Diagnostic and prognostic approaches for estrogen-induced cancers

Abstract

The present invention provides methods for detecting estrogen-induced cancer in an individual, methods for identifying an individual at risk of developing estrogen-induced cancer, and methods for determining or predicting the prognosis of an individual with estrogen-induced cancer. The methods of the present invention comprise determining the expression level of ALPPL2 in a biological sample (typically a blood sample) obtained from an individual.

Description

Technical Field

[0001] The present invention relates generally to diagnostic and prognostic methods and protocols for estrogen-induced cancers, particularly endometrial and ovarian cancers. Background Art

[0002] Uterine (endometrial) cancer is the fifth most common gynecologic cancer worldwide, with more than 60,000 new cases diagnosed each year and nearly 10,000 deaths. The 5-year overall survival rate for patients with endometrial cancer without metastasis ranges from 74% to 91%. However, for women with stage IV endometrial cancer, long-term survival drops to 20%. Obesity is an independent risk factor, accounting for approximately 50% of cases with a high body mass index (BMI, >30 kg / m 2 )related.

[0003] Endometrial cancer is most common in postmenopausal women. Early menarche and late menopause, or long-term exposure to estrogen, can lead to prolonged endometrial growth, which can subsequently cause endometrial hyperplasia and cancer. Hypertrophic adipocytes in obese women are the main source of aromatase, which synthesizes excess estrogen in situ and promotes endometrial adenocarcinoma. Therefore, elevated estrogen levels are closely associated with susceptibility to endometrial cancer.

[0004] The standard treatment for most patients with endometrial cancer is major surgery, usually a hysterectomy or bilateral salpingo-oophorectomy (removal of the fallopian tubes and ovaries). However, the five-year survival rate for patients with endometrial cancer is poor because the cancer is often diagnosed only at an advanced stage.

[0005] There is a clear need to identify biomarkers to detect the disease early, thereby making early treatment possible. Early diagnosis can have a significant impact on the patient's prognosis. If endometrial cancer is diagnosed in stage I or II, the five-year survival rate is about 90%. However, if the cancer is not diagnosed until stage III or IV, the five-year survival rate drops sharply to only about 40%. Most endometrial cancer patients (about 90%) have endometrioid histological features, which are significantly associated with a hyperestrogenic state. Therefore, identifying estrogen-responsive biomarkers will be particularly beneficial for early detection of elevated estrogen levels and diagnosis of endometrial cancer.

[0006] There are currently no universally accepted biomarkers for endometrial cancer. High levels of the oncoprotein stathmin have been shown to be associated with aggressive endometrial cancer and a poor prognosis, however, the use of stathmin as a biomarker is limited to patients with advanced endometrial cancer. Patients with endometrial cancer may undergo a blood test to determine CA-125 levels before surgery, however the utility of CA-125 as an endometrial cancer biomarker is limited by its lack of specificity and sensitivity, its lack of ability to detect early-stage cancer, and its poor prognostic ability.

[0007] There remains a need for biomarkers for endometrial and related cancers with improved diagnostic and prognostic capabilities. Summary of the invention

[0008] In one aspect, the present invention provides a method for detecting estrogen-induced cancer in an individual, the method comprising performing the following steps:

[0009] (a) determining the expression level of placental-like alkaline phosphatase 2 (ALPPL2) in a biological sample obtained from an individual; and

[0010] (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer,

[0011] wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates the presence of estrogen-induced cancer in the individual.

[0012] Determining the expression level of ALPPL2 may include qualitatively or quantitatively determining the expression of ALPPL2 protein. Alternatively, determining the expression level of ALPPL2 may include qualitatively or quantitatively determining the expression of ALPPL2 mRNA.

[0013] One or more statistical analyses may be performed on the determination of the ALPPL2 expression level. Exemplary statistical analyses include, but are not limited to, receiver operator characteristic (ROC) analysis, logistic regression analysis, Spearman's rank correlation analysis, and Mann-Whitney U test. In an exemplary embodiment, the method includes determining a statistical value, and comparing the statistical value, the statistical value derived from the expression level of ALPPL2 in a sample obtained from an individual and one or more reference samples. The comparison step may include, for example, a ROC analysis.

[0014] The estrogen-induced cancer can be, for example, endometrial cancer, ovarian cancer, or breast cancer. In an exemplary embodiment, the estrogen-induced cancer is endometrial cancer or ovarian cancer.

[0015] In an exemplary embodiment, the biological sample obtained from the individual is a fluid sample, more typically a blood sample, such as a whole blood, plasma, or serum sample. Typically, one or more reference samples are fluid samples, more typically a blood sample, such as a whole blood, plasma, or serum sample. One or more reference samples can be from one or more individuals known not to suffer from estrogen-induced cancer.

[0016] In another aspect, the present invention provides a method for identifying an individual at risk for developing an estrogen-induced cancer, the method comprising the steps of:

[0017] (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual; and

[0018] (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer,

[0019] wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates that the individual has an increased risk of developing an estrogen-induced cancer.

[0020] Generally, elevated expression levels of ALPPL2 are positively correlated with estrogen levels.

[0021] In another aspect, the present invention provides a method for determining or predicting the prognosis of an individual suffering from an estrogen-induced cancer, the method comprising performing the following steps:

[0022] (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual;

[0023] (b) comparing the determined expression level to the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer; and

[0024] (c) determining or predicting the prognosis of the individual based on the determined expression level and said comparison.

[0025] In one embodiment, predicting the prognosis comprises predicting the survival of an individual.

[0026] The present invention also provides a kit for detecting and screening estrogen-induced cancers, wherein the kit comprises one or more reagents for determining the expression of ALPPL2 as defined in the above embodiments.

[0027] The present invention also provides a computer system or device configured to help detect or diagnose estrogen-induced cancer, the risk of an individual suffering from the cancer, or the prognosis of an individual suffering from the cancer, wherein computer software is used to analyze data related to the expression of ALPPL2 as defined in the above embodiments and provide a diagnosis, risk assessment or prognosis prediction for the individual. Typically, the computing software is also used to compare the data with data related to the expression of ALPPL2 in one or more cancer-free reference samples.

[0028] Another aspect of the present invention provides a method for selecting an individual for treatment of an estrogen-induced cancer, the method comprising:

[0029] (a) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in a biological sample derived from the individual, wherein the expression level of ALPPL2 in the biological sample derived from the individual relative to the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer is indicative of the presence of estrogen-induced cancer in the individual; and

[0030] (b) selecting an individual determined in (a) to have an estrogen-induced cancer for treatment of said cancer.

[0031] Another aspect of the invention provides a method for monitoring an individual's response to therapeutic treatment of an estrogen-induced cancer, the method comprising:

[0032] (a) obtaining a first biological sample from an individual, wherein the first biological sample is obtained before or after initiation of therapeutic treatment;

[0033] (b) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said first biological sample;

[0034] (c) obtaining a second biological sample from the individual, wherein the second biological sample is obtained at a time point after initiation of therapeutic treatment and after obtaining the first biological sample;

[0035] (d) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said second biological sample; and

[0036] (e) comparing the expression levels of ALPPL2 in the first biological sample and the second biological sample,

[0037] Wherein a change in expression levels between the first biological sample and the second biological sample is indicative of whether the individual is responsive to a therapeutic treatment.

[0038] The method may further comprise obtaining and performing steps on a third or subsequent sample. Typically, the first, second and any subsequent samples are the same body fluid.

[0039] Another aspect of the invention provides a protocol for monitoring the efficacy of a therapeutic treatment of an estrogen-induced cancer, the protocol comprising:

[0040] (a) obtaining a first biological sample from an individual, wherein the first biological sample is obtained before or after initiation of therapeutic treatment;

[0041] (b) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said first biological sample;

[0042] (c) obtaining a second biological sample from the individual, wherein the second biological sample is obtained at a time point after initiation of therapeutic treatment and after obtaining the first biological sample;

[0043] (d) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said second biological sample; and

[0044] (e) comparing the expression levels of ALPPL2 in the first biological sample and the second biological sample,

[0045] Wherein a change in expression level between the first biological sample and the second biological sample indicates whether the therapeutic treatment is effective.

[0046] The protocol may further include obtaining and performing steps on a third or subsequent sample. Typically, the first, second and any subsequent samples are the same body fluid.

[0047] The above protocol can also be used to screen candidate drugs for the treatment of estrogen-induced cancers. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Embodiments of the invention are herein described, by way of non-limiting example only, with reference to the following drawings.

[0049] Figure 1 . Immunoblotting of ALPPL2 protein in 2D and 3D cultures of Ishikawa cells.

[0050] Figure 2Ishikawa cells were grown in 3D and treated with estrogen (E2, 10 nmol / L) and progesterone (P4, 100 nmol / L). (A) The bar graph shows the average colony size of different treatment groups (n=3). The diameter of 50 colonies in each treatment group was analyzed. (B) Ishikawa cells were treated with E2 and P4 and their proliferation was determined (n=3). (C) Quantitative real-time PCR analysis of the expression level of ALPPL2 mRNA in cDNA of Ishikawa organoids treated with E2 and / or P4 (n=3). (D) Immunoblot analysis of ALPPL2 protein from Ishikawa cells in 2D and 3D environments under different treatment conditions (n=3). (E) Densitometric quantification of protein blots in group E. Scale bar, 100 μm. Results represent mean ± SEM; *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

[0051] Figure 3 .(A) The figure shows the quantification of ALPPL2 staining intensity (n=3). (B) Alppl2 mRNA expression levels from cDNA of E2- and P4-treated mouse uteri (n=3). (C) Protein lysates from E2- and P4-treated mouse uteri were subjected to Western blot ALPPL2 analysis (n=3 mice / group). (D) Densitometric quantification of ALPPL2 Western blot bands is shown as a bar graph (n=3). (E) ALPPL2 staining intensity was quantified by H-score and shown as a bar graph (n=5). HSecE, human secretory endometrium; HProE, human hyperplastic endometrium. Scale bar, 100 μm. Results represent mean ± SEM; *, P<0.05; **, P<0.01.

[0052] Figure 4(A) Overall and (B) disease-free Kaplan-Meier analysis of ALPPL2 expression in endometrial cancer patients (TCGA project). The analysis was done by median cut of P value of log-rank test. Black line, samples with low ALPPL2; red line, samples with high ALPPL2. (C) Quantification of ALPPL2 staining intensity is shown as H score of normal (n=5), grade 1 (n=16), grade 1-2 (n=22), grade 2 (n=20), grade 2-3 (n=9), and grade 3 (n=25) endometrial cancer patients. Whisker box plot represents median with minimum and maximum values. P value was determined by Mann-Whitney U test compared with normal cases. (D) ROC curve showing ALPPL2 expression level of endometrioid adenocarcinoma relative to normal cases. (E) Protein lysates from cancerous and normal adjacent uterine tissues were analyzed by Western blot for the expression of ALPPL2 (n = 9 patients per group). Representative Western blots of normal and cancerous tissues from four patients are shown. (F) Densitometric quantification of the bands in F was averaged and shown as box-dotted line plots (n = 9). Pt, patient; AUC, area under the ROC curve; CI, confidence interval; HNormalAd, normal adjacent human endometrium; HendoCa, human endometrial carcinoma. Scale bar, 100 μm. Results represent mean ± SEM; *, P < 0.05; **, P < 0.01.

[0053] Figure 5 .Box-and-dotted line plots show (A) ALPPL2 and (B) CA-125 values ​​in plasma from endometrial cancer patients and normal women. Each box represents the maximum, upper quartile, median, lower quartile, and minimum value. (C) Comparison of the ability of ALPPL2 and CA-125 to discriminate endometrial cancer cases. The vertical line represents the CA-125 threshold (35 U / mL), above which women are referred to a gynecologist. The horizontal line represents the ALPPL2 threshold, which was selected by taking the 75th percentile of all control samples and considering the range between the median and the 75th percentile as the boundary. (D) The table shows the number of ALPPL2- and CA-125-positive cases, as well as the control group. (E) The bar graph shows the percentage of the total number of known case and control samples identified by CA-125 and ALPPL2 biomarker screening. ROC curve analysis of ALPPL2 and CA-125 in grade I (F), grade III / IV (G), and all (H) endometrial cancer cases and controls. AUC, area under the ROC curve; CI, confidence interval.

[0054] Figure 6Immunoblotting showed increased expression of ALPPL2 in four ovarian cancer positive tissue samples compared to cancer-free negative controls. DETAILED DESCRIPTION

[0055] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0056] As used herein, the singular forms "a", "an", and "the" also include plural aspects (i.e., at least one or more) unless the context clearly indicates otherwise. Thus, for example, reference to a "miRNA" includes a single miRNA as well as two or more miRNAs.

[0057] In the context of this specification, the term "about" should be understood to refer to a numerical range that a person skilled in the art would consider to be equivalent to the stated value while achieving the same function or result.

[0058] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprising" and "containing", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0059] "ALPPL2" refers to placental alkaline phosphatase 2 protein. Depending on the context, the term may also be used herein to refer to a gene, cDNA sequence, or mRNA sequence encoding the ALPPL2 protein. Human ALPPL2 is a 533 amino acid membrane-bound glycosylase, including a 19 amino acid N-terminal signal peptide. When present at elevated levels, cells secrete ALPPL2. Although the present disclosure generally relates to proteins and genes found in humans, those skilled in the art will understand that human sequence homologs from other species are also contemplated and encompassed. The cDNA encoding human ALPPL2 is located in the National Center for Biotechnology Information (NCBI) database under the accession number NM_031313. SEQ ID NO: 1 lists an exemplary amino acid sequence of a human ALPPL2 protein including an N-terminal signal peptide. SEQ ID NO: 2 lists an exemplary amino acid sequence of a mature human ALPPL2 protein (minus the N-terminal signal peptide). SEQ ID NO: 3 lists an exemplary nucleotide sequence of a human ALPPL2 gene.

[0060] The term "expression" is used in the present invention in its broadest context to refer to the measurable (qualitatively or quantitatively measurable) presence of a gene or protein. As described below, a variety of methods for determining or measuring ALPPL2 expression are contemplated. In some embodiments, measuring the expression of ALPPL2 includes determining the level of protein or mRNA. As used herein, the terms "level" and "amount" can be used interchangeably to indicate amount, semi-quantitative, relative amount, concentration, etc. Therefore, these terms cover the absolute or relative amount or concentration of a protein or mRNA in a sample, including the level in a population of individuals expressed as an average level and standard deviation.

[0061] As used herein, the term "derived from" means originating from or obtained from. The terms "derived from" and "from" are used interchangeably herein.

[0062] As used herein, the term "subject" refers to mammals, including humans, primates, livestock (e.g., sheep, pigs, cattle, horses, donkeys), laboratory test animals (e.g., mice, rabbits, rats, guinea pigs), companion animals (e.g., dogs, cats), and captive wild animals (e.g., foxes, kangaroos, deer). Typically, the mammal is a human or a laboratory test animal. More typically, the mammal is a human.

[0063] The inventors studied the secretome of endometrial cancer cells. Specifically, the transcriptome of endometrial cancer organoids was analyzed and ALPPL2 (alkaline phosphatase, placental-like 2) was determined to be the most important, highly secreted protein in endometrial cancer organoids. The inventors have found that there is a significant positive correlation between estrogen levels and ALPPL2 expression in vivo and in vitro. ALPPL2 has been shown to be overexpressed in tissue and plasma samples of endometrial cancer patients and tissue samples of human ovarian cancer patients. In endometrial cancer patients, overexpression of ALPPL2 has also been shown to be associated with low survival rates. The surprising findings of this study, illustrated herein, indicate that ALPPL2 is a useful biomarker for endometrial and ovarian cancer, for blood-based (e.g., plasma-based) diagnosis and prognosis of endometrial and ovarian cancer. ALPPL2 shows significantly improved diagnostic and prognostic potential compared to CA-125.

[0064] Thus, one aspect of the present invention provides a method for detecting estrogen-induced cancer in an individual, the method comprising performing the following steps:

[0065] (a) determining the expression level of placental-like alkaline phosphatase 2 (ALPPL2) in a biological sample obtained from an individual; and

[0066] (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer,

[0067] wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates the presence of estrogen-induced cancer in the individual.

[0068] Another aspect of the present invention provides a method for identifying an individual at risk of developing an estrogen-induced cancer, the method comprising the steps of:

[0069] (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual; and

[0070] (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer,

[0071] wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates that the individual has an increased risk of developing an estrogen-induced cancer.

[0072] Another aspect of the present invention provides a method for determining or predicting the prognosis of an individual suffering from an estrogen-induced cancer, the method comprising performing the following steps:

[0073] (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual;

[0074] (b) comparing the determined expression level to the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer; and

[0075] (c) determining or predicting the prognosis of the individual based on the determined expression level and said comparison.

[0076] Embodiments of the present invention provide biomarkers suitable for rapid and early detection and diagnosis of estrogen-induced cancers, thereby enabling appropriate treatment and patient management strategies to be implemented before the disease progresses to an advanced stage that is not easily treatable. Accordingly, the present invention also provides methods for facilitating early intervention to improve the prognosis of patients with such cancers by employing ALPPL2 as a biomarker.

[0077] In the context of this specification, the term "estrogen-induced cancer" refers to cancers that are associated with estrogen production and activity. In general, "estrogen-induced cancers" are cancers in which estrogen is involved in the etiology of the cancer and is associated with an increased risk of cancer. The terms "estrogen-related" and "associated with estrogen" can be used interchangeably with "estrogen-induced". Examples of estrogen-induced cancers include endometrial cancer (uterine cancer), ovarian cancer, and breast cancer.

[0078] In certain embodiments of the invention, the estrogen-induced cancer may be endometrial (uterine) cancer or ovarian cancer. Typically, the cancer is a carcinoma. Other exemplary forms of endometrial or ovarian cancer that may be diagnosed according to the present invention include sarcomas and carcinosarcomas.

[0079] The biological sample used to determine the expression level of ALPPL2 can be derived from any suitable body fluid or tissue. For example, the sample can comprise blood (e.g., red blood cells, white blood cells, whole blood, plasma, or serum), saliva, sputum, urine, breath, condensed air, or tissue. When the sample comprises tissue, typically the tissue is a tissue affected by estrogen-induced cancer. In a specific embodiment, the sample comprises whole blood, plasma, or serum. It is within the ability of a person of ordinary skill in the art to determine a suitable biological sample that can be obtained from an individual for use in the methods of the present invention.

[0080] Biological samples can be processed and analyzed according to the present invention almost immediately after collection (i.e., as fresh samples) for determining the presence of cancer, or they can be stored for subsequent analysis. If preservation of the biological sample is necessary or required, it will be understood by those skilled in the art that it should ideally be stored under conditions that maintain the integrity of the biomarkers within the sample (e.g., -80°C).

[0081] Those skilled in the art will appreciate that methods for determining or measuring the expression of ALPPL2 in a biological sample can be quantitative, semi-quantitative, or qualitative in nature. For example, a quantitative analysis can provide the amount or concentration of ALPPL2 in a sample within an appropriate error range (e.g., mean + / - standard deviation). In contrast, a semi-quantitative or qualitative analysis will typically provide an indication of the relative amount of ALPPL2 in a sample. This can include comparing the amount of ALPPL2 in a first sample to the amount of ALPPL2 in a second sample, and determining the relative amount between the first sample and the second sample.

[0082] According to the present invention, any suitable method or technique may be used to measure or determine ALPPL2 expression. Those skilled in the art will appreciate that the present invention is not limited to the mentioned means of determining and / or quantifying ALPPL2 expression. Those skilled in the art will be able to determine the appropriate means of detecting or measuring expression in any given case without undue burden or experimentation and without further invention.

[0083] Exemplary methods for determining ALPPL2 expression at the protein or polypeptide level include, for example, immunoassays using antibodies that bind to ALPPL2 protein, such as enzyme-linked immunosorbent assay (ELISA) or immunoblotting, 2D gel electrophoresis (including 2D-DIGE), multiplex protein expression assays, Western blots, immunoprecipitation assays, HPLC, LC / MS, flow cytometry, column chromatography, and spectroscopic analysis, including, for example, mass spectrometry, magnetic resonance imaging (MRI) spectroscopy, and single photon emission computed tomography (SPECT).

[0084] Exemplary methods for determining ALPPL2 expression at the mRNA level include PCR, RNA and cDNA microarrays, ligase chain reaction, oligonucleotide ligation assays, next generation sequencing, gel electrophoresis, Northern blots, flow cytometry, and in situ hybridization. Exemplary PCR methods include, but are not limited to, reverse transcriptase PCR, real-time PCR, quantitative PCR (qPCR), quantitative real-time PCR (qRT-PCR), and multiplex PCR.

[0085] By way of example only, particles (e.g., beads) in suspension or in a planar array can be used as the basis for an assay to measure protein or mRNA expression. For example, biomolecules such as antibodies or oligonucleotides can be conjugated to the surface of the beads to bind and capture ALPPL2 protein or mRNA, respectively. A range of detection methods known to those skilled in the art, such as flow cytometry or other suitable imaging techniques, can then be used to characterize the beads and detect the presence of protein or mRNA.

[0086] For the purposes of the present method, the expression level of ALPPL2 is generally compared to a reference level, wherein the reference level represents the absence of estrogen-induced cancer. The reference level may be derived from one or more reference samples. In the present invention, the term "reference" or "reference sample" refers to one or more biological samples from an individual or group of individuals diagnosed as not having estrogen-induced cancer. Alternatively or additionally, in some cases, it is desirable to compare the expression level of ALPPL2 from the subject of evaluation with one or more reference samples, wherein the reference sample refers to one or more biological samples from an individual or group of individuals with confirmed estrogen-induced cancer. In this case, the confirmed diagnosis may include a confirmed diagnosis of a particular stage or grade of estrogen-induced cancer.

[0087] A "reference sample" may include a compilation of data from one or more individuals that have confirmed a diagnosis that may serve as a "reference" or "control" for the purposes of the present invention. That is, a sample used as a reference sample or control need not be obtained specifically or immediately for the purpose of comparison with a sample obtained from a subject being evaluated.

[0088] Thus, reference levels of ALPPL2 expression can be predetermined using biological samples from a group of healthy individuals (i.e., without estrogen-induced cancer) to obtain an accurate median or mean. Reference levels can be determined for a variety of samples, such as various cell and tissue types and various body fluids. For the most accurate detection, reference samples for comparison include samples of the same type as the subject being evaluated in the provided methods. Reference levels can also be matched based on age, sex, or other factors.

[0089] According to the present invention, one or more statistical analyses can be performed on the expression data from one or more samples (including the sample being compared), thereby contributing to a diagnosis or prognosis method. Statistical analysis can include, for example, receiver operating characteristic (ROC) analysis, logistic regression analysis including logistic regression with k-fold validation, Spearman rank correlation analysis, Mann-Whitney U test, and calculation of Pearson correlation coefficient (PCC) values.

[0090] The methods of the present invention can be used to detect or diagnose individuals who have not been previously diagnosed or have not been diagnosed with cancer. Such diagnosis can be performed in the absence of clinical symptoms of cancer. For example, due to family history, obesity, estrogen exposure, determined estrogen levels, the presence of one or more genetic mutations, or the presence of an underlying disease or condition, an individual may show an increased risk of, susceptibility to, or predisposition to estrogen-induced cancer. For example, individuals with Lynch syndrome (hereditary non-polyposis colorectal cancer) are often associated with germline mutations in mismatch repair genes (e.g., MLH1, MSH2, MSH6, or PMS2) and have an increased risk of endometrial or ovarian cancer. Similarly, individuals with BRCA gene mutations are susceptible to breast cancer, ovarian cancer, and endometrial cancer. Those skilled in the art will appreciate that there are many factors (including symptoms, mutations, and conditions) that predispose individuals to estrogen-induced cancers, or increase the risk of such cancers, and the scope of the present invention is not limited to any one of the factors mentioned.

[0091] Alternatively, the methods disclosed herein can be used to confirm a diagnosis or preliminary diagnosis provided by a different means, such as ultrasound, tissue biopsy, MRI or PET scan, or blood test for one or more other biomarkers associated with cancer. Thus, the present methods can be used independently or in combination with one or more other diagnostic or prognostic methods, tests or assays. Thus, the diagnosis performed according to the embodiments disclosed herein can be associated with other means of diagnosing estrogen-induced cancers.

[0092] Reagent test kit

[0093] All necessary materials and reagents required for detecting or measuring ALPPL2 expression can be assembled together in a kit. Thus, the present invention provides diagnostic and test kits for detecting or determining the expression level of ALPPL2 in a biological sample, so as to facilitate the detection or diagnosis of estrogen-induced cancers, the risk of such cancers, or the prognosis of individuals with such cancers. The kits generally contain one or more reagents and / or devices for performing the methods disclosed herein. For example, the kit may contain reagents for isolating cells or cell components from a biological sample, such as reagents for extracting or isolating RNA or protein, and / or reagents for measuring ALPPL2 mRNA or protein expression.

[0094] The kit may also include suitable software, or access to suitable software, to facilitate comparison between reference expression levels and expression levels from individuals to be analyzed, and to facilitate statistical analysis that may be employed in such comparisons. Thus, the present invention also provides a computer system or apparatus configured to aid in the detection or diagnosis of an estrogen-induced cancer, the risk of developing such a cancer, or the prognosis of an individual suffering from such a cancer, wherein computer software is used to analyze data relating to the expression of ALPPL2 as defined herein, and to provide a diagnosis or prognosis prediction for an individual. Typically, the computing software is also used to compare the data with data relating to the expression of ALPPL2 in one or more reference samples without estrogen-induced cancer.

[0095] The kit may also include suitable means for receiving the biological sample, one or more containers or vessels for practicing the methods described herein, positive and negative controls (including reference samples), and instructions for use of the kit components contained therein according to the methods disclosed herein.

[0096] Treatment options

[0097] According to the methods of the present invention described above, individuals identified as having an estrogen-induced cancer can be selected for treatment or assigned to a treatment group, wherein an appropriate treatment regimen can be employed or prescribed for the treatment of the cancer.

[0098] Thus, in one embodiment, the methods disclosed herein may include the step of exposing (ie, subjecting) an individual identified as having an estrogen-induced cancer to a therapeutic regimen for treating said cancer.

[0099] Another aspect of the present invention provides a method for selecting an individual for treatment of an estrogen-induced cancer, the method comprising:

[0100] (a) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in a biological sample derived from the individual, wherein the expression level of ALPPL2 in the biological sample derived from the individual relative to the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer is indicative of the presence of estrogen-induced cancer in the individual; and

[0101] (b) selecting an individual determined in (a) to have an estrogen-induced cancer for treatment of said cancer.

[0102] The nature of the therapeutic treatment or regimen to be employed can be determined by one skilled in the art and generally depends on factors such as, but not limited to, the age, weight, and general health of the individual. Suitable therapeutic treatments and treatment regimens are known to those skilled in the art, non-limiting examples of which include surgery, chemotherapy, and / or radiation therapy.

[0103] As used herein, the terms "treat" and "treatment" refer to any and all uses of remedying cancer in any way or otherwise preventing, hindering, delaying or reversing the progression of cancer or one or more symptoms thereof. Therefore, the terms "treatment" and the like should be considered in their broadest sense. For example, treatment does not necessarily mean that the patient is treated until full recovery. In a condition exhibiting or characterized by multiple symptoms, treatment or prevention does not necessarily require remedying, preventing, hindering, delaying or reversing all of the symptoms, but rather may prevent, hinder, delay or reverse one or more of the symptoms.

[0104] Without being bound by theory or particular mode of practice, it can also be inferred from the present disclosure that the methods disclosed herein can be used to monitor an individual's response to therapeutic treatment and to monitor the efficacy of therapeutic treatment for estrogen-induced cancers, whereby the expression of ALPPL2 is determined (e.g., measured) in a biological sample obtained from the individual at two or more separate time points, including, for example, before the start of treatment, during treatment, and after cessation of treatment, to determine whether the individual has adequately responded to the treatment and whether the treatment is effective, for example, in inhibiting the development or progression of cancer.

[0105] Thus, one aspect of the invention provides a method for monitoring an individual's response to therapeutic treatment of an estrogen-induced cancer, the method comprising:

[0106] (a) obtaining a first biological sample from an individual, wherein the first biological sample is obtained before or after initiation of therapeutic treatment;

[0107] (b) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said first biological sample;

[0108] (c) obtaining a second biological sample from the individual, wherein the second biological sample is obtained at a time point after initiation of therapeutic treatment and after obtaining the first biological sample;

[0109] (d) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said second biological sample; and

[0110] (e) comparing the expression levels of ALPPL2 in the first biological sample and the second biological sample,

[0111] Wherein a change in expression level between the first biological sample and the second biological sample indicates whether the individual is responsive to the therapeutic treatment.

[0112] The present invention also provides a protocol for monitoring the efficacy of a therapeutic treatment of an estrogen-induced cancer, the protocol comprising:

[0113] (a) obtaining a first biological sample from an individual, wherein the first biological sample is obtained before or after initiation of therapeutic treatment;

[0114] (b) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said first biological sample;

[0115] (c) obtaining a second biological sample from the individual, wherein the second biological sample is obtained at a time point after initiation of therapeutic treatment and after obtaining the first biological sample;

[0116] (d) performing the step of determining the expression level of ALPPL2 as defined in the above embodiments in said second biological sample; and

[0117] (e) comparing the expression levels of ALPPL2 in the first biological sample and the second biological sample,

[0118] Wherein a change in the expression level between the first biological sample and the second biological sample indicates whether the therapeutic treatment is effective.

[0119] The method or protocol may further include obtaining and performing steps on a third or subsequent sample. Typically, the first sample, the second sample, and any subsequent samples are the same body fluid.

[0120] In one embodiment, a change in ALPPL2 expression between a first sample and a second (or subsequent) sample can indicate that the treatment regimen is effective. When the regimen disclosed herein indicates that the treatment regimen is ineffective (i.e., there is no change in the expression of ALPPL2 between the first sample and the second sample or the subsequent sample), the regimen can further include changing or modifying the treatment regimen to provide a more effective or aggressive treatment. This can include administering to the individual an additional dose of the same agent that the individual is currently receiving treatment for or changing the dose and / or type of drug.

[0121] The present invention also provides methods for screening candidate compounds and compositions as therapeutic agents for treating estrogen-induced cancers. For example, a suitable therapeutic agent can be obtained by selecting a compound or composition that can modulate the expression level of ALPPL2. This method of screening therapeutic agents can be performed in vivo or in vitro. For example, the screening method can be performed by the following steps: administering a candidate compound or composition to an individual (e.g., a laboratory test animal individual), measuring the expression level of ALPPL2 in a biological sample from the individual; selecting a compound or composition that increases or decreases the expression level of ALPPL2 compared to a control that has not been contacted with the candidate compound or composition.

[0122] Methods for selecting compounds or compositions for treating estrogen-induced cancers, monitoring the efficacy of such treatments, or screening candidate agents can also be used by, for example, obtaining a biological sample from an individual (e.g., an individual laboratory test animal); maintaining aliquots of the sample in the presence of a plurality of compounds or compositions; comparing the expression of ALPPL2 in each aliquot; and selecting a compound or composition that significantly alters the expression level of ALPPL2 in the aliquot containing the compound or composition relative to the expression level of ALPPL2 in the presence of the other compounds or compositions.

[0123] It will be appreciated that the above terms and associated definitions are for purposes of explanation only and not limitation.

[0124] In order that the invention may be readily understood and put into practical effect, certain preferred embodiments will now be described by way of the following non-limiting examples.

[0125] Reference in this specification to any previous publication (or information derived therefrom) or any known matter is not, and should not be taken as, an acknowledgement or acceptance or any form of suggestion that the previous publication (or information derived therefrom) or known matter constitutes common knowledge in the field to which this specification relates.

[0126] Example

[0127] Example 1 - Experimental Procedure

[0128] Cell lines and culture conditions

[0129] The human endometrial adenocarcinoma cell line Ishikawa (Sigma #99040201) was cultured in MEM (HyClone) medium supplemented with 5% heat-inactivated FBS (Bovogen Biologics), 2 mmol / L L-glutamine (HyClone), and antibiotics (50 U / mL penicillin, 50 mg / L streptomycin; Gibco) at 37°C in a humidified atmosphere containing 5% CO2. Cell line authentication was performed by short tandem repeat (STR) DNA profiling and MycoAlert TM Plus Mycoplasma Detection Kit (Lonza) was used to routinely detect mycoplasma contamination in cells.

[0130] Clinical samples

[0131] Human endometrial cancer patient samples: Human endometrial cancer tissue samples and adjacent normal tissue samples were collected from patients undergoing tumor resection or surgical debulking at John Hunter Hospital using a protocol approved by the University of Newcastle Human Research Ethics Committee. Fresh tissue samples were transported to the laboratory, washed with phosphate buffered saline (PBS), and fixed in 10% formalin buffer for paraffin embedding and sectioning. Corresponding normal adjacent tissue sections and tumor sections were also rapidly frozen and stored in liquid nitrogen for protein separation and Western blot analysis.

[0132] Human plasma samples: The protocol for the collection of human plasma samples was approved by the Human Research Ethics Committee of the University of Newcastle. Normal and endometrial adenocarcinoma patient plasma samples were collected from the Victorian Cancer Biobank, Australia.

[0133] Tissue Microarray: An endometrial carcinoma tissue microarray (EMC1021, US Biomax) consisting of 97 carcinoma cases (grades 1, 2, and 3) and 5 normal sections was analyzed for ALPPL2 protein expression using immunohistochemistry. TMThe image analysis platform quantified the ALPPL2 staining intensity; the H-score was calculated and used to establish a receiver operating characteristic (ROC) curve between normal and adenocarcinoma cases.

[0134] TCGA data: The association between ALPPL2 or MUC16 expression and patient survival was verified using the uterine cancer dataset from TCGA (Cancer Genome Atlas: www.cancergenome.nih.gov). TCGA microarray gene expression data were used to calculate the ALPPL2 or MUC16 mRNA expression z-score for 548 tumor samples. A z-score of ±2 was used as a cutoff to divide the samples into high and low ALPPL2 or MUC16 expression groups. Overall and disease-free Kaplan-Meier survival analysis was performed for both groups of patients using cBioPortal for Cancer Genomics (Cerami et al, Cancer Discov, 2012, 2:401-4).

[0135] Animals and hormone treatment

[0136] All procedures for mouse experiments were approved by the Animal Care and Ethics Committee of Newcastle University. To study the effects of steroid hormones, female C57BL / 6 mice aged 8-12 weeks were ovariectomized and rested for 7 days. One week after ovariectomy, mice were subcutaneously implanted with hormone pellets of 17-β-estradiol (0.72 mg per pellet, 90-day release, n=3) or 17-β-estradiol and progesterone (0.72 mg and 100 mg per pellet, 90-day release, n=3, Innovative Research of America). Mice with subcutaneous incisions but no pellets were used as controls (Sham, n=3). After 3 months, uterine tissues were collected, formalin-fixed paraffin-embedded (FFPE) processed, and snap-frozen for protein or RNA isolation.

[0137] RNA-Seq and data analysis

[0138] According to the manufacturer's instructions, RNeasy Mini kit (Qiagen) was used to isolate total RNA from 2D monolayer and 3D grown Ishikawa organoids. Library preparation, sequencing and read count analysis were performed as previously described (Sahoo et al, Oncotarget, 2017, 8: 71400-17). Transcripts with a generalized log2 fold change (GFOLD) value greater than 2 were considered statistically significant (Feng et al, Bioinformatics, 2012, 28: 2782-8).

[0139] 3D organoid formation analysis and immunofluorescence staining

[0140] 5000 Ishikawa cells / well were seeded in triplicate in 100 μL of culture medium onto a thin layer of basement membrane extract coated with reduced growth factors ( RGF BME: Trevigen) in 96-well tissue culture plates and allowed to form organoids. After 24 hours, the organoids were treated with the desired hormones: 10nmol / L estrogen (β-estradiol, Sigma#E8875) and 100nmol / L progesterone (medroxyprogesterone 17-acetate, Sigma#M1629). The medium with the desired hormone concentrations was replaced every 48 hours. On day 7, the colony size was measured and the JuLI TM The images were taken by Stage Real-Time Cell History Recorder (NanoEnTek) in a humidified incubator at 37°C and 5% CO2. 3D reagent (Promega) was incubated at room temperature for 30 minutes, and the luminescence signal was recorded using FLUOstar OPTIMA (BMG Labtech). Ishikawa 3D organoids were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, ProSciTech) for 20 minutes and processed for immunofluorescence analysis as previously described (Sahoo et al, Oncotarget, 2017, 8:71400-17).

[0141] Immunoblotting

[0142] Endometrial cancer samples: Human endometrial cancer samples, mouse uterine tissues and Ishikawa cells were lysed in ice-cold RIPA (radioimmunoprecipitation assay) buffer (50 mmol / L Tris-HCl pH 7.5, 150 mmol / L NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) containing protease and phosphatase inhibitors (Sigma). The lysate was centrifuged at 12000 rpm for 10 minutes at 4°C, and the supernatant was collected. Aliquots of the purified lysate containing the same protein content were boiled in 1x Laemmli sample buffer (0.04 mol / L Tris-HCl pH 6.8, 0.2% SDS, 0.01% bromophenol blue, 10% β-mercaptoethanol and 10% glycerol) at 95°C for 5 minutes and separated using 10% SDS-PAGE gel. Protein bands were electrophoretically transferred to nitrocellulose blotting membranes (GE Healthcare Life Sciences), blocked for 1 hour at room temperature in TBS-T (0.1% Tween 20 in TBS) containing 5% skim milk (w / v), and then incubated overnight at 4°C with the primary antibody ALPPL2 (1:500 dilution, Santa Cruz Biotechnology #sc-134255). The membranes were washed and incubated with horseradish peroxidase-conjugated anti-mouse secondary antibodies (Jackson ImmunoResearch Laboratories) for 1 hour at room temperature. The membranes were washed again in TBS-T, developed using a chemiluminescent substrate (Millipore) to detect HRP, and protein bands were detected by chemiluminescence (Fujifilm LAS-4000). GAPDH was used as a loading control. Densitometric quantification was performed using ImageJ software (NIH, USA).

[0143] Ovarian cancer samples: Human ovarian cancer samples were lysed in ice-cold RIPA (radioimmunoprecipitation assay) buffer (50 mmol / L Tris-HCl pH 7.5, 150 mmol / L NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) containing protease and phosphatase inhibitors (Sigma). The lysate was centrifuged at 12000 rpm for 10 minutes at 4°C, and the supernatant was collected. The lysate was centrifuged at 12000 rpm for 10 minutes at 4°C, and the supernatant was collected. Aliquots of the purified lysate containing the same protein content were boiled in 1x Laemmli sample buffer (0.04 mol / L Tris-HCl pH 6.8, 0.2% SDS, 0.01% bromophenol blue, 10% β-mercaptoethanol and 10% glycerol) at 95°C for 5 minutes and separated using 10% SDS-PAGE gel. Protein bands were electrophoretically transferred to nitrocellulose blotting membranes (GE Healthcare LifeSciences), blocked for 1 hour at room temperature in TBS-T (0.1% Tween 20 in TBS) containing 5% skim milk (w / v), and then incubated overnight at 4°C with the primary antibody ALPPL2 (1:500 dilution, Santa Cruz Biotechnology #sc-134255). The membranes were washed and incubated with horseradish peroxidase-conjugated anti-mouse secondary antibodies (Jackson ImmunoResearch Laboratories) for 1 hour at room temperature. The membranes were washed again in TBS-T, developed using a chemiluminescent substrate (Millipore) to detect HRP, and protein bands were detected by chemiluminescence (Fujifilm LAS-4000). GAPDH was used as a loading control. Densitometric quantification was performed using ImageJ software (NIH, USA).

[0144] Histology, Immunohistochemistry (IHC), and Digital Quantification

[0145] For histological analysis, human endometrial cancer tissues and mouse uteri were fixed in 10% neutral buffered formalin at 4 °C overnight and transferred to 70% ethanol until further processing. Formalin-fixed tissues were processed, embedded in paraffin, and cut into 5 μm thickness. Hematoxylin and eosin staining and immunohistochemistry were performed using standard protocols previously described (Sahoo et al, Mol Cancer Res, 2018 16(2):309-321). Tissue sections were incubated with the primary antibody ALPPL2 (1:50 dilution, Santa Cruz Biotechnology #sc-134255) at 4 °C overnight and then incubated with a peroxidase-conjugated secondary antibody (Thermo Fisher Scientific) and DAB substrate (Sigma) to detect bound antibodies. Tissues were stained with hematoxylin to visualize cell morphology. Images were captured using an Aperio AT2 slide scanner (Leica Biosystems, Victoria, Australia) with the same gain and exposure time. The Halo TM The image analysis platform performed quantitative IHC analysis and calculated the pixel intensity of DAB staining using the Area Quantification v1.0 algorithm (Indica Labs, New Mexico, USA). The immunohistochemical intensity score (H-Score) was calculated based on the pixel intensity value (the sum of 3x% of strongly stained pixels + 2x% of moderately stained pixels + 1x% of weakly stained pixels).

[0146] RNA extraction, first-strand cDNA synthesis and qRT-PCR

[0147] Total RNA was isolated from uterine and Ishikawa cells of mice treated with estrogen or progesterone using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. 250 ng of total RNA was used for cDNA synthesis using the RT2 First Strand Kit (Qiagen). The cDNA was amplified using sequence-specific Alppl2 primers. Real-time quantitative PCR (Q-PCR) was performed using RT2 SYBR Green ROX qPCR Mastermix (Qiagen) on a 7900HT FAST Thermocycler (Applied Biosystems) after a preincubation step and 40 amplification cycles (including denaturation, annealing, and extension of the fragments). Relative quantification [comparison of Ct (2 -ΔΔCt) method] was used to compare the expression levels of target genes and housekeeping genes (Gapdh) in different treatment groups. Primer sequences were: human ALPPL2 (F: 5'TGTTACCGAGAGCGAGAGC 3' (SEQ ID NO:4), R: 5'GTGGGTCTCTCCGTCCAG 3' (SEQ ID NO:5)), mouse Alppl2 (F: 5'ACACATGGCTCTGTCCAAGA 3' (SEQ ID NO:6), R: 5'TCGTGTTGCACTGGTTGAAG 3' (SEQ ID NO:7)), human GAPDH (F: 5'GCCACATCGCTCAGACACCAT 3' (SEQ ID NO:8), R: 5'GAAGGGGTCATTGATGGCAA 3' (SEQ ID NO:9)) and mouse Gapdh (F: 5'TGGCAAAGTGGAGATTGTTGCC 3' (SEQ ID NO:10), R: 5'AAGATGGTGATGGGCTTCCCG 3' (SEQ ID NO:11)).

[0148] ELISA

[0149] Plasma ALPPL2 and CA-125 levels in normal and endometrial adenocarcinoma patients were analyzed using human ALPPL2 (CUSABIO Life science #CSB-EL001633HU) and CA-125 (Abcam #ab195213) ELISA kits according to the manufacturer's instructions. Briefly, the assay plate was incubated with standards and samples. After incubation, the plate was incubated with biotin and HRP-avidin labeled antibodies for 1 hour. After washing, the plate was developed with a colorimetric reagent and read at a wavelength of 450nm.

[0150] Statistical analysis

[0151] Statistical analysis was performed using GraphPad Prism 7.02 software. All in vitro experiments were repeated three times, using three biological replicates for each repeat, and data are expressed as mean ± SEM. Statistical analysis was performed by Student's t-test (unpaired, two-tailed). ALPPL2 and CA-125 protein levels were compared between groups using the Mann-Whitney test. Chi-square test or Fisher's exact test was used for categorical data. Differences between overall survival and disease-free survival were assessed using Kaplan-Meier analysis and log-rank test. The prognostic ability of ALPPL2 and CA-125 biomarkers was compared using the area under the receiver operating characteristic curve (AUC); AUC = 0 indicates that it is extremely unlikely to occur in clinical practice, values ​​close to 0.5 indicate that the discrimination ability is close to chance, and AUC = 1 indicates that the diagnostic test is perfect in distinguishing between disease and normal. P < 0.05 was considered statistically significant.

[0152] Example 2 - ALPPL2 as a secreted protein in human endometrial cancer organoids

[0153] To identify potential tumor biomarkers for diagnosing endometrial cancer patients, the inventors characterized the secretome of endometrial cancer cells. To characterize the secretome of human endometrial cancer cells, the inventors cultured Ishikawa cells in three dimensions (3D) on an extracellular matrix to form organoids. In contrast to conventional two-dimensional cultures, the culture of organoids is beneficial because organoids are self-organized, stable, and similar to the tissue of origin. Endometrial organoids mimic uterine glands in vivo, responding to steroid signals and secreting components of "uterine milk."

[0154] Endometrial cancer organoids formed in 3D typically start from a single cell to organize into multicellular polarized (shown by GM130 on the apical side) and glandular (shown by actin filament arrangement) structures. In a 3D environment, endometrial cancer cells essentially switch to a secretory type by acquiring a natural glandular pattern and synthesize a large amount of secretory proteins compared to other proteins (nuclear, cytoplasmic, and membranous proteins) (data not shown). Transcriptome analysis of Ishikawa organoids identified 111 secretory protein-coding genes (90 upregulated and 21 downregulated) compared to monolayers of Ishikawa cells (>2-fold change, P<0.05). Further cumulative analysis of all highly significant (GFOLD>2; P<0.05; eFDR, 1) transcripts revealed that ALPPL2 was the most abundant protein-coding gene secreted in Ishikawa organoids (approximately 80-fold). ALPPL2 expression was verified at the translational level using immunoblotting and showed unique expression in Ishikawa organoids consistent with RNA-seq data ( Figure 1). These results suggest that endometrial cancer cells secrete ALPPL2 in large amounts in their native state.

[0155] Example 3 - Endometrial cancer organoid growth and ALPPL2 expression show similar trends to estrogen and progesterone

[0156] The inventors demonstrate here that the size and proliferation of Ishikawa organoids increase after administration of estrogen (E2), and that progesterone (P4) counteracts the mitogenic effects of E2 ( Figure 2 A and 2B). As endometrial cancer cells secrete ALPPL2, the inventors wondered whether E2-mediated proliferation of endometrial cancer cells also stimulates ALPPL2 expression. Real-time quantitative PCR analysis of ALPPL2 was performed in Ishikawa organoids grown in E2 alone, P4 alone, or in E2 and P4. ALPPL2 mRNA expression was significantly upregulated in E2-treated organoids, while P4 inhibited this effect ( Figure 2 C). Overexpression of ALPPL2 was also confirmed by Western blot analysis of total cell lysates of Ishikawa cells and organoids treated with E2 and / or P4 ( Figure 2 D and 2E). The results concluded that E2 promoted the proliferation of Ishikawa organoids with elevated ALPPL2 expression.

[0157] Example 4 - Steroid hormones regulate the expression of ALPPL2 in mouse and human uterus

[0158] To verify the response of ALPPL2 to steroid hormones in vivo, wild-type C57BL / 6 mice were ovariectomized and treated with vehicle, E2, or E2 and P4 for 3 months (n=3 for each treatment). The effect of steroid hormones on the mouse uterus was confirmed by histological analysis, and endometrial hyperplasia was increased in the E2-treated group compared with the uterus treated with E2 and P4 (data not shown). Immunohistochemical analysis showed that ALPPL2 expression was increased in E2-treated mice, while P4 attenuated the effect of E2 in E2 and P4-treated mice ( Figure 3 A). The expression of ALPPL2 in the uterus of mice treated with E2 and / or P4 was also determined at the mRNA and protein levels ( Figure 3 B-3D). ALPPL2 protein expression during the proliferative (E2 response) and secretory (P4 response) phases of the menstrual cycle was also investigated. Human secretory endometrium showed modest ALPPL2 expression compared to proliferative endometrium ( Figure 3 E). Taken together, these results suggest that ALPPL2 is an E2-responsive gene and that the high-estrogenic state of the uterus can be detected by ALPPL2 expression levels.

[0159] Example 5 - Prognostic significance of ALPPL2 in endometrial adenocarcinoma

[0160] The positive correlation between sex-steroid hormones and endometrial cancer has been described within the framework of the "unopposed estrogen hypothesis", suggesting that women with high endogenous estrogen levels are at increased risk of endometrial cancer. In this study, the inventors found that ALPPL2 expression was positively correlated with increased E2 concentrations. To assess the relevance of these findings in clinical cohorts, publicly available RNA-seq gene expression data from the TCGA (The Cancer Genome Atlas) endometrial carcinoma subset were analyzed. TCGA data analysis showed that amplification of ALPPL2 was closely associated with poor prognosis in patients with endometrial cancer. Kaplan-Meier analysis of 548 samples with median cut and log-rank test showed significant differences in total (Cox hazard ratio 0.2183, 95% CI: 0.0458-1.041, P = 0.0139) and disease-free survival time (Cox hazard ratio 0.8976, 95% CI: 0.2062-3.908, P = 0.5067), which linked ALPPL2 to poor prognosis ( Figure 4 A and 4B). Patients with high ALPPL2 expression were found to have decreased overall survival (36% death) compared to patients with low ALPPL2 expression (16% death).

[0161] To test the prognostic value of ALPPL2 protein levels in patients with endometrial cancer, immunohistochemistry was performed on formalin-fixed, paraffin-embedded (FFPE) tissue microarrays consisting of 61 low-grade and 30 high-grade endometrial adenocarcinomas ( Table 1 ).

[0162] Table 1. Relationship between clinicopathological variables and ALPPL2 expression in patients with endometrial cancer

[0163]

[0164] The mean ALPPL2 protein staining intensity was higher in adenocarcinoma cases compared with normal endometrium ( Figure 4 C; ALPPL2H-score: normal, 159±5.83 vs adenocarcinoma, 180.1±4.37; P=0.0174). In addition, the analysis of adenocarcinomas of different grades also showed that ALPPL2 protein expression was significantly increased compared with normal subjects ( Figure 4C). The corresponding area under the receiver operating curve (ROC) for normal vs adenocarcinoma patients was 0.82 (95% CI 0.69-0.93, P=0.0197) ( Figure 4 D). In addition, the inventors compared the ALPPL2 expression levels between endometrial cancer tissues and corresponding normal adjacent tissues from the same patient. All normal adjacent tissues and endometrial cancer tissue sections were subjected to histological analysis before protein isolation. Consistent with the tissue microarray data, Western blot analysis identified a significant upregulation of ALPPL2 in endometrial cancer tissues compared to normal adjacent endometrium ( Figure 4 E and 4F). Overall, these data suggest that significant upregulation of ALPPL2 protein during endometrial cancer may be useful for patient prognosis.

[0165] Analysis of the TCGA dataset also demonstrated that ALPPL2 was a better predictor of patient survival compared with CA-125 (MUC16 expression: high, 8.6% death, low, 17.9% death; data not shown). These data suggest that upregulation of ALPPL2 is an indicator of poor prognosis in patients with endometrial cancer.

[0166] Example 6 - ALPPL2 as a clinically useful blood-based tumor marker for endometrial cancer

[0167] ALPPL2 expression in plasma of 100 endometrial cancers of different histological types (low-grade and high-grade) and 60 normal women was analyzed and compared with CA-125 levels. Patients with grade I endometrial cancer had significantly higher median ALPPL2 levels (controls, 1.172 ng / mL, vs cases, 1.486 ng / mL; P < 0.0001), while patients with advanced disease (grade III / IV) showed higher CA-125 values ​​(controls, 18.21 U / mL, vs cases, 28.15 U / mL; P = 0.0002; Figure 5 A and 5B). However, compared with CA-125 levels (cases: median, 19.48 U / mL; range, 2.59-169.20 U / mL, vs controls: 18.21 U / mL; range, 4.84-132.20 U / mL; P = 0.2832), plasma total ALPPL2 levels in endometrial cancer patients (median, 1.4 ng / mL; range, 0.54-11.12 ng / mL) were significantly higher than those in normal women (median, 1.1 ng / mL; range, 0.35-2.99 ng / mL; P = 0.0101). The inventors also compared ALPPL2 values ​​with CA-125 values ​​in individual case and control samples ( Figure 5C). With a threshold of 1.5 ng / mL, ALPPL2 was positive in 40 of 100 cases (40%), whereas only 24 of 100 cases (24%) were detected by the CA-125 cutoff (35 U / mL, Figure 5 D). Overall, 52 (33%) of the 160 women had elevated ALPPL2 thresholds, whereas only 33 (12%) had elevated CA-125 values ​​( Figure 5 E). In addition, to determine the prognostic significance of ALPPL2, the inventors generated ROC curves to distinguish cancer cases from controls. When the analysis was restricted to patients with grade I endometrioid endometrial cancer, the superiority of ALPPL2 over CA-125 was enhanced (ALPPL2 AUC, 0.71 vs CA-125 AUC, 0.55; Figure 5 F). CA-125 had a better prognostic value in grade III / IV patients compared with grade I cases (CA-125 AUC, 0.73 vs ALPPL2 AUC, 0.55; Figure 5 G). However, for all patients, ALPPL2 (0.40) had a higher sensitivity than CA-125 (0.24, Figure 5 H). Therefore, it appears that ALPPL2 titer independently better identifies patients with early-stage endometrial cancer than CA-125.

[0168] Example 7 - Expression of ALPPL2 in ovarian cancer

[0169] The present inventors then investigated the expression of ALPPL2 in ovarian tissue samples from four patients who had been diagnosed with ovarian cancer. Figure 6 As shown, ALPPL2 protein was clearly detectable in ovarian cancer tissue samples relative to the housekeeping protein GAPDH and was detectable at least in patients 2, 3, and 4, but not in control samples from healthy patients without ovarian cancer. Sequence Listing <110> University of Newcastle, Australia <120> Diagnostic and prognostic approaches for estrogen-induced cancers <130> KHP202112941.2 <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 532 <212> PRT <213> Homo sapiens <400> 1 Met Gln Gly Pro Trp Val Leu Leu Leu Leu Gly Leu Arg Leu Gln Leu 1 5 10 15 Ser Leu Gly Ile Ile Pro Val Glu Glu Glu Asn Pro Asp Phe Trp Asn 20 25 30 Arg Gln Ala Ala Glu Ala Leu Gly Ala Ala Lys Lys Leu Gln Pro Ala 35 40 45 Gln Thr Ala Ala Lys Asn Leu Ile Ile Phe Leu Gly Asp Gly Met Gly 50 55 60 Val Ser Thr Val Thr Ala Ala Arg Ile Leu Lys Gly Gln Lys Lys Asp 65 70 75 80 Lys Leu Gly Pro Glu Thr Phe Leu Ala Met Asp Arg Phe Pro Tyr Val 85 90 95 Ala Leu Ser Lys Thr Tyr Ser Val Asp Lys His Val Pro Asp Ser Gly 100 105 110 Ala Thr Ala Thr Ala Tyr Leu Cys Gly Val Lys Gly Asn Phe Gln Thr 115 120 125 Ile Gly Leu Ser Ala Ala Ala Arg Phe Asn Gln Cys Asn Thr Thr Arg 130 135 140 Gly Asn Glu Val Ile Ser Val Met Asn Arg Ala Lys Lys Ala Gly Lys 145 150 155 160 Ser Val Gly Val Val Thr Thr Thr Arg Val Gln His Ala Ser Pro Ala 165 170 175 Gly Ala Tyr Ala His Thr Val Asn Arg Asn Trp Tyr Ser Asp Ala Asp 180 185 190 Val Pro Ala Ser Ala Arg Gln Glu Gly Cys Gln Asp Ile Ala Thr Gln 195 200 205 Leu Ile Ser Asn Met Asp Ile Asp Val Ile Leu Gly Gly Gly Arg Lys 210 215 220 Tyr Met Phe Pro Met Gly Thr Pro Asp Pro Glu Tyr Pro Asp Asp Tyr 225 230 235 240 Ser Gln Gly Gly Thr Arg Leu Asp Gly Lys Asn Leu Val Gln Glu Trp 245 250 255 Leu Ala Lys His Gln Gly Ala Arg Tyr Val Trp Asn Arg Thr Glu Leu 260 265 270 Leu Gln Ala Ser Leu Asp Pro Ser Val Thr His Leu Met Gly Leu Phe 275 280 285 Glu Pro Gly Asp Met Lys Tyr Glu Ile His Arg Asp Ser Thr Leu Asp 290 295 300 Pro Ser Leu Met Glu Met Thr Glu Ala Ala Leu Leu Leu Leu Ser Arg 305 310 315 320 Asn Pro Arg Gly Phe Phe Leu Phe Val Glu Gly Gly Arg Ile Asp His 325 330 335 Gly His His Glu Ser Arg Ala Tyr Arg Ala Leu Thr Glu Thr Ile Met 340 345 350 Phe Asp Asp Ala Ile Glu Arg Ala Gly Gln Leu Thr Ser Glu Glu Asp 355 360 365 Thr Leu Ser Leu Val Thr Ala Asp His Ser His Val Phe Ser Phe Gly 370 375 380 Gly Tyr Pro Leu Arg Gly Ser Ser Ile Phe Gly Leu Ala Pro Gly Lys 385 390 395 400 Ala Arg Asp Arg Lys Ala Tyr Thr Val Leu Leu Tyr Gly Asn Gly Pro 405 410 415 Gly Tyr Val Leu Lys Asp Gly Ala Arg Pro Asp Val Thr Glu Ser Glu 420 425 430 Ser Gly Ser Pro Glu Tyr Arg Gln Gln Ser Ala Val Pro Leu Asp Gly 435 440 445 Glu Thr His Ala Gly Glu Asp Val Ala Val Phe Ala Arg Gly Pro Gln 450 455 460 Ala His Leu Val His Gly Val Gln Glu Gln Thr Phe Ile Ala His Val 465 470 475 480 Met Ala Phe Ala Ala Cys Leu Glu Pro Tyr Thr Ala Cys Asp Leu Ala 485 490 495 Pro Arg Ala Gly Thr Thr Asp Ala Ala His Pro Gly Pro Ser Val Val 500 505 510 Pro Ala Leu Leu Pro Leu Leu Ala Gly Thr Leu Leu Leu Leu Gly Thr 515 520 525 Ala Thr Ala Pro 530 <210> 2 <211> 513 <212> PRT <213> Homo sapiens <400> 2 Ile Ile Pro Val Glu Glu Glu Asn Pro Asp Phe Trp Asn Arg Gln Ala 1 5 10 15 Ala Glu Ala Leu Gly Ala Ala Lys Lys Leu Gln Pro Ala Gln Thr Ala 20 25 30 Ala Lys Asn Leu Ile Ile Phe Leu Gly Asp Gly Met Gly Val Ser Thr 35 40 45 Val Thr Ala Ala Arg Ile Leu Lys Gly Gln Lys Lys Asp Lys Leu Gly 50 55 60 Pro Glu Thr Phe Leu Ala Met Asp Arg Phe Pro Tyr Val Ala Leu Ser 65 70 75 80 Lys Thr Tyr Ser Val Asp Lys His Val Pro Asp Ser Gly Ala Thr Ala 85 90 95 Thr Ala Tyr Leu Cys Gly Val Lys Gly Asn Phe Gln Thr Ile Gly Leu 100 105 110 Ser Ala Ala Ala Arg Phe Asn Gln Cys Asn Thr Thr Arg Gly Asn Glu 115 120 125 Val Ile Ser Val Met Asn Arg Ala Lys Lys Ala Gly Lys Ser Val Gly 130 135 140 Val Val Thr Thr Thr Arg Val Gln His Ala Ser Pro Ala Gly Ala Tyr 145 150 155 160 Ala His Thr Val Asn Arg Asn Trp Tyr Ser Asp Ala Asp Val Pro Ala 165 170 175 Ser Ala Arg Gln Glu Gly Cys Gln Asp Ile Ala Thr Gln Leu Ile Ser 180 185 190 Asn Met Asp Ile Asp Val Ile Leu Gly Gly Gly Arg Lys Tyr Met Phe 195 200 205 Pro Met Gly Thr Pro Asp Pro Glu Tyr Pro Asp Asp Tyr Ser Gln Gly 210 215 220 Gly Thr Arg Leu Asp Gly Lys Asn Leu Val Gln Glu Trp Leu Ala Lys 225 230 235 240 His Gln Gly Ala Arg Tyr Val Trp Asn Arg Thr Glu Leu Leu Gln Ala 245 250 255 Ser Leu Asp Pro Ser Val Thr His Leu Met Gly Leu Phe Glu Pro Gly 260 265 270 Asp Met Lys Tyr Glu Ile His Arg Asp Ser Thr Leu Asp Pro Ser Leu 275 280 285 Met Glu Met Thr Glu Ala Ala Leu Leu Leu Leu Ser Arg Asn Pro Arg 290 295 300 Gly Phe Phe Leu Phe Val Glu Gly Gly Arg Ile Asp His Gly His His 305 310 315 320 Glu Ser Arg Ala Tyr Arg Ala Leu Thr Glu Thr Ile Met Phe Asp Asp 325 330 335 Ala Ile Glu Arg Ala Gly Gln Leu Thr Ser Glu Glu Asp Thr Leu Ser 340 345 350 Leu Val Thr Ala Asp His Ser His Val Phe Ser Phe Gly Gly Tyr Pro 355 360 365 Leu Arg Gly Ser Ser Ile Phe Gly Leu Ala Pro Gly Lys Ala Arg Asp 370 375 380 Arg Lys Ala Tyr Thr Val Leu Leu Tyr Gly Asn Gly Pro Gly Tyr Val 385 390 395 400 Leu Lys Asp Gly Ala Arg Pro Asp Val Thr Glu Ser Glu Ser Gly Ser 405 410 415 Pro Glu Tyr Arg Gln Gln Ser Ala Val Pro Leu Asp Gly Glu Thr His 420 425 430 Ala Gly Glu Asp Val Ala Val Phe Ala Arg Gly Pro Gln Ala His Leu 435 440 445 Val His Gly Val Gln Glu Gln Thr Phe Ile Ala His Val Met Ala Phe 450 455 460 Ala Ala Cys Leu Glu Pro Tyr Thr Ala Cys Asp Leu Ala Pro Arg Ala 465 470 475 480 Gly Thr Thr Asp Ala Ala His Pro Gly Pro Ser Val Val Pro Ala Leu 485 490 495 Leu Pro Leu Leu Ala Gly Thr Leu Leu Leu Leu Gly Thr Ala Thr Ala 500 505 510 Pro <210> 3 <211> 1599 <212> DNA <213> Homo sapiens <400> 3 atgcaggggc cctgggtgct gctcctgctg ggcctgaggc tacagctctc cctgggcatc 60 atcccagttg aggagaa cccggacttc tggaccgcc aggcagccga ggccctgggt 120 gccgccaaga agctgcagcc tgcacagaca gccgccaaga acctcat cttcctggggt 180 gacgggatgg gggtgtctac ggtgacagct gccaggatcc taaaagggca gaagaaggac 240 aaactggggc ctgagacctt cctggccatg gaccgcttcc cgtacgtggc tctgtccaag 300 acatacagtg tagacaagca tgtgccagac agtggagcca cagccacggc ctacctgtgc 360 ggggtcagg gcaacttcca gaccattggc ttgagtgcag ccgcccgctt taaccagtgc 420 aacacgacac gcggcaacga gtcatctcc gtgatgaatc gggccaagaa agcaggaaag 480 tcagtgggag tgtaccac cacacgggtg cagcatgcct cgccagccgg cgcctacgcc 540 cacacggtga accgcaactg gtactcggat gccgacgtgc ctgcctcggc ccgccaggag 600 gggtgccagg acatcgccac gcagctcatc tccacatgg acatgatgt gatcctaggt 660 ggaggccgaa agtacatgtt tcccatgggg acccagacc ctgagtaccc agatgactac 720 agccaaggtg ggaccaggct ggacgggaag aatctggtgc aggaatggct ggcgaagcac 780 cagggtgccc ggtacgtgtg gaaccgcact gagctcctgc aggcttccct ggacccgtct 840 gtgacccatc tcatgggtct ctttgagcct ggagacatga aatacgagat ccaccgagac 900 tccacactgg acccctccct gatggagatg acagaggctg ccctgctcct gctgagcagg 960 aacccccgcg gcttcttcct cttcgtggag ggtggtcgca tcgaccatgg tcatcatgaa 1020 agcagggctt accgggcact gactgagacg atcatgttcg acgacgccat tgagagggcg 1080 ggccagctca ccagcgagga ggacacgctg agcctcgtca ctgccgacca ctcccacgtc 1140 ttctccttcg gaggctaccc cctgcgaggg agctccatct tcgggctggc ccctggcaag 1200 gcccgggaca ggaaggccta cacggtcctc ctatacggaa acggtccagg ctatgtgctc 1260 aaggacggcg cccggccgga tgttacggag agcgagagcg ggagccccga gtatcggcag 1320 cagtcagcag tgcccctgga cggagagacc cacgcaggcg aggacgtggc ggtgttcgcg 1380 cgcggcccgc aggcgcacct ggttcacggc gtgcaggagc agaccttcat agcgcacgtc 1440 atggccttcg ccgcctgcct ggagccctac accgcctgcg acctggcgcc ccgcgccggc 1500 accaccgacg ccgcgcaccc ggggccgtcc gtggtccccg cgttgcttcc tctgctggca 1560 gggaccttgc tgctgctggg gacggccact gctccctga 1599 <210> 4 <211> 19 <212> DNA <213> Homo sapiens <400> 4 tgttaccgag agcgagagc 19 <210> 5 <211> 18 <212> DNA <213> Homo sapiens <400> 5 gtgggtctct ccgtccag 18 <210> 6 <211> 20 <212> DNA <213> Mus musculus <400> 6 acacatggct ctgtccaaga 20 <210> 7 <211> 20 <212> DNA <213> Mus musculus <400> 7 tcgtgttgca ctggttgaag 20 <210> 8 <211> 21 <212> DNA <213> Homo sapiens <400> 8 gccacatcgc tcagacacca t 21 <210> 9 <211> 20 <212> DNA <213> Homo sapiens <400> 9 gaaggggtca ttgatggcaa 20 <210> 10 <211> twenty two <212> DNA <213> Mouse (Mus musculus) <400> 10 tggcaaagtg gagattgttg cc 22 <210> 11 <211> twenty one <212> DNA <213> Mouse (Mus musculus) <400> 11 aagatggtga tgggcttccc g 21

Claims

1. Use of one or more reagents for determining the expression level of placental-like alkaline phosphatase 2 (ALPPL2) in the preparation of a kit for detecting estrogen-induced cancer in an individual, wherein the kit is used in a method comprising performing the following steps: (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual; and (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer, wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates the presence of estrogen-induced cancer in the individual, The estrogen-induced cancer is early ovarian cancer or early endometrial cancer.

2. The use according to claim 1, wherein determining the expression level of ALPPL2 comprises qualitatively or quantitatively determining the expression of ALPPL2 protein or ALPPL2 mRNA.

3. The use according to claim 1, wherein the method comprises determining a statistical value and comparing the statistical value, the statistical value being derived from the expression level of ALPPL2 in a sample obtained from an individual and in one or more reference samples. The use according to claim 1 , wherein the biological sample obtained from the individual is a blood sample.

5. Use of one or more reagents for determining the expression of placental-like alkaline phosphatase 2 (ALPPL2) in the preparation of a kit for identifying an individual at risk of developing an estrogen-induced cancer, wherein the kit is used in a method comprising the steps of: (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual; and (b) comparing the determined expression level with the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer, wherein an elevated expression level of ALPPL2 in a sample obtained from the individual relative to the expression level of ALPPL2 in one or more reference samples indicates that the individual has an increased risk of developing an estrogen-induced cancer, The estrogen-induced cancer is early ovarian cancer or early endometrial cancer.

6. The use according to claim 1 or 5, wherein the increased expression level of ALPPL2 is positively correlated with estrogen level.

7. Use of one or more reagents for determining the expression of placental-like alkaline phosphatase 2 (ALPPL2) in the preparation of a kit for predicting survival of an individual with an estrogen-induced cancer, wherein the kit is used in a method comprising performing the following steps: (a) determining the expression level of ALPPL2 in a biological sample obtained from an individual; (b) comparing the determined expression level to the expression level of ALPPL2 in one or more reference samples without estrogen-induced cancer; and (c) predicting the survival of the individual based on the determined expression level and the result of the comparison in (b), The estrogen-induced cancer is early ovarian cancer or early endometrial cancer.

Images