Use of single nucleotide polymorphism rs1553607744 in detecting xeroderma pigmentosum gene

Abstract

The application discloses application of single nucleotide polymorphism rs1553607744 in detection of xeroderma pigmentosum gene, and belongs to the technical field of biological medicine; one technical scheme of the application is as follows: application of a substance for detecting polymorphism or genotype of rs1553607744 in XPC gene in preparation of a product for detecting single nucleotide polymorphism related to xeroderma pigmentosum; the substance for detecting the new site rs1553607744 and other substances (such as other substances for detecting single nucleotide polymorphism related to xeroderma pigmentosum) can be combined to detect xeroderma pigmentosum.

Description

Technical Field

[0001] This invention relates to the application of single nucleotide polymorphism rs1553607744 in the detection of xeroderma pigmentosum genes, and belongs to the field of biomedical technology. Background Technology

[0002] Xeroderma pigmentosum (XP) is an autosomal recessive genetic disorder. Patients present with diverse clinical symptoms, most commonly changes affecting the skin, eyes, and nervous system. Typical clinical manifestations include hypersensitivity to sunlight, hyperpigmentation, and susceptibility to photodamage and skin cancer in exposed areas. Skin lesions typically appear between 6 months and 3 years of age, commonly affecting sun-exposed areas such as the face, neck, and extensor surfaces of the forearms. Early lesions may present as freckle-like changes, blisters, depigmentation, dry skin, atrophy, or scarring. Later stages gradually develop into multiple actinic keratosis, keratoacanthoma, and various malignant skin tumors. Patients with xeroderma pigmentosum are approximately 1000 times more likely to develop skin cancer than the general population; almost 90% of patients will develop basal cell carcinoma, squamous cell carcinoma, melanoma, or other skin cancers in their teens.

[0003] Ultraviolet (UV) radiation can induce DNA damage. DNA damage and abnormal gene structure leading to abnormal expression or function of oncogenes and tumor suppressor genes are prerequisites for malignant transformation of cells. DNA damage is mainly repaired through the repair system (nucleotide excision repair and translocation synthesis). DNA repair plays a crucial role in repairing DNA damage and maintaining cellular genetic stability, and is essential for preventing skin cancer. The most important function of nucleotide excision repair is to repair DNA cross-links caused by UV radiation photoproducts, large compounds caused by carcinogens, and chemotherapy drugs. Typically, nucleotide excision repair includes whole genome repair and transcription-coupled repair, with whole genome repair capable of repairing damage across the entire genome. The nucleotide excision repair process includes DNA damage recognition, opening of the DNA strand surrounding the damage, DNA cleavage, synthesis of new complementary DNA strands, and ligation. Defects in genes related to the DNA excision repair system are a major cause of xeroderma pigmentosum; when UV-induced DNA damage occurs, the repair system malfunctions, leading to the disease.

[0004] Eight genes are associated with xeroderma pigmentosum: XPA, XPB, XPC, XPD, XPE, XPF, XPG, and XPV. Currently, most reported patients in my country have the XPC (genomic xeroderma pigmentosum C) type. XPC gene defects are associated with the pigmentary form of xeroderma pigmentosum and increase the risk of skin tumors. The XPC gene is located on chromosome 3 (3p25), consists of 16 exons, and is approximately 17kb in length. It encodes a DNA damage-binding protein in the nucleotide excision repair complex, which is crucial for recognizing and binding DNA photoproducts and is an important component of the XPC complex (XPC-HHR23B). This complex is the initial recognition factor for the entire repair process, recognizing and binding damaged DNA in the early stages of pan-genomic nucleotide excision repair, initiating DNA repair function, and maintaining cellular genetic stability. The level of XPC protein expression is one of the key factors affecting cellular damage recognition.

[0005] Multiple single nucleotide polymorphism sites associated with xeroderma pigmentosum have been found in the XPC gene coding region in the OMIM database. Although some progress has been made in its genetic epidemiology, the pathogenic genes or mutations of many patients have not yet been identified. Summary of the Invention

[0006] The purpose of this invention is to provide a novel application of single nucleotide polymorphism rs1553607744 in products for the detection of xeroderma pigmentosum.

[0007] The new uses described in this invention mainly include:

[0008] (1) Application of substances that detect the polymorphism or genotype of rs1553607744 in the XPC gene in the preparation of products for detecting single nucleotide polymorphisms associated with xeroderma pigmentosum.

[0009] (2) The application of substances that detect the polymorphism or genotype of rs1553607744 in the XPC gene in the preparation of products for identification or auxiliary identification of single nucleotide polymorphisms associated with xeroderma pigmentosum.

[0010] (3) Application of substances that detect polymorphisms or genotypes of rs1553607744 in the XPC gene in the preparation of products for screening xeroderma pigmentosum.

[0011] (4) The application of substances that detect the polymorphism or genotype of rs1553607744 in the XPC gene in the preparation of products for treating xeroderma pigmentosum.

[0012] (5) Application of single nucleotide polymorphism in XPC gene in the preparation of products for detecting xeroderma pigmentosum, wherein the single nucleotide polymorphism is a DNA sequence polymorphism with refSNP ID rs1553607744.

[0013] (6) Application of single nucleotide polymorphism in XPC gene in the preparation of products for identification or auxiliary identification of xeroderma pigmentosum gene: The single nucleotide polymorphism is a DNA sequence polymorphism with refSNP ID rs1553607744.

[0014] (7) Application of the polymorphism of rs1553607744 in the XPC gene in the preparation of screening products for xeroderma pigmentosum.

[0015] (8) Application of the polymorphism of rs1553607744 in the XPC gene in the preparation of products for prenatal screening of xeroderma pigmentosum.

[0016] (9) Products containing substances that detect the polymorphism of rs1553607744 in the XPC gene, including any one of the following products:

[0017] Products for detecting single nucleotide polymorphisms associated with xeroderma pigmentosum;

[0018] Products for identifying or assisting in the identification of single nucleotide polymorphisms associated with xeroderma pigmentosum;

[0019] Products for screening patients with xeroderma pigmentosum;

[0020] Prepare therapeutic products for pigmented xeroderma.

[0021] The substance described in this invention for detecting the polymorphism of rs1553607744 in the XPC gene contains PCR primers for amplifying genomic DNA fragments including rs1553607744.

[0022] In an embodiment of the present invention, the xeroderma pigmentosum specifically refers to a Chinese Han Chinese xeroderma pigmentosum family.

[0023] The locus rs1553607744 is a diallelic SNP locus (GRCh37.p13chr) on human chromosome 3. 3NC_000003.11:g.14214366C>T); The rs1553607744 site on the genomic DNA is located at the first base of the intron following the last base 299 of the second exon of the XPC gene (NM_004628:exon2:c.299+1G>A), located in the splice region; the variation at the rs1553607744 site is a substitution (C / T, or G / A on its complementary strand); the genotype of the rs1553607744 site is CC, CT, or TT; CC is the wild-type homozygous rs1553607744 site, CT is the mutant heterozygous rs1553607744 site, and TT is the mutant homozygous rs1553607744 site.

[0024] This invention demonstrates, through whole-exome sequencing analysis of patient genes, the impact of mutated splicing sites on XPC gene mRNA transcripts, and XPC protein expression, that the polymorphism of rs1553607744 is associated with xeroderma pigmentosum.

[0025] The beneficial effects of this invention are as follows: This invention, through exon sequencing, DNA and transcript Sanger sequencing analysis, and immunoblotting analysis of xeroderma pigmentosum pedigrees, identified a pathogenic single nucleotide variant site, rs1553607744, on the C-XPC gene in the xeroderma pigmentosum genome. This variant site is located in the intron region following exon 2 of the XPC gene, possesses selective splicing function, and is associated with truncated transcripts and prematurely terminated proteins of this gene.

[0026] Experiments have shown that the C-base substitution for T in rs1553607744 is associated with a truncated transcript of the XPC gene, which is caused by a 68-base deletion in the second exon of the XPC gene (NM_004628.5:c.265_332del). This truncated transcript can affect XPC protein expression. The sequence deletion causes an early stop codon in the second exon, leading to premature termination of XPC protein translation. XPC protein deficiency can cause xeroderma pigmentosum.

[0027] Diagnostic primers were designed targeting the coding region sequence of this gene, and a detection kit was invented for PCR in vitro DNA amplification combined with Sanger sequencing to detect the genotyping of the rs1553607744 locus of the XPC gene in xeroderma pigmentosum. This kit can be applied to clinical gene diagnosis of the disease and early pregnancy screening. The recessive homozygous mutant (TT) at the rs1553607744 locus can affect alternative splicing function, producing truncated transcripts and generating premature stop codons during translation of exon 2, leading to XPC protein deficiency and causing xeroderma pigmentosum. The heterozygous mutant CT at the rs1553607744 locus can combine with other heterozygous mutations on XPC that affect XPC protein expression and function to form a compound heterozygous mutation, resulting in xeroderma pigmentosum. Therefore, substances detecting this new locus and other loci (such as rs121965088 in Example 1) can be used in combination to detect xeroderma pigmentosum. Attached Figure Description

[0028] Figure 1 A family pedigree chart of patients with xeroderma pigmentosum;

[0029] Figure 2 Sanger sequencing results of the XPC gene rs121965088 on chromosome 3 in individuals from the XP family;

[0030] Figure 3 Sanger sequencing results of the XPC gene rs1553607744 on chromosome 3 in individuals from the XP family;

[0031] Figure 4 Electrophoretic pattern of PCR products containing the rs1553607744 site, amplified from the reverse transcribed cDNA of peripheral blood leukocytes of individuals in the XP family.

[0032] Figure 5 Sanger sequencing results of PCR products containing the rs1553607744 site from cDNA amplified by reverse transcription from peripheral blood leukocytes of individuals in the XP family.

[0033] Figure 6 Western blot results of XPC protein in XP families and healthy controls. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to specific embodiments, but the scope of protection of the present invention is not limited to the content described.

[0035] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Informed consent was obtained from all patients and healthy controls in this invention.

[0036] Example 1

[0037] I. The discovery process of the two mutation sites on the XPC gene:

[0038] The patient (II:2) developed recurrent freckle-like pigmented spots on her face starting at 8 months of age. Examination revealed densely distributed brownish freckle-like pigmented rashes on her face, neck, and other sun-exposed areas, along with generalized dry skin. Her 10-year-old sister (II:1) exhibited similar clinical features and had a 0.5cm × 1cm pigmented nodule on her right nose, which, upon skin biopsy, was diagnosed as basal cell carcinoma. The parents (I:1, I:2) were healthy and showed no similar clinical manifestations. Based on the early appearance of photosensitivity, freckle-like rashes, and the gradual development of skin tumors, the clinical diagnosis was xeroderma pigmentosum. The family pedigree is shown below. Figure 1 As shown.

[0039] To detect genetic mutations in this family, the present invention performed whole-exome sequencing analysis and a series of related experimental analyses on the family.

[0040] II. Whole-exome sequencing analysis

[0041] Genomic DNA was extracted from peripheral blood of each family member, standardized, and then efficiently enriched in whole-exon regions using a liquid-phase microarray capture system. After the constructed library passed library testing, high-throughput sequencing was performed. The sequencing data, after quality assessment, were used to detect variants, screen variants, and predict their association with xeroderma pigmentosum using the GRCh37 / hg19 reference genome. Since this family conforms to a recessive genetic pattern, the pathogenic variants are generally homozygous or compound heterozygous variants from both parents. Based on Mendelian recessive genetic disease patterns, this invention screened for mutations in four samples from this family, including homozygous and compound heterozygous variants from both parents. The results showed no homozygous variants conforming to the recessive inheritance pattern, but two compound heterozygous variants located in the XPC gene were identified, as shown in Table 1.

[0042] Table 1 shows the compound heterozygous variants of two genes located in the XPC gene.

[0043] III. Sanger sequencing validates two heterozygous mutation sites on the XPC gene in the family.

[0044] rs121965088 is a biallelic polymorphic SNP site on human chromosome 3 (GRCh37.p13chr3,NC_000003.11:g.14199648G>A); the variant is a substitution (G / A, and C / T on its complementary strand). The rs121965088 genotype is GG, GA, or AA; GG is the wild-type homozygous genotype at the rs121965088 locus, GA is the mutant heterozygous genotype at the rs121965088 locus, and AA is the mutant homozygous genotype at the rs121965088 locus; the replacement of the major allele G with the minor allele A on the genomic DNA of rs121965088 can lead to the replacement of the C base at position 1735 of exon 9 of the cDNA transcribed from the XPC gene with T, resulting in a mutation of the 579th amino acid Arg in the XPC-encoded protein into a stop codon (XPC:NM_004628:exon9:c.C1735T:p.R579X2); in recessive xeroderma pigmentosum, the mutant homozygous genotype AA is the pathogenic genotype of xeroderma pigmentosum at the rs121965088 locus.

[0045] To verify the mutation at the rs121965088 site on genomic DNA, this invention designed specific primers covering the DNA fragment containing this site for amplification. The primer sequences are rs121965088-F: ACCTGGGCTCAAGCACCG (Sequence 1 in the sequence listing); rs121965088-R: GTGGGAGCCATCGTAAGGAC (Sequence 2 in the sequence listing), with a product size of 631 bases. Using genomic DNA from four family members as templates, polymerase chain reaction (PCR) amplification was performed under the conditions shown in Table 2. The PCR products were purified and then sequenced using Sanger sequencing. The sequences were compared with the standard XPC gene sequence to determine the genotype of the rs121965088 site.

[0046] The results showed that the rs121965088 genotype at the rs121965088 locus was heterozygous mutant (GA) in healthy individuals I:1, patients II:1, and II:2, while the genotype at this locus in healthy individual I:1 was wild-type homozygous (GG). Figure 2 As shown, the heterozygous mutant at the rs121965088 site does not directly cause disease; therefore, this invention further investigated another mutation site on XPC.

[0047] Table 2 lists the conditions for the PCR amplification process.

[0048] To verify the genotyping of rs1553607744 in individuals within a family, this invention designed specific primers covering the DNA fragment containing this locus for amplification. The primer sequences are rs1553607744-F: CGTGCTTGGGACAGTAAGTATGAG (Sequence 3 in the sequence listing); rs1553607744-R: CCTCACCTTATGTTCTGTGTTGTC (Sequence 4 in the sequence listing); the product size is 578 bases. Using genomic DNA from four members of the family as templates, PCR amplification and Sanger sequencing were performed. Sequence alignment confirmed the genotyping of the rs1553607744 locus in different individuals. The results showed that in family I:2, II:1, and II:2, the genotype was heterozygous CT, while in family I:1, the genotype was wild-type homozygous CC. Figure 3 As shown. This site is predicted to be a splice site region variant; however, the impact of the rs1553607744 mutation on the XPC gene transcript, XPC protein, and xeroderma pigmentosum is currently unknown.

[0049] IV. Analysis of the effect of the splice site mutation rs1553607744 on XPC gene mRNA transcripts

[0050] To analyze the effect of the rs1553607744 (NM_004628:exon2:c.299+1G>A) mutation in the splice region on the XPC gene mRNA transcript, peripheral blood leukocytes were isolated from four individuals in this family. Total RNA was extracted and converted to cDNA. PCR amplification was performed using primers covering exon 2 of the XPC mRNA (XPC-cDNA-F: AGCCAGAAATCCAAGGCCAA (Sequence 5 in the sequence listing); XPC-cDNA-R: GTGAACCTTGTGTGTGTCCTC (Sequence 6 in the sequence listing). The expected size of the wild-type transcript amplification product was 575 bp. The amplification products were electrophoresed on a 2% agarose gel. Figure 4 As shown, the results revealed that in individuals I:2, II:1, and II:2 carrying the splice site mutation, the amplification product of the mRNA encoded by this gene produced a band of approximately 500 bp in addition to the expected size band; while individuals I:1 and healthy controls (NC) from outside the family only amplified one band of the expected size, with no other transcript bands; the results suggest that the heterozygous rs1553607744 mutation carried by I:2, II:1, and II:2 produced a truncated XPC transcript.

[0051] V. Sanger sequencing analysis of the XPC truncated transcript generated by the splice site mutation rs1553607744

[0052] To analyze the sequence deletion of the truncated XPC transcript generated by the mutant splicing of rs1553607744, total RNA was extracted from peripheral blood leukocytes of four individuals in the aforementioned family. After being reverse-engineered into cDNA, the PCR products amplified using the primers XPC-cDNA-F:AGCCAGAAATCCAAGGCCAA (sequence 3 in the sequence listing) and XPC-cDNA-R:GTGAACCTTGTGTGTGTCCTC (sequence 4 in the sequence listing) were ligated into a T-vector and sent for cloning and Sanger sequencing analysis. Sequencing samples included I:1, I:2, II:1, and II:2; each sample underwent sequencing and identification of at least five clones. Figure 5 As shown, the results indicated that in samples I:2, II:1, and II:2, there was a deletion of 68 bases in the second exon sequence of the XPC gene (NM_004628.5:c.265_332del). The XPC amplification product from sample I:1 in the family was wild-type, with no sequence deletion. To further clarify the impact of this base deletion on amino acid and protein coding, this invention analyzed the reading frames of the truncated XPC transcript and found that the sequence deletion led to premature termination of the stop codon, which in turn caused premature termination of XPC protein translation.

[0053] VI. Detection of XPC protein expression in family members

[0054] Since patients II:1 and II:2 in this family did not carry homozygous mutations at the rs121965088 or rs1553607744 sites, but instead carried heterozygous GA (from the father) and CT (from the mother) heterozygous CT (from the mother), respectively, it was determined whether the compound heterozygous mutations affected XPC protein expression. To detect XPC protein expression in the family, this invention used peripheral blood leukocytes from individual samples to perform Western blot analysis of XPC protein. Total protein was extracted from peripheral blood leukocytes of the family individuals, and XPC protein expression was detected using Western blot with β-actin as an internal control. Figure 6 As shown, the results indicated that compared to normal individuals, XPC protein was almost not expressed in II:1 and II:2 samples carrying a compound heterozygous mutation; XPC protein was expressed in small amounts in I:2 samples carrying only a heterozygous splicing mutation; and XPC protein was reduced in I:1 samples carrying a heterozygous mutation in exon 9. The heterozygous mutation XPC:NM_004628:exon9:c.C1735T:p.R579X2 in the XPC gene of this family resulted in the premature stop codon in exon 9 of the transcript; this mutation in II:1 and II:2 of the family originated from I:1. The heterozygous mutation NM_004628:exon2:c.299+1G>A in the XPC gene resulted in the premature stop codon in exon 2 of the XPC gene transcript; this mutation in II:1 and II:2 of the family originated from I:2. In this family, two compound heterozygous mutations in the DNA damage repair gene XPC resulted in the loss of protein expression; after ultraviolet radiation induced DNA damage, the repair system was impaired, leading to the disease in the family.

[0055] In summary, the homozygous mutant (TT) at the rs1553607744 site can produce truncated mRNA through selective splicing, leading to premature protein termination and XPC protein deficiency. The absence of XPC expression prevents the XPC complex from recognizing and binding to UV-induced DNA damage, affecting nucleotide excision repair function and thus triggering xeroderma pigmentosum.

[0056] Summary analysis: The homozygous recessive mutant (TT) at rs1553607744 can affect alternative splicing function, producing transcripts with a 68-base deletion and generating a premature stop codon during translation of exon 2, leading to XPC protein deficiency and xeroderma pigmentosum. Furthermore, the heterozygous mutant (CT) at rs1553607744 can also form a complex heterozygous mutation with other heterozygous mutant sites affecting the XPC protein, resulting in XPC protein deficiency and impaired nucleotide excision repair function, thus causing xeroderma pigmentosum. SEQUENCE LISTING <110> The First Affiliated Hospital of Kunming Medical University <120> Application of single nucleotide polymorphism rs1553607744 in detecting xeroderma pigmentosum gene <130> 20201230 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 18 <212> DNA <213> Artificial synthesis <400> 1 acctgggctc aagcaccg 18 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 gtgggagcca tcgtaaggac 20 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 cgtgcttggg acagtaagta tgag 24 <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <400> 4 cctcacctta tgttctgtgt tgtc 24 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 agccagaaat ccaaggccaa 20 <210> 6 <211> twenty one <212> DNA <213> Artificial sequence <400> 6 gtgaaccttg tgtgtgtcct c 21

Claims

1. Application of substances that detect the polymorphism or genotype of rs1553607744 in the XPC gene in the preparation of products for detecting single nucleotide polymorphisms associated with xeroderma pigmentosum.

2. Application of substances that detect the polymorphism or genotype of rs1553607744 in the XPC gene in the preparation of products for identification or auxiliary identification of single nucleotide polymorphisms associated with xeroderma pigmentosum.

3. Application of detecting polymorphisms or genotypes of rs1553607744 in the XPC gene in the preparation of products for screening xeroderma pigmentosum.

Images