Dry powder formulation of messenger RNA

By adding polymer to the mRNA and lipid nanoparticles mixture and spray drying, the problem of unstability of mRNA during spray drying is solved, and the high stability and efficient delivery of mRNA are achieved.

CN112638362BActive Publication Date: 2025-06-13TRANSLATE BIO INC
View PDF 43 Cites 0 Cited by

Patent Information

Application Number
CN201980056886.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2018-07-23
Filing Date
2019-07-23
Publication Date
2025-06-13
Estimated Expiration
2039-07-23

AI Technical Summary

Technical Problem

The mRNA encapsulated by existing lipid nanoparticles is unstable during spray drying, resulting in uneven particle characteristics and poor yields of the preparation.

Method used

The polymer is added to the mRNA and lipid nanoparticles mixture, and a dry powder preparation is formed through the spray drying process to prevent the aggregation of lipid nanoparticles and maintain the stability of the mRNA.

Benefits of technology

High stability of mRNA and high LNP encapsulation efficiency are achieved, ensuring long-term storage and efficient delivery of dry powder preparations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN112638362B_ABST
    Figure CN112638362B_ABST
Patent Text Reader

Abstract

The present invention provides stable dry powder messenger RNA formulations for therapeutic use, as well as methods for their preparation and use.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 702,193, filed Jul. 23, 2018; the provisional patent application is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on Jul. 19, 2019, is named MRT_2008WO_SeqListing.txt and is 1,137 bytes in size. Background of the Invention

[0005] Messenger RNA therapy (MRT) is becoming an increasingly important approach for treating a variety of diseases. Lipid - encapsulated mRNA formulations, such as lipid nanoparticle (LNP) compositions, exhibit high levels of cellular uptake and protein expression. However, currently these formulations are generally in liquid form and require administration typically by injection or via a nebulizer. These modes of administration are less desirable to patients compared to some less invasive routes (e.g., metered - dose inhalers). Lyophilized formulations sometimes do not provide reliable particle uniformity in the dry state or are difficult to handle and dispense. The lyophilized powder must be dissolved in a suitable solvent before being administered to a patient and can degrade within a few hours. Repeated freeze - thawing of mRNA preparations is not recommended as it can lead to instability of the mRNA and / or LNP. Summary of the Invention

[0006] The present invention particularly provides a dry powder (i.e., spray-dried) formulation of lipid-based nanoparticle-encapsulated mRNA for more efficient mRNA delivery and more efficient mRNA therapies. Prior to the present invention, one of the challenges of spray-drying lipid nanoparticle-encapsulated mRNA has arisen from the fact that both mRNA and lipid nanoparticle components are structurally unstable at the high temperatures and / or pressures required for proper spray-drying. For example, the inlet temperature of a spray dryer ranges between 80°C and 98°C. At or near the nozzle, the lipids tend to melt and / or aggregate at the high inlet temperatures. This impedes the flow of the formulation through the nozzle into the drying chamber, disrupts the uniform dispersion of the spray, and results in undesirable particle characteristics and poor yields. The present invention has unexpectedly solved this problem by adding a polymer to the mRNA and lipid nanoparticle mixture and then subjecting the mixture to a spray-drying process. As described herein, the inventors have observed that adding a polymer to the mRNA and lipid mixture can effectively prevent aggregation of the lipid nanoparticles and facilitate the formation of a dry powder of fine particles containing mRNA-loaded lipid nanoparticles suitable for inhalation.

[0007] Even more unexpectedly, although the nature of mRNA is extremely unstable, the dry powder formulation prepared according to the present invention is stable even at the high temperatures and / or pressures associated with spray-drying and is capable of maintaining a high degree of mRNA integrity even after long-term storage at various temperatures. In addition, the dry powder formulation prepared according to the present invention is also characterized by a high LNP encapsulation efficiency of mRNA, resulting in a high cellular delivery rate of mRNA. Thus, the present invention meets the long-standing need in the field of mRNA therapies for a stable dry powder form of an mRNA therapeutic agent that can be easily stored, transported, and dispensed. In addition, the dry powder formulation of mRNA according to the present invention can be administered to a patient in dry powder form (e.g., in a metered dose) or weighed out and reconstituted in a single-use amount without the need to freeze single-use liquid aliquots.

[0008] In one aspect, the present invention provides a dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, the particles comprising mRNA encoding a protein or peptide, one or more lipids, and one or more polymers.

[0009] In another aspect, the present invention provides a dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, the particles comprising one or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a peptide or polypeptide and one or more polymers.

[0010] In yet another aspect, the present invention provides a dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, the particles comprising one or more nanoparticles encapsulating mRNA encoding a peptide or polypeptide, the nanoparticles comprising one or more lipids and one or more polymers.

[0011] In yet another aspect, the present invention provides a dry powder formulation for delivering cystic fibrosis transmembrane conductance regulator (CFTR) messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, the particles comprising mRNA encoding the CFTR protein, one or more lipids, and one or more polymers. In some embodiments, one or more lipids form one or more lipid nanoparticles (LNPs) encapsulating mRNA encoding the CFTR protein. In some embodiments, one or more lipids and one or more polymers form one or more nanoparticles encapsulating mRNA encoding the CFTR protein.

[0012] As used herein, lipid nanoparticles (LNPs) encompass nanoparticles formed by lipids, as well as nanoparticles formed by both lipids and polymers. In some embodiments, nanoparticles formed by both lipids and polymers are referred to as lipid-polymer nanoparticles.

[0013] In some embodiments, the mRNA (e.g., CFTR mRNA) has an integrity of 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher. In some embodiments, the mRNA (e.g., CFTR mRNA) has an integrity of 90% or higher. In some embodiments, the mRNA (e.g., CFTR mRNA) has an integrity of 95% or higher. In some embodiments, the mRNA (e.g., CFTR mRNA) has an integrity of 98% or higher.

[0014] In some embodiments, the mRNA maintains an integrity of 90% or higher after storage at room temperature or below for 6 months or longer. In some embodiments, the mRNA maintains an integrity of 95% or higher after storage at room temperature or below for 6 months or longer. In some embodiments, the mRNA maintains an integrity of 98% or higher after storage at room temperature or below for 6 months or longer.

[0015] In some embodiments, after spray drying and storage at room temperature or below for three months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at room temperature or below for six months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at room temperature or below for nine months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at room temperature or below for twelve months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at 4 °C or below for three months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at 4 °C or below for six months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at 4 °C or below for nine months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after spray drying and storage at 4 °C or below for twelve months or longer, the mRNA maintains or is greater than 90% integrity. In some embodiments, after storage at room temperature or below for 3 months or longer, 6 months or longer, 9 months or longer, or 12 months or longer, the mRNA maintains or is greater than 95% integrity. In some embodiments, after storage at 4 °C or below for 3 months or longer, 6 months or longer, 9 months or longer, or 12 months or longer, the mRNA maintains or is greater than 95% integrity.

[0016] In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the plurality of spray-dried particles are part of the fine particles. In some embodiments, at least 20% of the plurality of spray-dried particles are part of the fine particles.

[0017] In some embodiments, the fine particles have a volume median diameter of 5 microns or less. In some embodiments, the fine particles have a volume median diameter of 4 microns or less. In some embodiments, the fine particles have a volume median diameter of 3 microns or less. In some embodiments, the fine particles have a volume median diameter of 2 microns or less. In some embodiments, the fine particles have a volume median diameter of 1 micron or less.

[0018] In some embodiments, the plurality of spray-dried particles have an average sphericity greater than 0.6, greater than 0.7, greater than 0.8, or greater than 0.9. In some embodiments, the plurality of spray-dried particles have a Z-average particle size less than 3,000 nm, 2,500 nm, 2,000 nm, 1,500 nm, 1,000 nm, or 500 nm.

[0019] In some embodiments, the plurality of spray-dried particles have a residual moisture content less than 20%, less than 18%, less than 16%, less than 14%, less than 12%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1%.

[0020] In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is inhaled as a dry powder in a metered-dose inhaler. In some embodiments, the dry powder formulation is reconstituted with a diluent and administered by nebulization.

[0021] In some embodiments, one or more polymers comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the combined weight of the lipids and polymers. In some embodiments, one or more polymers comprise about 10%-90%, 10%-80%, 10%-70%, 10%-60%, 10%-50%, 10%-40%, 10%-30%, 10%-20%, 15%-20%, 15%-25%, 15%-30%, 15%-35%, 15%-40%, 15%-45%, 15%-50%, 15%-55%, 15%-60%, 15%-65%, 15%-70%, 15%-75%, 15%-80%, or 15%-90% of the combined weight of the lipids and polymers. In some embodiments, one or more polymers comprise no more than 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the combined weight of the lipids and polymers.

[0022] In some embodiments, one or more polymers account for at least 50% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 40% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 30% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 20% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 15% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 12% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 10% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 9% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 8% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 7% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 6% of the total weight of the dry powder. In some embodiments, one or more polymers account for at least 5% of the total weight of the dry powder.

[0023] In some embodiments, one or more polymers are selected from the group consisting of: chitosan, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) copolymer (PLGA), poly(ε-caprolactone) (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline) acrylate, modified acrylate and polymethacrylate-based polymers, poly-N-(2-hydroxypropyl) methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethyl methacrylate) (pDMAEMA).

[0024] In some embodiments, one or more polymers include a polymethacrylate-based polymer. In some embodiments, one or more polymers include Eudragit EPO.

[0025] In some embodiments, one or more LNPs encapsulating mRNA (also referred to as mRNA-loaded LNPs) have a lipid:mRNA (N / P) ratio in the range of 1 - 20, 1 - 15, 1 - 10, 2 - 8, 2 - 6, or 2 - 4. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 18. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 14. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 10. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 8. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 1 to 6. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 8. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 6. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 2 to 4. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4 to 14.In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4 to 10. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2 or 4. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 4.

[0026] In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 70% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 75% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 80% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 85% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 90% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 92% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 94% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 95% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 96% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 97% or higher. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 98% or higher.

[0027] In some embodiments, one or more lipids include a cationic lipid. In some embodiments, the cationic lipid is selected from the group consisting of: C12-200, DOTAP (1,2-dioleoyl-3-trimethylammonium propane), DODAP (1,2-dioleoyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.

[0028] In some embodiments, the one or more mRNA-loaded lipid nanoparticles comprise one or more cationic lipids. In some embodiments, the one or more cationic lipids include ionizable cationic lipids. In some embodiments, the one or more cationic lipids include the cationic lipid C12-200. In some embodiments, the one or more cationic lipids include the cationic lipid DOTAP (1,2-dioleoyl-3-trimethylammonium propane). In some embodiments, the one or more cationic lipids include the cationic lipid DODAP (1,2-dioleoyl-3-dimethylammonium propane). In some embodiments, the one or more cationic lipids include the cationic lipid DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane). In some embodiments, the one or more cationic lipids include the cationic lipid DLinDMA. In some embodiments, the one or more cationic lipids include the cationic lipid DLin-KC2-DMA. In some embodiments, the one or more cationic lipids include the cationic lipid HGT-5000. In some embodiments, the one or more cationic lipids include the cationic lipid HGT-5001. In some embodiments, the one or more cationic lipids include the cationic lipid HGT-5002. In some embodiments, the one or more cationic lipids include the cationic lipid cKK-E12. In some embodiments, the one or more cationic lipids include the cationic lipid OF-02. In some embodiments, the one or more cationic lipids include the cationic lipid Target 23. In some embodiments, the one or more cationic lipids include the cationic lipid Compound 1. In some embodiments, the one or more cationic lipids include the cationic lipid Compound 2. In some embodiments, the one or more cationic lipids include the cationic lipid Compound 3. In some embodiments, the one or more cationic lipids include the cationic lipid HGT4001. In some embodiments, the one or more cationic lipids include the cationic lipid HGT4002. In some embodiments, the one or more cationic lipids include the cationic lipid HGT4003. In some embodiments, the one or more cationic lipids include the cationic lipid HGT4004. In some embodiments, the one or more cationic lipids include the cationic lipid HGT4005. In some embodiments, the one or more cationic lipids include the cationic lipid 18:1 carbon tail ribo lipid. In some embodiments, the one or more cationic lipids include the cationic lipid ICE.

[0029] In some embodiments, on a molar basis, the cationic lipid accounts for about 25%-50% of the total lipids in the LNP.

[0030] In some embodiments, one or more lipids include PEGylated lipids. In some embodiments, one or more mRNA-loaded lipid nanoparticles comprise one or more PEGylated lipids. In some embodiments, one or more PEGylated lipids comprise a poly(ethylene glycol) chain up to 5 kDa in length, the poly(ethylene glycol) chain being covalently linked to a lipid comprising one or more alkyl chains of length C6-C20. In some embodiments, one or more PEGylated lipids account for at most 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (in molar concentration) of the total lipids in the LNP. In some embodiments, in molar concentration, the PEGylated lipids account for about 1%-15% of the total lipids in the LNP. In some embodiments, in molar concentration, the PEGylated lipids account for at least 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, or 12% of the total lipids in the LNP.

[0031] In some embodiments, suitable LNPs according to the present invention are dual-lipid component LNPs.

[0032] In some embodiments, one or more lipids do not include neutral lipids or cholesterol-based lipids.

[0033] In some embodiments, one or more lipids further include neutral lipids and / or cholesterol-based lipids. In some embodiments, one or more lipids further include neutral lipids.

[0034] In some embodiments, suitable LNPs according to the present invention are triple-lipid component LNPs.

[0035] In some embodiments, the dry powder formulation according to the present invention further comprises at least one sugar. In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, mannitol, and combinations thereof. In some embodiments, the sugar is mannitol. In some embodiments, the sugar accounts for less than 30%, 25%, 20%, 15%, 10%, or 5% of the total weight.

[0036] In some embodiments, the dry powder formulation according to the present invention further comprises pharmaceutically acceptable excipients consisting of the group: esters, carbamates, phosphates, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

[0037] In some embodiments, suitable surfactants are selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glyceryl monostearate, glyceryl monolaurate, sorbitan monolaurate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucoside, and poloxamer (e.g., poloxamer 407). In some embodiments, the suitable surfactant is poloxamer.

[0038] In some embodiments, the dry powder formulation according to the present invention further contains a pharmaceutically acceptable excipient. In some embodiments, pharmaceutically acceptable excipients are selected from the group consisting of esters, carbamates, phosphates, phosphonitriles, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

[0039] In some embodiments, the dry powder formulation according to the present invention contains a surfactant. In some embodiments, surfactants are selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glyceryl monostearate, glyceryl monolaurate, sorbitan monolaurate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucoside, and copolymers. In some embodiments, the surfactant is poloxamer. In some embodiments, the surfactant is a poloxamer triblock copolymer consisting of a central hydrophobic polypropylene glycol block flanked by two hydrophilic polyethylene glycol (PEG) blocks. In some embodiments, the surfactant is poloxamer 407.

[0040] In some embodiments, the mRNA comprises up to 10% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 9% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 8% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 7% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 6% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 5% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 4% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 3% of the total weight of the dry powder. In some embodiments, the mRNA comprises up to 2% of the total weight of the dry powder. In some embodiments, the mRNA comprises 1%-10% of the total weight of the dry powder. In some embodiments, the mRNA comprises 1%-6% of the total weight of the dry powder. In some embodiments, the mRNA comprises 1%-5% of the total weight of the dry powder. In some embodiments, the mRNA comprises 1%-4% of the total weight of the dry powder. In some embodiments, the mRNA comprises 1%-3% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-10% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-9% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-8% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-7% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-6% of the total weight of the dry powder. In some embodiments, the mRNA comprises 2%-5% of the total weight of the dry powder. In some embodiments, the mRNA is unmodified. In some embodiments, the mRNA contains one or more modified nucleotides.

[0041] In some embodiments, the mRNA encodes a peptide. In some embodiments, the mRNA encodes a therapeutic protein. In some embodiments, the therapeutic protein is CFTR.

[0042] In some embodiments, the CFTR mRNA comprises about 1%-20%, 1%-15%, 1%-10%, 1%-8%, 1%-6%, 1%-5%, 5%-15% or 5%-10% of the total weight of the spray-dried particles. In some embodiments, the CFTR mRNA comprises about 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5% or 15% of the total weight of the spray-dried particles.

[0043] In another aspect, the present invention provides a method for delivering cystic fibrosis transmembrane conductance regulator (CFTR) messenger ribonucleic acid (mRNA) for in vivo expression, the method comprising the step of administering the dry powder formulation described herein to a subject in need thereof. In some embodiments, the dry powder formulation described herein is administered by pulmonary delivery. In some embodiments, the dry powder formulation is administered by inhalation.

[0044] In another aspect, the present invention provides a method for delivering cystic fibrosis transmembrane conductance regulator (CFTR) messenger ribonucleic acid (mRNA) for in vivo expression, the method comprising the steps of: reconstituting the dry powder formulation described herein into a liquid solution; and administering the reconstituted liquid solution to a subject in need thereof. In some embodiments, the reconstituted liquid solution is administered by nebulization. In some embodiments, the subject has cystic fibrosis.

[0045] In another aspect, the present invention provides a method for manufacturing a dry powder formulation, the method comprising providing a mixture comprising mRNA, one or more lipids, and a polymer; and spray-drying the mixture to form a plurality of particles.

[0046] In some embodiments, before adding the polymer, one or more lipids are first mixed with mRNA to form mRNA-loaded lipid nanoparticles.

[0047] In some embodiments, the method according to the present invention further comprises adding one or more excipients to the mixture before spray-drying.

[0048] In some embodiments, the plurality of spray-dried particles are characterized by one or more of the following: a) a moisture content of less than 10%; b) a volume median diameter of a portion of the fine particles of less than 5 microns; c) a Z-average particle size in the range of 10 - 3000 nm; d) an N / P ratio in the range of 1 to 20; e) an mRNA encapsulation efficiency of greater than 80%; and f) an mRNA integrity of greater than 95%.

[0049] In yet another aspect, the present invention provides a method for in vivo delivery of mRNA, the method comprising administering the dry powder formulation described herein to a subject in need thereof. In some embodiments, the dry powder formulation is administered via an oral, nasal, tracheal, pulmonary, or rectal route. In some embodiments, the dry powder formulation is administered by inhalation. In some embodiments, the dry powder formulation is administered by nasal spray. In some embodiments, the formulation is administered by a metered-dose inhaler. In some embodiments, the formulation is administered by a nebulizer.

[0050] In another aspect, the present invention provides a method for delivering cystic fibrosis transmembrane conductance regulator (CFTR) messenger ribonucleic acid (mRNA) for in vivo expression, the method comprising the step of administering the dry powder formulation described herein to a subject in need thereof.

[0051] In yet another aspect, the present invention provides a method of treating a disease or disorder in a patient by administering an effective dose of the mRNA in the dry powder formulation described herein to the patient. In some embodiments, the disease or disorder is selected from cystic fibrosis; asthma; chronic obstructive pulmonary disease (COPD); emphysema; primary ciliary dyskinesia (CILD1) with or without situs inversus, or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-linked); autosomal recessive cytochrome b-positive granulomatous disease; surfactant deficiency, pulmonary surfactant metabolism dysfunction 1, pulmonary surfactant metabolism dysfunction 2, pulmonary surfactant metabolism dysfunction 3; respiratory distress syndrome of premature infants; tuberculosis, pulmonary viral diseases, including influenza, respiratory syncytial virus (RSV).

[0052] Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.

[0053] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.

[0054] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and together with the description serve to explain the principles of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The drawings are for illustrative purposes only and are not limiting.

[0056] Figure 1 An exemplary illustration of the spray drying technique for the mRNA formulation is shown.

[0057] Figure 2 The percentage of recovery of LNP-encapsulated mRNA material after spray drying is shown in the absence and presence of polymer in the formulation.

[0058] Figure 3 The spectrophotometric analysis of the mRNA reference for integrity assessment is depicted.

[0059] Figure 4 Depicts exemplary data that shows the integrity of mRNA after extraction from lipid nanoparticles.

[0060] Figure 5 Depicts exemplary data that shows the integrity of mRNA encapsulated in LNP in a formulation with a polymer, two weeks after spray drying and storage at 4°C.

[0061] Figure 6 Depicts exemplary data that shows the integrity of mRNA encapsulated in LNP in a formulation with a polymer, two weeks after spray drying and storage at -20°C.

[0062] Figure 7 Depicts exemplary data that shows that storage temperature has no effect on the integrity of mRNA encapsulated in LNP in a formulation with a polymer, and after two weeks of storage after spray drying.

[0063] Figure 8 Depicts exemplary data that shows the integrity of mRNA encapsulated in LNP in a formulation with a polymer, four weeks after spray drying and storage at 4°C.

[0064] Figure 9 Depicts exemplary data that shows the integrity of mRNA encapsulated in LNP in a formulation with a polymer, four weeks after spray drying and storage at -20°C.

[0065] Figure 10 Depicts exemplary data that shows the integrity of mRNA in a formulation with a polymer (without LNP), three weeks after spray drying and storage at 4°C.

[0066] Figure 11 Depicts exemplary data that shows the integrity of mRNA in a formulation with a polymer (without LNP), three weeks after spray drying and storage at -20°C.

[0067] Figure 12 Depicts exemplary data that shows that storage temperature has no effect on the integrity of mRNA formulated with a polymer (without LNP), and after three weeks of storage after spray drying.

[0068] Figure 13 Depicts exemplary data that shows the integrity of mRNA in a formulation with a polymer (without LNP), five weeks after spray drying and storage at 4°C.

[0069] Figure 14Depicts exemplary data that show the integrity of mRNA in a formulation with a polymer (without LNP) after spray drying and five weeks of storage at -20°C.

[0070] Figure 15A and Figure 15B Shows exemplary in vivo mRNA expression measured by bioluminescence after administration of an mRNA spray-dried preparation in mice. 1 mg of luciferase mRNA was administered. For Figure 15A , the mRNA was administered in dry powder form. For Figure 15B , the mRNA was administered in liquid form after the dry powder was dissolved in water.

[0071] Figure 16A1 - A6 depicts exemplary capillary electrophoresis chromatograms that show the integrity of CFTR mRNA after spray drying. Figures 16A1 - A3 depict control CFTR mRNA that was neither spray dried nor encapsulated, while Figures 16A4 - A6 depict CFTR mRNA extracted from the spray-dried formulation.

[0072] Definitions

[0073] To make the present invention more readily understandable, certain terms are first defined below. The following terms and other definitions of other terms are set forth throughout the specification.

[0074] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, an animal can be a transgenic animal, a genetically engineered animal, and / or a clone.

[0075] About or approximately: As used herein, when applied to one or more target values, the term "about" or "approximately" refers to a value similar to the reference value. In certain embodiments, the term "about" or "approximately" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the stated value, unless otherwise specified or otherwise apparent from the context (unless the number exceeds 100% of the possible value).

[0076] Delivery: As used herein, the term "delivery" encompasses local delivery and systemic delivery. For example, delivery of mRNA encompasses cases in which the mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also referred to as "local distribution" or "local delivery"), and cases in which the mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), and is systemically distributed and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0077] Encapsulation: As used herein, the term "encapsulation" or grammatical equivalents refers to the process of confining individual mRNA molecules within nanoparticles.

[0078] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into a complete protein (e.g., an enzyme) and / or post-translational modification of the polypeptide or fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production" and grammatical equivalents thereof are used interchangeably.

[0079] Improve, increase, or decrease: As used herein, the terms "improve", "increase", or "decrease" or grammatical equivalents refer to a value relative to a baseline measurement, such as a measurement in the same individual prior to the start of treatment as described herein, or a measurement in a control subject (or control subjects) in the absence of the treatment as described herein. A "control subject" is a subject having the same form of disease as the treated subject and being approximately the same age as the treated subject.

[0080] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in cell culture, etc., rather than within a multicellular organism.

[0081] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism such as a human and non-human animals. In the context of a cell-based system, the term can be used to refer to events that occur within a living cell (as opposed to, e.g., an in vitro system).

[0082] Local distribution or delivery: As used herein, the terms "local distribution", "local delivery" or grammatical equivalents refer to tissue-specific delivery or distribution. Generally, local distribution or delivery requires that the protein (e.g., an enzyme) encoded by the mRNA be translated and expressed intracellularly or with limited secretion, which avoids entry into the patient's circulatory system.

[0083] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. The mRNA can contain one or more coding and non-coding regions. The mRNA can be purified from natural sources, produced and optionally purified using recombinant expression systems, chemically synthesized, etc. In appropriate cases, such as in the case of chemically synthesized molecules, the mRNA can contain nucleoside analogs, such as those having chemically modified bases or sugars, backbone-modified analogs, etc. Unless otherwise specified, the display direction of the mRNA sequence is 5' to 3'. In some embodiments, the mRNA is or contains natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2'-aminoadenosine, 2'-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyl-uridine, 2'-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2'-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanosine, and 2'-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., thiophosphate esters and 5'-N-phosphoramidite linkages).

[0084] N / P ratio: As used herein, the term "N / P ratio" refers to the molar ratio of the positively charged molecular units in the cationic lipid in the lipid nanoparticle to the negatively charged molecular units in the mRNA encapsulated within the lipid nanoparticle. Thus, the N / P ratio is typically calculated as the ratio of the number of moles of amine groups in the cationic lipid in the lipid nanoparticle to the number of moles of phosphate groups in the mRNA encapsulated within the lipid nanoparticle.

[0085] Patient: As used herein, the term "patient" or "subject" refers to any organism to which the provided composition can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals, such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal.

[0086] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a substance that is applicable within the scope of reasonable medical judgment to contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0087] Subcutaneous administration: As used herein, the term "subcutaneous administration" or "subcutaneous injection" refers to an injection into the subcutaneous tissue, which is the tissue layer between the skin and the muscle.

[0088] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include prenatal and postnatal. In many embodiments, the subject is a human. A subject can be a patient, which refers to a person who presents to a healthcare provider for diagnosis or treatment of a disease. The term "subject" may be used interchangeably with "individual" or "patient" herein. A subject may have a disease or disorder or be susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0089] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent refers to an amount that is sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition when administered to a subject having the disease, disorder, and / or condition or being susceptible to the disease, disorder, and / or condition. One of ordinary skill in the art will recognize that a therapeutically effective amount is typically administered via a dosing regimen that includes at least one unit dose.

[0090] Treatment: As used herein, the term "treatment" refers to any method for partially or completely relieving, ameliorating, reducing, suppressing, preventing, delaying the onset of, decreasing the severity of, and / or decreasing the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. To reduce the risk of developing a pathology associated with a disease, treatment can be administered to a subject who does not exhibit signs of the disease and / or exhibits only early signs of the disease. Detailed Description

[0091] The present invention provides a stable dry powder formulation for therapeutic use, the dry powder formulation containing mRNA-loaded lipid nanoparticles (mRNA-LNP). Specifically, the present invention provides a dry powder formulation for delivering mRNA, the dry powder formulation comprising a plurality of spray-dried particles, each spray-dried particle comprising one or more mRNA-loaded lipid nanoparticles and a polymer, as well as methods for their preparation and use.

[0092] Various aspects of the present invention are described in detail in the following sections. The use of sections is not intended to limit the present invention. Each section can be applicable to any aspect of the present invention. In this application, unless otherwise specified, the use of "or" means "and / or".

[0093] Spray Drying Method

[0094] Various spray drying methods can be used to practice the present invention. Generally, the method involves removing moisture from a composition by passing the composition in liquid form through a device; Figure 1 A simplified schematic diagram is provided. Briefly, a liquid formulation containing the composition of interest is passed through a narrow inlet spray "atomizer" nozzle into a first chamber, which is a drying chamber. Generally, the liquid formulation passes through in a steady stream. The liquid formulation is sprayed into the drying chamber in the form of tiny droplets. A stream of heated air or gas is also introduced into the drying chamber to form an air current. The flow of the heated stream disperses the incoming droplets and dries them into the form of solid particles. The product is introduced into a second chamber through the flow of a connector or pipe. The second chamber is a cyclone powder collector. Here, an air circulation generates a cyclone, and the powder particles are collected into a collection container attached to the outlet end by a vortex flow. The cyclone chamber is attached to an exhaust fan, which helps to cool the components. The inlet and outlet temperatures can be adjusted by the operator. The respective inlet and outlet temperatures, the temperature inside the chamber, the liquid feed flow rate (suction percentage), the pressure, the nature of the heated air stream, and most importantly the composition of the liquid feed are appropriately adjusted in order to effect optimal drying of any particulate matter.

[0095] In some embodiments, the inlet temperature can be adjusted in the range of 40°C to 200°C. In some embodiments, the outlet temperature is in the range between 20°C - 70°C. The relative pressure of the pump and the suction can also be adjusted by the operator. In some embodiments, for spray drying mRNA-lipid nanoparticles, the inlet temperature is adjusted between 70°C and 200°C. In some embodiments, the inlet temperature is adjusted between 80°C and 200°C. In some embodiments, the inlet temperature is adjusted between 90°C and 200°C. In some embodiments, the inlet temperature is adjusted between 95°C and 180°C. In some embodiments, the inlet temperature is adjusted between 95°C and 160°C. In some embodiments, the inlet temperature is adjusted between 90°C and 150°C. In some embodiments, the inlet temperature is adjusted between 90°C and 120°C. In some embodiments, the inlet temperature is adjusted between 90°C and 100°C. In some embodiments, the inlet temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C or 100°C.

[0096] The suction percentage entering the drying chamber is typically adjusted between 50% and 100%. In some embodiments, the suction percentage entering the drying chamber is adjusted between 50% and 100%. In some embodiments, the suction percentage entering the drying chamber is adjusted between 60% and 100%. In some embodiments, the suction percentage entering the drying chamber is adjusted between 70% and 100%. In some embodiments, the suction percentage entering the drying chamber is adjusted between 80% and 100%. In certain embodiments, the suction percentage is adjusted between 80% and 90%. In some embodiments, the suction percentage is equal to or less than 100%, or equal to or less than 95%, or equal to or less than 90%, or equal to or less than 85%, or equal to or less than 80%.

[0097] In some embodiments, the liquid flow entering the drying chamber through the inlet is regulated by a pump and is set within the range of 10% - 50%. In some embodiments, the pump is set within the range of 20% and 40%. In some embodiments, the pump is set within the range of 10% and 30%. In some embodiments, the pump is set within the range of 20% and 30%. In some embodiments, the pump is set within the range of 30% and 50%. In some embodiments, the pump is set at 25%.

[0098] In some embodiments, the outlet temperature is within the range of 20°C to 70°C. In some embodiments, the outlet temperature is between 30°C and 60°C. In some embodiments, the outlet temperature is between 20°C and 50°C. In some embodiments, the outlet temperature is between 30°C and 50°C. In some embodiments, the outlet temperature is between 40°C and 50°C. In some embodiments, the outlet temperature is between 45°C and 50°C.

[0099] Spray drying of the mRNA-LNP can be carried out using any suitable spray drying device. As is known to those of ordinary skill in the art, many spray drying instruments are commercially available and can be used to practice the present invention. Exemplary commercially available devices suitable for the present invention include, but are not limited to, the following devices: Mini Spray Dryer B-290; Nano Spray Dryer B-90 (manufactured by Buchi); Dehydrated MicraSpray Dryer GMP; Dehydrated MicraSpray Dryer Sterile Series (manufactured by SPXFLOW); MDL-50 and MDL-015 (manufactured by Fujisaki Electric); Multi-functional Mini Spray Dryer GAS410 (manufactured by Yamato Scientific America); LSD-1500 Mini Spray Dryer, MSD-8 Multi-functional Laboratory Spray Dryer; PSD-12 Precision Pharmaceutical Spray Dryer (manufactured by Changzhou Xiandao Drying Equipment Co., Ltd.); Tall Dryer TM ; Multi-stage Dryer; Compact Dryer TM ; FILTERMAT Spray Dryer; Multi-functional-SD TM ; Fluidized Spray Dryer; Mobile Mini TM ; SDMICRO TM ; Production Mini TM (manufactured by GEA Process Engineering), etc. Some of these manufacturers can also be conveniently scaled up from laboratory scale to industrial manufacturing scale.

[0100] Spray-dried mRNA-loaded nanoparticles

[0101] According to the present invention, spray drying of mRNA-loaded nanoparticles involves adding a polymer to the mRNA and lipid mixture. In some embodiments, the lipid and mRNA are first mixed to pre-form mRNA-loaded lipid nanoparticles before adding the polymer. In some embodiments, the lipid, mRNA, and polymer are mixed simultaneously before spray drying. In some embodiments, the method according to the present invention further includes adding one or more excipients to the mixture before spray drying.

[0102] Lipid nanoparticles loaded with mRNA

[0103] Any desired lipids can be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, suitable lipid mixtures contain cationic lipids, non-cationic lipids, and / or PEGylated lipids. In some embodiments, suitable lipid mixtures also contain cholesterol-based lipids. In some embodiments, mRNA-LNP is formed by first mixing mRNA and lipids, then mixing with a polymer or other excipients, and subjecting the mixture to spray drying.

[0104] In some embodiments, an mRNA-LNP is formed by mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution is heated to a predetermined temperature above ambient temperature prior to mixing (see U.S. Patent No. 9,668,980, titled "Encapsulation of Messenger RNA", the disclosure of which is incorporated herein by reference in its entirety).

[0105] In some embodiments, an mRNA-LNP is formed by combining preformed lipid nanoparticles with mRNA (see U.S. Patent Application Publication No. 2018 / 0153822, the disclosure of which is incorporated herein by reference).

[0106] In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 70% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 75% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 80% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 85% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 86% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 87% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 88% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 89% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 90% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 91% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 92% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 93% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 94% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 95% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 96% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 97% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 98% or higher. In some embodiments, prior to spray drying, the encapsulation efficiency of lipid nanoparticles for mRNA is 99% or higher.

[0107] In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 70% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 75% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 80% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 85% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 86% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 87% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 88% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 89% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 90% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 91% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 92% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 93% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 94% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 95% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 96% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 97% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 98% or higher. In some embodiments, after spray-drying a formulation of a polymer and LNP-encapsulated mRNA, the encapsulation efficiency of the LNP for the mRNA is 99% or higher.

[0108] In some embodiments, the encapsulation efficiency of LNP for mRNA is 70% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 75% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 80% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 85% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 86% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 87% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 88% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 89% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 90% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 91% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 92% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 93% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 94% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 95% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 96% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 97% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA. In some embodiments, the encapsulation efficiency of LNP for mRNA is 98% or higher before and after spray-drying the formulation of the polymer and LNP-encapsulated mRNA.In some embodiments, the encapsulation efficiency of LNP for mRNA is 99% or higher before and after spray drying the formulation of the polymer and LNP-encapsulated mRNA.

[0109] In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 10% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 15% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 20% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 25% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 30% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 35% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 40% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 41% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 42% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 43% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 44% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 45% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 46% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 47% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 48% or greater than the quality of the formulation before the spray drying step. In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 49% or greater than the quality of the formulation before the spray drying step.In some embodiments, the quality of the formulation of the polymer and LNP-encapsulated mRNA recovered from the spray drying step is 50% or greater of the quality of the formulation before the spray drying step.

[0110] In some embodiments, mRNA is combined with lipids using a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and is also amenable to scale-up. In some embodiments, the N / P ratio ranges between 1 and 20. In some embodiments, the N / P ratio is greater than 2, or greater than 3, or greater than 4, or greater than 5, or greater than 6, or greater than 7, or greater than 8, or greater than 9, or greater than 10, or greater than 11, or greater than 12, or greater than 13, or greater than 14, or greater than 15. In some embodiments, the N / P ratio is 17, or 18, or 19, or 20.

[0111] Suitable mRNA-loaded lipid nanoparticles can be made in a variety of particle sizes. In some embodiments, the particle size of the mRNA-loaded lipid nanoparticles before spray drying is determined by the length of the maximum diameter of the lipid nanoparticles. In some embodiments, the mRNA-loaded lipid nanoparticles before spray drying have a particle size not greater than about 250 nm (e.g., not greater than about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm). In some embodiments, suitable liposomes have a size range of about 10 - 250 nm (e.g., a range of about 10–225 nm, 10–200 nm, 10–175 nm, 10–150 nm, 10 - 125 nm, 10–100 nm, 10–75 nm, or 10–50 nm). In some embodiments, the mRNA-loaded lipid nanoparticles before spray drying have a particle size in the range of about 100 - 250 nm (e.g., in the range of about 100 - 225 nm, 100 - 200 nm, 100 - 175 nm, 100 - 150 nm). In some embodiments, the mRNA-loaded lipid nanoparticles before spray drying have a particle size in the range of about 10 - 100 nm (e.g., in the range of about 10 - 90 nm, 10 - 80 nm, 10 - 70 nm, 10 - 60 nm, or 10–50 nm). In a particular embodiment, the mRNA-loaded lipid nanoparticles before spray drying have a particle size less than about 100 nm.

[0112] A variety of alternative methods known in the art can be used to determine the size of a liposome population. One such size determination method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension by bath or probe sonication produces a progressive size reduction down to small ULVs with diameters less than about 0.05 microns. Homogenization is another method that relies on shear energy to break large liposomes into smaller liposomes. In a typical homogenization procedure, MLVs are recycled through a standard emulsion homogenizer until a selected liposome size is observed, usually between about 0.1 and 0.5 microns. The size of liposomes can be determined by quasi-elastic light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonication of the liposomes formed. Intermittent sonication cycles can be alternated with QELS evaluation to guide efficient liposome synthesis.

[0113] Suitable mRNA-loaded lipid nanoparticles contain one or more of cationic lipids, PRGylated lipids, non-cationic lipids, and cholesterol-based lipids.

[0114] Cationic lipid

[0115] As used herein, the term "cationic lipid" refers to any of a number of lipids and lipid-like classes that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, many of which are commercially available.

[0116] Suitable cationic lipids for the compositions and methods of the present invention include cationic lipids as described in International Patent Publication WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate, having the following compound structure:

[0117]

[0118] and its pharmaceutically acceptable salts.

[0119] Other suitable cationic lipids for the compositions and methods of the present invention include ionizable cationic lipids as described in International Patent Publication WO2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid of one of the following formulas:

[0120]

[0121] or a pharmaceutically acceptable salt thereof, wherein R 1 and R 2 are each independently selected from the group consisting of: hydrogen, optionally substituted different saturated or unsaturated C 1 -C 20 alkyl and optionally substituted different saturated or unsaturated C 6 -C 20 acyl; wherein L 1 and L 2 are each independently selected from the group consisting of: hydrogen, optionally substituted C 1 -C 30 alkyl, optionally substituted different unsaturated C 1 -C 30 alkenyl and optionally substituted C 1 -C 30 alkynyl; wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., wherein m is three); and wherein n is zero or any positive integer (e.g., wherein n is one). In certain embodiments, the compositions and methods of the invention include the cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (“HGT5000”), said cationic lipid having the following compound structure:

[0122]

[0123] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention include the cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (“HGT5001”), said cationic lipid having the following compound structure:

[0124]

[0125] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention include the cationic lipid and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (“HGT5002”), said cationic lipid having the following compound structure:

[0126]

[0127] and its pharmaceutically acceptable salts.

[0128] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described as amino alcohol lipids in International Patent Publication WO2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure:

[0129]

[0130] and its pharmaceutically acceptable salts.

[0131] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids as described in International Patent Publication WO2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure:

[0132]

[0133] and its pharmaceutically acceptable salts.

[0134] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids as described in International Patent Publication WO2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure:

[0135]

[0136] and its pharmaceutically acceptable salts.

[0137] Other suitable cationic lipids for the compositions and methods of the present invention include a cationic lipid having the general formula 14,25-di-tridecyl 15,18,21,24-tetraaza-octatriacontane and its pharmaceutically acceptable salts.

[0138] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids as described in International Patent Publications WO2013 / 063468 and WO 2016 / 205691, each of which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following formula:

[0139]

[0140] or its pharmaceutically acceptable salt, wherein RL Each instance of is independently an optionally substituted C 6 -C 40 alkenyl. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0141]

[0142] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0143]

[0144] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0145]

[0146] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0147]

[0148] and pharmaceutically acceptable salts thereof.

[0149] Other suitable cationic lipids for the compositions and methods of the present invention include cationic lipids as described in International Patent Publication WO2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following formula:

[0150]

[0151] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; each R A is independently hydrogen, an optionally substituted C1-50 alkyl, an optionally substituted C2-50 alkenyl, an optionally substituted C2-50 alkynyl, an optionally substituted C3-10 carbocyclic group, an optionally substituted 3-14 membered heterocyclic group, an optionally substituted C6-14 aryl, an optionally substituted 5-14 membered heteroaryl or a halogen; and each R BIndependently is hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclic group, optionally substituted 3-14 membered heterocyclic group, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen. In certain embodiments, the compositions and methods of the present invention include the cationic lipid "Target 23" having the following compound structure:

[0152]

[0153] and its pharmaceutically acceptable salts.

[0154] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include the cationic lipids having the following compound structures:

[0155]

[0156] or its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include the cationic lipids having the following compound structures:

[0157]

[0158] or its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include the cationic lipids having the following compound structures:

[0159]

[0160] or its pharmaceutically acceptable salts.

[0161] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described in U.S. Provisional Patent Application Serial No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include the cationic lipids having the following formula:

[0162]

[0163] or its pharmaceutically acceptable salts, wherein each R 1 and R 2 independently is H or C 1 -C 6 aliphatic; each m independently is an integer having a value of 1 to 4; each A independently is a covalent bond or an arylene group; each L 1Independently is an ester, thioester, disulfide bond or acid anhydride group; each L 2 Independently is C 2 -C 10 aliphatic; each X 1 Independently is H or OH; and each R 3 Independently is C 6 -C 20 aliphatic. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following formula:

[0164]

[0165] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following formula:

[0166]

[0167] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following formula:

[0168]

[0169] or a pharmaceutically acceptable salt thereof.

[0170] Other suitable cationic lipids for the compositions and methods of the present invention include cationic lipids as described in J. McClellan, M. C. King, Cell 2010, 141, 210 - 217 and Whitehead et al., Nature Communications (2014) 5:4277, which are incorporated herein by reference. In certain embodiments, the cationic lipids of the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0171]

[0172] and their pharmaceutically acceptable salts.

[0173] Other suitable cationic lipids for the compositions and methods of the present invention include cationic lipids as described in International Patent Publication WO2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structures:

[0174]

[0175] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0176]

[0177] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0178]

[0179] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0180]

[0181] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0182]

[0183] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0184]

[0185] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0186]

[0187] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0188]

[0189] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0190]

[0191] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0192]

[0193] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0194]

[0195] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0196]

[0197] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0198]

[0199] and their pharmaceutically acceptable salts.

[0200] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0201]

[0202] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0203]

[0204] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0205]

[0206] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0207]

[0208] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0209]

[0210] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0211]

[0212] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0213]

[0214] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0215]

[0216] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0217]

[0218] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0219]

[0220] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0221]

[0222] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0223]

[0224] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0225]

[0226] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0227]

[0228] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0229]

[0230] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0231]

[0232] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0233]

[0234] and their pharmaceutically acceptable salts.

[0235] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following formula:

[0236]

[0237] or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 one of which is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -S-S-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O-; and L 1 or L 2 the other of which is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -S-S-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NRa C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O- or a direct bond; G 1 and G 2 each independently is an unsubstituted C 1 -C 12 alkylene or C 1 -C 12 alkenylene; G 3 is C 1 -C 24 alkylene, C 1 -C 24 alkenylene, C 3 -C 8 cycloalkylene, C 3 -C 8 cycloalkenylene; R a is H or C 1 -C 12 alkyl; R 1 and R 2 each independently is C 6 -C 24 alkyl or C 6 -C 24 alkenyl; R 3 is H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 is C 1 -C 12 alkyl; R 5 is H or C 1 -C 6 alkyl; and x is 0, 1 or 2.

[0238] Other suitable cationic lipids for the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure:

[0239]

[0240] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure:

[0241]

[0242] and their pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0243]

[0244] and their pharmaceutically acceptable salts.

[0245] Other suitable cationic lipids for the compositions and methods of the present invention include cationic lipids as described in International Patent Publication WO2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipids of the compositions and methods of the present invention include compounds having one of the following formulas:

[0246]

[0247]

[0248] and their pharmaceutically acceptable salts. For any of these four general formulas, R 4 is independently selected from -(CH 2 ) n Q and -(CH 2 ) n CHQR; Q is selected from the group consisting of -OR, -OH, -O(CH 2 ) n N(R) 2 , -OC(O)R, -CX 3 , -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O) 2 R, -N(H)S(O) 2 R, -N(R)C(O)N(R) 2 , -N(H)C(O)N(R) 2 , -N(H)C(O)N(H)(R), -N(R)C(S)N(R) 2 , -N(H)C(S)N(R) 2 , -N(H)C(S)N(H)(R) and heterocycles; and n is 1, 2 or 3. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0249]

[0250] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures:

[0251]

[0252] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0253]

[0254] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0255]

[0256] and their pharmaceutically acceptable salts.

[0257] Other suitable cationic lipids for the compositions and methods of the invention include cationic lipids as described in International Patent Publications WO2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0258]

[0259] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0260]

[0261] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0262]

[0263] and their pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures:

[0264]

[0265] and their pharmaceutically acceptable salts.

[0266] Other suitable cationic lipids for the compositions and methods of the invention include cholesterol-based cationic lipids. In certain embodiments, the compositions and methods of the invention include imidazole cholesterol esters or "ICE" having the following compound structures:

[0267]

[0268] and its pharmaceutically acceptable salts.

[0269] Other suitable cationic lipids for the compositions and methods of the present invention include cleavable cationic lipids as described in International Patent Publication WO2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following formula:

[0270]

[0271] wherein R 1 is selected from the group consisting of imidazole, guanidine, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; wherein R 2 is selected from the group consisting of one of the following two general formulas:

[0272]

[0273] and wherein R 3 and R 4 are each independently selected from the group consisting of optionally substituted different saturated or unsaturated C 6 -C 20 alkyl and optionally substituted different saturated or unsaturated C 6 -C 20 acyl; and wherein n is zero or any positive integer (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more). In certain embodiments, the compositions and methods of the present invention include the cationic lipid "HGT4001" having the following compound structure:

[0274]

[0275] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include the cationic lipid "HGT4002" having the following compound structure:

[0276]

[0277] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include the cationic lipid "HGT4003" having the following compound structure:

[0278]

[0279] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include the cationic lipid "HGT4004" having the following compound structure:

[0280]

[0281] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include the cationic lipid "HGT4005" having the following compound structure:

[0282]

[0283] and its pharmaceutically acceptable salts.

[0284] Other suitable cationic lipids for the compositions and methods of the present invention include cleavable cationic lipids, as described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid that is any one of the general formulas or structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having a structure according to formula (I'),

[0285]

[0286] wherein:

[0287] RX is independently -H, -L1-R1 or –L5A-L5B-B';

[0288] Each of L1, L2 and L3 is independently a covalent bond, -C(O)-, -C(O)O-, -C(O)S- or -C(O)NRL-;

[0289] Each of L4A and L5A is independently -C(O)-, -C(O)O- or -C(O)NRL-;

[0290] Each of L4B and L5B is independently a C1-C20 alkylene, C2-C20 alkenylene or C2-C20 alkynylene;

[0291] Each of B and B' is NR4R5 or a 5- to 10-membered nitrogen-containing heteroaryl;

[0292] Each of R1, R2 and R3 is independently a C6-C30 alkyl, C6-C30 alkenyl or C6-C30 alkynyl;

[0293] Each R4 and R5 is independently hydrogen, C1-C10 alkyl; C2-C10 alkenyl; or C2-C10 alkynyl; and

[0294] each RL is independently hydrogen, C1-C20 alkyl, C2-C20 alkenyl or C2-C20 alkynyl.

[0295] In certain embodiments, the compositions and methods of the invention include a cationic lipid that is the compound (139) of 62 / 672,194, which has the following compound structure:

[0296] ("18:1 carbon tail ribose lipid").

[0297] In some embodiments, the compositions and methods of the invention include a cationic lipid, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride ("DOTMA"). (Feigner et al. Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Patent No. 4,897,355, which is incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the invention include, for example, 5-carboxyspermine glycin dioctadecylamide ("DOGS"); 2,3-dioleoyloxy-N-[2-(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanammonium ("DOSPA") (Behr et al. Proc. Nat'l Acad. Sci. 86, 6982 (1989), U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761); 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"); 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0298] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include: 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (“DSDMA”); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (“DODMA”); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (“DLinDMA”); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane (“DLenDMA”); N-dioleyl-N,N-dimethylammonium chloride (“DODAC”); N,N-distearyl-N,N-dimethylammonium bromide (“DDAB”); N-(1,2-dimyristyloxypropyl)-N,N-dimethyl-N-hydroxyethylammonium bromide (“DMRIE”); 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadienyloxy)propane (“CLinDMA”); 2-[5'-(cholest-5-en-3-β-oxy)-3'-oxapentyloxy)-3-dimethyl-1-(cis,cis-9',12'-octadecadienyloxy)propane (“CpLinDMA”); N,N-dimethyl-3,4-dioleyloxybenzylamine (“DMOBA”); 1,2-N,N'-dioleylcarbamoyl-3-dimethylaminopropane (“DOcarbDAP”); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine (“DLinDAP”); 1,2-N,N'-dilinoletcarbamoyl-3-dimethylaminopropane (“DLincarbDAP”); 1,2-dilinoleylcarbamoyl-3-dimethylaminopropane (“DLinCDAP”); 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (“DLin-K-DMA”); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA”); (2R)-2-((8-[(3β)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA(2R)”); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,fsl-dimethyl 3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA(2S)”); 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane (“DLin-K-XTC2-DMA”);and 2-(2,2-bis((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (“DLin-KC2-DMA”) (see, WO 2010 / 042877, which is incorporated herein by reference; Semple et al., Nature Biotech. 28:172-176 (2010)). (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, D.V., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Publication WO 2005 / 121348). In some embodiments, one or more cationic lipids comprise at least one of an imidazole, a dialkylamino, or a guanidinium moiety.;

[0299] In some embodiments, one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (“XTC”); (3aR,5s,6aS)-N,N-dimethyl-2,2-bis((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (“ALNY-100”) and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-di-undecyl-4,7,10,13-tetraazacyclohexadecane-1,16-diamide (“NC98-5”).

[0300] In some embodiments, the compositions of the present invention comprise one or more cationic lipids, which account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% of the total lipid content in the composition (e.g., lipid nanoparticles) by weight. In some embodiments, the compositions of the present invention comprise one or more cationic lipids, which account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 80% of the total lipid content in the composition (e.g., lipid nanoparticles) in mole %. In some embodiments, the compositions of the present invention comprise one or more cationic lipids, which account for about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45% or about 35-40%) of the total lipid content in the composition (e.g., lipid nanoparticles) by weight. In some embodiments, the compositions of the present invention comprise one or more cationic lipids, which account for about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45% or about 35-40%) of the total lipid content in the composition (e.g., lipid nanoparticles) in mole %.

[0301] In some embodiments, instead of or in addition to the cationic lipids described herein, sterol-based cationic lipids can be used. Suitable sterol-based cationic lipids are sterol-based cationic lipids containing dialkylamino, imidazole, and guanidine. For example, certain embodiments relate to compositions comprising one or more sterol-based cationic lipids containing imidazole, such as imidazole cholesterol esters or "ICE" lipids (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propionate, as represented by the following structure (I). In certain embodiments, lipid nanoparticles for delivering RNA encoding a functional protein (e.g., mRNA) can comprise one or more imidazole-based cationic lipids, such as imidazole cholesterol esters or "ICE" lipids (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propionate, as represented by the following structure:

[0302]

[0303] In some embodiments, the percentage of cationic lipid in the liposome can be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid constitutes about 30-50% by weight (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome. In some embodiments, the cationic lipid (e.g., ICE lipid) accounts for about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, or about 80% of the liposome on a molar basis.

[0304] PEGylated lipid

[0305] In some embodiments, suitable lipid solutions comprise one or more PEGylated lipids. For example, the present invention also contemplates the use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids (e.g., derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide)). Envisioned PEG-modified lipids include, but are not limited to, polyethylene glycol chains up to 5 kDa in length, which are covalently linked to lipids having one or more alkyl chains of C 6 -C 20 length. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, particularly useful exchangeable lipids are PEG-ceramides having shorter acyl chains (e.g., C 14 or C 18 ).

[0306] PEG-modified phospholipids and derivatized lipids can account for at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15% or at least 20% of the total lipids in the liposome.

[0307] Non-cationic / helper lipids

[0308] As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic or anionic lipid. As used herein, the phrase "anionic lipid" refers to any one of a variety of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylethanolamine (POPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl phosphatidylethanolamine (POPE), 4-(N-maleimidomethyl)-cyclohexane-1-carboxylic acid dioleoyl phosphatidylethanolamine (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphatidylethanolamine (DMPE), distearoyl phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE) or mixtures thereof.

[0309] In some embodiments, the non-cationic lipid can be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% by weight or mole of the total lipid in a suitable lipid solution. In some embodiments, one or more non-cationic lipids are about 20%-50% (e.g., about 20%-45%, about 20%-40%, about 25%-50%, about 25%-45% or about 25%-40%) by weight or mole of the total lipid in a suitable lipid solution.

[0310] Cholesterol-based lipid

[0311] In some embodiments, a suitable lipid solution comprises one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylformamide cholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335) or ICE. In some embodiments, one or more cholesterol-based lipids are at least about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60% or 70% by weight or mole of the total lipid in a suitable lipid solution. In some embodiments, one or more cholesterol-based lipids are about 20%-50% (e.g., about 20%-45%, about 20%-40%, about 25%-50%, about 25%-45% or about 25%-40%) by weight or mole of the total lipid in a suitable lipid solution.

[0312] The Examples section describes exemplary combinations of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEGylated lipids. For example, suitable lipid solutions can contain cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; or HGT5001, DPPC, cholesterol, and DMG-PEG2K. The selection of the cationic lipid, non-cationic lipid, and / or PEGylated lipid comprising the lipid mixture and the relative molar ratios of such lipids to each other are based on the characteristics of one or more of the selected lipids and the characteristic properties of the mRNA to be encapsulated. Other considerations include, for example, the saturation of the alkyl chains and the size, charge, pH, pKa, fusogenicity, and toxicity of the selected lipids. Thus, the molar ratios can be adjusted accordingly.

[0313] Typically, the mRNA-loaded lipid nanoparticles comprise from 0.1% to 30% of the total solids content of the spray-dried mixture. In some embodiments, the total solids content of the mRNA-loaded nanoparticle composition to be spray-dried is between 0.5% - 20%. In some embodiments, the total solids content of the mRNA-loaded nanoparticle composition to be spray-dried is between 2% - 20%. In some embodiments, the total solids content of the mRNA-loaded nanoparticle composition to be spray-dried is between 2% - 15%. In some embodiments, the total solids content of the mRNA-loaded nanoparticle composition to be spray-dried is between 2% - 10%.

[0314] Polymer

[0315] A variety of polymers can be used in the spray-dried mRNA-LNP according to the present invention. Generally, suitable polymers have low toxicity and are well tolerated over a wide range of concentrations. In some embodiments, suitable polymers are positively charged. Exemplary polymers include, but are not limited to, chitosan, polyester, polyurethane, polycarbonate, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) copolymer (PLGA), poly(ε-caprolactone) (PCL), polyamidoamine, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline) acrylate, modified acrylate and methacrylate-based polymers, poly-N-(2-hydroxypropyl) methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethyl methacrylate) (pDMAEMA).

[0316] In some embodiments, the suitable polymer is a polymethacrylate derivative comprising repeating units of monomers having the following structure,

[0317] wherein, R 1 is independently C 1 -C 6 alkyl, L 1 is independently C 2 -C 6 alkylene, R 1A and R 1B are each independently C 1 -C 6 alkyl, and a is an integer from 1 to 500; R 2 is independently C 1 -C 6 alkyl, R 2A is independently C 1 -C 6 alkyl, b is an integer from 1 to 500; R 3 is independently C 1 -C 6 alkyl, R 3A is independently C 1 -C 6 alkyl, and c is an integer from 1 to 500.

[0318] In some embodiments, the repeating unit can be represented by the following formula,

[0319] where each R 4 is independently R 2 or R 3 ; each R 4A is independently R2A or R 3A ; and d is an integer from 1 to 500. In the above structure, L 1 can be -CH 2 CH 2 , and each R 1A and R 1B is methyl; and / or each R 1 , R 2 and R 3 is methyl; and / or R 2A is butyl and R 3A is methyl.

[0320] In some embodiments, exemplary members of the polymer are represented by the following formula:

[0321]

[0322] Exemplary members of this group are known by the trade name Eudragit. In some embodiments of the present invention, the polymer contained in the spray-dried mRNA-LNP formulation is an Eudragit polymer. Eudragit forms a class of amorphous polymers or copolymers that are derived from acrylates and methacrylates and whose properties are determined by functional groups. The proportion of individual Eudragit grades differs in terms of neutral, basic or acidic groups and thus also in terms of physicochemical properties. Some available forms are anionic, some are cationic and some are neutral. In some embodiments, this type of polymer used for spray drying together with the mRNA-LNP complex has a positively charged tertiary amine group and a methacrylate backbone. They can form complexes with mRNA and encapsulate mRNA. They have a high Tg and excellent thermoplastic properties, which contribute to spray drying. These polymers are insoluble at higher pHs and can thus help to protect mRNA from degradation in surfactants. Eudragit polymers have been approved by the US Food and Drug Administration (FDA) for oral use and have been used in commercial oral products for decades. These polymers have low toxicity and are well tolerated at a wide range of concentrations.

[0323] In some embodiments, the polymers used include the insoluble Eudragit class at pH 5 and above. In some embodiments, this property of the polymer is used for oral delivery of the active mRNA ingredient so that the mRNA is not released in saliva. One advantage of these polymers is their ability to effectively mask the taste and odor of the active ingredient and other excipients because the functional polymers are insoluble in the oral cavity.

[0324] Thus, in some embodiments, the methacrylic acid derivative polymers described above are used to prepare formulations for stable spray-dried mRNA-LNP dry powder. In some embodiments, these methacrylic acid derivative polymers are used for the sustained release of mRNA. In some embodiments, methacrylic acid derivative polymers that are insoluble at pH ≥ 5 are used to deliver suitable mRNA to the gastrointestinal tract (GI). In some embodiments, methacrylic acid derivative polymers are used to deliver suitable mRNA to the colon.

[0325] In some embodiments, the polymer comprises less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, or 5% of the total weight of the dry powder. In some embodiments, the polymer comprises 1% to 60% of the total weight of the dry powder. In some embodiments, the polymer comprises about 1%-90%, 10%-90%, 20%-90%, 10%-50%, 1%-20%, 2%-15%, 3%-12%, 1%-10%, 2%-9%, 3%-8%, 1%-7%, 2%-6%, or 3%-5% of the total weight of the dry powder.

[0326] Other excipients

[0327] In some embodiments, sugars and other excipients are added to the mRNA-loaded nanoparticle and polymer mixture prior to spray drying.

[0328] Sugar

[0329] Prior to spray drying, various sugars can be added to the mixture. The sugars are expected to provide a stabilizing effect during the dehydration process. Exemplary sugars suitable for the formulation are monosaccharides, disaccharides, and polysaccharides selected from the group consisting of glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol.

[0330] In some embodiments, suitable sugars are lactose and / or mannitol. In some embodiments, a suitable sugar is mannitol. In some embodiments, mannitol is added at a concentration of about 1%-10%. In some embodiments, mannitol is added at a concentration of about 2%-10%. In some embodiments, mannitol is added at a concentration of about 3%-10%. In some embodiments, mannitol is added at a concentration of about 4%-10%. In some embodiments, mannitol is added at a concentration of about 5%-10%.

[0331] In some embodiments, a suitable sugar is trehalose. In some embodiments, both mannitol and trehalose are added.

[0332] Surfactant

[0333] In some embodiments, a surfactant is used as an excipient. The surfactant increases the surface tension of the composition. In some embodiments, the surfactants used for spray drying mRNA lipid compositions are selected from the group consisting of: CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, coconut monoethanolamide, coconut diethanolamide, glyceryl monostearate, glyceryl monolaurate, sorbitan monolaurate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucoside, and poloxamer. In some embodiments, the surfactant used is poloxamer.

[0334] Various other excipients may be included in the spray-dried formulation. These excipients include, but are not limited to, various polyesters, polyurethanes, poly(ester amides), poly(orthoesters), polyanhydrides, poly(anhydride-imide) copolymers, polyphosphates, polyphosphazenes, amino acids, collagen, chitosan, cyclodextrin, polysaccharides, maltodextrin, albumin, various sugars, surfactants, buffers, and salts.

[0335] Dry powder

[0336] The dry powder prepared according to the present invention contains a plurality of spray-dried particles. Residual moisture content, aerosol performance, and physicochemical stability are important parameters for spray-dried pharmaceuticals. It is determined by the weight loss of the sample after heating and drying, and the formula is as follows:

[0337] Moisture content % = [(SW b - SW a ) / SW b × 100%,

[0338] wherein, SW b is the weight of the sample before heating, and SW a is the weight of the sample after heating. Perkin Elmer TGA 7 (Perkin Elmer) is an example of a commercial instrument with relevant software, which is used to measure the residual moisture in nanoparticles.

[0339] Typically, for the dose uniformity of the active pharmaceutical ingredient of a formulation, the particle size distribution is maintained within an acceptable range. In particular, for pulmonary delivery, the particles of a dry powder formulation affect the distribution and deposition of the aerosol within the respiratory system. In many cases, for the effective absorption and distribution of the therapeutic component, it is preferred to deposit the particles in the large airways. Aerosols of extremely fine particles, such as particles with a diameter less than 1 micron, can deposit peripherally to be effectively absorbed by specific cells of the lung, such as the absorption of the active pharmaceutical ingredient as a bronchodilator by smooth muscle.

[0340] The primary particle size distribution of spray-dried particles is measured by dynamic light scattering and expressed as the Z-average particle size. The Z-average particle size is the average calculated from the intensity-weighted distribution of the particle size, also known as the cumulant particle size, and is given by the formula D z =∑S i / ∑(S i / D i ) where S i is the scattering intensity of particle “i” and D i is the diameter of the particle. In addition to these parameters, fine and coarse particle fractions are also defined.

[0341] In another aspect, the polydispersity index (PDI) is a measure of the molecular mass distribution of a given particle sample.

[0342] The ζ potential is a measure of the magnitude of the electrostatic or charge repulsion / attraction between particles and is one of the fundamental parameters known to affect stability. Its measurement can provide insights into the causes of dispersion, aggregation, or flocculation and can be used to improve the formulation of dispersions, emulsions, and suspensions. ZP represents the degree of repulsion between particles that are close and carry similar charges in a dispersion. A high ZP indicates more highly charged particles. Typically, a high ZP (negative or positive) can prevent particle aggregation due to electrical repulsion and render the nanoparticle dispersion electrostable. In another aspect, in the case of a low ZP, the attractive force exceeds the repulsive force and the dispersion coagulates or flocculates. The ζ potential can be measured by photon correlation spectroscopy using available equipment systems (e.g., Zetasizer Nano (Malvern Instruments)).

[0343] The sphericity of nanoparticles is a measure of the degree of closeness with which the particles reassemble into a sphere. It can be measured using the Waddell equation and is denoted by Ψ, and the equation is as follows:

[0344] Surface area of a sphere of a given particle with the same volume

[0345] The surface area of the particle

[0346] The particle size distribution and shape or sphericity of the spray-dried mRNA-lipid formulation can be measured by scanning electron microscopy (SEM), transmission electron microscopy or by a Coulter particle size analyzer by the change in electrical resistance exerted by the particles in a fluid.

[0347] Finally, the mRNA content and / or integrity are evaluated by HPLC or Northern blot analysis. In some embodiments, mass spectrometry and other related spectro-photochemical analyses are performed for the stability, integrity and quality assessment of the mRNA-nanoparticle formulation.

[0348] The spray-dried mRNA lipid nanoparticles of the present invention contain less than 10% moisture (w / w). In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 9% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 8% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 7% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 6% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 5% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 4% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 3% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 2% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention can retain less than about 1% moisture. In some embodiments, the moisture content of the spray-dried mRNA-LNP formulation is less than 5%.

[0349] The present invention provides spray-dried mRNA LNP formulations, wherein the mRNA lipid nanoparticles have a heterogeneous particle size and the fine particle fraction (fnfr) is less than 10 μm. In some embodiments, the fnfr of the mRNA-LNP dry powder particles of the present invention ranges between 1-10 μm. The optimal Z-average particle size of the spray-dried sample of mRNA-LNP can be ≤10 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP is ≤8 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP is ≤5 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP should be in the range of 0.01-10 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP should be in the range of 0.1-10 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP should be in the range of 0.1-5 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP should be in the range of 0.1-3 μm. In some embodiments, the Z-average particle size of the spray-dried sample of mRNA-LNP should be in the range of 0.1-5 μm.

[0350] In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 200 nm. In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 180 nm. In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 150 nm. In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 120 nm. In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 100 nm. In some embodiments, prior to spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 50 nm.

[0351] In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 5000 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 4000 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 3000 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 2000 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 1000 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 500 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 500 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 300 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 200 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 100 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 50 nm. In some embodiments, after spray drying, the mRNA-lipid nanoparticles have a Z-average particle size of less than 10 nm.

[0352] Dry powder formulations of mRNA-LNPs are provided herein, wherein the average sphericity of the mRNA-LNP particles ranges from 0.7 to 1. In some embodiments, the average sphericity of the mRNA lipid nanoparticles is greater than 0.7, or greater than 0.8, or greater than 0.9.

[0353] In some embodiments, the ζ-potential value of the nanoparticles for use in this application is between +30 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between +20 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between +10 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between 0 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between -10 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between -20 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between +20 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is between -20 mV and -30 mV. In some embodiments, the ζ-potential value of the nanoparticles is about -30 mV, and the polydispersity index is less than about 0.3.

[0354] In some embodiments, the dry powder formulation of the provided mRNA-LNP contains up to 30%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% of the total weight of the dry powder. In some embodiments, the mRNA accounts for 1%-6%, 1%-5%, 1%-4%, 1%-3%, 2%-10%, 2%-9%, 2%-8%, 2%-7%, 2%-6%, 2%-5%, 2%-10%, 2%-15%, 2%-20%, 2%-30% of the total weight of the dry powder.

[0355] Stability

[0356] Provided are spray-dried mRNA-LNP formulations that are stable upon storage under various conditions. As used herein, the term "stable" means that the mRNA retains greater than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% integrity after storage. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than one year. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 11 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 10 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 9 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 8 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 7 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 6 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 5 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 4 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 3 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 2 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20 °C), at 4 °C, or at room temperature for greater than 1 month.

[0357] In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20°C), at 4°C, or at room temperature for greater than 8 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20°C), at 4°C, or at room temperature for greater than 7 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20°C), at 4°C, or at room temperature for greater than 6 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20°C), at 4°C, or at room temperature for greater than 5 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing conditions (-20°C), at 4°C, or at room temperature for greater than 4 weeks.

[0358] messenger RNA

[0359] The present invention can be used to formulate any mRNA. As used herein, mRNA is the type of RNA that carries information from DNA to ribosomes for translation of the encoded protein. The mRNA can be synthesized according to any of a variety of known methods. For example, the mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT generally uses a linear or circular DNA template that contains a promoter, a ribonucleotide triphosphate pool, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary depending on the particular application.

[0360] The present invention can be used to formulate mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs that are equal to or greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb in length. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs that are in the range of about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb in length.

[0361] The present invention can be used to formulate unmodified mRNA or mRNA containing one or more modifications that generally enhance stability. In some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions (UTRs).

[0362] In some embodiments, the modification of mRNA can include the modification of the nucleotides of the RNA. The modified mRNA according to the present invention can include, for example, backbone modification, sugar modification, or base modification. In some embodiments, the mRNA can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), which include but are not limited to purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)) and modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouridine (5-uridine), dihydrouridine, 2-thio-uridine, 4-thio-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-(carboxyhydroxymethyl)-uridine, 5-fluoro-uridine, 5-bromo-uridine, 5-carboxymethylaminomethyl-uridine, 5-methyl-2-thio-uridine, 5-methyl-uridine, N-uridine-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uridine, 5-methoxyaminomethyl-2-thio-uridine, 5'-methoxycarbonylmethyl-uridine, 5-methoxy-uridine, uridine-5-oxyacetic acid methyl ester, uridine-5-oxyacetic acid (v), 1-methyl-pseudouridine, Q nucleoside, β-D-mannosyl-Q nucleoside, wybutosine, and phosphoramidates, thiophosphates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogs is known to those skilled in the art, for example, from U.S. Patent No. 4,373,071, U.S. Patent No. 4,401,796, U.S. Patent No. 4,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707, U.S. Patent No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319, U.S. Patent No. 5,262,530, and 5,700,642, the entire disclosures of which are incorporated herein by reference.

[0363] In some embodiments, the mRNA can contain RNA backbone modifications. Generally, backbone modifications are modifications in which the phosphodiester of the nucleotide backbone contained in the RNA is chemically modified. Exemplary backbone modifications typically include, but are not limited to, modifications selected from the group consisting of: methylphosphonate, methylphosphoramidate, aminophosphate, thiophosphate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium groups, etc., which means replacing the phosphodiester bond with other anionic, cationic or neutral groups.

[0364] In some embodiments, the mRNA can contain sugar modifications. Typical sugar modifications are chemical modifications of the sugar of the nucleotides it contains, including but not limited to sugar modifications selected from the following: 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamino-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides and their isomers (2'-arabinosylcytidine 5'-triphosphate, 2'-arabinosyluridine 5'-triphosphate) or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0365] In some embodiments, the mRNA can contain modifications of nucleobases (base modifications). Modified nucleotides that contain base modifications are also referred to as base-modified nucleotides. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallyl cytidine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0366] Generally, mRNA synthesis includes adding a "cap" at the 5' end and a "tail" at the 3' end. The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" is used to protect the mRNA from exonuclease degradation.

[0367] Thus, in some embodiments, the mRNA contains a 5' cap structure. The 5' cap is typically added as follows: First, an RNA terminal phosphatase removes a terminal phosphate group from the 5' nucleotide, leaving two terminal phosphates; then guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase, generating a 5'-5' reverse triphosphate bond; then the 7-nitrogen of guanine is methylated by a methyltransferase. 2'-O-methylation can also occur at the first base and / or the second base following the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (where m represents a 2'-O-methyl residue).

[0368] In some embodiments, the mRNA includes a 3' tail structure. Generally, the tail structure includes a poly(A) and / or poly(C) tail. The poly-A or poly-C tail at the 3' end of the mRNA typically contains at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb adenosine or cytosine nucleotides, respectively. In some embodiments, the poly-A or poly-C tail can be about 10 to 800 adenosine or cytosine nucleotides (e.g., about 10 to 200 adenosine or cytosine nucleotides, about 10 to 300 adenosine or cytosine nucleotides, about 10 to 400 adenosine or cytosine nucleotides, about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550 adenosine or cytosine nucleotides, about 10 to 600 adenosine or cytosine nucleotides, about 50 to 600 adenosine or cytosine nucleotides, about 100 to 600 adenosine or cytosine nucleotides, about 150 to 600 adenosine or cytosine nucleotides, about 200 to 600 adenosine or cytosine nucleotides, about 250 to 600 adenosine or cytosine nucleotides, about 300 to 600 adenosine or cytosine nucleotides, about 350 to 600 adenosine or cytosine nucleotides, about 400 to 600 adenosine or cytosine nucleotides, about 450 to 600 adenosine or cytosine nucleotides, about 500 to 600 adenosine or cytosine nucleotides, about 10 to 150 adenosine or cytosine nucleotides, about 10 to 100 adenosine or cytosine nucleotides, about 20 to 70 adenosine or cytosine nucleotides, or about 20 to 60 adenosine or cytosine nucleotides). In some embodiments, the tail structure includes a combination of poly(A) and poly(C) tails having various lengths as described herein. In some embodiments, the tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides. In some embodiments, the tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0369] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect the stability or translation of the mRNA, such as an iron-responsive element.

[0370] In some embodiments, the 3' untranslated region comprises one or more polyadenylation signals, protein-binding sites that affect the localization and stability of the mRNA in the cell, or one or more miRNA-binding sites.

[0371] Exemplary 5' and / or 3' UTR sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' UTR sequence can comprise a partial sequence or a fragment of the CMV immediate early 1 (IE1) gene to increase nuclease resistance and / or increase the half-life of the polynucleotide. It is also contemplated to include a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3' end or in the untranslated region of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide relative to their unmodified counterparts and include, for example, modifications made to improve the resistance of such polynucleotides to nuclease digestion in vivo.

[0372] The mRNA construct design can be designated as X-coding sequence-Y. Exemplary X and Y nucleotide sequences are as follows:

[0373] X (5′UTR sequence) =

[0374] GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO:1)

[0375] Y (3′UTR sequence) =

[0376] CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO:2)

[0377] or

[0378] GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU(SEQ ID NO:3)

[0379] While in some embodiments the mRNA provided by in vitro transcription reactions is desired, other sources of mRNA are envisioned within the scope of the present invention, including mRNA produced from bacteria, fungi, plants, and / or animals.

[0380] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding the human cystic fibrosis transmembrane receptor, the cystic fibrosis transmembrane conductance regulator CFTR (hCFTR) protein. In some embodiments, codon optimization is performed for a suitable mRNA sequence for efficient expression in human cells. U.S. Patent Application Serial No. 15 / 981,757, filed May 16, 2018, describes in detail the preparation and optimization of CFTR mRNA for therapeutic delivery, the disclosure of which is hereby incorporated by reference in its entirety.

[0381] Pharmaceutical Formulations and Therapeutic Uses

[0382] The pharmaceutical compositions of the dry powder formulations of the present invention can be used for various therapeutic applications. To facilitate in vivo delivery, the dry powder formulations as described herein can be combined with one or more additional pharmaceutical carriers, targeting ligands, or stabilizers. In some embodiments, one or more additional pharmaceutical carriers can be added to the formulation prior to spray drying. In some embodiments, one or more additional pharmaceutical carriers can be added to the formulation using post-insertion techniques into the dry powder formulation (i.e., after spray drying). Techniques for formulating and administering drugs can be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition.

[0383] The dry powder formulations described herein can be administered in vivo in powder form or after reconstitution. Suitable routes of administration for the formulations described herein include oral, rectal, vaginal, transmucosal, pulmonary, including intratracheal or inhaled, or enteral administration; parenteral delivery, including intradermal, transdermal (topical), intramuscular, subcutaneous, intramedullary injection; and intrathecal, direct intraventricular, intravenous, intraperitoneal or intranasal. In certain embodiments, intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, administration results in delivery of the nucleic acid to muscle cells. In some embodiments, administration results in delivery of the nucleic acid to hepatocytes (i.e., liver cells).

[0384] The pharmaceutical formulations of the present invention can be administered in a local rather than a systemic manner, for example, by directly injecting the pharmaceutical formulation into the target tissue, preferably in the form of a sustained release formulation. Depending on the tissue to be targeted, local delivery can be affected in various ways. Exemplary tissues in which the delivered mRNA can be delivered and / or expressed include, but are not limited to, lung, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In an embodiment, the tissue to be targeted is in the liver. For example, an aerosol containing the composition of the present invention can be inhaled (for nasal, tracheal or bronchial delivery). In some embodiments, the composition of the present invention can be delivered using a metered dose inhaler. In some embodiments, the composition of the present invention can be reconstituted and nebulized for delivery. In some embodiments, the composition of the present invention can be injected into the site of injury, disease manifestation or pain. In some embodiments, the composition of the present invention can be provided in the form of a lozenge for oral, tracheal or esophageal administration. In some embodiments, the composition of the present invention can be provided in the form of a liquid, tablet or capsule for administration to the stomach or intestine. In some embodiments, the composition of the present invention can be provided in the form of a suppository for rectal or vaginal administration. In some embodiments, the composition of the present invention can be delivered to the eye by using a cream, drops or even an injection.

[0385] In some embodiments, the dry powder formulations of the present invention are reconstituted into a liquid solution and nebulized for delivery. Nebulization can be achieved by any nebulizer known in the art. The nebulizer converts the liquid into a fine mist so that it can be more easily inhaled into the lungs. Nebulizers are effective for infants, children, and adults. Nebulizers are capable of nebulizing large doses of inhaled drugs. Generally, nebulizers used with the present invention include a detachable mouthpiece.

[0386] In some embodiments, the dry powder formulations as described herein can be used to deliver a therapeutically effective amount of mRNA for treating various diseases or disorders. For example, the dry powder formulations prepared by spray drying according to the present invention can be administered via oral, nasal, tracheal, or pulmonary routes for treating lung-related diseases such as cystic fibrosis. In some embodiments, the dry powder formulations are administered by inhalation. In some embodiments, the formulations are administered via a metered-dose inhaler. In some embodiments, the dry powder formulations are administered by nasal spray. In some embodiments, the dry powder formulations are rehydrated and administered in the form of intravenous infusion, injection, oral drops, nasal drops, and any other application forms readily conceivable by those of ordinary skill in the art.

[0387] The present invention can be used to treat various other lung-related diseases, disorders, and conditions. In some embodiments, the stable dry powder formulations of the present invention can be used to treat one or more of the following: asthma; COPD; emphysema; primary ciliary dyskinesia (CILD1) with or without situs inversus, or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dubé syndrome; hereditary hemorrhagic telangiectasia; α-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-linked); autosomal recessive cytochrome b-positive granulomatous disease; surfactant deficiency, pulmonary surfactant metabolism dysfunction 1, pulmonary surfactant metabolism dysfunction 2, pulmonary surfactant metabolism dysfunction 3; respiratory distress syndrome of the premature infant; tuberculosis, pulmonary viral diseases, including influenza, respiratory syncytial virus (RSV).

[0388] Accordingly, in certain embodiments, the present invention provides methods for preparing dry powder compositions comprising full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of the lung or lung cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the ATP-binding cassette subfamily A member 3 protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the dynein axon intermediate chain 1 protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the dynein axon heavy chain 5 (DNAH5) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the α-1-antitrypsin protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding the forkhead box P3 (FOXP3) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding one or more surfactant proteins, such as one or more of surfactant protein A, surfactant protein B, surfactant protein C, and surfactant protein D.

[0389] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of the liver or liver cells of a subject. Such peptides and polypeptides can include those associated with urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrosis disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery to or treatment of the liver or liver cells with an enriched full-length mRNA provides a dry powder benefit.

[0390] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with urea cycle disorders. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding ornithine transcarbamylase (OTC) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding argininosuccinate synthetase 1 protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding carbamoyl phosphate synthetase I protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding argininosuccinate lyase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding arginase protein.

[0391] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with lysosomal storage disorders. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding α-galactosidase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding glucocerebrosidase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding iduronate-2-sulfatase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding iduronidase protein. In certain embodiments, the present invention provides methods for preparing therapeutic compositions having full-length mRNAs encoding N-acetyl-α-D-glucosaminidase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding heparan N-sulfatase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding galactosamine-6-sulfatase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding β-galactosidase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding lysosomal lipase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding transcription factor EB (TFEB).

[0392] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with glycogen storage diseases. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding acid alpha-glucosidase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding glucose-6-phosphatase (G6PC) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding liver glycogen phosphorylase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding muscle phosphoglycerate mutase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding glycogen debranching enzyme.

[0393] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with amino acid metabolism. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding phenylalanine hydroxylase. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding glutaryl-CoA dehydrogenase. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding propionyl-CoA carboxylase. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding oxalate oxidase alanine-glyoxylate aminotransferase.

[0394] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with lipid metabolism or fibrotic diseases. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding mTOR inhibitors. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding ATPase phospholipid transporter 8B1 (ATP8B1) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding one or more NF-κB inhibitors, such as one or more of I-κBα, interferon-related developmental regulator 1 (IFRD1), and sirtuin 1 (SIRT1). In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding PPAR-γ protein or active variants.

[0395] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding proteins associated with methylmalonic acidemia. For example, in certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding methylmalonyl-CoA mutase proteins. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding methylmalonyl-CoA epimerase proteins.

[0396] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs, for which delivery to or treatment of the liver can provide dry powder benefits. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding ATP7B proteins (also known as Wilson disease proteins). In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding porphobilinogen deaminase. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding one or more coagulation enzymes, such as factor VIII, factor IX, factor VII, and factor X. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding human hemochromatosis (HFE) proteins.

[0397] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding peptides or polypeptides for delivery to or treatment of the cardiovascular system or cardiovascular cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding vascular endothelial growth factor A proteins. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding relaxin proteins. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding bone morphogenetic protein 9 proteins. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding bone morphogenetic protein 2 receptor proteins.

[0398] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of muscle or muscle cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding dystrophin. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a human mitochondrial protein (frataxin). In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of the myocardium or cardiomyocytes of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a protein that modulates one or both of potassium and sodium channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a protein that modulates the Kv7.1 channel in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a protein that modulates the Nav1.5 channel in muscle tissue or muscle cells.

[0399] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of the nervous system or nervous system cells of a subject. For example, in certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding survival motor neuron 1 protein. For example, in certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding survival motor neuron 2 protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a human mitochondrial protein (frataxin). In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding ATP-binding cassette sub-family D member 1 (ABCD1) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding CLN3 protein.

[0400] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding peptides or polypeptides for delivery to or treatment of the blood or bone marrow, or blood cells or bone marrow cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding β-globin. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding Bruton's tyrosine kinase protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding one or more coagulation enzymes, such as factor VIII, factor IX, factor VII, and factor X.

[0401] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding peptides or polypeptides for delivery to or treatment of the kidney or kidney cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding the α5 chain of type IV collagen (COL4A5) protein.

[0402] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding peptides or polypeptides for delivery to or treatment of the eye or eye cells of a subject. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding ATP-binding cassette subfamily A member 4 (ABCA4) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding retinitis pigmentosa GTPase regulator protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding centrosomal protein of 290 kDa (CEP290).

[0403] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding peptides or polypeptides for delivery of a vaccine or treating with a vaccine to a subject or cells of a subject. For example, in certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from infectious agents such as viruses. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from influenza virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from respiratory syncytial virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from rabies virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from cytomegalovirus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from rotavirus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from hepatitis viruses such as hepatitis A virus, hepatitis B virus or hepatitis C virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from human papillomavirus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from herpes simplex virus such as herpes simplex virus 1 or herpes simplex virus 2. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from human immunodeficiency virus such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from human metapneumovirus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from human parainfluenza virus such as human parainfluenza virus type 1, human parainfluenza virus type 2 or human parainfluenza virus type 3. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from malaria virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from Zika virus. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNAs encoding antigens from chikungunya virus.

[0404] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antigen associated with a subject's cancer or an antigen identified from the subject's cancer cells. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antigen determined from the subject's own cancer cells, i.e., providing a personalized cancer vaccine. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antigen expressed from a mutant KRAS gene.

[0405] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody. In certain embodiments, the antibody can be a bispecific antibody. In certain embodiments, the antibody can be part of a fusion protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody against OX40. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody against VEGF. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody against tumor necrosis factor α. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody against CD3. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an antibody against CD19.

[0406] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an immunomodulator. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding interleukin 12. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding interleukin 23. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding interleukin 36γ. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a constitutively active variant of one or more stimulators of interferon genes (STING) proteins.

[0407] In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an endonuclease. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding an RNA-guided DNA endonuclease protein, such as a Cas 9 protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a meganuclease protein. In certain embodiments, the present invention provides methods for preparing dry powder compositions having full-length mRNA encoding a transcription activator-like effector nuclease protein. In certain embodiments, the present invention provides a method for preparing a dry powder composition having full-length mRNA encoding a zinc finger nuclease protein.

[0408] The present invention can be used to treat a variety of other diseases, disorders, and conditions that require sustained release of mRNA formulations. These examples include diseases where mRNA delivery in the digestive tract is useful. These diseases include, but are not limited to, apolipoprotein E deficiency; inflammatory bowel disease or Crohn's disease; adhesion G protein-coupled receptor VI deficiency; von Willebrand disease type 2; calcium oxalate CAON-related kidney stones; and late-onset diabetes type 8.

[0409] The present invention can be used to treat a variety of other diseases, disorders, or conditions where targeted delivery of an mRNA formulation to a tissue or organ can be advantageous. These can be carried out by binding or not binding a suitable polymer to a specific targeting moiety.

[0410] Examples

[0411] Although certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the invention.

[0412] Example 1. mRNA-LNP Dry Powder Formulations Recovered from Spray Drying

[0413] In this example, LNP-encapsulated mRNA formulations were prepared with or without a polymer and spray dried. The results showed that the LNP-encapsulated mRNA formulations prepared with a polymer had an unexpectedly high recovery from the spray drying process compared to the same mRNA-LNP formulations prepared without a polymer.

[0414] Specifically, two LNP-encapsulated mRNA formulations (mRNA encoding firefly luciferase (FFL) and the formulations are designated FFL-F1 and FFL-F2, respectively) were prepared without using a polymer or using a polymer, and the respective compositions of each are as described in Table 1. To prepare these formulations for spray drying, first, the FFL mRNA was mixed with lipid nanoparticles (LNP) using a gear pump to encapsulate the mRNA in the LNP. Then, for the "using polymer" samples, the polymer solution was then mixed with the mRNA-LNP using a gear pump. The solution was then spray dried as shown in the illustration of the apparatus in Figure 1 . The spray drying was carried out using the following conditions: inlet temperature of 90 °C, suction percentage of 85%, pump percentage of 25%, and outlet temperature of 46 - 50 °C.

[0415] Table 1. Composition and characteristics of the mRNA formulations of Example 1

[0416]

[0417]

[0418] Results

[0419] Without using a polymer, the spray drying step of each LNP-mRNA formulation was unsuccessful. In each case, as shown in Table 1 (bottom) and Figure 2 , the material aggregated in the spray dryer and blocked the various chambers of the spray dryer, so little or no material was recovered. However, the same two LNP-mRNA formulations prepared with a polymer were successfully spray dried, and the material recovery rate from the spray drying step exceeded 40%, as shown in Table 1 (bottom) and Figure 2 .

[0420] Before and after the spray drying step, the effects of spray drying on the encapsulation efficiency and nanoparticle size (Z-average diameter) were measured, and the values are listed in Table 1 (bottom). For the LNP-mRNA formulations prepared with a polymer, before and after spray drying, the encapsulation efficiency did not change significantly in the material, and the nanoparticle size was found to increase from before to after spray drying. For the LNP-mRNA formulations prepared without using a polymer, since the spray drying step could not produce any substantial material, these metrics could not be determined.

[0421] Example 2. Integrity and stability of the mRNA dry powder formulations

[0422] In this example, two mRNA preparations encoding argininosuccinate synthetase or ASS1 mRNA were prepared and their long-term stability was evaluated. Specifically, an mRNA preparation (ASS1-F1) that did not contain LNP but contained a polymer was prepared. A second mRNA preparation (ASS-F2) that included LNP-encapsulated LNP plus polymer was prepared. Each preparation is further described in Table 2.

[0423] For the ASS1-F1 preparation, the mRNA was directly mixed with the polymer using a gear pump. For the ASS1-F2 preparation, the mRNA was first mixed with lipid nanoparticles (LNP) using a gear pump to encapsulate the mRNA in the LNP, and then the polymer solution was mixed with the mRNA-LNP using a gear pump. The final preparations were concentrated, and mannitol was added to each preparation. The solution was then spray-dried as shown in the illustration of the instrument in Figure 1 The spray drying was carried out using the following conditions: an inlet temperature of 90 °C, a suction percentage of 85%, a pump percentage of 25%, and an outlet temperature of 46 - 50 °C.

[0424] Table 2. Composition and characteristics of the mRNA preparations of Example 2

[0425]

[0426]

[0427] Encapsulation efficiency and nanoparticle size. The effect of spray drying on the encapsulation efficiency was measured before and after drying. In this example, in the preparation using the polymer, the encapsulation efficiency of the LNP-encapsulated mRNA was 75.28 ± 1.43 before the process and 81.85 ± 0.44 after, indicating that the spray drying process does not have a negative impact on the encapsulation efficiency. The average particle sizes of the nanoparticles before and after spray drying were 99.4 ± 1.3 and 426 ± 12, respectively.

[0428] Integrity and stability of the mRNA dry powder. Even when stored at refrigerated temperature (4 °C) or frozen at

[0429] -20 °C for different time periods, the LNP-encapsulated mRNA in the preparation using the polymer still provided unexpectedly high integrity and stability of the mRNA after spray drying. The integrity and stability of the mRNA described below were evaluated by spectrophotometric analysis, such as capillary electrophoresis (CE), and by gel electrophoresis, such as by Northern blot analysis.

[0430] Figure 3 and Figure 4 as an exemplary control for mRNA integrity analysis. Specifically, Figure 3Shows intact mRNA evaluated by CE (left panel) and gel electrophoresis (right panel). In the left panel of the figure, intact mRNA is shown as a single spectrophotometric peak (shaded), and in the right panel of the figure, intact mRNA is shown as a single band corresponding to the expected mRNA molecular size. The single peak and single band indicate intact mRNA and no degradation products, respectively. Similarly, Figure 4 shows mRNA extracted from LNP prior to spray drying (i.e., the extraction was for the purpose of performing CE and gel electrophoresis analysis of the mRNA) to confirm that the mRNA extracted from LNP does not produce significant mRNA degradation products. The comparison of the CE peaks and gel bands in Figure 4 is shown in Figure 3 and indicates that the process for extracting mRNA from LNP does not produce significant mRNA degradation products.

[0431] Aliquots of the spray-dried ASS1-F1 formulation or the spray-dried ASS1-F2 formulation were stored at 4 °C or -20 °C, respectively, and samples were taken at different time points, reconstituted, and the mRNA integrity was evaluated by CE and gel electrophoresis. Specifically, the mRNA integrity of the dry powder ASS1 mRNA-LNP formulated with the polymer (ASS1-F2) was evaluated at 2 weeks and 4 weeks after spray drying and stored at 4 °C or -20 °C; the mRNA integrity of the dry powder ASS1 mRNA (without using LNP) formulated with the polymer (ASS1-F1) was evaluated at 3 weeks and 5 weeks after spray drying and stored at 4 °C or -20 °C.

[0432] Figure 5 and Figure 6 show the mRNA integrity of the dry powder ASS1 mRNA-LNP formulated with the polymer (ASS1-F2) stored at 4 °C or -20 °C for two weeks, respectively. Figure 5 and Figure 6 show a single CE peak (left panel) and a single gel band (right panel), respectively, indicating that ASS1 mRNA remains intact and does not degrade under both temperature conditions. Figure 7 Further shows the overlap of two peaks of ASS1 mRNA (from Figure 5 and Figure 6 ), indicating that the mRNA remains intact regardless of the storage temperature. These data suggest that the spray-dried formulations of mRNA lipid nanoparticles using the polymer can remain stable for at least two weeks within a certain storage temperature range, such as at a temperature equal to or up to about -20 °C or at a temperature equal to or up to about 4 °C.

[0433] Figure 8 and Figure 9Shows the mRNA integrity of dry powder ASS1 mRNA-LNP formulated with polymer (ASS1-F2), stored at 4 °C or -20 °C for four weeks respectively. Figure 8 and Figure 9 Both show a single CE peak (left panel) and a single gel band (right panel), indicating that ASS1 mRNA remains intact and undegraded under both temperature conditions. These data suggest that the spray-dried formulation of mRNA lipid nanoparticles using the polymer can remain stable for at least four weeks over a wide range of storage temperatures, such as at a temperature equal to or up to about -20 °C or at a temperature equal to or up to about 4 °C.

[0434] Figure 10 and Figure 11 Shows the mRNA integrity of dry powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1), stored at 4 °C or -20 °C for three weeks. As Figure 10 and Figure 11 shown, ASS1-F1 mRNA remains intact and undegraded under both temperature conditions. Figure 12 Depicts the overlay of CE peaks of ASS1 mRNA (from Figure 10 and Figure 11 ), where the complete alignment of the CE peaks indicates that the mRNA is undegraded. This suggests that the spray-dried mRNA formulation with polymer (without LNP encapsulation) remains stable for at least three weeks over a wide range of storage temperatures (e.g., at a temperature equal to or up to about -20 °C or at a temperature equal to or up to about 4 °C).

[0435] Figure 13 and Figure 14 Shows the mRNA integrity of dry powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1), stored at 4 °C or -20 °C for five weeks. As Figure 13 and Figure 14 shown, ASS1-F1 mRNA remains intact and undegraded under both temperature conditions. This suggests that the spray-dried mRNA formulation with polymer (without LNP encapsulation) remains stable for at least five weeks over a wide range of storage temperatures (e.g., at a temperature equal to or up to about -20 °C or at a temperature equal to or up to about 4 °C).

[0436] Surprisingly, for dry powder ASS1 mRNA-LNP (ASS1-F2) formulated with polymer and for dry powder ASS1 mRNA (without LNP) (ASS1-F1) formulated with polymer, the integrity of the mRNA can be maintained for a longer period at higher storage temperatures, such as refrigerated storage (about 4 °C).

[0437] Example 3. One-step method for mRNA encapsulation in lipid-polymer nanoparticles

[0438] In this example, the lipid, mRNA, and polymer were prepared in a single step to produce lipid-polymer encapsulated mRNA nanoparticles (formulations ASS1-F3 using the polymer and ASS1-F4 using the polymer). This is contrary to Examples 1 and 2, in which the LNP encapsulated mRNA nanoparticles were first prepared and then the polymer was added to the formulation. Additionally, reference formulations were prepared by the same method but did not include the polymer in the nanoparticles or formulation (formulations ASS1-F3 without the polymer and ASS1-F4 without the polymer).

[0439] Specifically, the lipid and polymer (or lipid only for the control formulations) were dissolved in ethanol and mixed with the mRNA solution using a gear pump. Four different formulations were prepared. Using cKK-E12 as the cationic lipid, the first and second formulations (ASS1-F3 without the polymer and ASS1-F3 using the polymer) were prepared with or without the polymer. Using ICE (imidazole cholesterol ester) as the cationic lipid, the third and fourth formulations (ASS1-F4 without the polymer and ASS1-F4 using the polymer) were prepared with or without the polymer. ASS1-F3 using the polymer and ASS1-F4 using the polymer included Eudragit as the polymer. All four formulations included mRNA encoding ASS1 as the mRNA encapsulated in the nanoparticles. Each formulation was concentrated and mannitol was added. All formulations are further described in Table 3. Each formulation was spray dried using the conditions described in Example 1.

[0440] Table 3. Composition and characteristics of the mRNA formulations of Example 3

[0441]

[0442]

[0443] Results

[0444] The spray drying step for the formulations without polymers (ASS1-F3 without polymer and ASS-F4 without polymer) was unsuccessful. In each case, the material aggregated in the spray dryer and blocked the various chambers of the spray dryer, so that for the formulations without polymers, little or no material was recovered, and as shown in Table 3 (bottom), the recovery rate of each material was 1±2%. However, the same two formulations prepared using the polymer in the nanoparticles (ASS1-F3 with polymer and ASS-F4 with polymer) were successfully spray dried, and the recovery rate of the material recovered from the spray drying step exceeded 35% and was close to 40%, as described in Table 3.

[0445] Before and after the spray drying step, the effects of spray drying on the encapsulation efficiency and nanoparticle size (Z-average diameter) were measured for the formulations prepared using the polymer in the nanoparticles, and the values are listed in Table 3 (bottom). For each lipid-polymer-mRNA nanoparticle, the encapsulation efficiency did not change significantly before and after spray drying, and the nanoparticle size was found to increase from before to after spray drying. For the formulations prepared without polymers, since the spray drying step could not produce any substantial material, these indicators could not be determined.

[0446] These results particularly show that the polymer added to the lipid nanoparticles encapsulating mRNA can successfully spray dry the mRNA-encapsulated lipid nanoparticles. This is contrary to the same lipid nanoparticles without mRNA, which were not successfully spray dried.

[0447] Example 4. One-step method for mRNA encapsulation in lipid-polymer nanoparticles

[0448] In this example, the polymer PLGA was mixed with lipids and mRNA in one step to produce lipid-PLGA-encapsulated mRNA nanoparticles.

[0449] Specifically, the lipids and PLGA (or only lipids for the control formulation) were dissolved in a mixture of ethanol and acetonitrile (1:2) and mixed with the ASS1 mRNA solution using a gear pump. The final formulation was concentrated in 5% mannitol and then spray dried. The spray drying was carried out under the following conditions: inlet temperature of 90 °C, suction percentage of 85%, pump percentage of 25% and outlet temperature of 46 - 50 °C. The formulations are further described in Table 4.

[0450] Table 4. Composition and characteristics of the mRNA formulations of Example 4

[0451]

[0452]

[0453] Results

[0454] The spray drying step of the formulation prepared with PLGA polymer in nanoparticles was successfully spray dried, and the material was recovered from the spray drying step.

[0455] Example 5. In Vivo Delivery of Spray-Dried mRNA Formulations

[0456] In this example, the spray-dried formulation was administered to mice in the form of a dry powder using FFL-F1 of the polymer (as described in Example 1) and in a form dissolved in a liquid, and mRNA expression in the administered formulation was detected in both methods.

[0457] Specifically, in one method, a dry powder formulation of FFL-F1 and the polymer was administered to mice at a dose of 1 mg using a DP-4M type dry powder insufflator. Twenty-four hours after the dry powder administration, the FFL substrate luciferin was administered using a nebulizer, and the in vivo expression of luciferase was detected by bioluminescence. The results are described in Figure 15A in.

[0458] In the second method, FFL-F1 of the polymer was dissolved in water at a concentration of 20 mg / ml and 50 μl was administered to each mouse using a nebulizer, at a dose of 1 mg. Twenty-four hours after the administration, the FFL substrate luciferin was administered using a nebulizer, and the in vivo expression of luciferase was detected by bioluminescence. The results are described in Figure 15B in.

[0459] These results indicate that after spray drying, the mRNA encapsulated in the LNP formulated with the polymer remains active. These results also indicate that the spray-dried LNP-encapsulated mRNA can be directly administered as a dry powder to provide in vivo protein expression.

[0460] Example 6. Dry Powder Formulation of CFTR mRNA Lipid-Polymer Nanoparticles

[0461] In this example, the mRNA encoding the cystic fibrosis transmembrane conductance regulator protein (CFTR), or CFTR mRNA, was encapsulated in lipid-polymer nanoparticles and successfully spray dried into a stable dry powder.

[0462] Specifically, to prepare lipid-polymer nanoparticles encapsulating CFTR-mRNA, the PEG-modified lipid, cationic lipid, and polymer described in Table 5 below were dissolved in 150 mL of ethanol and mixed with CFTR-mRNA (0.05 g dissolved in 600 mL, pH 4.5, 1 mM citrate buffer, 150 mM sodium chloride) using a gear pump. Then, 37.5 g of mannitol was dissolved at 5% weight / volume into 750 mL of the CFTR-mRNA solution (20% ethanol) encapsulated in the lipid-polymer nanoparticles. The resulting mixture was then spray-dried on a Buchi spray dryer using the following spray-drying conditions: inlet temperature of 90 °C, aspiration percentage of 90%, pump percentage of 25%, and outlet temperature of 46 - 50 °C.

[0463] Table 5. Dry powder formulation of CFTR-mRNA lipid-polymer nanoparticles

[0464]

[0465]

[0466] To quantitatively determine the integrity of CFTR-mRNA in the lipid-polymer nanoparticles after spray drying, the nanoparticles were mixed and dissolved in ethanol, and CFTR-mRNA was precipitated from the nanoparticles using an RNA precipitation buffer containing guanidine thiocyanate, N-lauroylsarcosine, and sodium citrate pH 6.5. The precipitated mRNA was further separated and purified using an RNeasy silica membrane (Qiagen) and then redissolved in RNase-free water. The purified mRNA was evaluated by capillary electrophoresis using a Fragment Analyzer (Agilent) according to the manufacturer's publicly available instructions. Briefly, an appropriate amount of intercalating dye and RNA separation gel were mixed and loaded onto the instrument. The capillary conditioning buffer was diluted to the required concentration and then loaded onto the conditioning fluid line. The inlet buffer, wash buffer, and storage buffer were added to the well plate and then added to the designated positions. The extracted mRNA and control mRNA were diluted to 150 ng / μL, denatured by heating at 70 °C for 5 minutes using formamide loading buffer, and then immediately cooled. The samples were further diluted using a dilution marker according to the manufacturer's instructions and run on the Fragment Analyzer using the relevant separation method.

[0467] As described in the above embodiments, LNP-mRNA formulations without the use of additional polymers cannot be successfully spray-dried. Specifically, the LNP-mRNA material aggregates in the spray dryer and clogs the various compartments of the spray dryer, such that little or no LNP-mRNA material is recovered. As shown in the above embodiments, the problem of the inability to successfully spray-dry LNP-mRNA material can be overcome by adding a polymer to the LNP formulation, either by including the polymer with the lipids such that the polymer is present in the step of preparing the nanoparticles and encapsulating the mRNA, or by adding the polymer to the formulation after the step of generating the lipid nanoparticles and encapsulating the mRNA.

[0468] Herein, by adding a polymer, particularly an Eudragit polymer, the CFTR-mRNA encapsulated within the lipid nanoparticles was successfully spray-dried. Specifically, the Eudragit polymer was included with the lipid mixture prior to the step of generating the nanoparticles and encapsulating the mRNA, thereby generating CFTR-mRNA encapsulated by lipid-polymer nanoparticles. The integrity of the successfully spray-dried CFTR-mRNA lipid-polymer nanoparticles was also evaluated using capillary electrophoresis (CE) analysis. Figures 16A1-A6 show exemplary CE chromatograms of the CFTR-mRNA peak integrity before and after spray-drying, which indicates that the integrity of the CFTR-mRNA remained intact after spray-drying in the lipid-polymer. Figures 16A1-A3 depict the control CFTR mRNA that was neither spray-dried nor encapsulated, while Figures 16A4-A6 depict the CFTR mRNA extracted from the spray-dried formulation. Sequence Listing <110> Translate Bio, Inc. <120> Dry Powder Formulations of Messenger RNA <130> MRT-2008WO <150> 62 / 702,193 <151> 2018-07-23 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 140 <212> RNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 1 ggacagaucg ccuggagacg ccauccacgc uguuuugacc uccauagaag acaccgggac 60 cgauccagcc uccgcggccg ggaacggugc auuggaacgc ggauuccccg ugccaagagu 120 gacucaccgu ccuugacacg 140 <210> 2 <211> 105 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 2 cggguggcau cccugugacc ccuccccagu gccucuccug gcccuggaag uugccacucc 60 agugcccacc agccuugucc uaauaaaauu aaguugcauc aagcu 105 <210> 3 <211> 105 <212> RNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 3 ggguggcauc ccugugaccc cuccccagug ccucuccugg cccuggaagu ugccacucca 60 gugcccacca gccuuguccu aauaaaauua aguugcauca aagcu 105

Claims

1. A dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, each particle comprising: One or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a protein or polypeptide; and One or more polymers, and Wherein: The LNP comprises one or more lipids; The one or more polymers comprise a polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone; The plurality of spray-dried particles have a residual moisture content of less than 10%; The one or more polymers account for at least 10% of the combined weight of the lipids and polymers; and After storage at 4°C or below for 6 months or longer, the mRNA maintains 90% or higher integrity.

2. The dry powder formulation according to claim 1, wherein the one or more polymers are present in the one or more LNPs encapsulating the mRNA.

3. The dry powder formulation according to claim 1, wherein after storage at 4°C or below for 12 months or longer, the mRNA has 90% or higher integrity.

4. A dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray-dried particles, each particle comprising: One or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a protein or polypeptide; and One or more polymers, and Wherein: The LNP comprises one or more lipids; The one or more polymers comprise a polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone; The plurality of spray-dried particles have a residual moisture content of less than 10%; The one or more polymers account for at least 10% of the combined weight of the lipids and polymers; and After storage at room temperature or below for 6 months or longer, the mRNA maintains 90% or higher integrity.

5. The dry powder formulation according to claim 1, wherein at least 20% of the plurality of spray-dried particles are fine particles, wherein the fine particles have a volume median diameter of less than 5 μm.

6. The dry powder formulation according to claim 1, wherein the dry powder formulation is inhalable.

7. The dry powder formulation according to claim 1, wherein the formulation is nebulizable upon reconstitution.

8. The dry powder formulation according to claim 1, wherein the one or more polymers account for at least 15% of the combined weight of the lipids and polymers.

9. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 20% of the combined weight of the lipids and polymers.

10. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 25% of the combined weight of the lipids and polymers.

11. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 30% of the combined weight of the lipids and polymers.

12. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 35% of the combined weight of the lipids and polymers.

13. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 40% of the combined weight of the lipid and the polymer.

14. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 45% of the combined weight of the lipid and the polymer.

15. The dry powder formulation according to claim 8, wherein the one or more polymers account for at least 50% of the combined weight of the lipid and the polymer.

16. The dry powder formulation according to claim 1, wherein the one or more polymers account for 10% - 90% of the combined weight of the lipid and the polymer.

17. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 80% of the combined weight of the lipid and the polymer.

18. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 70% of the combined weight of the lipid and the polymer.

19. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 60% of the combined weight of the lipid and the polymer.

20. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 50% of the combined weight of the lipid and the polymer.

21. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 40% of the combined weight of the lipid and the polymer.

22. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 30% of the combined weight of the lipid and the polymer.

23. The dry powder formulation according to claim 16, wherein the one or more polymers account for 10% - 20% of the combined weight of the lipid and the polymer.

24. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 20% of the combined weight of the lipid and the polymer.

25. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 25% of the combined weight of the lipid and the polymer.

26. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 30% of the combined weight of the lipid and the polymer.

27. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 35% of the combined weight of the lipid and the polymer.

28. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 40% of the combined weight of the lipid and the polymer.

29. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 45% of the combined weight of the lipid and the polymer.

30. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 50% of the combined weight of the lipid and the polymer.

31. The dry powder formulation according to claim 16, wherein the one or more polymers account for 15% - 55% of the combined weight of the lipid and the polymer.

32. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 60% of the combined weight of the lipid and the polymer.

33. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 65% of the combined weight of the lipid and the polymer.

34. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 70% of the combined weight of the lipid and the polymer.

35. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 75% of the combined weight of the lipid and the polymer.

36. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 80% of the combined weight of the lipid and the polymer.

37. The dry powder preparation according to claim 16, wherein the one or more polymers account for 15% - 90% of the combined weight of the lipid and the polymer.

38. The dry powder preparation according to claim 1, wherein the one or more polymers account for no more than 90% of the combined weight of the lipid and the polymer.

39. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 80% of the combined weight of the lipid and the polymer.

40. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 70% of the combined weight of the lipid and the polymer.

41. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 60% of the combined weight of the lipid and the polymer.

42. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 55% of the combined weight of the lipid and the polymer.

43. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 50% of the combined weight of the lipid and the polymer.

44. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 45% of the combined weight of the lipid and the polymer.

45. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 40% of the combined weight of the lipid and the polymer.

46. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 35% of the combined weight of the lipid and the polymer.

47. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 30% of the combined weight of the lipid and the polymer.

48. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 25% of the combined weight of the lipid and the polymer.

49. The dry powder preparation according to claim 38, wherein the one or more polymers account for no more than 20% of the combined weight of the lipid and the polymer.

50. The dry powder preparation according to claim 1, wherein the polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone is represented by the following formula: , wherein R 1 and R 4 are each independently C 1 -C 6 alkyl; L 1 is independently C 2 -C 6 alkylene; R 1A and R 1B are each independently C 1 -C 6 alkyl; each R 4A is independently C 1 -C 6 alkyl; and d is an integer from 1 to 500.

51. The dry powder formulation according to claim 1, wherein the one or more polymers comprise Eudragit® EPO.

52. The dry powder formulation according to any one of claims 1-51, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 1-20.

53. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 1-15.

54. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 1-10.

55. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 2-8.

56. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 2-6.

57. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the one or more mRNAs have a lipid:mRNA (N / P) ratio in the range of 2-4.

58. The dry powder formulation according to claim 52, wherein the one or more LNPs encapsulating the mRNAs have a lipid:mRNA (N / P) ratio of 2 or 4.

59. The dry powder formulation according to any one of claims 1-51, wherein the LNP has an encapsulation efficiency of 80% or higher.

60. The dry powder formulation according to any one of claims 1-51, wherein the one or more lipids include cationic lipids.

61. The dry powder formulation according to claim 60, wherein the cationic lipid is selected from the group consisting of: C12-200, DOTAP (1,2-dioleoyl-3-trimethylammonium propane), DODAP (1,2-dioleoyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, OF-02, ICE (imidazole cholesterol ester), and combinations thereof.

62. The dry powder formulation according to claim 61, wherein the cationic lipid is cKK-E12.

63. The dry powder formulation according to claim 61, wherein the cationic lipid is ICE.

64. The dry powder formulation according to claim 61, wherein the cationic lipid is OF-02.

65. The dry powder formulation according to claim 60, wherein the cationic lipid accounts for 25%-50% of the total lipids in the LNP in terms of molar concentration.

66. The dry powder formulation according to any one of claims 1-51, wherein the one or more lipids comprise PEGylated lipids.

67. The dry powder formulation according to claim 66, wherein the PEGylated lipids account for 1%-15% of the total lipids in the LNP in terms of molar concentration.

68. The dry powder formulation according to claim 66, wherein the PEGylated lipids account for at least 1% of the total lipids in the LNP in terms of molar concentration.

69. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 2% of the total lipids in the LNP in terms of molar concentration.

70. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 3% of the total lipids in the LNP in terms of molar concentration.

71. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 4% of the total lipids in the LNP in terms of molar concentration.

72. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 5% of the total lipids in the LNP in terms of molar concentration.

73. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 6% of the total lipids in the LNP in terms of molar concentration.

74. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 8% of the total lipids in the LNP in terms of molar concentration.

75. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 10% of the total lipids in the LNP in terms of molar concentration.

76. The dry powder formulation according to claim 68, wherein the PEGylated lipids account for at least 12% of the total lipids in the LNP in terms of molar concentration.

77. The dry powder formulation according to any one of claims 1-51, wherein the LNP is a dual-lipid component LNP.

78. The dry powder formulation according to any one of claims 1-51, wherein the one or more lipids do not include neutral lipids or cholesterol-based lipids.

79. The dry powder formulation according to any one of claims 1-51, wherein the one or more lipids further include neutral lipids or cholesterol-based lipids.

80. The dry powder formulation according to claim 79, wherein the LNP is a triple-lipid component LNP.

81. The dry powder formulation according to any one of claims 1-51, further comprising at least one sugar selected from the group consisting of monosaccharides, disaccharides, and polysaccharides.

82. The dry powder formulation according to claim 81, wherein the sugar is selected from the group consisting of glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, and inulin.

83. The dry powder formulation according to any one of claims 1-51, which further comprises xylitol, sorbitol, lactitol, or mannitol.

84. The dry powder formulation according to any one of claims 1-51, which further comprises mannitol.

85. The dry powder formulation according to any one of claims 1 - 51 further comprises a pharmaceutically acceptable excipient selected from the group consisting of esters, phosphazenes, amino acids, collagen, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

86. The dry powder formulation according to claim 85, wherein the pharmaceutically acceptable excipient is chitosan.

87. The dry powder formulation according to claim 85, wherein the pharmaceutically acceptable excipient is selected from the group consisting of carbamates and phosphates.

88. The dry powder formulation according to claim 85, wherein the surfactant is selected from the group consisting of CHAPS (3 - [(3 - cholamidopropyl)dimethylammonio]-1 - propanesulfonate), phospholipids, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X - 100, coconut amide monoethanolamine, coconut amide diethanolamine, glyceryl monostearate, glyceryl monolaurate, sorbitan monolaurate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers.

89. The dry powder formulation according to claim 88, wherein the surfactant is selected from the group consisting of phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, and sphingomyelin.

90. The dry powder formulation according to claim 88, wherein the surfactant is poloxamer.

91. The dry powder formulation according to any one of claims 1 - 51, wherein the one or more mRNAs account for 1% - 20% of the total weight of the spray - dried particles.

92. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 1% - 15% of the total weight of the spray - dried particles.

93. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 1% - 10% of the total weight of the spray - dried particles.

94. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 1% - 8% of the total weight of the spray - dried particles.

95. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 1% - 6% of the total weight of the spray - dried particles.

96. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 1% - 5% of the total weight of the spray - dried particles.

97. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 5% - 15% of the total weight of the spray - dried particles.

98. The dry powder formulation according to claim 91, wherein the one or more mRNAs account for 5% - 10% of the total weight of the spray - dried particles.

99. The dry powder formulation according to any one of claims 1 - 51, wherein the one or more mRNAs account for 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5%, or 15% of the total weight of the spray - dried particles. Use of the dry powder formulation according to any one of claims 1 - 51 in the preparation of a formulation for delivering messenger RNA (mRNA) for in vivo expression to a subject in need thereof.

101. The use according to claim 100, wherein the formulation is administered by pulmonary delivery.

102. The use according to claim 100, wherein the formulation is administered by inhalation.

103. The use according to claim 100, wherein the mRNA encodes cystic fibrosis transmembrane conductance regulator (CFTR), and wherein the subject has cystic fibrosis.

104. Use of a liquid solution reconstituted from the dry powder formulation according to any one of claims 1 - 51 in the preparation of a formulation for delivering messenger RNA (mRNA) for in vivo expression to a subject in need thereof.

105. The use according to claim 104, wherein the reconstituted liquid solution is administered by nebulization.

106. The use according to claim 104, wherein the mRNA encodes cystic fibrosis transmembrane conductance regulator (CFTR), and wherein the subject has cystic fibrosis.

107. A dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray - dried particles, each spray - dried particle comprising one or more nanoparticles encapsulating mRNA encoding a peptide or polypeptide, each nanoparticle comprising: one or more lipids, and one or more polymers, wherein the one or more polymers comprise a polymethacrylate - based polymer having a positively charged tertiary amine group and a methacrylic acid backbone, and wherein: the plurality of spray - dried particles have a residual moisture content of less than 10%; the one or more polymers account for at least 10% of the combined weight of the lipids and polymers; and after storage at 4°C or below for 6 months or longer, the mRNA maintains 90% or higher integrity.

108. The dry powder formulation according to claim 107, wherein after storage at 4°C or below for 12 months or longer, the mRNA has 90% or higher integrity.

109. A dry powder formulation for delivering messenger RNA (mRNA), the dry powder formulation comprising a plurality of spray - dried particles, each spray - dried particle comprising one or more nanoparticles encapsulating mRNA encoding a peptide or polypeptide, each nanoparticle comprising: one or more lipids, and one or more polymers, wherein the one or more polymers comprise a polymethacrylate - based polymer having a positively charged tertiary amine group and a methacrylic acid backbone, and wherein: the plurality of spray - dried particles have a residual moisture content of less than 10%; the one or more polymers account for at least 10% of the combined weight of the lipids and polymers; and after storage at room temperature or below room temperature for 6 months or longer, the mRNA maintains 90% or higher integrity.

110. The dry powder formulation according to claim 107, wherein after storage at 4 o °C or below for 6 months or longer, the mRNA maintains 95% or higher integrity.

111. The dry powder formulation according to claim 107, wherein at least 20% of the plurality of spray-dried particles are fine particles, and the fine particles have a volume median diameter of less than 5 μm.

112. The dry powder formulation according to claim 107, wherein the dry powder formulation is inhalable.

113. The dry powder formulation according to claim 107, wherein the formulation is nebulizable upon reconstitution.

114. The dry powder formulation according to claim 107, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 1-20.

115. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 1-15.

116. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 1-10.

117. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 2-8.

118. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 2-6.

119. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 2-4.

120. The dry powder formulation according to claim 114, wherein the one or more nanoparticles encapsulating the mRNA have a lipid:mRNA (N / P) ratio of 2 or 4.

121. The dry powder formulation according to claim 107, wherein the nanoparticles loaded with mRNA have an encapsulation efficiency of 80% or higher.

122. The dry powder formulation according to claim 107, wherein the one or more nanoparticles loaded with mRNA comprise one or more cationic lipids.

123. The dry powder formulation according to claim 122, wherein the one or more cationic lipids are selected from the group consisting of C12-200, DOTAP (1,2-dioleoyl-3-trimethylammonium propane), DODAP (1,2-dioleoyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, OF-02, ICE (imidazole cholesterol ester), and combinations thereof.

124. The dry powder formulation according to claim 107, wherein the one or more nanoparticles loaded with mRNA comprise one or more PEGylated lipids.

125. The dry powder formulation according to claim 107, wherein the one or more nanoparticles are dual-lipid component LNPs.

126. The dry powder formulation according to claim 107, wherein the one or more mRNA-loaded nanoparticles further comprise one or more neutral lipids or one or more cholesterol-based lipids.

127. The dry powder formulation according to claim 126, wherein the one or more nanoparticles are triple-lipid component LNPs.

128. The dry powder formulation according to claim 107, wherein the one or more polymers account for less than 20% of the total weight.

129. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 15% of the total weight.

130. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 12% of the total weight.

131. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 10% of the total weight.

132. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 9% of the total weight.

133. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 8% of the total weight.

134. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 7% of the total weight.

135. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 6% of the total weight.

136. The dry powder formulation according to claim 128, wherein the one or more polymers account for less than 5% of the total weight.

137. The dry powder formulation according to claim 107, wherein the one or more polymers account for at least 15% of the combined weight of the lipids and polymers.

138. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 20% of the combined weight of the lipids and polymers.

139. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 25% of the combined weight of the lipids and polymers.

140. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 30% of the combined weight of the lipids and polymers.

141. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 35% of the combined weight of the lipids and polymers.

142. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 40% of the combined weight of the lipids and polymers.

143. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 45% of the combined weight of the lipids and polymers.

144. The dry powder formulation according to claim 137, wherein the one or more polymers account for at least 50% of the combined weight of the lipids and polymers.

145. The dry powder formulation according to claim 107, wherein the one or more polymers account for 10% - 90% of the combined weight of the lipid and the polymer.

146. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 80% of the combined weight of the lipid and the polymer.

147. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 70% of the combined weight of the lipid and the polymer.

148. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 60% of the combined weight of the lipid and the polymer.

149. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 50% of the combined weight of the lipid and the polymer.

150. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 40% of the combined weight of the lipid and the polymer.

151. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 30% of the combined weight of the lipid and the polymer.

152. The dry powder formulation according to claim 145, wherein the one or more polymers account for 10% - 20% of the combined weight of the lipid and the polymer.

153. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 20% of the combined weight of the lipid and the polymer.

154. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 25% of the combined weight of the lipid and the polymer.

155. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 30% of the combined weight of the lipid and the polymer.

156. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 35% of the combined weight of the lipid and the polymer.

157. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 40% of the combined weight of the lipid and the polymer.

158. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 45% of the combined weight of the lipid and the polymer.

159. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 50% of the combined weight of the lipid and the polymer.

160. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 55% of the combined weight of the lipid and the polymer.

161. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 60% of the combined weight of the lipid and the polymer.

162. The dry powder formulation according to claim 145, wherein the one or more polymers account for 15% - 65% of the combined weight of the lipid and the polymer.

163. The dry powder preparation according to claim 145, wherein the one or more polymers account for 15% - 70% of the combined weight of the lipid and the polymer.

164. The dry powder preparation according to claim 145, wherein the one or more polymers account for 15% - 75% of the combined weight of the lipid and the polymer.

165. The dry powder preparation according to claim 145, wherein the one or more polymers account for 15% - 80% of the combined weight of the lipid and the polymer.

166. The dry powder preparation according to claim 145, wherein the one or more polymers account for 15% - 90% of the combined weight of the lipid and the polymer.

167. The dry powder preparation according to claim 107, wherein the one or more polymers account for no more than 90% of the combined weight of the lipid and the polymer.

168. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 80% of the combined weight of the lipid and the polymer.

169. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 70% of the combined weight of the lipid and the polymer.

170. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 60% of the combined weight of the lipid and the polymer.

171. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 55% of the combined weight of the lipid and the polymer.

172. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 50% of the combined weight of the lipid and the polymer.

173. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 45% of the combined weight of the lipid and the polymer.

174. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 40% of the combined weight of the lipid and the polymer.

175. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 35% of the combined weight of the lipid and the polymer.

176. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 30% of the combined weight of the lipid and the polymer.

177. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 25% of the combined weight of the lipid and the polymer.

178. The dry powder preparation according to claim 167, wherein the one or more polymers account for no more than 20% of the combined weight of the lipid and the polymer.

179. The dry powder preparation according to claim 107, wherein the polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone is represented by the following formula: , wherein R 1 and R 4 are each independently C 1 -C 6 alkyl; L 1 is independently C 2 -C 6 alkylene; R 1A and R 1B are each independently C 1 -C 6 alkyl; each R 4A is independently C 1 -C 6 alkyl; and d is an integer from 1 to 500.

180. The dry powder preparation according to claim 179, wherein the one or more polymers comprise Eudragit® EPO.

181. The dry powder preparation according to claim 107 further comprises at least one sugar selected from the group consisting of monosaccharides, disaccharides, and polysaccharides.

182. The dry powder preparation according to claim 181, wherein the sugar is selected from the group consisting of glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, and inulin.

183. The dry powder preparation according to claim 107 further comprises xylitol, sorbitol, lactitol, or mannitol.

184. The dry powder preparation according to claim 107 further comprises mannitol.

185. The dry powder preparation according to claim 107 further comprises a pharmaceutically acceptable excipient selected from the group consisting of esters, phosphazenes, amino acids, collagen, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

186. The dry powder preparation according to claim 185, wherein the pharmaceutically acceptable excipient is chitosan.

187. The dry powder preparation according to claim 185, wherein the pharmaceutically acceptable excipient is selected from the group consisting of carbamates and phosphate esters.

188. The dry powder preparation according to claim 185, wherein the surfactant is selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, coconut amide monoethanolamine, coconut amide diethanolamine, glyceryl monostearate, glyceryl monolaurate, sorbitan monolaurate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers.

189. The dry powder preparation according to claim 188, wherein the surfactant is selected from the group consisting of phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, and sphingomyelin.

190. The dry powder preparation according to claim 188, wherein the surfactant is a poloxamer.

191. The dry powder preparation according to claim 190, wherein the surfactant is poloxamer 407.

192. The dry powder preparation according to claim 107, wherein the mRNA encodes a peptide.

193. The dry powder preparation according to claim 107, wherein the mRNA encodes a therapeutic protein.

194. The dry powder preparation according to claim 193, wherein the therapeutic protein is CFTR.

195. The dry powder preparation according to claim 193, wherein the therapeutic protein is ornithine transcarbamylase (OTC).

196. Use of the dry powder preparation according to any one of claims 107-195 in the preparation of a preparation for in vivo delivery of mRNA.

197. Use of the dry powder preparation according to any one of claims 107-195 in the preparation of a preparation for treating a disease or disorder in a patient.

198. The use according to claim 196 or 197, wherein the formulation is administered by inhalation.

199. The use according to claim 196 or 197, wherein the formulation is administered by nasal spray.

200. The use according to claim 196 or 197, wherein the formulation is administered by a metered-dose inhaler.

201. The use according to claim 197, wherein the disease or disorder is selected from cystic fibrosis; asthma; chronic obstructive pulmonary disease (COPD); emphysema; primary ciliary dyskinesia (CILD1) with or without situs inversus; pulmonary fibrosis; Birt-Hogg-Dubé syndrome; hereditary hemorrhagic telangiectasia; α-1 antitrypsin deficiency; X-linked cytochrome b-positive granulomatosis; autosomal recessive cytochrome b-positive granulomatosis; surfactant deficiency; respiratory distress syndrome of the premature infant; tuberculosis; pulmonary viral disease.

202. The use according to claim 201, wherein the disease or disorder is Kartagener syndrome.

203. The use according to claim 201, wherein the disease or disorder is selected from the group consisting of pulmonary surfactant metabolism dysfunction 1, pulmonary surfactant metabolism dysfunction 2, and pulmonary surfactant metabolism dysfunction 3.

204. The use according to claim 201, wherein the disease or disorder is influenza or respiratory syncytial virus (RSV).

205. A method for manufacturing a dry powder formulation, the method comprising: providing a mixture comprising messenger RNA (mRNA), one or more lipids, and a polymer, wherein the polymer comprises a polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone; and spray-drying the mixture to form a plurality of spray-dried particles, wherein each spray-dried particle comprises one or more nanoparticles encapsulating the mRNA, wherein each nanoparticle comprises the one or more lipids, and wherein: the plurality of spray-dried particles have a residual moisture content of less than 10%; the one or more polymers account for at least 10% of the combined weight of the lipids and the polymer; and the mRNA maintains 90% or higher integrity after storage at 4°C or below for 6 months or longer.

206. The method according to claim 205, wherein the one or more lipids are first mixed with the mRNA to form mRNA-loaded lipid nanoparticles before adding the polymer.

207. The method according to claim 205, wherein the one or more lipids, the mRNA, and the polymer are mixed in a single step to form mRNA-loaded lipid-polymer nanoparticles.

208. The method according to any one of claims 205-207, further comprising adding one or more excipients to the mixture before spray-drying.

209. The method according to claim 205, wherein the plurality of spray-dried particles: a) comprise a fraction of fine particles having a volume median diameter of less than 5 μm; b) having a Z-average particle size in the range of 10 - 3000 nm; c) having an N / P ratio in the range of 1 to 20; and / or d) having an mRNA encapsulation efficiency of 80% or higher.

210. The method according to any one of claims 205 - 207, wherein the mRNA encodes a protein or a peptide.

211. The method according to any one of claims 205 - 207, wherein the mRNA encodes a peptide.

212. The method according to any one of claims 205 - 207, wherein the mRNA encodes a therapeutic protein.

213. The method according to claim 212, wherein the therapeutic protein is CFTR.

214. The method according to claim 212, wherein the therapeutic protein is OTC.

215. The method according to any one of claims 205 - 207, wherein the polymethacrylate-based polymer having a positively charged tertiary amine group and a methacrylic acid backbone is represented by the following formula: , wherein R 1 and R 4 are each independently C 1 -C 6 alkyl; L 1 is independently C 2 -C 6 alkylene; R 1A and R 1B are each independently C 1 -C 6 alkyl; each R 4A is independently C 1 -C 6 alkyl; and d is an integer from 1 to 500.

216. The method according to claim 215, wherein the polymer comprises Eudragit® EPO.

Citation Information

Patent Citations

  • Treatment of cystic fibrosis by delivery of codon-optimized mRNA encoding CFTR

    US11173190B2

  • Process of Preparing mRNA-Loaded Lipid Nanoparticles

    US20180153822A1

  • Solid-phase synthesis of polynucleotides

    US4373071A

  • Solid-phase synthesis of polynucleotides

    US4401796A

  • Phosphoramidite compounds and processes

    US4415732A