Adenovirus

By introducing mutations into the early genes of adenovirus and placing the genes encoding proteins V and VII under the control of heterologous promoters to form adenoviral bodies, the problems of low delivery efficiency and high toxicity of adenovirus vectors in gene therapy are solved, achieving efficient and selective delivery of large DNA fragments to tumor cells and enhancing the therapeutic effect.

CN112996918BActive Publication Date: 2026-03-13ERASMUS UNIV MEDICAL CENT ROTTERDAM ERASMUS MC
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-09-17
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing adenovirus vectors suffer from low delivery efficiency, high toxicity, and difficulty in effectively delivering large DNA fragments in gene therapy, especially in delivery to metastatic tumors.

Method used

By introducing Δ24 and/or Δ55k mutations into the early genes of adenovirus, the genes encoding protein V and/or protein VII are placed under the control of a heterologous promoter, forming recombinant adenovirus nucleic acid, which is then packaged into extracellular vesicles to form extracellular vesicles called adenovirions, thereby achieving efficient packaging and delivery of the viral genome.

Benefits of technology

It achieved efficient packaging and delivery of adenovirus genomes, reduced toxicity, and improved delivery efficiency to target cells, especially in tumor cells, enabling selective replication and lysis and enhancing therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0002979692170000011
    Figure HDA0002979692170000011
  • Figure HDA0002979692170000021
    Figure HDA0002979692170000021
  • Figure HDA0002979692170000031
    Figure HDA0002979692170000031
Patent Text Reader

Abstract

This invention relates to recombinant adenovirus nucleic acids in which genes encoding protein V and / or genes encoding protein VII are placed under the control of a heterologous promoter, to recombinant adenovirus nucleic acids in which the adenovirus nucleotide sequence is mutated in a manner that renders it incapable of producing one or more of the capsid proteins, to cell vesicles filled with such adenovirus material, to cells provided with such adenovirus material, and to methods and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to recombinant adenovirus nucleic acids in which genes encoding protein V and / or genes encoding protein VII are placed under the control of a heterologous promoter, to recombinant adenovirus nucleic acids in which the adenovirus nucleotide sequence is mutated in a manner that renders it incapable of producing one or more of the capsid proteins, to cell vesicles filled with such adenovirus material, to cells provided with such adenovirus material, and to methods and uses thereof. Background Technology

[0002] Gene therapy is a treatment method in which genetic material is introduced into cells, where it can replace defective genes or the expression of therapeutic molecules (such as cytokines) or therapeutic antibodies.

[0003] These genes are delivered into cells using appropriate media, such as viral vectors. Viral vectors have the natural ability to infect cells by inserting their DNA into the cells and replicating within them.

[0004] Adenoviruses are commonly used as viral vectors. Adenoviruses are well-characterized non-enveloped viruses associated with respiratory infections and conjunctivitis. (Chu, RL, Clinical Cancer Research, 2004, 10, 5299-5312).

[0005] Adenoviruses are particularly suitable viral vectors because they can infect both replicating and quiescent cells, carry large DNA fragments (up to 30 kbp) without integrating into the host cell's genome. Furthermore, extensive molecular biological knowledge is available, and the viruses can be efficiently purified to high titers.

[0006] Different subtypes of adenovirus exist, with types 2 and 5 being the most commonly used for delivery purposes.

[0007] A fully mature human adenovirus type 5 virus particle is approximately 110 nanometers in size, icosahedral in shape, and contains a nucleus containing double-stranded DNA surrounded by a capsid.

[0008] The main proteins forming the capsid are hexagonal, pentagonal, and fibrin, but the capsid also includes proteins IIIa, VI, VIII, and IX. In this study, fibrin is found to facilitate binding to host cell receptors such as the Coxsackie-Ad receptor (CAR). Furthermore, protein IX was found to play a role in the stability of viral particles (Lee, CS et al., Genes & Diseases, 2017, 4, 43-63).

[0009] The viral nucleus consists of a 36kb double-stranded linear DNA genome and proteins IVa2, V, VII, terminal proteins, μ, and adenoviral protease.

[0010] The genome consists of early genes E1A, E1B, E2, E3 and E4 involved in viral DNA replication, intermediate genes pIX and IVa2 encoding capsid proteins, late genes L1 to L5, and nucleoproteins V and VII.

[0011] To improve the safety of viral vectors, different generations have been developed, each containing specific modifications or deletions to the genome, thereby altering the virus's ability to replicate itself or induce an immune response.

[0012] First-generation adenoviruses contain a deletion of the E1 region to impair viral replication. However, the use of such adenovirus vectors still results in a strong immune response, which is associated with high cytotoxicity.

[0013] Therefore, a second-generation viral vector was developed, in which specific mutations or deletions were made in the E2 and / or E4 genes in addition to the E1 region. Although the immune response was significantly reduced, cytotoxic side effects were still observed.

[0014] Therefore, third-generation or enterovirus-free vectors have been developed in which all genes encoding the enzymes or proteins required for replication are eliminated. However, such viruses present purification challenges because they require the presence of a suitable helper virus. (Jounaidi, Y, Curr Cancer Drug Targets. 2007, 7(3), 285-301).

[0015] In cancer treatment, oncolytic viruses such as conditionally replicating adenoviruses (CRAd) have become powerful tools for selectively targeting cancer cells. This effect can be achieved in different ways.

[0016] First, specific mutations can be introduced into the viral DNA, such as the deletion of 24 base pairs in the E1a gene (AdΔ24) or the deletion of the E1b-55kDa gene (AdΔ1520). This leads to the prohibition of CRAd replication in healthy cells, while in cancer cells, this mutation is compensated for by cellular defects, thereby enabling viral replication and thus causing cancer cell lysis.

[0017] Alternatively, the E1 gene can be placed under a cancer-specific promoter to allow controlled transcription of the E1 region, resulting in selective replication of viral particles only in cancer cells. (Yamamoto, M, Curiel, DT, Molecular Therapy 2010, 18(2), 243-250)

[0018] Furthermore, during cancer cell lysis, oncolytic virus particles are released, which can subsequently infect adjacent (uninfected) cancer cells. This phenomenon is known as the bystander effect and can help improve treatment outcomes. (Lee, CS et al., Genes & Diseases, 2017, 4, 43-63)

[0019] However, the use of adenoviral vectors for gene therapy remains associated with major drawbacks. For example, efficient delivery, especially to metastatic tumors, remains a challenge due to their large size, "stickiness" to cells, inability to be transferred via blood, neutralization by antibodies, and binding / uptake into cells such as erythrocytes or hepatic macrophages.

[0020] Extracellular vesicles (EVs) are organelles typically composed of a lipid bilayer ranging in size from about 50 nm to 1000 nm, which are secreted by the cell. They can form by outward budding (including apoptotic vesicles) through the plasma membrane or inward budding through the endosomal membrane, thus creating multivesicle units, which then release vesicles upon fusion with the plasma membrane (exogenous body). EVs typically contain different types of payloads, depending on the donor cell. These payloads can be processed as waste from the cell and thus disposed of by the EV, or they can be used for intercellular communication, i.e., by delivering the payload from one cell to another. (van der Pol, E et al., Pharmacological Reviews, 64(3), 676-705; Maas, S. et al., Journal of Controlled Release, 2015, 200, 87-96)

[0021] Furthermore, tumor-derived EVs have been shown to play a crucial role in tumor progression and metastasis in animal models through active communication with neighboring cells and their local microenvironment. Tumor EVs are thought to influence immune system homeostasis through several pathways, particularly by inhibiting CD8+ T cell-mediated tumor targeting or suppressing NK cells, thereby creating a protective microenvironment for the tumor. In addition, EVs appear to promote vascular recruitment to improve oxygen supply and facilitate the release of tumor cells into the circulation and their spread to other sites (Becker, A., Cancer Cell, 2016, 30, 836-848).

[0022] Furthermore, EVs can be tissue-specific, depending on their surface protein composition. For example, specific integrins expressed on tumor-secreted EVs lead to adhesion to specific cell types. (Hoshino, A. et al., Nature. 2015, 527(7578):329-335; Costa-Silva, B., Nat Cell Biol. 2015, 17(6):816-826).

[0023] Due to their natural ability to transfer biological contents into recipient cells and their target specificity, there has been recent interest in developing EVs as therapeutic mediators. Indeed, using EVs as therapeutic mediators offers numerous benefits. Because they are naturally present in biological systems, they can penetrate deeper into tissues, thereby improving delivery efficiency. Furthermore, they can cross the blood-brain barrier and are therefore suitable as delivery mediators for targets residing in the brain.

[0024] In addition, EVs can evade the immune system, thereby reducing the clearance of EVs from the system, and EVs do not induce an immunogenic response.

[0025] However, a reliable and reproducible method for loading EVs and packaging large DNA constructs has not yet been established. Generally, small nucleic acids (e.g., short hairpin RNAs) are introduced into EVs using electroporation or sonication. These methods are inefficient, and studies have even reported that such strategies do not result in actual packaging within the EV, but only in aggregation on the outside. (Kooijmans et al. J Control Release. 2013 Nov 28; 172(1):229-238).

[0026] Therefore, there is still a need for a medium that exhibits improved delivery characteristics and reduced toxicity compared to adenovirus vectors, but with similar stacking efficiency and the ability to load large DNA fragments. Summary of the Invention

[0027] The inventors have surprisingly discovered that when cells are infected with adenovirus, a novel particle called an "adenosome" can be obtained, which consists of cellular vesicles loaded with adenoviral nuclei (i.e., the viral genome combined with viral nucleoproteins). The adenosome combines the advantageous properties of cellular vesicles with those of adenovirus.

[0028] Therefore, the present invention provides recombinant adenovirus nucleic acid with mutations in early genes, wherein the gene encoding protein V and / or the gene encoding protein VII is under the control of a heterologous promoter. In a preferred embodiment, the mutation is a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region. In another preferred embodiment, the recombinant adenovirus nucleic acid is an adenovirus nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenovirus vector. It is also preferred that, in the recombinant adenovirus nucleic acid with mutations in early genes according to the present invention, the gene encoding protein V and the gene encoding protein VII are under the control of a heterologous promoter. In one embodiment, the heterologous gene may be inserted into the recombinant adenovirus nucleic acid. In yet another aspect, the present invention provides cell vesicles comprising such recombinant adenovirus nucleic acids with mutations in early genes, wherein the gene encoding protein V and / or the gene encoding protein VII is under the control of a heterologous promoter according to the present invention. In a preferred embodiment, the cell vesicle is an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and contains components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicles are extracellular vesicles. In one embodiment, the recombinant adenoviral nucleic acid with mutations in the early genes comprises both genes encoding proteins V and / or VII under the control of a heterologous promoter and genes encoding proteins V and / or VII under the control of the original promoter, i.e., the late adenoviral promoter. Alternatively, the recombinant adenoviral nucleic acid with mutations in the early genes comprises only genes encoding proteins V and / or VII under the control of a heterologous promoter, and excludes genes encoding proteins V and / or VII under the control of the original promoter, i.e., the late adenoviral promoter. In a preferred embodiment, the adenoviral nucleic acid with mutations in the early genes, wherein the genes encoding protein V and / or protein VII are under the control of a heterologous promoter, is mutated in such a manner that it is no longer able to produce one or more of the major capsid proteins. In another preferred embodiment, one or more late genes encoding the major capsid protein are partially or completely deleted from the nucleotide sequence of the adenoviral nucleic acid, which has a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. In another embodiment, one or more late genes of the adenoviral nucleic acid, which has a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter, are placed under the control of an expression regulator, preferably a Tet-On or Tet-Off system for doxycycline-controlled gene expression.In another preferred embodiment, the mutation in the early gene and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter in an adenoviral nucleic acid such that it can no longer be packaged in the adenoviral capsid, preferably by side-attaching the adenoviral packaging sequence (psi) at the loxP site to establish a Cre-based deletion of the sequence.

[0029] In another aspect, the present invention provides cellular vesicles comprising recombinant adenoviral nucleic acids in which genes encoding protein V and / or proteins encoding VII are placed under the control of a heterologous promoter. In a preferred embodiment, the cellular vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicles are extracellular vesicles. In a preferred embodiment, the nucleic acid does not contain early adenoviral genes and does not contain genes encoding viral capsid proteins. In a particularly preferred embodiment, the nucleic acid does not contain adenoviral nucleic acids other than genes encoding proteins V and / or VII. It is also preferred that, in the recombinant adenoviral nucleic acid, the genes encoding protein V and proteins VII are placed under the control of a heterologous promoter. In one embodiment, the cellular vesicle containing recombinant adenoviral nucleic acid in which the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter further contains a second adenoviral nucleic acid with a heterologous gene or a mutation in an early gene, preferably wherein the mutation is a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region, and / or the recombinant adenoviral nucleic acid is an adenoviral nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenoviral vector. The recombinant adenoviral nucleic acid in which the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter and the second adenoviral nucleic acid with a mutation in an early gene may be present on the same nucleic acid molecule or on two separate nucleic acid molecules. In a preferred embodiment, the adenoviral nucleic acid with a mutation in an early gene and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter is mutated in such a way that it is no longer able to produce one or more of the major capsid proteins. In another preferred embodiment, one or more late genes encoding the major capsid protein are partially or completely deleted from the nucleotide sequence of the adenoviral nucleic acid, which has a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. In another embodiment, one or more late genes of the adenoviral nucleic acid, which has a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter, are placed under the control of an expression regulator, preferably a Tet-On or Tet-Off system for doxycycline-controlled gene expression.In another preferred embodiment, the adenoviral nucleic acid containing a mutation in an early gene, wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter such that it can no longer be packaged in an adenoviral capsid, preferably by side-applying adenoviral packaging (psi) at a loxP site to establish a CRE-based deletion of the sequence. The recombinant adenoviral nucleic acid wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter and the heterologous gene may also be present on the same nucleic acid molecule or on two separate nucleic acid molecules.

[0030] In another aspect, the present invention provides cellular vesicles comprising recombinant adenoviral nucleic acids in which genes encoding protein V and / or protein VII are placed under the control of a heterologous promoter and in which protein V and / or protein VII are fused to a heterologous molecule, particularly encoding a therapeutic protein, an imaging protein, or a protein that can be purified. In a preferred embodiment, the cellular vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicles are extracellular vesicles. In a preferred embodiment, the nucleic acid does not contain early adenoviral genes and does not contain genes encoding viral capsid proteins. In a particularly preferred embodiment, the nucleic acid does not contain adenoviral nucleic acids other than genes encoding protein V and / or protein VII. It is also preferred that, in the recombinant adenoviral nucleic acid, genes encoding protein V and genes encoding protein VII are placed under the control of a heterologous promoter. Protein V and / or VII may be directly fused to the heterologous molecule, preferably a heterologous protein, or alternatively, a linker sequence may be present between protein V / protein VII and the heterologous molecule. Suitable adapters for fusing two protein and / or peptide sequences are well known in the art.

[0031] In another aspect, the present invention provides cellular vesicles comprising adenoviral proteins V and / or VII, and nucleic acid molecules comprising recombinant adenoviral nucleic acids having mutations in early genes. In a preferred embodiment, the cellular vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicles are extracellular vesicles. In a preferred embodiment, the cellular vesicles comprise proteins V and VII. In a preferred embodiment, the mutation is a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region. In another preferred embodiment, the recombinant adenoviral nucleic acid is the adenoviral nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenoviral vector. In a preferred embodiment, the adenoviral nucleic acid having mutations in early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter in a manner that prevents it from producing one or more of the major capsid proteins. In another preferred embodiment, one or more late genes encoding the major capsid protein are partially or completely deleted from the nucleotide sequence of the adenoviral nucleic acid, which has a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. In another embodiment, one or more late genes of the adenoviral nucleic acid having a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter are placed under the control of an expression regulator, preferably a Tet-On or Tet-Off system for doxycycline-controlled gene expression. In another preferred embodiment, the adenoviral nucleic acid having a mutation in the early genes and wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter is mutated in such a way that it can no longer be packaged in the adenoviral capsid, preferably by side-linking adenoviral packaging (psi) at a loxP site to establish a CRE-based recombinase deletion of the sequence. In one embodiment, the heterologous gene may be inserted into the recombinant adenoviral nucleic acid. Preferably, in the recombinant adenovirus nucleic acid, the genes encoding protein V and protein VII are placed under the control of a heterologous promoter.

[0032] In another aspect, the present invention provides cellular vesicles comprising adenoviral protein V and / or protein VII, and nucleic acid molecules comprising heterologous genes. In a preferred embodiment, the cellular vesicle comprises both protein V and protein VII. In a preferred embodiment, the cellular vesicle is an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and comprises components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicle is an extracellular vesicle.

[0033] In another aspect, the present invention provides cellular vesicles comprising adenoviral protein V and / or protein VII, wherein protein V and / or protein VII are fused with a heterologous molecule, particularly a therapeutic protein, imaging protein, or a protein that allows for purification. In a preferred embodiment, the cellular vesicle is an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and comprises components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicle is an extracellular vesicle. In a preferred embodiment, the cellular vesicle comprises both protein V and protein VII, wherein protein V and / or protein VII are fused with a heterologous molecule, preferably wherein both protein V and protein VII are fused with a heterologous molecule. The heterologous molecule fused with protein V and the heterologous molecule fused with protein VII may be the same or different. Protein V and / or VII may be directly fused with the heterologous molecule, preferably a heterologous protein, or alternatively, a linker may be present between protein V / protein VII and the heterologous molecule. Suitable linkers for fusing two protein and / or peptide sequences are well known in the art. The cell vesicles may also contain recombinant adenovirus nucleic acid according to the invention, which has a mutation in an early gene, optionally wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter.

[0034] In another aspect, the present invention provides nucleic acid molecules, such as nucleic acid vectors or plasmids, comprising recombinant adenovirus nucleic acid according to the invention. In one embodiment, the recombinant adenovirus nucleic acid is a recombinant adenovirus nucleic acid having a mutation in an early gene, wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. In another embodiment, the recombinant adenovirus nucleic acid is a recombinant adenovirus nucleic acid wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter and preferably does not contain an early adenovirus gene and does not contain a gene encoding a viral capsid protein, more preferably does not contain adenovirus nucleic acid other than the gene encoding protein V and / or protein VII.

[0035] In another aspect, the present invention relates to recombinant adenovirus nucleic acid in which the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter, preferably selected from early adenovirus promoters, intermediate promoters of protein IX, or heterologous promoters of non-adenovirus origin, such as phosphoglycerate kinase (PGK) or cytomegalovirus promoters.

[0036] Another part of the invention is recombinant adenovirus nucleic acid as defined above, wherein the viral nucleic acid is mutated in such a way that it is no longer able to produce one or more of the major capsid proteins, preferably wherein one or more of the late genes encoding the major capsid proteins are partially or completely deleted from the nucleotide sequence, or wherein one or more of the late genes are placed under the control of an expression regulator, such as a Tet-On or Tet-Off system for doxycycline-induced or controlled gene expression.

[0037] Alternatively, the present invention relates to recombinant adenoviral nucleic acids, wherein the adenoviral nucleotide sequence is mutated in such a way that it is no longer able to produce one or more major capsid proteins, preferably wherein one or more late genes encoding the major capsid proteins are partially or completely deleted from the nucleotide sequence, or wherein one or more late genes are placed under the control of an expression regulator, such as a Tet-On or Tet-Off system for doxycycline-induced or controlled gene expression. In such recombinant adenoviral nucleic acids according to claims 8-10, wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter, preferably selected from early adenoviral promoters, intermediate promoters of protein IX, or heterologous promoters of non-adenoviral origin, such as phosphoglycerate kinase (PGK) or cytomegalovirus promoters.

[0038] In another embodiment, in the recombinant adenovirus nucleic acid of the present invention, protein V and / or protein VII are fused with a heterologous molecule, which is preferably a protein, particularly a therapeutic or imaging protein, or a protein that can be purified, or a nucleic acid molecule encoding a therapeutic or imaging protein, or a protein that can be purified. In a preferred embodiment, the heterologous molecule is selected from green fluorescent protein, red fluorescent protein, ferric oxide, SNAP tags, and biotinylated sequences.

[0039] In another preferred embodiment of the invention, the recombinant adenovirus nucleic acid has an inserted heterologous gene, preferably wherein the heterologous gene encodes a biomolecule selected from the group consisting of: prodrug converting enzymes, preferably thymidine kinase; cytokines, preferably GM-CSF, IL-2, or IL-12; checkpoint inhibitors, preferably targeting CTLA-4 or PD-1; agonistic antibodies or ligands to stimulate immune cells, preferably targeting 4-1BB, OX40, or CD40; recombinant bispecific T cell adaptor antibodies, preferably BiTE; microRNAs, shRNS, Cas9-guided RNA, peptides that inhibit protein kinases, and peptides that stimulate antitumor immune responses.

[0040] In another preferred embodiment, the invention comprises a recombinant adenovirus nucleic acid as described above, wherein the recombinant adenovirus nucleic acid has a mutation in the early gene, preferably a Δ24 mutation in the E1a region or a Δ55k mutation in the E1b region. Also preferred is a recombinant adenovirus nucleic acid according to the invention comprising an RGD sequence fused with fibrin.

[0041] Another part of the invention comprises cells containing recombinant adenovirus nucleic acid according to the invention or nucleic acid molecules according to the invention, preferably HER911, PER.C6 or HEK293T cells.

[0042] Another part of the invention is a method for producing cells according to the invention, the method comprising:

[0043] -Culturing cells in a culture medium;

[0044] - Introduce the recombinant adenovirus nucleic acid as described above into the cells.

[0045] Another part of the present invention is a recombinant adenovirus particle containing recombinant adenovirus nucleic acid according to the present invention.

[0046] The present invention also includes cell vesicles comprising recombinant adenovirus nucleic acid according to the invention or nucleic acid molecules according to the invention, preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs), and comprising components from the plasma membrane of said cells, more preferably extracellular vesicles. The present invention also includes cell vesicles filled with recombinant adenovirus nucleic acid according to the invention, preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs), and comprising components from the plasma membrane of said cells, more preferably extracellular vesicles. Preferably, such cell vesicles comprising or filled with recombinant adenovirus nucleic acid are used to treat diseases, preferably wherein the disease is cancer or wherein the disease is a genetic disorder, particularly a genetic disorder of the brain, liver, or gastrointestinal tract, or wherein the disease is selected from age-related diseases, preferably Alzheimer's disease, Parkinson's disease, or arthritis, or wherein the disease is an infectious disease.

[0047] In another embodiment, cell vesicles containing or filled with recombinant adenovirus nucleic acid are used to monitor viral replication. These cell vesicles are preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the cell's plasma membrane, more preferably extracellular vesicles.

[0048] The present invention also includes a therapeutic composition comprising cell vesicles according to the invention or recombinant adenovirus particles according to the invention and a drug carrier or vesicle, wherein the cell vesicles are preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells, more preferably extracellular vesicles.

[0049] Another part of the invention relates to the use of cell vesicles according to the invention as dyes for use in vitro tissue or cell cultures and organoids, wherein the cell vesicles are preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells, more preferably extracellular vesicles.

[0050] The present invention also includes a method for generating extracellular vesicles according to the invention, the method comprising:

[0051] -Culturing cells in a culture medium;

[0052] - Introducing the recombinant adenovirus nucleic acid according to the invention into the cells;

[0053] - Harvest extracellular vesicles containing or filled with recombinant adenovirus nucleic acid.

[0054] In another aspect, the present invention provides a method for preparing extracellular vesicles, the method comprising:

[0055] -Culturing cells in a culture medium;

[0056] - Introduce recombinant adenovirus nucleic acid, in which the gene encoding protein V and / or the gene encoding protein VII are placed under the control of a heterologous promoter, into the cell;

[0057] - Introduce recombinant adenovirus nucleic acid containing mutations and / or heterologous genes from early genes into cells;

[0058] -Optionally subject cells containing recombinant adenovirus nucleic acid to cellular stress;

[0059] - Harvest extracellular vesicles.

[0060] Furthermore, the present invention relates to a method for treating diseases, particularly genetic disorders, cancer, or age-related diseases, the method comprising: - administering to a subject in need a cell vesicle according to the invention or a therapeutic composition according to the invention, wherein the cell vesicle is preferably an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and contains components from the plasma membrane of said cells, more preferably an extracellular vesicle.

[0061] The present invention also includes a diagnostic method for detecting adenovirus nucleic acid, the method comprising:

[0062] - Administer the recombinant adenovirus according to the invention or cell vesicles filled with the recombinant adenovirus nucleic acid according to the invention to subjects in need;

[0063] - Harvest bodily fluids from the subject;

[0064] - Quantification of adenovirus nucleic acid in cell vesicles. In a preferred embodiment, the cell vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the cell's plasma membrane. In a particularly preferred embodiment, the cell vesicles are extracellular vesicles. Attached Figure Description

[0065] Figure 1 - Adenoviral nucleoproteins V and VII within EVs were detected by mass spectrometry. GS184 glioma cells were infected with wild-type HADV-5. A: EVs were separated from adenovirus particles by ultracentrifugation using an iodixanol density gradient (an internally developed method). B: Western blotting confirmed proper separation of EVs (anti-Rab27b staining) from viral particles (anti-fiber staining). C: Mass spectrometry analysis was performed to compare the protein profiles of cells, virus, and EVs. As expected, both viral capsids and nucleoproteins were detected in both cells and virus. However, EVs appeared to contain only the abundant nucleoproteins (V and VII).

[0066] Figure 2 - EVs from adenovirus-infected cells appeared to contain viral DNA and appeared to be infectious. GS756 cells were infected with conditionally replicating adenovirus (Ad.5.d24.RGD.GFP), and after 72 h, the supernatant was subjected to iodixanol density gradient centrifugation to separate EVs (top region) from viral particles (bottom region). Different fractions were subjected to different assays: A. EV-Quant assay, showing EVs in the top fraction; B. Quantitative PCR (targeting viral fibrillary gene sequencing), showing viral DNA present at the bottom (as expected) but also at the top; C. Infectivity assay for A549 cells, demonstrating the ability of EVs to infect cells.

[0067] Figure 3 - Detection of pV fused to GFP in EVs after cell infection with pV.GFP adenovirus. A: Using our internally developed EV-Quant assay, not only red fluorescent particles (labeled EV membranes) but also green fluorescent particles were observed. Therefore, three types of particles were detected: green particles only = virus particles, red particles only = empty EVs, and red + green particles = EVs loaded with pV.GFP (adenoviruses). B: A large number of adenoviruses were detected in the supernatant 64 hours after GS184 cell infection. C: Adenovirus secretion occurred in different cell types (GS562, HER911, A549). The type of culture medium can affect adenovirus secretion; for example, EV production increased for HER911 cells cultured in serum-free DMEM. D: The concentration of adenoviruses in the cell supernatant increased over time.

[0068] Figure 4 - Adenovirion levels correlated with adenovirus infectivity levels after cancer cell infection. This opens up opportunities for adenovirions as a biomarker platform. A: Adenovirion levels were determined by EVQuant assays of the supernatant (6 days post-infection) after infecting four different primary glioblastoma cultures with pV.GFP adenovirus. Cell viability was determined using an ATP-based cell viability assay. B: Pooled linear regression analysis of adenovirion concentration and cell viability. Both plots show a strong negative correlation between adenovirion concentration and cell viability.

[0069] Figure 5 - Comparison of tissue penetration of adenoviral agents and viral particles into glioblastoma neurospheres. Adenoviral agents and viral particles were isolated from HER911 cells infected with HAdV-5Δ24.RGD.GFP using an iodixanol density gradient program. Adenoviral agents and viral particles were administered to GS neurospheres in equal infectious units. Six days later, confocal microscopy was performed to analyze GFP expression in the neurospheres. The mean number of GFP-positive cells at different depths in the neurosphere is indicated (5 spheres per condition).

[0070] Figure 6-A: Heterologous expression of pV / pVII leads to enhanced DNA incorporation into EVs. HER911 cells were transfected with plasmid DNA: pUC57.CMV.Crimson_CMV.eGFP (empty plasmid) or pUC57.CMV.Crimson-pVII_CMV.eGFP-pV (EV-loaded plasmid). One day later, cells were infected with adenovirus (wild-type HADV-5), and three days later, EVs were isolated using an iodixanol density gradient method (EVs in fractions 4 to 7). B: Q-PCR was used to quantify DNA incorporation in EVs. This clearly shows that heterologous expression of pV / pVII further enhances the incorporation of viral genomic DNA (top figure). Furthermore, in the case of pV / pVII expression plus viral infection, pUC57 DNA was also incorporated into EVs at an increased level (bottom figure). Detailed Implementation

[0071] It has been found that when cells are infected by adenovirus, they secrete extracellular vesicles containing adenoviral material that can be used as a medium for the delivery of biological substances (Aksela, L, University of Helsinki, Delivery of oncolytic adenovirus via extracellular vesicles; Dourad, MR et al., Journal of Extracellular Vesicles, June 2017 (Supplement 1), extracellular vesicles derived from cancer-associated fibroblasts may have a role in oral cancer invasion; Garofalo, M., Journal of Extracellular Vesicles, June 2017 (Supplement 1), Oncolyticadenoviruses encapsulated into the extracellular vesicles as carriers for targeted drug delivery, Garofalo, M., J Control Release. 2018, 283, 223-234).

[0072] The inventors have now surprisingly discovered that cellular vesicles, such as extracellular vesicles called "adenovirions," possess unique properties of great therapeutic value, for example, in delivering biological carriers to target cells. This discovery is surprising because extracellular vesicles typically exhibit a limited stacking capacity. Upon detailed evaluation of these adenovirions, it was observed that the adenovirions package viral DNA bound to viral nucleoproteins V and VII, while capsid proteins (such as hexagonal, pentagonal, and fibrin) are absent. Therefore, the inventors recognize that proteins V and VII play a crucial role in the tight stacking of viral DNA, allowing it to adhere to the extracellular vesicle. In fact, as... Figure 6 As shown in Figure B, nucleic acids containing genes encoding pV and pVII can increase the incorporation of adenovirus DNA into extracellular vesicles (top figure).

[0073] It is also envisioned that adenoviruses with the potential to be effectively accumulated in cellular vesicles would have significant therapeutic value. Therefore, this invention relates to recombinant adenoviral nucleic acids in which the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. The recombinant adenoviral nucleic acid according to the invention may be an adenoviral nucleic acid having one or both of the genes encoding protein V and protein VII; that is, it may be a full-length adenoviral nucleic acid or may be a gene encoding only one of these two proteins. Furthermore, it may include additional mutations and / or deletions relative to naturally occurring adenoviruses.

[0074] Therefore, the present invention covers several aspects. In one aspect, the present invention relates to a novel oncolytic adenovirus whose genome is increased in secretion into cellular vesicles through enhanced or earlier expression of pV and / or pVII, thereby providing an improved oncolytic adenovirus with improved diffusion and killing effects. This novel adenovirus may be an adenovirus with mutations in an early gene and wherein the gene encoding pV and / or pVII is placed under the control of a heterologous promoter, while retaining the original pV and / or pVII intact or having invalid or missing original pV and / or pVII. Alternatively, the pV and / or pVII under the control of a heterologous promoter and the oncolytic adenovirus are provided alone, but may also be provided in combination. Such adenoviruses express pV and / or pVII early in the cellular process and promote the packaging of adenoviral nucleic acid into cellular vesicles.

[0075] In another aspect, the present invention relates to the use of pV and / or pVII for loading adenovirus or heterologous DNA or heterologous protein or peptide, or combinations thereof, into cellular vesicles, wherein these protein or peptide sequences are optionally loaded at high levels into the cellular vesicles by fusing the heterologous protein or peptide with pV and / or pVII, thereby providing the cellular vesicles as therapeutic agents for a variety of diseases. The cellular vesicles are secreted after, for example, the introduction of two separate recombinant nucleic acid molecules into the cell. One nucleic acid molecule contains a gene encoding pV and / or pVII, optionally fused with a sequence of a therapeutic protein, wherein said gene is under the control of a heterologous promoter. The other nucleic acid molecule contains adenovirus nucleic acid with a mutation in the early gene and / or heterologous gene. When introduced into the cell, the producing cell secretes cellular vesicles containing the adenovirus nucleic acid and / or the heterologous gene. Alternatively, a single nucleic acid molecule containing a gene encoding pV and / or pVII and optionally fused with a sequence of a therapeutic protein, and adenovirus nucleic acid with a mutation in the early gene and / or heterologous gene, is used. Unbound by theory, it is believed that pV and / or pVII are expressed in cells by nucleic acids containing genes encoding pV and / or pVII, wherein the genes are placed under a heterologous promoter and promote the packaging of nucleic acid molecules into cellular vesicles.

[0076] As used herein, the term "cellular vesicle" refers to a cell-derived vesicle having a membrane enclosing its internal space. These vesicles are prepared and / or obtained, for example, using the methods according to the invention described below and in the examples herein.

[0077] A preferred example of a cellular vesicle as used herein is an extracellular vesicle. Extracellular vesicles (EVs) are organelles made of a lipid bilayer typically ranging in size from about 50 nm to 1000 nm, which are secreted from the cell. They form by outward budding (including apoptotic vesicles) through the plasma membrane or inward budding through the endosomal membrane, thereby generating multivesicle units, which then release vesicles upon fusion with the plasma membrane (exogenous body). Extracellular vesicles can be prepared by culturing suitable production cells in a suitable culture medium, introducing the recombinant adenovirus nucleic acid according to the invention and optionally a heterologous gene into the cells, and harvesting the extracellular vesicles.

[0078] Alternatively, loaded cellular vesicles can also be generated via a “destruction of cells and vesicle reformation” protocol, such as Hoogduijn et al. 2017 ( FDC, Luk F, Korevaar SS, Bouzid R, Paz AH, López-Iglesias C, Baan CC, Merino A, Hoogduijn MJ. Membrane particles generated from mesenchymal stromal cells modulate immune responses by selective targeting of pro-inflammatory monocytes. Sci Rep. 2017 Sep 21; 7(1):12100) and WO 2017 / 204639. Therefore, pV and / or pVII, as well as, for example, heterologous DNA or oncolytic adenoviruses, are expressed in producing cells such as mesenchymal stem cells (also known as mesenchymal stromal cells; MSCs), followed by subsequent cell disruption (e.g., by osmotic shock), nucleus removal, cell grading (e.g., by needle insertion), and vesicle reformation. These cellular vesicles contain components (including lipids and proteins) from the plasma membrane of the producing cells and have an average particle size between 70 nm and 170 nm. The MSCs used to prepare such cell vesicles are preferably derived from adipose tissue, preferably human adipose tissue. Such cell vesicles according to the invention are prepared, for example, by the method described by Hoogduijn et al. 2017, whereby the recombinant adenovirus nucleic acid according to the invention and optionally a heterologous gene are introduced into the cells prior to cell lysis.

[0079] Therefore, in a preferred embodiment, the cell vesicles according to the invention are extracellular vesicles or vesicles derived from lysed cells (preferably lysed MSCs), and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cell vesicles according to the invention are extracellular vesicles.

[0080] A heterologous promoter can be any type of promoter that, in its natural state, is not located at that specific location and / or does not drive the expression of the protein preceding it. It can be a promoter from a heterologous organism, such as a promoter from cytomegalovirus or any other constitutive promoter that functions in adenovirus and / or host cells expressing adenovirus nucleic acid. Expression of one or both of proteins V and VII in the cell enables the packaging of DNA fused to the therapeutic protein moiety, along with pV and / or pVII, within cellular vesicles.

[0081] Alternatively, it can be an adenovirus promoter, such as the intermediate promoter pIX or any early adenovirus promoter. An early promoter is a promoter that drives the expression of so-called early genes (i.e., genes first expressed after viral infection). By placing genes under the control of an early promoter, these genes are transcribed first during viral replication. Therefore, efficient stacking of viral DNA can be achieved when genes encoding proteins V and VII are placed under the control of an early promoter.

[0082] However, when cells are infected with such adenovirus particles, redundant capsid (or outer shell) proteins are still produced for the preparation of adenoviruses. Therefore, in another alternative embodiment, the recombinant adenovirus nucleic acid is mutated in a manner that prevents the production of one or more of the major capsid proteins. Advantageously, such adenovirus nucleic acid allows for the production of adenovirus material that does not elicit an immune response.

[0083] Several methods exist for obtaining recombinant adenoviral nucleic acids that cannot produce major capsid proteins. For example, the nucleic acid can be mutated so that one or more, preferably all, of the late-stage genes encoding the major capsid proteins are completely or partially deleted. From a production economics perspective, adenoviral vectors lacking genes encoding these major capsid proteins make the system more efficient by eliminating viral genome incorporation into viral particles and promoting viral genome incorporation into EVs. Furthermore, removing redundant genes from the adenoviral genome enhances the ability to achieve heterologous genes.

[0084] In an alternative embodiment, transcription of the late gene is reversibly turned on or off via tetracycline-controlled transcriptional activation. In the absence of tetracycline, the binding of the Tet repressor to the Tet operon blocks the expression of the late gene. This repression is reversed in the presence of tetracycline or certain derivatives thereof, such as doxycycline. Therefore, the invention also relates to recombinant adenovirus nucleic acid in which one or more late genes are placed under the control of an expression regulator, preferably a Tet-On or Tet-Off system for doxycycline-induced or controllable gene expression.

[0085] The advantage of this type of adenoviral nucleic acid is that, for example in cell cultures, the expression of late genes can still be utilized, thereby allowing the adenovirus to replicate efficiently, while, for example when used in the method according to the invention, the expression of late genes can be turned off.

[0086] Another part of the invention is a recombinant adenovirus nucleic acid according to the invention, wherein the adenovirus nucleic acid is mutated in a manner that prevents it from being packaged in an adenovirus capsid. This is preferably achieved by lateralizing the adenovirus packaging sequence (psi) at the loxP site. This results in the deletion of the Cre-based recombinase of the psi sequence. Cre-lox recombination is well known in the art and is frequently used to generate enterovirus-free constructs. Therefore, those skilled in the art know how to achieve this. Any method that results in the deletion of the Cre-based recombinase of the packaging gene can be used. Suitable examples are described by Parks et al. (Parks RJ, Chen L, Anton M, Sankar U, Rudnicki MA, Graham FL. A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc Natl Acad Sci US A., 26 Nov 1996; 93(24):13565-70).

[0087] In a preferred embodiment, the viral nucleic acid comprises a combination of the above-described mutations. Therefore, in one embodiment, the invention preferably relates to recombinant adenoviral nucleic acid in which the gene encoding nucleoprotein V and / or the gene encoding nucleoprotein VII is placed under a heterologous promoter, preferably an early adenoviral promoter, an intermediate protein IX promoter, or a promoter derived from a heterologous organism (particularly cytomegalovirus), to ensure efficient adenovirial formation, and wherein the adenoviral nucleic acid is mutated in such a way that it is no longer able to produce one or more of the major capsid proteins. Preferably, it relates to adenoviral nucleic acid in which one or more late genes encoding the major capsid protein are partially or completely deleted, or wherein one or more late genes are placed under the control of an expression regulator, preferably a Tet-On or Tet-Off system for doxycycline-induced or controlled gene expression.

[0088] As discussed in the introductory paragraph, track records have confirmed that adenoviral vectors serve as powerful vectors for delivering (large) heterologous genes into cells. This delivery occurs without the virus and heterologous sequence integrating into the host genome, providing additional safety.

[0089] Furthermore, adenovirus vectors have been shown to be effective vaccine vectors, outperforming common vaccine vectors such as poxvirus vectors, naked DNA vaccines, and alpha-virus vectors in inducing protective immune responses. Therefore, this invention also relates to adenovirus vectors used as vaccine vectors for heterologous genes capable of inducing protective immune responses in subjects.

[0090] Several methods are known in the art for inserting heterologous genes into adenovirus DNA. This can be achieved, for example, using next-generation gene-editing methods (e.g., CRISPR-Cas) and / or using classic recombinant DNA techniques. Those skilled in the art will know how to do this.

[0091] As used herein, the term "heterologous gene" refers to any gene heterologous to adenovirus nucleic acid. In principle, any heterologous gene deemed useful may be inserted, such as genes encoding molecules with therapeutic effects, genes inducing protective antibody titers, or genes encoding molecules that can be used for reporter (imaging) purposes. In a preferred embodiment, the heterologous gene encodes a biomolecule selected from the group consisting of: prodrug-converting enzymes, preferably thymidine kinase; cytokines, preferably GM-CSF, IL-2, or IL-12; checkpoint inhibitors, preferably targeting CTLA-4 or PD-1; agonistic antibodies or ligands to stimulate immune cells, preferably targeting 4-1BB, OX40, or CD40; recombinant bispecific T-cell adaptor antibodies, preferably BiTE; microRNAs, shRNS, Cas9-guided RNA, peptides that inhibit protein kinases, and peptides that stimulate antitumor immune responses.

[0092] A group of therapeutic genes that has attracted considerable attention is the group of prodrug-activating genes (also known as suicide genes). These genes encode enzymes that catalyze the conversion of (non-toxic) prodrugs into (toxic) drugs.

[0093] In one implementation, the heterologous gene to be inserted is the gene encoding herpes simplex virus thymidine kinase (HSV-tk). Transfer of the HSV-tk gene makes the cells sensitive to treatment with substances capable of killing cancer cells, such as ganciclovir.

[0094] Thymidine kinase is involved in the phosphorylation of ganciclovir, a nucleotide analog that becomes cytotoxic upon phosphorylation by blocking DNA replication, thereby selectively killing dividing cells. Furthermore, the cytotoxic effect of phosphorylated ganciclovir has been found to extend further to adjacent untransfected cells. Therefore, HSV-tk gene transfer and ganciclovir administration are particularly suitable for the treatment of solid tumors. (Sandmair, AM et al., Cancer Gene Therapy, 2000, 7(3), 413-421).

[0095] Furthermore, the adenoviral nucleic acid and cellular vesicles according to the invention are particularly suitable for treating genetic disorders, wherein the cellular vesicles are preferably extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells, more preferably extracellular vesicles containing or filled with such substances. These genetic disorders may be hereditary or acquired, but in either case, they are caused by abnormalities in the genome. Depending on the abnormality, functional genes may be introduced to correct or suppress defective genes.

[0096] Therefore, the present invention also relates to recombinant adenovirus nucleic acid in which a heterologous gene having therapeutic activity or, in other words, beneficial effect in genetic disorders is inserted.

[0097] Specifically, the present invention relates to adenoviral nucleic acids, wherein a heterologous gene encodes a biomolecule selected from the group comprising: prodrug converting enzymes, preferably thymidine kinases or ligands, such as peptides that inhibit protein kinases; cytokines, preferably GM-CSF, IL-2 or IL-12; checkpoint inhibitors, preferably targeting CTLA-4 or PD-1; agonist antibodies or ligands to stimulate immune cells, preferably antitumor immune responses, particularly targeting 4-1BB, OX40 or CD40; recombinant bispecific T cell adaptor antibodies, preferably BiTE; microRNA, shRNS; Cas9 guide RNA encoding DNA to correct defective genes.

[0098] As shown in the embodiments, proteins V and VII promote the incorporation of additional nucleic acid molecules into extracellular vesicles. Therefore, as an alternative form of inserting a heterologous gene into adenoviral nucleic acid, the heterologous gene may be provided in combination with proteins V and / or VII (preferably proteins V and VII) or genes encoding proteins V and / or VII (preferably proteins V and VII), but may also be provided separately. In this embodiment, the heterologous gene may be combined with recombinant nucleic acids according to the invention in which the genes encoding protein V and / or protein VII are placed under the control of a heterologous promoter and do not contain early adenoviral genes and do not contain genes encoding viral capsid proteins. For example, the heterologous gene may be combined with recombinant nucleic acids according to the invention that do not contain adenoviral nucleic acids other than the genes encoding proteins V and / or VII placed under the control of a heterologous promoter.

[0099] Therefore, the present invention also provides cell vesicles comprising a nucleic acid molecule and a heterologous gene, wherein the nucleic acid molecule contains recombinant adenoviral nucleic acid in which a gene encoding protein V and / or a gene encoding protein VII (preferably protein V and protein VII) is placed under the control of a heterologous promoter. In a preferred embodiment, the nucleic acid does not contain an early adenoviral gene and does not contain a gene encoding a viral capsid protein. In a particularly preferred embodiment, the nucleic acid does not contain adenoviral nucleic acid other than the gene encoding protein V and / or protein VII. The heterologous gene may be present on the same nucleic acid molecule (such as a vector or plasmid) as the gene encoding protein V and / or the gene encoding protein VII, or the heterologous gene may be present on a different nucleic acid molecule than the nucleic acid molecule containing the gene encoding protein V and / or the gene encoding protein VII. In a preferred embodiment, the cell vesicle is an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and contains components from the plasma membrane of said cells. In a particularly preferred embodiment, the cell vesicle is an extracellular vesicle.

[0100] The present invention also relates to cellular vesicles comprising protein V and / or protein VII, and nucleic acid molecules comprising heterologous genes. Optionally, said protein V and / or protein VII, preferably protein V and protein VII, are fused with heterologous molecules, particularly therapeutic proteins, imaging proteins, or proteins that allow for purification. This will be further detailed below. In a preferred embodiment, the cellular vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicles are extracellular vesicles.

[0101] In principle, cell vesicles may contain any heterologous genes deemed useful, as detailed above, such as genes encoding molecules with therapeutic effects, genes inducing protective antibody titers, or genes encoding molecules that can be used for reporting (imaging) purposes.

[0102] Another approach to delivering therapeutic biomolecules to recipient cells is by fusing viral protein V and / or protein VII with heterologous proteins, particularly therapeutic proteins, imaging proteins, proteins that allow purification, peptides that inhibit protein kinases, or peptides that stimulate antitumor immune responses.

[0103] Fusion of protein V and / or protein VII with an imaging protein allows for the monitoring of adenoviruses or cellular vesicles containing the fusion protein in a subject. Essentially, any imaging protein that can be linked to protein V or protein VII is suitable. Examples of suitable imaging molecules include green fluorescent protein, red fluorescent protein, affinity tags for magnetic separation (such as iron oxide), SNAP tags, or biotinylated sequences. Linking the protein can be performed by fusing the viral gene of protein V or protein VII with a nucleic acid encoding the protein of interest. Alternatively, an adaptor system such as the streptavidin-biotin system can be used to conjugate the protein to protein V or protein VII fused to an adaptor tag.

[0104] Imaging proteins, when fused with pV / pVII as described above or expressed as a single protein from adenoviral vector nucleic acid, driven for example by a CMV promoter or a tissue / cell-specific promoter, or even when contained within the same vesicle but separated from the adenoviral sequence, are suitable for disease detection or diagnosis or for monitoring particle distribution because their fluorescence or magnetism can be detected in biological systems. Therefore, such labeled adenoviral nucleic acids are also suitable for use as dyes or labeling molecules. Specifically, these can be used in in vitro or ex vivo systems such as cell and tissue cultures. One promising application is the use of the cellular vesicles of the present invention as dyes for labeling tissue or cell cultures and organoids (i.e., tissue-cultured organoid systems). There, they can be used to locate cell-specific compounds, identify potential drug targets, express fluorescent colors in specific cell types, etc.

[0105] Imaging equipment can be any suitable imaging device for detecting the markers. For example, to detect fluorescence, fluorescence microscopy, fluorescence-activated cell sorting, or ultraviolet light can be used. Emission can be used to detect markers that induce luminescence signals, such as firefly luciferase or Renilla luciferase. To detect magnetic nanoparticles or proteins, magnetic resonance imaging (MRI) or suitable staining agents such as manganese peroxidase can be employed. The markers can also be tags that can be used to pull down pV and / or pVII along with the associated DNA. This pull-down can be used, for example, to provide biomarkers for the replication of oncolytic adenoviruses.

[0106] Therefore, another aspect of the present invention relates to a diagnostic method for detecting adenovirus nucleic acid, comprising:

[0107] - Administer the recombinant adenovirus nucleic acid according to the invention or cell vesicles filled with the recombinant adenovirus nucleic acid according to the invention to subjects in need;

[0108] - Harvest bodily fluid samples from the subject;

[0109] - Quantify adenovirus nucleic acid in cell vesicles.

[0110] The fusion of protein V and / or protein VII with a therapeutic protein allows for the generation of cellular vesicles containing that therapeutic protein. Such cellular vesicles can be used to treat a variety of diseases, such as infectious diseases, cancer, age-related diseases, preferably Alzheimer's disease, Parkinson's disease, or arthritis, and genetic disorders, particularly those of the brain, liver, heart, and gastrointestinal tract, as further detailed below. Any therapeutic protein can be fused with protein V and / or protein VII. Examples include peptides that inhibit protein kinases and peptides that stimulate antitumor immune responses. In a preferred embodiment, the therapeutic protein is a tumor antigen protein or a tumor antigen peptide. Cellular vesicles containing protein V and / or protein VII fused with a tumor antigen peptide are particularly useful for treating cancer. Tumor antigen peptides are generated through the degradation of tumor antigen proteins, which are tumor-specific proteins. Tumor antigen peptides bind to HLA class antigens (HLA antigens), which are transported to the cell surface for antigen presentation. Tumors can be treated by using tumor antigen proteins or tumor antigen peptides as so-called cancer vaccines to enhance tumor-specific CTLs in cancer patients. In a preferred embodiment, the cell vesicles comprise protein V and / or protein VII fused to a therapeutic protein (preferably a tumor antigen protein or tumor antigen peptide), and recombinant adenovirus nucleic acid according to the invention, which has a mutation in an early gene, preferably wherein the mutation is a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region, more preferably wherein the recombinant adenovirus nucleic acid is an adenovirus nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenovirus vector.

[0111] In another embodiment, the present invention relates to recombinant adenovirus nucleic acids having mutations in the nucleotide sequence of early genes. Such mutations can lead to viral replication defects, as is the case with adenovirus particles, wherein the E1 region, both E1 and E2 regions, E1 and E4, E1, E2 and E4, or all early genes are missing. Alternatively, specific mutations in early genes are known, such as the Δ24 mutation in the E1a gene, which induces specific viral replication only in cancer cells. Furthermore, specific mutations may also include the introduction of organ-specific promoters that make the virus specific to that particular organ, such as the brain or prostate. Therefore, adenovirus particles according to the present invention and carrying such mutations are particularly suitable for cancer treatment.

[0112] Preferably, the present invention relates to recombinant adenovirus nucleic acid containing a Δ24 mutation in the E1a region and / or a Δ55 mutation in the E1b region, and adenovirus particles containing said nucleic acid.

[0113] In another preferred embodiment, the present invention relates to recombinant adenovirus nucleic acid, wherein the recombinant adenovirus nucleic acid is an adenovirus nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenovirus vector, particularly an oncolytic adenovirus vector.

[0114] In another embodiment, the present invention relates to viral particles comprising recombinant adenovirus nucleic acid having an integrin recognition motif such as the RGD sequence (Arg-Gly-Asp), which enables the virus to bind to certain members of the integrin family, which act as entry receptors for the virus into (mammalian) cells. Preferably, the RGD sequence is fused with fibrin.

[0115] Furthermore, the present invention relates to cell vesicles comprising any recombinant adenovirus nucleic acid according to the present invention. In one embodiment, the present invention also relates to cell vesicles filled with recombinant adenovirus nucleic acid according to the present invention.

[0116] In a preferred embodiment, the cell vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the cell's plasma membrane. In a particularly preferred embodiment, the cell vesicles are extracellular vesicles.

[0117] Also preferred are cellular vesicles containing recombinant adenoviral nucleic acids in which the gene encoding protein V and / or the gene encoding protein VII (preferably the genes encoding both protein V and protein VII) are placed under the control of a heterologous promoter. Such EVs preferably also contain adenoviral nucleic acids with a heterologous gene or alternatively with a mutation in an early gene. Therefore, the invention also includes cellular vesicles containing…

[0118] -A nucleic acid molecule containing recombinant adenovirus nucleic acid in which the gene encoding protein V and / or the gene encoding protein VII are placed under the control of a heterologous promoter, and a heterologous gene; or

[0119] - Nucleic acid molecules containing recombinant adenovirus nucleic acids in which the gene encoding protein V and / or the gene encoding protein VII are placed under the control of a heterologous promoter, and nucleic acid molecules containing heterologous genes.

[0120] The present invention also relates to cellular vesicles comprising protein V and / or protein VII, preferably protein V and protein VII; and

[0121] - Nucleic acid molecules containing recombinant adenovirus nucleic acids with mutations in early genes; and / or

[0122] - Heterologous gene. In a preferred embodiment, the mutation in the early gene of the recombinant adenovirus nucleic acid is a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region. In another preferred embodiment, the recombinant adenovirus nucleic acid is the adenovirus nucleic acid of a conditionally replicating adenovirus and / or a replication-defective adenovirus vector. In one embodiment, the nucleic acid molecule containing the recombinant adenovirus nucleic acid with a mutation in the early gene also contains a heterologous gene. In another embodiment, the heterologous gene is present on a nucleic acid molecule different from the nucleic acid molecule containing the recombinant adenovirus nucleic acid.

[0123] In principle, cell vesicles may contain any heterologous genes deemed useful, as detailed above, such as genes encoding molecules with therapeutic effects, genes inducing protective antibody titers, or genes encoding molecules that can be used for reporting (imaging) purposes.

[0124] Compared to standard adenovirus vectors, these cellular vesicles (adenovirions) according to the invention offer several advantages as therapeutic delivery media. Due to their lipid bilayer coating, delivery of viral DNA over long distances, deep into tissues, or across the blood-brain barrier is significantly improved. This effect is achieved, in particular, by the fact that the vesicles allow shielding against neutralizing antibodies, thereby allowing for longer circulation times within the system.

[0125] Furthermore, cell vesicles are non-immunogenic, and therefore exhibit lower toxicity compared to common viral vectors.

[0126] Therefore, the cellular vesicles of the present invention are suitable for the prevention and treatment of various diseases. Examples include infectious diseases, cancer, age-related diseases, preferably Alzheimer's disease, Parkinson's disease, or arthritis, as well as genetic disorders, particularly those affecting the brain, liver, heart, and gastrointestinal tract.

[0127] Preferably, the cell vesicles of the present invention are used to treat or prevent cancer, genetic disorders, infectious diseases, or age-related disorders.

[0128] Therefore, the present invention also provides a method for treating diseases, particularly genetic disorders, cancer, infectious diseases, or age-related diseases, the method comprising:

[0129] - Administer the cell vesicles according to the invention to the subject in need. In a preferred embodiment, the cell vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cell vesicles are extracellular vesicles.

[0130] In cancer treatment, the cell vesicles preferably comprise conditionally replicating adenovirus and / or replication-deficient adenovirus vectors. In one embodiment, the cell vesicle comprises recombinant adenovirus nucleic acid according to the invention, wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter, the recombinant adenovirus nucleic acid having a mutation in an early gene and being a conditionally replicating adenovirus and / or replication-deficient adenovirus vector. In another embodiment, the cell vesicle comprises:

[0131] -Genes encoding protein V and / or protein VII, or genes encoding protein V and / or protein VII, which are placed under the control of heterologous promoters; and

[0132] - A recombinant adenovirus nucleic acid with a mutation in the early gene, wherein the recombinant adenovirus nucleic acid is a conditionally replicating adenovirus and / or a replication-defective adenovirus vector. In both alternative forms, the mutation in the early gene of the recombinant adenovirus nucleic acid is preferably a Δ24 mutation in the E1a region and / or a Δ55k mutation in the E1b region.

[0133] Also particularly suitable for treating cancer are cell vesicles according to the invention in which protein V and / or protein VII are fused with a therapeutic protein, preferably a tumor antigen protein or a tumor antigen peptide. Such cell vesicles may also contain recombinant adenovirus nucleic acid according to the invention, which has a mutation in an early gene, optionally wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter.

[0134] In the treatment of infectious diseases, age-related diseases (preferably Alzheimer's disease, Parkinson's disease, or arthritis) and genetic disorders (especially genetic disorders of the brain, liver, heart, and gastrointestinal tract), and also alternatively in the treatment of cancer, the cell vesicles according to the invention preferably contain heterologous genes.

[0135] In one embodiment, a heterologous gene is inserted into a recombinant adenovirus nucleic acid according to the invention, wherein the gene encoding protein V and / or the gene encoding protein VII is placed under the control of a heterologous promoter. The recombinant adenovirus nucleic acid may be any of the following:

[0136] - Adenoviral nucleic acid, wherein the adenoviral nucleic acid has a mutation in an early gene and wherein the gene encoding protein V and / or the gene encoding protein VII is under the control of a heterologous promoter, preferably a conditionally replicating adenovirus and / or a replication-defective adenovirus vector, or

[0137] - Adenoviral nucleic acid, wherein the gene encoding protein V and / or the gene encoding protein VII are placed under the control of a heterologous promoter and the adenoviral nucleic acid does not contain early adenoviral genes and does not contain genes encoding viral capsid proteins, preferably the adenoviral nucleic acid does not contain adenoviral nucleic acids other than the genes encoding protein V and / or protein VII.

[0138] In another embodiment, the heterologous gene is present on a nucleic acid molecule that is different from the nucleic acid molecule containing the gene encoding protein V and / or the gene encoding protein VII, which is placed under the control of a heterologous promoter.

[0139] In another embodiment, the cell vesicle contains adenovirus protein V and / or protein VII and a heterologous gene, preferably the cell vesicle contains adenovirus protein V and / or protein VII and a nucleic acid molecule containing a heterologous gene.

[0140] The present invention also relates to a method for generating extracellular vesicles according to the invention, the method comprising:

[0141] -Culturing cells in a culture medium;

[0142] - Introducing the recombinant adenovirus nucleic acid according to the invention into the cells;

[0143] - Harvest extracellular vesicles containing or filled with recombinant adenovirus nucleic acid.

[0144] Depending on the therapeutic goal of EV, this method can utilize a variety of cell lines. Suitable cell lines include human embryonic retina (HER) 911, PER.C6, mesenchymal stem cells (MSCs), neural stem cells (NSCs), HEK293T, A549 (lung epithelial carcinoma), and primary human glioblastoma cells.

[0145] Cells can be cultured using any suitable method known in the art, and a technician will know how to do so.

[0146] Cells can be cultured using any suitable medium for growth. Particularly good results were obtained when cells were cultured in Dalberg's Modified Eagle Medium (DMEM) or NS (neurospheric, serum-free) medium.

[0147] Various additives can be added to the growth medium to further support cell growth.

[0148] To obtain optimal performance, cells are preferably cultured at 37°C in an incubator.

[0149] The introduction of recombinant adenovirus nucleic acid into cells can be achieved in several ways.

[0150] In one embodiment, the recombinant adenovirus nucleic acid according to the invention can be stably integrated into the genome of a cell. Integration can be achieved using any suitable method known in the art, preferably via lentiviral transduction or CRISPR-Cas. In an advantageous embodiment, only a portion of the recombinant adenovirus nucleic acid is integrated into the cell's genome, and the remainder of the nucleic acid is delivered to the cell by other means (e.g., as a plasmid or via viral infection of the cell). In a preferred embodiment, genes encoding pV and pVII are integrated into the cell's genome. In this way, the key proteins pV and pVII are highly expressed by the producing cells, thereby allowing efficient accumulation of the (adenovirus) nucleic acid present in the cell.

[0151] Alternatively, adenovirus nucleic acid can be introduced into cells via transfection.

[0152] Furthermore, cells containing the recombinant adenovirus nucleic acid according to the invention are preferably kept in a low-oxygen (hypoxic) or normal (normative) oxygen atmosphere. Cell growth is preferably carried out at 37°C or above, accompanied by temporary cold or temporary heat shock.

[0153] Therefore, the present invention also provides cells comprising recombinant adenovirus nucleic acid according to the invention, preferably HER911, PER.C6, or HEK293T cells. These cells can be used as production cells to generate adenovirus particles or extracellular vesicles comprising recombinant adenovirus nucleic acid. Preferably, after the introduction of adenovirus nucleic acid, the cells continuously produce adenovirus particles or extracellular vesicles comprising recombinant adenovirus nucleic acid in an unlimited amount for an extended period of time, for example, several weeks after the introduction of adenovirus nucleic acid.

[0154] Therefore, the present invention also relates to a method for preparing such production cells, the method comprising:

[0155] - Culture suitable cells in a culture medium;

[0156] - The recombinant adenovirus nucleic acid according to the invention is introduced into the cells.

[0157] Therefore, the recombinant adenoviral nucleic acid, containing genes encoding protein V and / or protein VII, is placed under the control of a heterologous promoter. The recombinant nucleic acid can exist as a plasmid, or it can be stably integrated into the cell's genome.

[0158] The present invention also includes a method for generating extracellular vesicles, the method comprising:

[0159] - Culture suitable cells in a culture medium;

[0160] - Introducing the recombinant adenovirus nucleic acid according to the invention into the cells;

[0161] - Harvest extracellular vesicles containing adenoviral nucleic acid. Part of this method may include assays to verify whether the extracellular vesicles contain adenoviral nucleic acid, such as fluorescence-based detection of labeled protein V or protein VII. In other words, such tests will determine whether normal EVs or adenoviruses of the present invention are produced.

[0162] Extracellular vesicles contain adenoviral nucleic acid (preferably with mutations in early genes) and protein V and / or protein VII.

[0163] Optionally, in this method, cells containing recombinant adenovirus nucleic acid are subjected to cellular stress. This step induces a cellular stress response. In principle, "cellular stress" refers to any adverse environmental condition on the cells. Examples of cellular stress include: cell infection, such as viral infection, preferably adenovirus infection; cell irradiation; cell exposure to toxins, chemical agents, including genotoxic agents and proteasome inhibitors, such as melphalan, bortezomib, 5-fluorouracil, cisplatin, and doxorubicin; cell exposure to temperature differences; cell exposure to hypoxic conditions; cell exposure to osmotic shock; and cell exposure to oxidative stress. In a preferred embodiment, the cellular stress is viral infection of the cells, preferably with wild-type or recombinant adenovirus vectors such as conditionally replicating adenoviruses and / or replication-defective adenoviruses.

[0164] After adenovirus nucleic acid is introduced into cells, EVs containing adenovirus nucleic acid are harvested. Typically, EVs containing adenovirus nucleic acid are harvested by isolating or extracting them from cells or cell culture media containing adenovirus nucleic acid at least 48 hours after infection or transfection.

[0165] In one embodiment, EVs are separated from the supernatant by centrifugation of the suspension. Centrifugal force carries the suspended particles to the bottom of the tube, where a precipitate forms. For good results, the supernatant is centrifuged at a high speed, preferably about 100,000 x g, for 60 to 120 minutes, preferably 70 minutes.

[0166] Optionally, the supernatant is first centrifuged to remove larger particles, such as cells, from the supernatant containing EVs. Alternatively, the supernatant can be filtered through a suitable filter to remove larger particles, such as cell debris.

[0167] After separating the precipitate, it is preferable to suspend the precipitate in a suitable solvent and optionally centrifuge the suspension again. This re-separation of the precipitate removes any solvent that may contain contaminants such as proteins. Any suitable solvent with the potential to suspend the precipitate and dissolve any potential contaminants can be used. Particularly good results were obtained with buffers such as phosphate-buffered saline (PBS).

[0168] The precipitate was then resuspended in a suitable solvent, preferably PBS, and loaded onto an iodixanol gradient. After centrifugation, fractions containing EVs with adenovirus content were separated.

[0169] The present invention also includes therapeutic compositions comprising the adenovirus particles of the present invention or the cell vesicles of the present invention and a pharmaceutically acceptable carrier or mediator. In a preferred embodiment, the cell vesicles are extracellular vesicles or vesicles derived from lysed cells (preferably MSCs) and contain components from the plasma membrane of said cells. In a particularly preferred embodiment, the cell vesicles are extracellular vesicles.

[0170] The present invention also relates to a method for treating genetic disorders, comprising:

[0171] - Administer the therapeutic composition, cellular vesicle, or adenovirus particle according to the invention to the subject in need. In a preferred embodiment, the cellular vesicle is an extracellular vesicle or a vesicle derived from lysed cells (preferably MSCs) and contains components from the plasma membrane of said cells. In a particularly preferred embodiment, the cellular vesicle is an extracellular vesicle.

[0172] This invention provides a method in which extracellular vesicles (EVs) can be generated in vitro by infecting cells with an adenovirus according to the invention. The EVs can then be administered to a subject. In another object of the invention, the adenovirus as described herein is provided directly to the subject. These viruses then infect the subject's target cells, forming extracellular vesicles in the subject and further distributing throughout the body.

[0173] The mode of administration can vary. Routes of administration include oral, rectal, mucosal, intestinal, parenteral, intramuscular, subcutaneous, intradermal, intramedullary, intrathecal, direct intracardiac, intravenous, intraperitoneal, intranasal, intraocular, intratumoral, inhalation, inhalation, local, dermal, percutaneous, intra-arterial, epidural, or intracranial.

[0174] In certain embodiments, the therapeutic compositions, adenoviruses, or vesicles of the present invention may be administered via invasive routes such as injection. In other embodiments of the invention, the therapeutic compositions, adenoviruses, or vesicles of the present invention may be administered intravenously, subcutaneously, intramuscularly, intraarterially, intracranially, epidurally, intratumorally, or by inhalation or aerosol delivery. Non-invasive routes (e.g., oral; e.g., in pills, capsules, or tablets, topically, rectally) are also within the scope of the invention.

[0175] Clinicians determine the appropriate dosage, for example, using parameters or factors known or suspected to affect treatment in the field. Generally, the dosage begins slightly below the optimal dose and is then increased in small increments until the desired or optimal effect is achieved relative to any negative side effects. Important diagnostic measures include, for example, symptoms of inflammation or levels of inflammatory cytokines produced.

[0176] The therapeutic compositions, cellular vesicles, or adenovirus particles according to the invention may be in liquid or solid dosage forms. When using liquid dosage forms, they may include sprays, mists, suspensions, solutions, emulsions, or aerosols. Solid dosage forms include capsules, tablets, granules, powders, and gels.

[0177] The therapeutic compositions, adenovirus particles, and cellular vesicles disclosed herein may be provided by continuous infusion or by doses administered, for example, daily, 1-7 times per week, weekly, bi-weekly, monthly, bi-monthly, quarterly, semi-annually, or annually. The total weekly dose is generally at least 0.05 μg / kg body weight, and more generally at least 0.2 μg / kg, 0.5 μg / kg, 1 μg / kg, 10 μg / kg, 100 μg / kg, 0.25 mg / kg, 1.0 mg / kg, 2.0 mg / kg, 5.0 mg / ml, 10 mg / kg, 25 mg / kg, 50 mg / kg or higher (see, for example, Yang et al. (2003) New Engl. J. Med. 349:427-434; Herold et al. (2002) New Engl. J. Med. 346:1692-1698; Liu et al. (1999) J. Neurol. Neurosurg. Psych. 67:451-456; Portielje et al. (2003) Cancer Immunol. Immunother. 52:151-144; Willis et al. Front Cardiovasc. Med., 2017, 4, 63). Doses may also be provided to achieve predetermined target concentrations of adenovirus or adenovirus particles in the subject's serum, such as 0.1 μg / ml, 0.3 μg / ml, 1 μg / ml, 3 μg / ml, 10 μg / ml, 30 μg / ml, 100 μg / ml, 300 μg / ml or higher, or approximately 10 μg / ml. 8 Up to 10 12μg / ml viral particles. In other embodiments, the adenovirus or adenovirus particles of the present invention are administered at doses of 10 mg / subject, 20 mg / subject, 50 mg / subject, 80 mg / subject, 100 mg / subject, 200 mg / subject, 500 mg / subject, 1000 mg / subject, or 2500 mg / subject, for example, or orally or intravenously weekly, every two weeks, "every four weeks", monthly, every two months, or quarterly.

[0178] As used herein, the term "effective dose" refers to the amount of the adenovirus or extracellular vector of the present invention that, when administered alone or in combination with an adjunct therapeutic agent to cells, tissues, or a treated individual, effectively induces a measurable improvement in one or more symptoms of the disease. An effective dose also refers to the amount of adenovirus particles or adenovirus bodies sufficient to cause at least a partial improvement in symptoms, such as tumor shrinkage, restoration of enzyme production in the liver, reduction of intracranial plaque buildup and improvement in memory, or improvement in cardiac function after infarction. When administered to an individual as a single active ingredient, the effective dose refers to that ingredient alone. When administered in combination, the effective dose refers to the combined amount of active ingredients that produce a therapeutic effect, whether administered in combination, continuously, or simultaneously. An effective dose of the therapeutic agent will result in an improvement of diagnostic measures or parameters of at least 10%, typically at least 20%, preferably at least about 30%, more preferably at least 40%, and most preferably at least 50%. In cases where disease severity is assessed using subjective measures, the effective dose may also result in an improvement in subjective measures.

[0179] The therapeutic compositions, adenovirus particles, or adenovirus bodies according to the invention can be delivered as monotherapy or as a combination therapy. For example, adenovirus bodies or adenovirus particles can be administered in combination with common anticancer agents such as chemotherapy agents, radiotherapy, immune checkpoint inhibitors, and targeted small molecules (e.g., kinase inhibitors or proteasome inhibitors).

[0180] The present invention also relates to a kit for detecting diseases. The kit comprises adenovirus particles containing labeled adenovirus nucleic acid and / or adenovirus bodies containing labeled adenovirus nucleic acid. Alternatively, the kit comprises a therapeutic composition according to the invention, adenovirus particles or adenovirus bodies, and labeled antibodies specific to viruses or heterologous compounds that can be produced by viruses.

[0181] Example

[0182] Example 1: Detection of adenovirus nucleoprotein in EVs by mass spectrometry

[0183] GS184 cells (primary glioblastoma cells, obtained from Erasmus MC, Department of Neurosurgery) were plated in ten T175 flasks for 24 hours, and then infected with wild-type HADV-5. Cells were cultured as a monolayer on an extracellular matrix (ECM 1:100 in dPBS solution, Cultrex, Sanbio) coated with normal saline (NS) medium (DMEM-F12 + fibroblast growth factor + endothelial growth factor + heparin + B27 + 1% penicillin-streptomycin). Cells were then infected with wild-type human adenovirus type 5 (HAdV-5) at an MOI of 5 infectious particles / cell. The medium was replaced with NS medium after 2 hours. Supernatant and cells were collected 40 hours post-infection. As described in De Vrij, 2013, Nanomedicine (Lond), 8(9):1443-58, EVs were isolated from cell culture supernatant using an iodixanol-based density gradient (ultracentrifugation at 192,000 g for 4 hours). The iodixanol gradient consisted of three layers: 40% iodixanol as the bottom layer (2 mL), 25% iodixanol as the middle layer (6 mL), and 5% iodixanol as the top layer (2 mL). Figure 1 a Previously, it was shown that EVs concentrate in the interface region between the top and middle fractions (De Vrij, 2013, Nanomedicine (Lond), 8(9):1443-58). Adenovirus particles are known to concentrate in the bottom (40% iodixanol) fraction. Iodixanol fractions were subjected to SDS-PAGE and Western blot using antibodies against adenovirus fibrin and Rab27a proteins (protocol described in De Vrij, 2013, Nanomedicine (Lond), 8(9):1443-58), and these antibodies were specific for foreign EV types. Figure 1 b Mass spectrometry analysis was performed on cell pellets and purified EVs and viral agents using the protocol described in De Vrij, 2015, Int J Cancer, 137(7):1630-42 to obtain in-depth information on protein content. Figure 1 c In short, dissolve the sample in 50 μl of lysis buffer (RapiGest) in 50 mM ammonium carbonate. TM Surfactant (1 mg / ml) -1(Waters Corporation, MA) Reduction and alkylation were performed by adding 2 ml of 0.5 M dithiothreitol to each sample and incubating at 60 °C for 30 min. After cooling to room temperature, 10 ml of 0.3 M iodoacetamide was added, and the mixture was incubated in the dark for 30 min. Subsequently, 100 ng of 1.5 ml of 3 mM Tris-HCl solution (diluted 1:10 in 50 mM NH4HCO3) was added to each sample. -1 Gold-coated trypsin (Promega, Madison, WI) was incubated overnight at 37°C. To inactivate the trypsin, 3 ml of 25% trifluoro-acid was added and the sample was incubated at 37°C for 30 min. Next, the sample was centrifuged at 10,000 × g for 15 min at 4°C, and the supernatant was transferred to an LC / MS-certified vial (Waters Corporation). For each sample, a portion (10%) of the total volume was measured on a nano-liquid chromatography (nano-LC) system (Ultimate 3000 Nano-LC system, Dionex, Thermo Scientific, Amsterdam, The Netherlands) to determine the relative concentration. Based on these measurements, the injection volume for each individual sample was adjusted to allow for MS analysis of samples with equal volumetric digestion. MS analysis was performed using a coupled nano-LC system with the Orbitrap MS platform (LTQ-Orbitrap XL, Thermo Scientific). MS mass spectra were extracted from the raw data files and converted to Mascot Universal Format (MGF) files using Extract-MSN (part of XCalibur (version 2.0.7), Thermo Scientific). The data files were searched by Mascot (version 2.3; Matrix Science, London, UK) against the UniProt Swiss-Prot database selected for Homo sapiens and viral proteins. Figure 1 c As shown, both viral capsid and nucleoproteins were detected in both cells and viruses. However, EV appears to contain only the abundant nucleoproteins (V and VII).

[0184] Example 2: Detection of oncolytic adenovirus DNA in EVs by PCR, and the ability of EVs to infect cells.

[0185] GS756 cells were plated in two T175 flasks 24 h before infection with conditionally replicating adenovirus (CRAd) Ad.5.d24.RGD.GFP (MOI = 1 infectious particle / cell). (Virus details including genomic construction are provided in Balvers, 2014, Viruses, 6(8), 3080-3096.) After 72 hours, the supernatant was collected for EV isolation. Low-speed centrifugation was performed to remove cells and cell debris (150×g for 5 min followed by 3000×g for 20 min), followed by ultracentrifugation at 100,000×g for 70 min to precipitate EVs and viral particles. The precipitate was subjected to iodixanol density gradient centrifugation, and the iodixanol fraction was separated as described above.

[0186] To determine the amount of EVs within each fraction, samples for EV-quant analysis were prepared. For this, the samples were incubated with a red fluorescent dye (rhodamine at a final concentration of 0.33 ng / μl) on a membrane labeled with EVs. Next, the EVs were immobilized (by adding TEMED bisacrylamide and APS bisacrylamide (1:1)) in 96-well plates with glass bottoms, and images were acquired using a confocal microscope (Opera Phenix system, Perkin Elmer). The membrane labeling of the vesicles was visualized as red dots. Data obtained from the Opera system were converted in a Microsoft Excel template to provide EV counts and EV concentrations. A graph was plotted using Graphpad PRISM 6.0 to show the EVs in the top fraction (…). Figure 2 a ).

[0187] To detect the presence of viral genome in EVs, quantitative PCR (qPCR) was performed. For viral DNA detection, primers binding to viral fibrin sequences (HAdV5_fiber_ForPrim1, sequence: CAAGGACCCCTCACAGTGTC; HAdV5_fiber_RevPrim1, sequence: AGGGTACTGCTATCGGTGGT) were used. qPCR was performed using the Applied Bioscience SYBR Green method with standard PCR amplification settings. Adenovirus log(10) copy numbers were determined by generating a standard curve derived from serial dilutions of full-length adenovirus DNA (linearized viral genome). Ct values ​​were converted to Log(10) copy numbers based on the generated standard curve, and all samples were measured in duplicate. The data were plotted using Graphpad PRISM 6.0, showing the presence of viral DNA at the bottom (as expected) but also at the top. Figure 2 b).

[0188] For all iodixanol fractions, infectivity was assessed by exposing these fractions to A549 lung cancer cells. Fluorescence microscopy was performed 72 hours post-infection to determine infectivity, as measured by the percentage of GFP-positive cells. NucBlue was added. TM A staining agent (Thermo Fisher Scientific) was used to facilitate the counting of the total cell number. Cell counting was performed using ImageJ software (FIJI), which demonstrates the ability of EVs to infect cells. Figure 2 c ).

[0189] Example 3: EV-Quant demonstrates that pV.GFP is incorporated into EVs after cells are infected with pV.GFP virus.

[0190] Cells (GS184, GS562, A549, and HER911) were plated in 48-well plates for 24 h and then infected with adenovirus (pV.GFP) with green fluorescent protein attached to the pV protein. Cells were infected with an MOI of 50 virus particles / cell in 100 μL of medium / well (NS medium for GS184 and GS562 and serum medium for HER911 / A549). (Serve medium: Dalberg's modified Eagle medium + 10% fetal bovine serum (FBS) + 1% penicillin-streptomycin). For each cell line, the medium was changed after 2 h to NS medium, DMEM medium only, and serum medium. (Serve medium was pre-removed from bovine EV by ultracentrifugation at 100,000 x g for 16 h). For all cell lines, each medium condition was used in triplicate. The supernatant was collected 64 h post-infection and centrifuged at 500 x g for 10 min to remove cell debris. All 143 μL of supernatant was analyzed for EV-Quant. In the case of GFP-pV protein fusion, viral particles are expected to appear as green dots in the EV-Quant assay. Furthermore, the sample was incubated with a membrane labeled with EV and dyed with red fluorescent dye.

[0191] Therefore, adenoviruses can be visualized as a combination of red and green dots (pseudo-colored as yellow by software). Thus, EV-Quant assays were used to quantify three types of particles: red only (empty EV), green only (virus), and red + green (yellow) (adenoviruses). Figure 3 a A large number of adenoviruses were detected in the supernatant 64 hours after GS184 cell infection. picture 3b It was also found that adenoviral secretion occurred in different cell types (GS562, HER911, A549), and the type of culture medium could affect adenoviral secretion; for example, for HER911 cells cultured in serum-free DMEM, the yield was increased (…). Figure 3c). Finally, it was demonstrated that the concentration of adenovirus in the cell supernatant increased over time. Figure 3 d ).

[0192] Example 4: Biomarker potential of adenovirons: Correlating adenovironosome levels with oncolytic virus infectivity

[0193] Four different GS cultures were infected with pV-GFP adenovirus, and the relationship between cell infection and adenovirus secretion was assessed. Figure 4 Six days post-infection, adenoviral levels were determined by EV-Quant, and cell viability was measured by a luminescent ATP-based cell viability assay (CellTiterGlo, Promega). Luminescence was measured using a photometer (Infinite M200 Tecan reader). Linear regression analysis and statistical tests were performed using GraphPad Prism.

[0194] It has been found that after infecting cancer cells, adenoviral levels are correlated with adenoviral infectivity, providing evidence of a strong negative correlation between adenoviral concentration and cell viability. Figure 4 a and Figure 4 b This opens up opportunities for adenoviral agents as a biomarker platform.

[0195] Example 5: Infection of neurospheres by adenoviruses and viral fractions from Ad5.d24.RGD.GFP

[0196] HER911 cells were infected with CRAd Ad5.d24.RGD.GFP (six T175 flasks, grown in serum-containing DMEM medium). After 2 h, the medium was replaced with serum-free DMEM. After 48 h, adenovirus bodies were separated from viral particles using a standard iodixanol-based procedure (as described above). The top fraction (4 mL) and bottom fraction (4 mL) of the gradient were collected. Each fraction was added to 6 mL PBS / fraction and centrifuged through an Amicon 100kD centrifuge filter to concentrate the particles to a final volume of 200 μL. The infectious particle titer on the monolayer of GS cells was determined before adding the sample to the neurospheres. Neurospheres were constructed from GS940 primary tumor cells (one sphere per well) and infected with adenovirus bodies and viral particles at equal infectious titers when they were 7 days old. Confocal microscopy was performed on day 6 post-infection to analyze GFP expression within the neurospheres. The depth of GFP expression appeared similar for both adenovirus bodies and viral particles. Figure 5 ).

[0197] Example 6: Heterologous expression of pV.pVII leads to enhanced DNA incorporation into EVs

[0198] HER911 cells were plated in four T75 flasks containing serum-enriched medium. One day later, the cells were transfected with the largest prepared DNA plasmids (FuGENE6 protocol, where 850 μl of medium + 34 μl of FuGENE + 17 μg of DNA were added to 10 ml of medium): two flasks containing pUC57.CMV.Crimson_CMV.eGFP and two flasks containing pUC57.CMV.Crimson-pVII_CMV.eGFP-pV. See Figure 6 a After DNA plasmid synthesis, sequencing was performed as a quality control. The pV and pVII sequences were derived from the wild-type HADV-5 genome sequence. A sequence encoding a flexible adapter (aacggcggagggagc) was introduced between the fluorescent tag sequences (eGFP and Crimson) and pV / pVII. One day post-transfection, eGFP and Crimson (infrared) fluorescence were observed in cells using microscopy (Nikon Wide-field microscope), with transfection efficiency of approximately 70% in all cases. Of interest, eGFP and Crimson were observed to be homogeneous throughout the cells (as expected), while eGFP-pV and Crimson-pVII signals appeared as dots. Cells in all flasks showed no signs of stress / loss of cell viability, nor did they exhibit pV / pVII protein toxicity. One day post-transfection, cells were infected with wild-type HADV-5 (MOI = 5 infectious units / cell) for 2 hours, after which the medium was replaced with DMEM-only. One day post-infection, the first signs of infection became apparent, notably only in flasks containing cells containing Crimson-pVII_.eGFP-pV. For flasks containing Crimson_eGFP cells, infection became apparent after two days, which is the standard for HADV-5 infection. Three days post-infection, supernatants were collected from four flasks and EVs were isolated using a standard iodixanol-based procedure (as described above). (EVs were fractionated 4 to 7). qPCR (as described above) was performed to analyze the DNA load in the EVs. This clearly demonstrated that heterologous expression of pV / pVII further enhanced the incorporation of viral genomic DNA. Figure 6 b (See the image above). Furthermore, increased incorporation of pUC57 DNA was observed, which requires not only the presence of the pUC57 plasmid but also additional factors associated with adenovirus infection in this context (…). Figure 6 b (See figure below). Regarding the importance of using pV / pVII as the internal packaging module for oncolytic adenoviruses, the expression of the protein module does not adversely interfere with viral yield, and viral yield even increases slightly.

Claims

1. Use of nucleoprotein V and nucleoprotein VII for enhancing the loading of adenoviral DNA into cellular vesicles, wherein a gene encoding nucleoprotein V and a gene encoding nucleoprotein VII are placed under the control of a heterologous promoter in a recombinant adenoviral nucleic acid and the recombinant adenoviral nucleic acid does not comprise adenoviral nucleic acid other than the gene encoding nucleoprotein V and the gene encoding nucleoprotein VII, and whereby the recombinant adenoviral nucleic acid and a nucleic acid molecule comprising an adenoviral nucleic acid having a mutation in an early gene are introduced into a cell.

2. Use according to claim 1, wherein the nucleic acid molecule comprising an adenoviral nucleic acid having a mutation in an early gene further comprises a heterologous gene, the recombinant adenoviral nucleic acid and the heterologous gene are loaded into cellular vesicles, whereby the heterologous gene is further introduced into a cell.

3. Method for preparing extracellular vesicles, the method comprising: - culturing a cell in a culture medium; - introducing into the cell a recombinant adenoviral nucleic acid in which a gene encoding nucleoprotein V and a gene encoding nucleoprotein VII are placed under the control of a heterologous promoter, and wherein the nucleic acid does not comprise adenoviral nucleic acid other than the gene encoding nucleoprotein V and the gene encoding nucleoprotein VII; - introducing into the cell an adenoviral nucleic acid comprising a mutation in an early gene; and - harvesting the extracellular vesicles.

4. Method according to claim 3, wherein the adenoviral nucleic acid comprising a mutation in an early gene comprises a heterologous gene.

5. Method according to claim 3 or 4, further comprising subjecting the cell to cellular stress.

Citation Information

Patent Citations

  • Use of mesenchymal stem cells and parts thereof

    WO2017204639A1

  • Method for constructing adenovirus core protein genetic marker vector

    CN101935671A

  • Diminishing viral gene expression by promoter replacement

    US20050026139A1

  • Armed replication-competent oncolytic adenoviruses

    WO2018118967A1