Barley hvcsif6 promoter elements and their use in modulating barley grain beta-glucan content
By editing the CCAAT-box element in the promoter region of the barley HvCslf6 gene using gene editing technology, the problem of unclear regulation of β-glucan content in barley grains was solved, and the β-glucan content was significantly reduced, thus enhancing the application value of barley.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2026-06-26
AI Technical Summary
The regulation of β-glucan content in barley grains is unclear in existing technologies, especially the transcriptional regulation mechanism of the Cslf6 gene, which affects the use and quality of barley.
By identifying and editing the CCAAT-box element in the upstream promoter region of the barley HvCslf6 gene using gene editing technology, designing sgRNA targets, constructing a CRISPR/Cas9 gene editing vector, and transforming barley genetic transformation materials, transgenic plants with significantly altered β-glucan content were obtained.
Gene-edited plants with reduced β-glucan content in barley grains were successfully prepared, significantly reducing β-glucan content and improving the uses and product quality of barley.
Smart Images

Figure CN119736293B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to the barley HvCslf6 promoter element and its application in regulating the β-glucan content of barley grains. Background Technology
[0002] Barley is one of my country's major crops, playing a vital role in ensuring food security and promoting the development of animal husbandry and the beer industry. Beta-glucan is a crucial trait affecting the uses and quality of barley, and this influence varies depending on its intended use. When barley is used as livestock feed and in beer production, low β-glucan content in the grains is required because β-glucan can hinder digestion and growth in livestock, reduce wort filtration speed and malt extraction rate, and cause beer turbidity, sedimentation, and flavor deterioration. However, when barley is used as food, β-glucan is a beneficial component, helping to lower blood sugar and cholesterol, cleanse the intestines, and enhance immunity. The β-glucan we ingest in daily life mainly comes from grains, but major grain crops such as rice, wheat, and corn have relatively low β-glucan content (below 1%), while barley and oats have higher levels, especially barley, which generally contains around 4%-5%, and can reach over 8% in some cases.
[0003] Currently, Cslf6 in barley has been confirmed as a key gene controlling β-glucan synthesis (Garcia-Gimenez, G., Barakate, A., Smith, P., Stephens, J., Khor, SF, Doblin, MS, Hao, P., et al. (2020). Targeted mutation of barley(1,3;1,4)-β-glucan synthases reveals complex relationships between the storage and cell wall polysaccharide content, Plant Journal, 104(4):1009-1022.). Its upstream promoter contains numerous transcription factor binding sites (Garcia-Gimenez Guillermo, Schreiber Miriam, Dimitroff George, Little Alan, Singh Rohan, Fincher Geoffrey B., Burton Rachel A., Waugh Robbie, Tucker Matthew R., Houston Kelly. (2022). Identification of candidate MYB transcription Factors that influence CslF6 expression in barley grain (Frontiers in Plant Science, 13, 883-139). These factors may play an important role in regulating CslF6 gene expression. Therefore, gene editing of key cis-regulatory elements upstream of the CslF6 gene promoter could provide a new research method for a deeper understanding of Cslf6 gene transcriptional regulation, ultimately elucidating the synthesis mechanism of (1,3; 1,4)-β-glucan. However, current research on the transcriptional regulation of the Cslf6 gene is scarce, and the effects and functions of these key cis-regulatory elements on Cslf6 gene expression remain unclear. Summary of the Invention
[0004] To address the deficiency in existing technologies where the effects of key cis-acting elements in barley on Cslf6 gene expression are unclear, this invention provides a barley HvCslf6 promoter element and its application in regulating β-glucan content in barley grains. The specific technical solution is as follows:
[0005] In a first aspect, the present invention provides a barley HvCslf6 promoter element, wherein the barley HvCslf6 promoter element is located 295bp to 300bp upstream of the transcription start site of the barley HvCslf6 gene; the nucleotide sequence of the HvCslf6 promoter element is CCGTTG, which belongs to the CCAAT-box element; the gene number of the HvCslf6 gene in BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.
[0006] In a second aspect, the present invention provides a biological material comprising the above-mentioned HvCslf6 promoter element, wherein the biological material is a recombinant vector and / or genetically engineered bacteria.
[0007] Thirdly, the present invention provides the application of the above-mentioned barley HvCslf6 promoter element, or the above-mentioned biomaterial, in regulating the β-glucan content of barley grains.
[0008] Fourthly, the present invention provides a method for preparing gene-edited plants with reduced β-glucan content in barley grains, comprising: using gene editing technology to edit promoter elements in the promoter region of the HvCslf6 gene to obtain gene-edited plants with reduced β-glucan content in barley grains;
[0009] The gene number of the HvCslf6 gene in BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.
[0010] Furthermore, the original nucleotide sequence of the upstream promoter region is shown in SEQ ID NO.1; the nucleotide sequence of the gene-edited promoter element is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.
[0011] Furthermore, the edit target of the promoter element comprises a sequence of CCAAT-box elements.
[0012] Furthermore, the promoter element is located 295bp to 300bp before the CDS region of the HvCslf6 gene, and the nucleotide sequence of the promoter element is CCGTTG, which belongs to the CCAAT-box element.
[0013] Furthermore, the method for preparing the gene-edited plants with reduced β-glucan content in barley grains includes the following steps:
[0014] (1) Design sgRNA target sites targeting key cis-acting elements in the 2Kbp promoter region upstream of the ATG of the HvCslf6 gene;
[0015] (2) Based on the sgRNA target sites designed in step (1), prepare CRISPR / Cas9 gene editing vectors;
[0016] (3) Construct genetically engineered bacteria containing CRISPR / Cas9 gene editing vectors, transform them into barley genetic transformation materials, and after screening with vector marker genes, obtain transgenic plants with significantly altered β-glucan content in barley grains that do not contain exogenous genes.
[0017] Furthermore, the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO. 5 to 9.
[0018] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.7.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] This invention utilizes gene editing technology to identify a key element in the upstream promoter region of the major gene for barley β-glucan synthesis that affects the β-glucan content in barley grains. Based on this, a method is provided to prepare transgenic plants with altered β-glucan content in barley grains, providing a new means and tool for detecting and regulating β-glucan content in barley grains. Attached Figure Description
[0021] Figure 1 This is a schematic diagram of gene editing of the Cslf6 promoter element; (a) shows the location of gene editing target sites in the promoter region, with a total of 5 target sites (T1-T5); (b) shows the mutation types obtained at the five target sites, each containing a key cis-acting element. Pro-Cslf6-CK represents wild-type barley GP, which is the control group. Pro-Cslf6-mT1-1 represents the first mutation type obtained at the first target site T1 of the Cslf6 gene promoter. Specifically, the T1 target site yielded 2 mutation types, the T2 target site yielded 2 mutation types, the T3 target site yielded 1 mutation type, the T4 target site yielded 3 mutation types, and the T5 target site yielded 1 mutation type.
[0022] Figure 2 The graph shows the statistical content of β-glucan in mature grains of plants with different mutation types; among them, Pro-Cslf6-CK represents wild-type barley GP, which is the control group, and Pro-Cslf6-mT1-1, etc. represent the mutation types in the Cslf6 gene promoter; *, * and *** indicate that there is significance at the P<0.05, P<0.01 and P<0.001 levels, respectively, and ns indicates that there is no significant difference compared with the control.
[0023] Figure 3 This diagram illustrates the genotypes of the mutation sites in three mutants of wild-type barley at the GP and T3 target sites. Pro-Cslf6-CK represents wild-type barley GP; Pro-Cslf6-mT3-1 (1bp-in) represents a mutant with one A base inserted into the CCAAT-box of the barley promoter; Pro-Cslf6-mT3-2 (1bp-in) represents a mutant with one T base inserted into the CCAAT-box of the barley promoter; and Pro-Cslf6-mT3-3 (2bp-in) represents a mutant with two TT bases inserted into the CCAAT-box of the barley promoter.
[0024] Figure 4 This is a statistical chart showing the β-glucan content in wild-type and three mutant barley grains; where Pro-Cslf6-CK represents the Golden Promise (GP) of wild-type barley, Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2 and Pro-Cslf6-mT3-3 represent the three mutants at the T3 target site, DAF 21 indicates the test was performed 21 days after flowering, DAF 28 indicates the test was performed 28 days after flowering, and Mature indicates the test was performed after grain maturity.
[0025] Figure 5 The graph shows the relative expression levels of Cslf6 in wild-type and three mutant barley grains; DAF 21 indicates the detection was performed 21 days after flowering, and Pro-Cslf6-CK indicates wild-type barley GP. Detailed Implementation
[0026] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.
[0027] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.
[0029] The nucleotide sequence of the upstream promoter region of HvCslf6 is shown in SEQ ID NO.1. The upstream promoter region is located before the CDS region of the HvCslf6 gene and has a length of 2.0 kb. The nucleotide sequence of the promoter element provided in this application is CCGTTG, which belongs to the CCAAT-box element. The nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.
[0030] SEQ ID NO.1:
[0031]
[0032] SEQ ID NO.2:
[0033]
[0034] SEQ ID NO.3:
[0035]
[0036] SEQ ID NO.4:
[0037]
[0038] The barley variety used in this invention is Golden Promise.
[0039] Example 1: Construction of vectors for knocking out different promoter elements of the Cslf6 gene and obtaining transgenic plants.
[0040] 1) Prediction of Cslf6 gene promoter elements
[0041] The gene sequence of Cslf6 (HORVU.MOREX.r3.7HG0698110) was assembled using Geneious software. The first 2.0 kb of its CDS region was selected as the promoter region. The promoter elements of the Cslf6 gene were predicted using the PlantCARE online software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html). Five key cis-acting elements were selected for target design, and their positions on the promoter are as follows: Figure 1 As shown in (a) and (b) above, detailed information is provided in Table 1:
[0042] Table 1 Different promoter elements and their gene editing targets
[0043]
[0044] 2) Design of promoter element knockout sgRNA
[0045] The sgRNA target sites were designed near the cis-acting elements using the online website targetdesign (http: / / skl.scau.edu.cn / targetdesign / ). The sequences containing each element at the target site were edited, and the off-target rate was detected on the website crispor (http: / / crispor.tefor.net / crispor.py). The sgRNA sequences (as shown in Table 1, SEQ ID NO. 5-9) were determined by combining the knockout elements and off-target detection.
[0046] 3) Construction of promoter element knockout carrier
[0047] ① The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digestion products were rapidly dephosphorylated using CIP (M0525V, NEB, USA) to prevent vector self-ligation.
[0048] ② Design target primers based on the sequence of different promoter elements (as shown in Table 1);
[0049] ③ Dissolve the target primers in TE buffer to a final concentration of 100 μM / L, and anneal them at 90℃ for 1-2 min using a PCR instrument;
[0050] ④ The target primer annealing product is phosphorylated with T4 PNK (M0201S, NEB, USA);
[0051] ⑤U6 linearized vector and annealed phosphorylated product were ligated using T4 ligase (MO202L, NEB, USA) to obtain knockout vectors with different promoter elements.
[0052] ⑥ The above knockout vector was transformed into competent Escherichia coli DH5α. Single clone verification and sequencing were performed using sgF of each target primer as F primer and P2 (GCGATTAAGTTGGGTAACGC) as universal R primer.
[0053] After sequencing was confirmed to be correct, plasmids were extracted to obtain different cas9-Pro-Cslf6 promoter editing vector plasmids Pro-Cslf6-mT1 to T5.
[0054] 4) Obtaining transgenic plants
[0055] All constructed knockout vector positive plasmids were transformed into Agrobacterium using the heat shock method. Commercial Agrobacterium competent cells AGL1 (AC1020S, Weidi Biotechnology, China) were used as the recipient strain. Genetic transformation was performed by in vitro GP embryos infected with Agrobacterium, followed by selection and culture with hygromycin (HYG) to obtain transgenic plants. DNA was extracted from leaves of T0 generation transgenic plants and wild-type plants. The following two primer pairs were used to sequence five target regions to detect mutation types: Pro-Cslf6-F1 / R1 primers were used to detect mutations at T1-T4 targets, and Pro-Cslf6-F2 / R2 primers were used to detect mutations at T5 targets. The amplification lengths were 799 bp and 657 bp, respectively. The primers are as follows:
[0056] Pro-Cslf6-F1: 5'-GCACAAGCTCACAAACCC-3';
[0057] Pro-Cslf6-R1: 5'-GGAGAACAGGTCCAAGGTCC-3';
[0058] Pro-Cslf6-F2: 5'-AGTCAAGGGGTGAGCTTGTG-3';
[0059] Pro-Cslf6-R2: 5'AGGAATGCATTGGTCCCCTG-3'.
[0060] Example 2: Determination and Analysis of β-glucan Content in Transgenic Plants
[0061] After transgenic verification of the T0 generation plants, a total of 10 different homozygous mutant types of plants were finally obtained, such as... Figure 1 As shown in (b), gene editing at the T1 target yielded two mutant plant types, namely Pro-Cslf6-mT1-1 and Pro-Cslf6-mT1-2; similarly, the T2 target yielded 2 mutant plant types, the T3 target yielded 1 mutant plant type, the T4 target yielded 3 mutant plant types, and the T5 target yielded 1 mutant plant type.
[0062] Mature seeds from GP plants of various mutant types and control group were then harvested for β-glucan content analysis. The assay method used was the β-Glucan Assay Kit (Mixed Linkage) (K-BGLU, Megazyme).
[0063] Analysis results as follows Figure 2 As shown, compared with the control group Pro-Cslf6-CK, except for Pro-Cslf6-mT4-3, the β-glucan content in the mature seeds of all other mutants was significantly lower, especially in the Pro-Cslf6-mT3 mutant, where the decrease was most significant, reaching 20.27%. This indicates that the cis-acting element CCAAT-box at this target site is the most crucial to the final phenotype caused by this gene. Therefore, we will only study the variation at the T3 target site in subsequent studies.
[0064] Following the knockout of the T3 target site, we continued to cultivate the remaining T0 generation heterozygous seeds and extracted DNA from the T1 generation for sequencing analysis. We discovered two more mutation types at the T3 target site besides Pro-Cslf6-mT3. We named these three mutation types Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3. The genotypes of the mutation sites for the three mutants are as follows: Figure 3 As shown.
[0065] Plants lacking both marker genes were simultaneously screened using HYG and Cas9 selection markers. Mutation sites were detected using universal primers HYG-F / R and Cas9-F / R, ultimately resulting in transgenic plants without the exogenous gene. The universal primers are as follows:
[0066] HYG-F: 5'-TAAATAGCTGCGCCGATGGT-3';
[0067] HYG-R: 5'-GGCGACCTCGTATTGGGAAT-3';
[0068] Cas9-F: 5'-CCTGGCCCACATGATCAAGT-3';
[0069] Cas9-R: 5'-TGTACTTCTCAGGCAGCTGC-3';
[0070] T2 generation seeds, after positive identification, can be used for subsequent steps.
[0071] Similarly, the β-glucan content of mature seeds from Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3 mutants and Pro-Cslf6-CK plants was determined and analyzed using the β-Glucan Assay Kit (Mixed Linkage) (K-BGLU, Megazyme).
[0072] Analysis results as follows Figure 4 As shown, compared with the control group GP plants, the β-glucan content in the Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3 mutants was significantly reduced at 21 and 28 days after flowering and in mature grains. Specifically, at the maturity stage, the β-glucan content in the grains of each mutant was significantly reduced by 36.8%, 13.0%, and 10.9% respectively compared to the control. Therefore, this invention successfully produced gene-edited plants with reduced β-glucan content in barley grains.
[0073] Example 3: Validation of Cslf6 gene expression level
[0074] 1) Cultivation and sampling of barley materials
[0075] Control group plants GP and mutants Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3 were simultaneously planted in a plant growth chamber. The temperature in the plant growth chamber was 22℃ during the day and 18℃ at night, the photoperiod was 14h during the day and 10h at night, and the light intensity was 300 μm·m. -2 s -1 The soil used for planting was a mixture of peat and vermiculite in a 9:1 ratio. Barley grains were sampled during grain development (21 days after flowering). After cutting the spikes and removing the awns, the grains were quickly placed in 15mL centrifuge tubes pre-cooled in liquid nitrogen, flash-frozen in liquid nitrogen, and stored at -80℃. RNA contamination was avoided throughout the sampling process.
[0076] 2) RNA extraction, reverse transcription, and quantitative real-time PCR
[0077] Total RNA was extracted using a Quick RNA extraction kit (Huayueyang Biotechnology Co., Ltd., Beijing, China). cDNA was synthesized according to the instructions of a reverse transcription kit (Takara, Japan). The expression level of the Cslf6 gene was measured using the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The amplified sequence is shown below:
[0078] GAPDH-F: 5'-GTGAGGCTGGTGCTGATTACG-3';
[0079] GAPDH-R: 5'-TGGTGCAGCTAGCATTTGAGAC-3';
[0080] Cslf6-F: 5'-TGGGCATTCACCTTCGTCAT-3';
[0081] Cslf6-R: 5'-TGTCCGGGCAAACTCATCAA-3'.
[0082] Utilize TB Green TM PreMix Ex Taq TM qRT-PCR was performed using a kit (Takara, Japan) and a LightCycler 480 real-time PCR system (Roche, Switzerland). The reaction program was 95°C pre-denaturation for 90 s, 95°C denaturation for 5 s, and 60°C annealing for 20 s, for 40 cycles. The response Ct value for each gene was determined based on the amplification curves, and a 22... –ΔΔCt The relative gene expression levels were calculated using the method described in Schefe, JH, Lehmann, KE, Buschmann, IR, Unger, T. and Funke-Kaiser, H. (2006). Quantitative real-time RT-PCR data analysis: Current concepts and the novel "gene expression's CT difference" formula, Journal of Molecular Medicine, 84(11):901-910. Each value was measured in four biological replicates.
[0083] like Figure 5 As shown, the expression level of the Cslf6 gene in the grains during development was significantly lower than that in the wild-type control (GP). This indicates that the decrease in β-glucan content in the grains of the mutant provided in this application compared to the wild type is due to the decreased expression level of the Cslf6 gene.
Claims
1. A method for preparing gene-edited plants with reduced β-glucan content in barley grains, characterized in that, include: Using gene editing technology, promoter elements in the promoter region of the HvCslf6 gene were edited to obtain gene-edited plants with reduced β-glucan content in barley grains. The HvCslf6 gene has the gene number HORVU.MOREX.r3.7HG0698110 in BARLEX Morex v3 Gene Models. The promoter element is located 295 bp to 300 bp before the CDS region of the HvCslf6 gene, and its nucleotide sequence is CCGTTG, belonging to the CCAAT-box element. The original nucleotide sequence of the upstream promoter region is shown in SEQ ID NO.1; the nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.
4.
2. The preparation method according to claim 1, characterized in that, The edit target of the promoter element contains a sequence of CCAAT-box elements.
3. The preparation method according to claim 1, characterized in that, Includes the following steps: (1) Design sgRNA target sites targeting promoter elements in the 2Kbp promoter region upstream of the ATG of the HvCslf6 gene; (2) Based on the sgRNA target sites designed in step (1), prepare CRISPR / Cas9 gene editing vectors; (3) Construct genetically engineered bacteria containing CRISPR / Cas9 gene editing vectors, transform them into barley genetic transformation materials, and after screening with vector marker genes, obtain transgenic plants with significantly altered β-glucan content in barley grains that do not contain exogenous genes.
4. The preparation method according to claim 3, characterized in that, The nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO. 5 to 9.