24 hours of completion of carrier infusion.

[0171] Patients in the study did not receive prophylactic steroid treatment. No treatment-related serious adverse events or ALT elevations requiring more than 7 days of corticosteroid treatment were observed in the first three groups. One patient in the fourth group experienced an ALT elevation (>1.5x ULN) in week four, requiring a tapered course of oral steroids. Seven weeks after the start of steroid therapy, the patient did not experience any associated loss of Factor VIII activity or ALT elevation. The same patient experienced a treatment-related infusion reaction but was discharged the following day according to the protocol schedule.

[0172] Table II provides an explanation of 9×10 11 2×10 12 1×10 13 and 3×10 13 Data on the dosage of AAV carriers at doses of vg / Kg. Figure 1-3Data on FVIII activity obtained after application are provided.

[0173] Table II. Results of AAV Dosage Administration. “Follow-up” refers to the period after administration during which FVIII activity levels (column 2) and FVIII treatment frequency (column 5) were measured.

[0174]

[0175] Example 7: Ten patients treated with SB-525 gene therapy showed a dose-dependent increase in FVIII activity, four of whom received 3x10 13 Patients treated with a dose of vg / kg achieved normal FVIII levels.

[0176] The eight patients described in Example 6 were followed up more frequently, at a rate of 3 × 10⁸. 13 Two more patients (patients 9 and 10) were added to the trial at a dose of vg / kg. Figure 4 and 5 The FVIII activity of all ten patients over time was plotted after treatment with the vector.

[0177] Spontaneous bleeding events disappeared with increasing dosage, and no bleeding events were reported in any high-dose patients. See Figure 6 Approximately 3 weeks after vector injection coverage, for one patient in group 3 (1x10⁻¹²), 13 vg / kg) and high-dose group (3x10) 13 For all patients (vg / kg), FVIII use was reduced to zero. Patient 9 received their last infusion at 3 weeks and 2 days, but has not received any infusions since. See Figure 7 (An asterisk indicates that the infusion occurred at 3 weeks and 2 days).

[0178] Figure 8-10 This paper summarizes the adverse event findings from clinical trials.

[0179] All patents, patent applications and publications mentioned in this article are incorporated herein by reference in their entirety.

[0180] Although the disclosure has been provided in detail by way of illustration and example for the purpose of clarity, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit or scope of this disclosure. Therefore, the foregoing descriptions and examples should not be construed as restrictive. sequence list <110> SANGAMO THERAPEUTICS, INC. <120> Improving clinical parameters through factor VIII expression <130> 1147465 <140> <141> <150> 62 / 869,445 <151> 2019-07-01 <150> 62 / 826,887 <151> 2019-03-29 <150> 62 / 714,553 <151> 2018-08-03 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 1457 <212> PRT <213> Homo sapiens <400> 1 Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe 1 5 10 15 Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser 20 25 30 Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg 35 40 45 Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val 50 55 60 Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile 65 70 75 80 Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln 85 90 95 Ala Glu Val Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser 100 105 110 His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser 115 120 125 Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp 130 135 140 Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu 145 150 155 160 Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser 165 170 175 Tyr Leu Ser His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile 180 185 190 Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr 195 200 205 Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly 210 215 220 Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp 225 230 235 240 Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr 245 250 255 Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val 260 265 270 Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile 275 280 285 Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser 290 295 300 Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met 305 310 315 320 Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His 325 330 335 Asp Gly Met Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro 340 345 350 Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp 355 360 365 Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser 370 375 380 Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr 385 390 395 400 Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro 405 410 415 Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn 420 425 430 Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met 435 440 445 Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu 450 455 460 Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu 465 470 475 480 Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro 485 490 495 His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu Pro Lys 500 505 510 Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe 515 520 525 Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp 530 535 540 Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg 545 550 555 560 Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu 565 570 575 Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val 580 585 590 Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu 595 600 605 Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp 610 615 620 Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val 625 630 635 640 Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp 645 650 655 Tyr Ile Leu Ser Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe 660 665 670 Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr 675 680 685 Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro 690 695 700 Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly 705 710 715 720 Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp 725 730 735 Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys 740 745 750 Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn Pro Pro Val Leu 755 760 765 Lys Arg His Gln Arg Glu Ile Thr Arg Thr Thr Leu Gln Ser Asp Gln 770 775 780 Glu Glu Ile Asp Tyr Asp Asp Thr Ile Ser Val Glu Met Lys Lys Glu 785 790 795 800 Asp Phe Asp Ile Tyr Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe 805 810 815 Gln Lys Lys Thr Arg His Tyr Phe Ile Ala Ala Val Glu Arg Leu Trp 820 825 830 Asp Tyr Gly Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln 835 840 845 Ser Gly Ser Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr 850 855 860 Asp Gly Ser Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His 865 870 875 880 Leu Gly Leu Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile 885 890 895 Met Val Thr Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser Phe Tyr Ser 900 905 910 Ser Leu Ile Ser Tyr Glu Glu Asp Gln Arg Gln Gly Ala Glu Pro Arg 915 920 925 Lys Asn Phe Val Lys Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val 930 935 940 Gln His His Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp 945 950 955 960 Ala Tyr Phe Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu 965 970 975 Ile Gly Pro Leu Leu Val Cys His Thr Asn Thr Leu Asn Pro Ala His 980 985 990 Gly Arg Gln Val Thr Val Gln Glu Phe Ala Leu Phe Phe Thr Ile Phe 995 1000 1005 Asp Glu Thr Lys Ser Trp Tyr Phe Thr Glu Asn Met Glu Arg Asn 1010 1015 1020 Cys Arg Ala Pro Cys Asn Ile Gln Met Glu Asp Pro Thr Phe Lys 1025 1030 1035 Glu Asn Tyr Arg Phe His Ala Ile Asn Gly Tyr Ile Met Asp Thr 1040 1045 1050 Leu Pro Gly Leu Val Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr 1055 1060 1065 Leu Leu Ser Met Gly Ser Asn Glu Asn Ile His Ser Ile His Phe 1070 1075 1080 Ser Gly His Val Phe Thr Val Arg Lys Lys Glu Glu Tyr Lys Met 1085 1090 1095 Ala Leu Tyr Asn Leu Tyr Pro Gly Val Phe Glu Thr Val Glu Met 1100 1105 1110 Leu Pro Ser Lys Ala Gly Ile Trp Arg Val Glu Cys Leu Ile Gly 1115 1120 1125 Glu His Leu His Ala Gly Met Ser Thr Leu Phe Leu Val Tyr Ser 1130 1135 1140 Asn Lys Cys Gln Thr Pro Leu Gly Met Ala Ser Gly His Ile Arg 1145 1150 1155 Asp Phe Gln Ile Thr Ala Ser Gly Gln Tyr Gly Gln Trp Ala Pro 1160 1165 1170 Lys Leu Ala Arg Leu His Tyr Ser Gly Ser Ile Asn Ala Trp Ser 1175 1180 1185 Thr Lys Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala Pro 1190 1195 1200 Met Ile Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe 1205 1210 1215 Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser Leu Asp 1220 1225 1230 Gly Lys Lys Trp Gln Thr Tyr Arg Gly Asn Ser Thr Gly Thr Leu 1235 1240 1245 Met Val Phe Phe Gly Asn Val Asp Ser Ser Gly Ile Lys His Asn 1250 1255 1260 Ile Phe Asn Pro Pro Ile Ile Ala Arg Tyr Ile Arg Leu His Pro 1265 1270 1275 Thr His Tyr Ser Ile Arg Ser Thr Leu Arg Met Glu Leu Met Gly 1280 1285 1290 Cys Asp Leu Asn Ser Cys Ser Met Pro Leu Gly Met Glu Ser Lys 1295 1300 1305 Ala Ile Ser Asp Ala Gln Ile Thr Ala Ser Ser Tyr Phe Thr Asn 1310 1315 1320 Met Phe Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His Leu Gln 1325 1330 1335 Gly Arg Ser Asn Ala Trp Arg Pro Gln Val Asn Asn Pro Lys Glu 1340 1345 1350 Trp Leu Gln Val Asp Phe Gln Lys Thr Met Lys Val Thr Gly Val 1355 1360 1365 Thr Thr Gln Gly Val Lys Ser Leu Leu Thr Ser Met Tyr Val Lys 1370 1375 1380 Glu Phe Leu Ile Ser Ser Ser Gln Asp Gly His Gln Trp Thr Leu 1385 1390 1395 Phe Phe Gln Asn Gly Lys Val Lys Val Phe Gln Gly Asn Gln Asp 1400 1405 1410 Ser Phe Thr Pro Val Val Asn Ser Leu Asp Pro Pro Leu Leu Thr 1415 1420 1425 Arg Tyr Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile Ala 1430 1435 1440 Leu Arg Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr 1445 1450 1455 <210> 2 <211> 84 <212> DNA <213> unknown <220> <223> Unknown description: SERPIN1 Enhanced Subsequence <400> 2 gggggaggct gctggtgaat attaaccaag atcaccccag ttaccggagg agcaaacagg 60 gactaagttc acacgcgtgg tacc 84 <210> 3 <211> 223 <212> DNA <213> unknown <220> <223> Unknown description: TTRm promoter sequence <400> 3 gtctgtctgc acatttcgta gagcgagtgt tccgatactc taatctccct aggcaaggtt 60 catatttgtg taggttatactt attctccttt tgttgactaa gtcaataatc agaatcagca 120 ggtttggagt cagcttggca gggatcagca gcctgggttg gaaggagggg gtataaaagc 180 cccttcacca ggagaagccg tcacacagat ccacaagctc ctg 223 <210> 4 <211> 4374 <212> DNA <213> unknown <220> <223> Unknown description: The coding sequence of FVIII <400> 4 atgcagatcg agctctccac ctgcttcttt ctgtgcctgt tgagattctg cttcagcgcc 60 accaggagat actacctggg ggctgtggag ctgagctggg actacatgca gtctgacctg 120 ggggagctgc ctgtggatgc caggttcccc cccagagtgc ccaagagctt ccccttcaac 180 acctctgtgg tgtacaagaa gaccctgttt gtggagttca ctgaccacct gttcaacatt 240 gccaagccca ggcccccctg gatgggcctg ctgggcccca ccatccaggc tgaggtgtat 300 gacactgtgg tgatcaccct gaagaacatg gccagccacc ctgtgagcct gcatgctgtg 360 ggggtgagct actggaaggc ctctgagggg gctggattg atgaccagac cagccagagg 420 gagaaggagg atgacaaggt gttccctggg ggcagccaca cctatgtgtg gcaggtgctg 480 aaggaatg gccccatggc ctctgacccc ctgtgcctga cctacagcta cctgagccat 540 gtggacctgg tgaaggacct gaactctggc ctgattgggg ccctgctggt gtgcagggag 600 ggcagcctgg ccaaggagaa gacccagacc ctgcacaagt tcatcctgct gtttgctgtg 660 tttgatgagg gcaagagctg gcactctgaa accaagaaca gcctgatgca ggacagggat 720 gctgcccttg ccagggcctg gcccaagatg caacactgtga atggctatgt gaacaggagc 780 ctgcctggcc tgattggctg ccacaggaag tctgtgtact ggcatgtgat tggcatgggc 840 accacccctg aggtgcacag catcttcctg gagggccaca ccttcctggt caggaaccac 900 aggcaggcca gcctggagat cagccccatc accttcctga ctgcccagac cctgctgatg 960 gacctgggcc agttcctgct gttctgccac atcagcagcc accagcatga tggcatggag 1020 gcctatgtga aggtggacag ctgccctgag gagccccagc tgaggatgaa gaacaatgag 1080 gaggctgagg actatgatga tgacctgact gactctgaga tggatgtggt gaggtttgat 1140 gatgacaaca gccccagctt catccagatc aggtctgtgg ccaagaagca ccccaagacc 1200 tgggtgcact acattgctgc tgaggaggag gactgggact atgcccccct ggtgctggcc 1260 cctgatgaca ggagctacaa gagccagtac ctgaacaatg gcccccagag gattggcagg 1320 aagtacaaga aggtcaggtt catggcctac actgatgaaa ccttcaagac cagggaggcc 1380 atccagcatg agtctggcat cctgggcccc ctgctgtatg gggaggtggg ggacaccctg 1440 ctgatcatct tcaagaacca ggccagcagg ccctacaaca tctaccccca tggcatcact 1500 gatgtgaggc ccctgtacag caggaggctg cccaaggggg tgaagcacct gaaggacttc 1560 cccatcctgc ctggggagat cttcaagtac aagtggactg tgactgtgga ggatggcccc 1620 accaagtctg accccaggtg cctgaccaga tactacagca gctttgtga catggagagg gacctggcct ctggcctgat tggccccctg ctgatctgct acaaggagtc tgtggaccag 1740 aggggcaacc agatcatgtc tgacaagagg aatgtgatcc tgttctctgt gtttgatgag aacaggagct ggtacctgac tgagaacatc cagaggttcc tgcccaaccc tgctggggtg cagctggagg accctgagtt ccaggccagc aacatcatgc acagcatcaa tggctatgtg tttgacagcc tgcagctgtc tgtgtgcctg catgaggtgg cctactggta catcctgagc 1980 attggggccc agactgactt cctgtctgtg ttcttctctg gctacacctt caagcacaag atggtgtatg aggacaccct gaccctgttc cccttctctg gggagactgt gttcatgagc atggagaacc ctggcctgtg gattctgggc tgccacaact ctgacttcag gaacaggggc atgactgccc tgctgaaagt ctccagctgt gacaagaaca ctggggacta ctatgaggac agctatgagg acatctctgc ctacctgctg agcaagaca atgccattga gcccaggagc ttcagccaga atccacccgt ccttaagcgc catcagcgcg agatcaccag gaccaccctg 2340 cagtctgacc aggaggagat tgactatgat gacaccatct ctgtggagat gaagaaggag 2400 gactttgaca tctacgacga ggacgagaac cagagcccca ggagcttcca gaagaagacc 2460 aggcactact tcattgctgc tgtggagagg ctgtgggact atggcatgag cagcagcccc 2520 catgtgctga ggaacagggc ccagtctggc tctgtgcccc agttcaagaa ggtggtgttc 2580 caggagttca ctgatggcag cttcacccag cccctgtaca gaggggagct gaatgagcac 2640 ctgggcctgc tgggccccta catcagggct gaggtggagg acaacatcat ggtgaccttc 2700 aggaaccagg ccagcaggcc ctacagcttc tacagcagcc tgatcagcta tgaggaggac 2760 cagaggcagg gggctgagcc caggaagaac tttgtgaagc ccaatgaaac caagacctac 2820 ttctggaagg tgcagcacca catggccccc accaaggatg agtttgactg caaggcctgg 2880 gcctacttct ctgatgtgga cctggagaag gatgtgcact ctggcctgat tggccccctg 2940 ctggtgtgcc acaccaacac cctgaaccct gcccatggca ggcaggtgac tgtgcaggag 3000 tttgccctgt tcttcaccat ctttgatgaa accaagagct ggtacttcac tgagaacatg 3060 gaggagaact gcagggcccc ctgcaacatc cagatggagg accccacctt caaggaaac 3120 tacaggttcc atgccatcaa tggctacatc atggacaccc tgcctggcct ggtgatggcc 3180 caggaccaga ggatcaggtg gtacctgctg agcatgggca gcaatgagaa catccacagc 3240 atccacttct ctggccatgt gttcactgtg aggaagaagg aggagatcaa gatggccctg 3300 tacaacctgt accctggggt gtttgagact gtggagatgc tgcccagcaa ggctggcatc 3360 tggagggtgg agtgcctgat tggggagcac ctgcatgctg gcatgagcac cctgttcctg 3420 gtgtacagca acaagtgcca gacccccctg ggcatggcct ctggccacat cagggacttc 3480 cagatcactg cctctggcca gtatggccag tgggccccca agctggccag gctgcactac 3540 tctggcagca tcaatgcctg gagcaccaag gagcccttca gctggatcaa ggtggacctg 3600 ctggccccca tgatcatcca tggcatcaag acccagggg ccaggcagaa gttcagcagc 3660 ctgtacatca gccagttcat catcatgtac agcctggatg gcaagaagtg gcagacctac 3720 aggggcaaca gcactggcac cctgatggtg ttctttggca atgtggacag ctctggcatc 3780 aagcacaaca tcttcaaccc ccccatcatt gccagataca tcaggctgca ccccacccac 3840 tacagcatca ggagcaccct gaggatggag ctgatgggct gtgacctgaa cagctgcagc 3900 atgcccctgg gcatggagag caaggccatc tctgatgccc agatcactgc cagcagctac 3960 ttcaccaaca tgtttgccac ctggagcccc agcaaggcca ggctgcatct gcagggcagg 4020 agcaatgcct ggaggcccca ggtcaacaac cccaaggagt ggctgcaggt ggacttccag 408   aagaccatga aggtgactgg ggtgaccacc cagggggtga agagcctgct gaccagcatg 4140 tatgtgaagg agttcctgat cagcagcagc caggatggcc accagtggac cctgttcttc 4200 cagaatggca aggtgaaggt gttccagggc aaccaggaca gcttcacccc tgtggtgaac 4260 agcctggacc cccccctgct gaccagatac ctgaggattc acccccagag ctgggtgcac 4320 cagattgccc tgaggatgga ggtgctgggc tgtgaggccc aggacctgta ctga 4374 <210> 5 <211> 4894 <212> DNA <213> Unknown <220> It should be noted that there seems to be a formatting issue in the original text where "408" in line might be incorrect. It's possible it should be "4080" like the other lines. The translation is done based on the provided text as is. <223> Unknown description: Expression cassette sequence <400> 5 gcggcctaag cttggaacca ttgccacctt cagggggagg ctgctggtga atattaacca 60 agatcacccc agttaccgga ggagcaaaca gggactaagt tcacacgcgt ggtaccgtct 120 gtctgcacat ttcgtagagc gagtgttccg atactctaat ctccctaggc aaggttcata 180 tttgtgtagg ttacttattc tccttttgtt gactaagtca ataatcagaa tcagcaggtt 240 tggagtcagc ttggcaggga tcagcagcct gggttggaag gagggggtat aaaagcccct 300 tcaccaggag aagccgtcac acagatccac aagctcctga agaggtaagg gtttaagtta 360 tcgttagttc gtgcaccatt aatgtttaat tacctggagc acctgcctga aatcattttt 420 ttttcaggtt ggctagtatg cagatcgagc tctccacctg cttctttctg tgcctgttga 480 gattctgctt cagcgccacc aggagatact acctgggggc tgtggagctg agctgggact 540 acatgcagtc tgacctgggg gagctgcctg tggatgccag gttccccccc agagtgccca 600 agagcttccc cttcaacacc tctgtggtgt acaagaagac cctgtttgtg gagttcactg 660 accacctgtt caacattgcc aagcccaggc ccccctggat gggcctgctg ggccccacca 720 tccaggctga ggtgtatgac actgtggtga tcaccctgaa gaacatggcc agccaccctg 780 tgagcctgca tgctgtgggg gtgagctact ggaaggcctc tgagggggct gagtatgatg 840 accagaccag ccagagggag aaggaggatg acaaggtgtt ccctgggggc agccacacct 900 atgtgtggca ggtgctgaag gagaatggcc ccatggcctc tgaccccctg tgcctgacct 960 acagctacct gagccatgtg gacctggtga aggacctgaa ctctggcctg attggggccc 1020 tgctggtgtg cagggagggc agcctggcca aggagaagac ccagaccctg cacaagttca 1080 tcctgctgtt tgctgtgttt gatgagggca agagctggca ctctgaaacc aagaacagcc 1140 tgatgcagga cagggatgct gcctctgcca gggcctggcc caagatgcac actgtgaatg 1200 gctatgtgaa caggagcctg cctggcctga ttggctgcca caggaagtct gtgtactggc 1260 atgtgattgg catgggcacc acccctgagg tgcacagcat cttcctggag ggccacacct 1320 tcctggtcag gaaccacagg caggccagcc tggagatcag ccccatcacc ttcctgactg 1380 cccagaccct gctgatggac ctgggccagt tcctgctgtt ctgccacatc agcagccacc 1440 agcatgatgg catggaggcc tatgtgaagg tggacagctg ccctgaggag ccccagctga 1500 ggatgaagaa caatgaggag gctgaggact atgatgatga cctgactgac tctgagatgg 1560 atgtggtgag gtttgatgat gacaacagcc ccagcttcat ccagatcagg tctgtggcca 1620 agaagcaccc caagacctgg gtgcactaca ttgctgctga ggaggaggac tgggactatg 1680 cccccctggt gctggcccct gatgacagga gctacaagag ccagtacctg aacaatggcc 1740 cccagaggat tggcaggaag tacaagaagg tcaggttcat ggcctacact gatgaaacct 1800 tcaagaccag ggaggccatc cagcatgagt ctggcatcct gggccccctg ctgtatgggg 1860 aggtggggga caccctgctg atcatcttca agaaccaggc cagcaggccc tacaacatct 1920 acccccatgg catcactgat gtgaggcccc tgtacagcag gaggctgccc aagggggtga 1980 agcacctgaa ggacttcccc atcctgcctg gggagatctt caagtacaag tggactgtga 2040 ctgtggagga tggccccacc aagtctgacc ccaggtgcct gaccagatac tacagcagct 2100 ttgtgaacat ggagagggac ctggcctctg gcctgattgg ccccctgctg atctgctaca 2160 aggagtctgt ggaccagagg ggcaaccaga tcatgtctga caagaggaat gtgatcctgt 2220 tctctgtgtt tgatgagaac aggagctggt acctgactga gaacatccag aggttcctgc 2280 ccaaccctgc tggggtgcag ctggaggacc ctgagttcca ggccagcaac atcatgcaca 2340 gcatcaatgg ctatgtgttt gacagcctgc agctgtctgt gtgcctgcat gaggtggcct 2400 actggtacat cctgagcatt ggggcccaga ctgacttcct gtctgtgttc ttctctggct 2460 acaccttcaa gcacaagatg gtgtatgagg acaccctgac cctgttcccc ttctctgggg 2520 agactgtgtt catgagcatg gagaaccctg gcctgtggat tctgggctgc cacaactctg 2580 acttcaggaa caggggcatg actgccctgc tgaaagtctc cagctgtgac aagaacactg 2640 gggactacta tgaggacagc tatgaggaca tctctgccta cctgctgagc aagaacaatg 2700 ccattgagcc caggagcttc agccagaatc cacccgtcct taagcgccat cagcgcgaga 2760 tcaccaggac caccctgcag tctgaccagg aggagattga ctatgatgac accatctctg 2820 tggagatgaa gaaggaggac tttgacatct acgacgagga cgagaaccag agccccagga 2880 gcttccagaa gaagaccagg cactacttca ttgctgctgt ggagaggctg tgggactatg 2940 gcatgagcag cagcccccat gtgctgagga acagggccca gtctggctct gtgccccagt 3000 tcaagaaggt ggtgttccag gagttcactg atggcagctt cacccagccc ctgtacagag 3060 gggagctgaa tgagcacctg ggcctgctgg gcccctacat cagggctgag gtggaggaca 3120 acatcatggt gaccttcagg aaccaggcca gcaggcccta cagcttctac agcagcctga 3180 tcagctatga ggaggaccag aggcaggggg ctgagcccag gaagaacttt gtgaagccca 3240 atgaaaccaa gacctacttc tggaaggtgc agcaccacat ggcccccacc aaggatgagt 3300 ttgactgcaa ggcctgggcc tacttctctg atgtggacct ggagaaggat gtgcactctg 3360 gcctgattg ccccctgctg gtgtgccaca ccaacaccct gaaccctgcc catggcaggc 3420 aggtgactgt gcaggagttt gccctgttct tcaccatctt tgatgaaacc aagagctggt 3480 acttcactga gaacatggag aggaactgca gggccccctg caacatccag atggaggacc 3540 ccaccttcaa ggagaactac aggttccatg ccatcaatgg ctacatcatg gacaccctgc 3600 ctggcctggt gatggcccag gaccagagga tcaggtggta cctgctgagc atgggcagca 3660 atgagaacat ccacagcatc cacttctctg gccatgtgtt cactgtgagg aagaaggagg 3720 agtacaagat ggccctgtac aacctgtacc ctggggtgtt tgagactgtg gagatgctgc 3780 ccagcaaggc tggcatctgg agggtggagt gcctgattgg ggagcacctg catgctggca 3840 tgagcaccct gttcctggtg tacagcaaca agtgccagac ccccctgggc atggcctctg 3900 gccacatcag ggacttccag atcactgcct ctggccagta tggccagtgg gcccccaagc 3960 tggccaggct gcactactct ggcagcatca atgcctggag caccaaggag cccttcagct 4020 ggatcaaggt ggacctgctg gcccccatga tcatccatgg catcaagacc cagggggcca 4080 ggcagaagtt cagcagcctg tacatcagcc agttcatcat catgtacagc ctggatggca 4140 agaagtggca gacctacagg ggcaacagca ctggcaccct gatggtgttc tttggcaatg 4200 tggacagctc tggcatcaag cacaacatct tcaacccccc catcattgcc agatacatca 4260 ggctgcaccc cacccactac agcatcagga gcaccctgag gatggagctg atgggctgtg 4320 acctgaacag ctgcagcatg cccctgggca tggagagcaa ggccatctct gatgcccaga 4380 tcactgccag cagctacttc accaacatgt ttgccacctg gagccccagc aaggccaggc 4440 tgcatctgca gggcaggagc aatgcctgga ggccccaggt caacaacccc aaggagtggc 4500 tgcaggtgga cttccagaag accatgaagg tgactggggt gaccacccag ggggtgaaga 4560 gcctgctgac cagcatgtat gtgaaggagt tcctgatcag cagcagccag gatggccacc 4620 agtggaccct gttcttccag aatggcaagg tgaaggtgtt ccagggcaac caggacagct 4680 tcacccctgt ggtgaacagc ctggaccccc ccctgctgac cagatacctg aggattcacc 4740 cccagagctg ggtgcaccag attgccctga ggatggaggt gctgggctgt gaggcccagg 4800[[ID=十七]]<零零零零九二三>[[结束]]acctgtactg aggatccaat aaaatatctt tattttcatt acatctgtgt gttggttttt 4860 tgtgtgtttt cctgtaacga tcgggctcga gcgc 4894 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220>[[ID=三十一]]<零零零零九三零>[[结束]] It should be noted that there may be some inaccuracies in the translation of the above text due to the complexity and specific nature of the content. It is recommended to double-check with relevant professionals or reference materials for more accurate translation in the context of patent texts.<223> Artificial sequence description: Synthetic primers <400> 6 ggagatgaag aaggaggact ttg 23 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Synthetic probe <400> 7 acatctacga cgaggacgag aacca 25 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Synthetic primers <400> 8 tccacagcag caatgaagta g 21 <210> 9 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Synthetic primers <400> 9 cctgggccag ttcctgct 18 <210> 10 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Synthetic probe <400> 10 ttctgccaca tcagcagcca cca 23 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Synthetic primers <400> 11 ggcctccatg ccatcatg 18 <210> 12 <211> 130 <212> DNA <213> Adeno-associated virus <400> 12 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct 130 <210> 13 <211> 108 <212> DNA <213> Adeno-associated virus <400> 13 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgcccgggc tttgcccggg cggcctcagt gagcgagcga gcgcgcag 108 <210> 14 <211> 19 <212> PRT <213> Homo sapiens <400> 14 Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe 1 5 10 15 Cys Phe Ser

Claims

1. Use of an adenovirus-associated virus serotype 6 (AAV6) vector in the preparation of a medicament for the treatment of hemophilia A in human subjects, wherein the AAV6 vector encodes factor VIII (FVIII) protein, and is expressed in one or more 1×10⁻⁶ ppm. 13 Up to 5×10 13 The human subjects were administered a dose of vg / kg intravenously, wherein the administration of the AAV6 carrier resulted in a clinically relevant increase in circulating FVIII activity levels, and The AAV6 vector contains an expression cassette, which contains... The first insulator sequence comprising nucleotides 14-32 of SEQ ID NO:5 Based on the enhancing subsequence of SEQ ID NO:2, According to the promoter sequence of SEQ ID NO:3, The encoding is based on the coding sequence of the FVIII protein according to SEQ ID NO:1, and The second insulator sequence comprising nucleotides 4869-4885 of SEQ ID NO:

5.

2. The use of claim 1, wherein the drug is suitable for delivery of 1 × 10 13 AAV6 vg / kg up to 3×10 13 The dosage of AAV6 vg / kg.

3. The use of claim 1, wherein the drug is adapted to deliver 2 × 10 13 AAV6 vg / kg up to 4×10 13 The dosage of AAV6 vg / kg.

4. The use of claim 1, wherein the drug is adapted to deliver 3 × 10 13 The dosage of AAV6 vg / kg.

5. The use of any one of claims 1-4, wherein the AAV6 vector comprises an AAV2 5' inverted terminal repeat (ITR) sequence and an AAV2 3' ITR sequence flanking the expression cassette.

6. The use of claim 5, wherein the AAV2 5′ITR comprises the nucleotide sequence of SEQ ID NO: 12 and / or the AAV2 3′ITR comprises the nucleotide sequence of SEQ ID NO:

13.

7. The use of claim 5 or 6, wherein the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 5.

Images