Composition for inhibiting hepatitis B virus replication

Abstract

The present invention provides a pharmaceutical composition for treating hepatitis B. The pharmaceutical composition comprises an inhibitory substance against microRNA binding to the 5'-side ε signal sequence of the pregenomic RNA of the hepatitis B virus, a composition for inhibiting the replication of the hepatitis B virus, and a pharmaceutical composition for treating hepatitis B virus infection.

Description

Technical Field

[0001] The present invention relates to a composition for inhibiting the replication of hepatitis B virus. Background Art

[0002] MicroRNA (miRNA) is a short RNA of about 22 bases in length that does not encode proteins. It is a factor that forms a complex with AGO protein and regulates gene expression mainly by degrading and inhibiting translation of mRNA with target sequences. Figure 1 ). The standard microRNA production process is as follows Figure 1 As shown, primary microRNA (pri-microRNA) is synthesized by transcription, and the primary microRNA is a primary transcript containing a hairpin structure. Drosha, which acts as RNaseIII in the cell nucleus, cuts the hairpin base of pri-microRNA to form a microRNA precursor (pre-microRNA). The pre-microRNA thus formed is mainly transported from the cell nucleus to the cytoplasm by exportin-5, and then cut by Dicer, another RNaseIII, to form a double-stranded RNA (microRNA duplex) of 20-24 bases. The double-stranded RNA is loaded into the Ago protein, and only one strand of the RNA chain forms a stable complex with the Ago protein to form an RNA-induced silencing complex (RISC). Ultimately, this single-stranded mature microRNA can play a directing role in gene expression regulation, performing RNA degradation or translation inhibition.

[0003] MicroRNA was originally isolated as a factor necessary for the development of nematodes, but subsequent studies have shown that it is a mechanism that is ubiquitous in humans and other animals and plants. In addition, microRNAs are often reported to regulate the replication and pathogenicity of DNA and RNA viruses (Non-patent document 1: Jopli ng CL et al., Science 309, 1577-1581, 2005; Non-patent document 2: Pedersen IM et al., Nature 449, 919-922, 2007.). Hepatitis B virus (HBV) is classified as a membrane-structured DNA virus, which synthesizes genomic DNA from pregenomic RNA (pgRNA) through its own reverse transcriptase during replication. The genomic DNA in HBV particles is circular and incompletely double-stranded. After infecting hepatocytes, it is converted into closed circular double-stranded DNA (cccDNA) in the nucleus for continuous infection. HBV mRNAs and pgRNA are expressed from cccDNA. HBV mRNAs express proteins such as viral antigens, while HBV pgRNA serves not only as mRNA but also as a source for viral capsid formation and HBV DNA synthesis. Studies have reported that HBV-derived mRNA is a target of host microRNA and its expression is inhibited ( Figure 2 , Non-patent document 3: Zhang GL et al., Antiviral Res 94. 2010 Nov; 88(2): 169-75.) However, no microRNA that directly promotes HBV replication has been found.

[0004] Prior art literature

[0005] Non-patent literature

[0006] Non-patent document 1: Jopling CL et al., Science 309, 1577-1581, 2005.

[0007] Non-patent document 2: Pedersen IM et al., Nature 449, 919-922, 2007.

[0008] Non-patent document 3: Zhang GL et al., Antiviral Res. 2010 Nov; 88(2): 169-75. Summary of the invention

[0009] Technical Problems to be Solved by the Invention

[0010] The object of the present invention is to provide a composition for inhibiting the replication of hepatitis B virus and a pharmaceutical composition for treating hepatitis B virus infection, comprising a substance that inhibits the function of miR-4453 (a microRNA).

[0011] As a result of intensive studies to solve the above-mentioned problems, the present inventors succeeded in suppressing viral replication by inhibiting the function of miR-4453 (a type of microRNA), thereby completing the present invention.

[0012] Technical means to solve technical problems

[0013] That is, the present invention is as follows.

[0014] (1) A composition for inhibiting the replication of hepatitis B virus, comprising: an inhibitory substance against microRNA that binds to the 5'-side epsilon signal sequence of pregenomic RNA of hepatitis B virus.

[0015] (2) A pharmaceutical composition for treating hepatitis B virus infection, comprising: an inhibitory substance against microRNA that binds to the 5'-side epsilon signal sequence of the pregenomic RNA of the hepatitis B virus.

[0016] (3) The composition according to item (1) or (2), wherein the microRNA comprises a base sequence complementary to at least 7 bases in a conserved sequence of the 5′-side epsilon signal sequence.

[0017] (4) The composition according to item (3), wherein the 7-base sequence is represented by CCAAGCU in the sequence of pregenomic RNA.

[0018] (5) The composition according to item (1) or (2), wherein the microRNA is miR-4453.

[0019] (6) The composition according to item (5), wherein miR-4453 comprises the base sequence represented by GAGCUUGGUCUGUAG CGGUU (SEQ ID NO: 1).

[0020] (7) The composition according to item (1) or (2), wherein the inhibitory substance is a nucleic acid comprising an antisense oligonucleotide, siRNA, shRNA or artificially cross-linked nucleic acid that inhibits the function of miR-4453.

[0021] (8) The composition according to item (1) or (2), wherein the inhibitory substance is a nucleic acid comprising an antisense oligonucleotide, siRNA, shRNA or artificial cross-linked nucleic acid targeting all or part of the base sequence represented by GAGCUUGGU CUGUAGCGGUU (SEQ ID NO: 1).

[0022] (9) The composition according to item (1) or (2), wherein the inhibitory substance is a nucleic acid comprising an antisense oligonucleotide, siRNA, sh RNA or artificial cross-linked nucleic acid containing the base sequence represented by AACCGCTACAGACCAAGCTC (SEQ ID NO: 2).

[0023] (10) A method for inhibiting the replication of hepatitis B virus, comprising the step of contacting the hepatitis B virus with the composition described in any one of items (1) to (9) in vitro.

[0024] (11) A pharmaceutical composition comprising the composition described in any one of items (1) to (9).

[0025] (12) The pharmaceutical composition according to item (11), which is used for gene therapy.

[0026] In addition, the present invention also includes the following inventions.

[0027] (13) A method for treating hepatitis B virus infection, comprising the step of administering to a patient a composition as described in any one of items (1) to (9) or an inhibitory substance against microRNA that binds to the 5' epsilon signal sequence of the pregenomic RNA of the hepatitis B virus. Here, the treatment method also includes a gene therapy method. In addition, the patient is not limited to a patient infected with the hepatitis B virus, but also includes a patient who may be infected with the hepatitis B virus.

[0028] (14) For the preparation of a therapeutic drug for hepatitis B virus infection, use of the composition described in any one of items (1) to (9) or use of an inhibitory substance against microRNA that binds to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus. Here, the therapeutic drug also includes a gene therapy drug.

[0029] (15) For the treatment of hepatitis B virus infection, use of the composition described in any one of items (1) to (9) or use of an inhibitory substance against microRNA that binds to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus. Here, the treatment also includes gene therapy.

[0030] (16) A composition according to any one of items (1) to (9) for treating hepatitis B virus infection, or an inhibitory substance against microRNA that binds to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus. The treatment also includes gene therapy.

[0031] It should be noted that, for the specific examples of the microRNA bound to the 5'-side ε signal sequence of the pregenomic RNA of the hepatitis B virus and the inhibitory substances against the microRNA in the inventions of items (13) to (16), the same composition as that of items (3) to (9) can be adopted.

[0032] Effects of the Invention

[0033] The present invention provides a composition comprising a substance that inhibits the function of miR-4453 (a microRNA). The composition of the present invention can be used to treat hepatitis B. Sequence Listing <110> Tokyo Metropolitan Institute of Medical Science <120> Composition for inhibiting hepatitis B virus replication <130> G2062WO <150> JP2018-215898 <151> 2018-11-16 <160> twenty two <170> PatentIn version 3.5 <210> 1 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 1 gagcuugguc uguagcgguu 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 2 aaccgctaca gaccaagctc 20 <210> 3 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 3 cacugccuuc caccaaacuc 20 <210> 4 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 4 gagcuugguc uguagcgguu 20 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 5 uaccgcuguu accaauuuu 19 <210> 6 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 6 gagcuugguc uguagcgguu 20 <210> 7 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 7 cacuguucaa gccuccaagc ug 22 <210> 8 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 8 gagcuugguc uguagcgguu 20 <210> 9 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 9 uggaugaugu gguauugggg gcc 23 <210> 10 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 10 agccccugcc caccgcacac ug 22 <210> 11 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 11 acuccaccau agaucacucc c 21 <210> 12 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic RNA <400> 12 uggaguguga caaugguguu ug 22 <210> 13 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 13 tgtacatgtc ccactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 14 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 14 tgtacatgtc ccacttttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 15 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 15 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 16 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 16 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggcttta gggcatggac 60 a 61 <210> 17 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 17 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 18 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 18 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 19 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 19 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 20 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 20 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 21 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> 21 tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 <210> 22 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic DNA <400> twenty two tgttcatgtc ctactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 60 a 61 BRIEF DESCRIPTION OF THE DRAWINGS

[0034] [ Figure 1 ] represents the expression and function of microRNA (miRNA).

[0035] [ Figure 2 ] shows the HBV DNA genome and RNA structure.

[0036] [ Figure 3 ] shows the changes in microRNA expression levels after HBV infection in vivo.

[0037] [ Figure 4 ] shows the microRNA expression profiles during HBV replication and infection in vitro.

[0038] [ Figure 5 ] represents the effects of selected microRNAs on HBV in an in vitro HBV replication model.

[0039] [ Figure 6 ] show the effects of selected microRNAs on HBV in primary human hepatocytes infected with HBV.

[0040] [ Figure 7 ] indicate the targets of miR-4453 in HBV RNA.

[0041] [ Figure 8 ] represents the HBV replication regulation model based on miR-4453.

[0042] [ Fig. 9 ] shows the results of Northern blotting analysis of pgRNA stability when new RNA synthesis was stopped by actinomycin D.

[0043] [ Fig.10 ] shows the results of HBV replication inhibition experiment using mir-4453 inhibitor miRIDIAN.

[0044] [ Fig.11] shows the results of HBV replication inhibition assay using mir-4453 inhibitor S-TuD.

[0045] [ Fig.12 ] shows the results of HBV replication inhibition assay using mir-4453 inhibitor S-TuD.

[0046] [ Fig.13 ] shows the analysis results of the anti-HBV effect of mir-4453 inhibitor in humanized liver chimeric mice.

[0047] Specific embodiments of the present invention

[0048] The present invention provides a composition for inhibiting the replication of hepatitis B virus (HBV), and a pharmaceutical composition and method for treating HBV infection. The present invention is based on the use of the following inhibitory substance, which is an inhibitory substance for microRNA (miRNA) that binds to the 5'ε signal sequence of the pregenomic RNA (pgRNA) of HBV, and the inhibitory substance is directed to microRNA that activates protein synthesis essential for HBV replication or microRNA that improves the stability of pgRNA. By using the inhibitory substance to inhibit the replication of HBV, diseases caused by HBV infection can be treated or alleviated.

[0049] 1. Overview

[0050] It is well known that microRNA (miRNA) regulates the replication and pathogenicity of DNA and RNA viruses. Hepatitis B virus (HBV) is classified as a membrane-structured DNA virus that synthesizes genomic DNA from pregenomic RNA (pgRNA) by its own reverse transcriptase during replication. Although several microRNAs that inhibit HBV replication have been reported, the present inventors have identified microRNAs whose expression increases due to HBV infection, and found that one of them directly acts on HBV RNA to activate replication. In addition, it was found that the microRNA interacts with the ε sequence necessary for capsid formation and DNA synthesis of pgRNA.

[0051] Although it is known that microRNA plays a positive role in viral RNA, one example is miR-122 in hepatitis C virus (HCV) (Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P. Science. 2005 Sep 2; 30 (5740): 1577-81. Modulation of hepatitis C vir us RNA abundance by a liver-specific microRNA.), this is the first time it has been discovered in HBV. In terms of the inhibitory effect of this microRNA on viral replication, it can be used as a new therapeutic agent for HBV infection.

[0052] Here, the structures of HBV DNA genome and RNA are Figure 2 The DNA genome of HBV is 3.2kb. Figure 2 As shown, 5 mRNAs are expressed. Among them, 3.5 kb pregenomic RNA (pgRNA) is used as a template for synthesizing HBV genomic DNA. Although several microRNAs have been reported to inhibit HBV replication, no microRNA has been found to enhance HBV replication by targeting HBV RNA.

[0053] There are two ε signal sequences at the 5' and 3' ends of the pgRNA ( Figure 8 ), the present invention discovered that viral replication can be inhibited by inhibiting microRNA that binds to the 5'-side ε signal sequence, particularly microRNA that binds to at least 7 base sequences in the conserved sequence of the 5'-side ε signal sequence.

[0054] Therefore, the present invention provides an inhibitory substance against microRNA that binds to the 5' epsilon signal sequence of HBV pregenomic RNA. "Inhibitory substance against microRNA" refers to a nucleic acid that binds to microRNA by forming a base pair and inhibits its function.

[0055] The present inventors have found that as an inhibitory substance against microRNA (e.g., an inhibitory substance that inhibits the function of miR-4453), a single-stranded oligonucleotide containing a nucleotide analog such as an antisense oligonucleotide, siRNA, shRNA or an artificial cross-linked nucleic acid (LNA) unit causes the function inhibition of microRNA. To cause the function inhibition of microRNA, an oligonucleotide containing an antisense oligonucleotide, siRNA, shRNA or LNA unit against microRNA that binds to the seed region sequence, particularly the conserved region of the 5' side ε signal sequence, can be used.

[0056] The microRNA that binds to a sequence of at least 7 bases in the conserved sequence of the 5' side ε signal sequence can include miR-4453, and the inhibitory substance against miR-4453 can include a nucleic acid (antisense oligonucleotide, siRNA, shRNA or LNA) having a base sequence complementary to all or part of the base sequence of miR-4453. These antisense oligonucleotides, siRNA, shRNA or LNA are also referred to as "inhibitors" in this specification.

[0057] The conserved sequence of 7 bases of the ε signal sequence on the 5' side of the pregenomic RNA is represented by "CCAAG CU", and inhibitory substances of miR-4453 containing such a conserved sequence include, for example, inhibitors against miR-4453 (for example, a sequence represented by GAGCUUGGUCUGUAGCGGUU (sequence number 1)).

[0058] In the present invention, the base sequence of the inhibitor such as LNA is a complementary sequence to the mature sequence of miR-4453, but the length is not particularly limited, for example, 16 to 27 bases, preferably 20 bases. For example, the base sequence of LNA may have at least one LNA monomer, or two or more LNA monomers, and in the present invention, preferably 20 LNA monomers.

[0059] For example, the base sequences of the mature sequence of miR-4453 and the inhibitor comprising LNA against the mature sequence of miR-4453 are shown below.

[0060] 1. Mature sequence of miR-4453: GAGCUUGGUCUGUAGCGGUU (SEQ ID NO. 1)

[0061] 2. Sequence of LNA targeting miR-4453 mature sequence: AACCGCTACAGACCAAGC TC (SEQ ID NO. 2)

[0062] The present invention relates to a composition for inhibiting HBV replication and a pharmaceutical composition for treating HBV infection, comprising an inhibitory substance for microRNA binding to the 5'-side ε signal sequence of HBV pregenomic RNA. Diseases caused by HBV infection include HBV-related diseases in addition to hepatitis B, such as liver fibrosis, chronic hepatitis, cirrhosis, and liver cancer.

[0063] The administration form of the composition of the present invention can be injection. In addition to normal systemic administration such as intravenous and intra-arterial administration, it can also be used for local administration such as muscle, joint, subcutaneous, and intradermal administration. In addition, the administration form using a catheter can also be adopted. In this case, it is usually provided in the form of a unit dose ampoule or a high dose container, or it can be a powder that is re-dissolved in an applicable carrier (such as sterile water) when used.

[0064] In addition, in addition to the above-mentioned injection, the administration forms of the composition of the present invention also include suppositories, administration through the nasal cavity or oral mucosa, and oral administration.

[0065] In addition, the above dosage form may contain additives commonly used in preparations. Additives are excipients, fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, buffers, preservatives, solubilizers, preservatives, flavoring agents, soothing agents, stabilizers and tonicity agents commonly used in drug production, and the above can be appropriately selected and used and prepared by conventional methods.

[0066] The dosage varies in a wide range depending on the therapeutic purpose, the age of the subject, the administration route and the number of administrations. The amount of nucleic acid contained in the pharmaceutical composition of the present invention can be appropriately set by the practitioner.

[0067] As another therapeutic method, there is a gene therapy method using a gene therapy vector expressing shRNA that inhibits the function of a target microRNA.

[0068] The gene therapy vector is obtained by inserting the inhibitory substance (DNA) such as the shRNA sequence into an appropriate vector. The vectors used to insert the inhibitory substance are roughly divided into non-viral vectors and viral vectors. For example, as a non-viral vector, a vector having pCAGGS or the like can be cited.

[0069] On the other hand, examples of viral vectors include adenovirus, lentivirus and the like.

[0070] Kits using viral vectors are commercially available (for example, Adeno-X Adeno viral System 3 manufactured by Takara Bio and adeno-associated virus (AAV) vector manufactured by Applied Viromics), and viral vectors can be constructed very easily.

[0071] In the present invention, methods for introducing gene therapy vectors into patients suffering from HBV-related diseases include a method of directly introducing gene therapy vectors into patient tissues, a method of removing target cells from the patient's body and introducing gene therapy vectors into the cells in vitro, and then introducing the cells into the body, etc.

[0072] For example, the effective amount of the pharmaceutical composition of the present invention and the effective amount administered in combination with a suitable diluent and a pharmacologically acceptable carrier ranges from 10 mg to 200 mg per 1 kg body weight at a time, with an administration interval of once a week to once a month.

[0073] The dose of gene therapy virus can be adjusted appropriately according to the stage, age, weight, etc. of the patient. For example, the effective dose is 1×10 12 Up to 2×10 13 Genome copies / kg. Administer this dose one to several times. Example

[0074] Hereinafter, the present invention will be described in detail with reference to Examples. However, the scope of the present invention is not limited to these Examples.

[0075] Example 1

[0076] 1. Methods

[0077] The present inventors used humanized liver chimeric mice as an animal model of HBV infection. The sources of infection used HBV of genotype A AeJPN strain (AB246338.1) and genotype C CJPNAT strain (AB246345.1). RNA was prepared from mouse livers 10 weeks after infection for RNA-seq analysis. PXB cells from PhoenixBio were used as primary human hepatocytes. miRIDIAN microRNA mimics from Dharmacon was used as microRNA, and miRCURY LNA microRNA Power Inhibitors (YI04104482) from Exiqon were used as microRNA inhibitors. A multifunctional envelope-type nanodevice (MEND) was used to deliver microRNA to primary human hepatocytes (Yamamoto N, Sato Y, Munakata T, Kakuni M, Tateno C, Sanada T, Hirata Y, Murakami S, Tanaka Y, Chayama K, Hatakeyama H, Hyodo M, Harashima H, Kohara M. J Hepatol. 2016 Mar; 64(3): 547-55. Novel pH-sensitive multifunctional envelope-type nanodevice for siRNA-based treatments for chronic HBV infection.) In the HBV replication analysis using cultured cells, HepG2.2.15-derived cells that constitutively express HBV were used. In addition, HepG2-hNTCP-C4 and HepG2-hNTCP-30 cells that overexpress hNTCP, which is considered to be a HBV receptor, were used in the infection experiment. In the pgRNA analysis, secreted luciferase was used instead of the HBV core protein, and a reporter gene that did not express HBpol was used.

[0078] 2. Results

[0079] As microRNAs whose expression levels were significantly changed by HBV infection in chimeric mice, three microRNAs were identified in genotype A (MIR663A (up), MIR210HG (up), and MIR4453 (down)), and three microRNAs were identified in genotype C (MIR3648 (up), MIR663A (up), and MIR4453 (down)). Figure 3). Among them, MIR210HG has been reported to be a microRNA whose expression level increases due to HBV replication, and which targets HBV mRNA and inhibits protein expression.

[0080] Figure 3 It is a graph showing the changes in microRNA expression levels after HBV infection in vivo. The contents of Tables A to F are as follows.

[0081] (A) Experimental scheme for HBV infection of humanized liver chimeric mice.

[0082] (B) Quantification of HBV RNA in chimeric mice infected with HBV.

[0083] (C and D) Volcano blots showing the expression of individual microRNAs quantified by RNA-seq analysis, with the X-axis representing the logarithm of the expression change and the Y-axis representing the negative logarithm of the q-value.

[0084] Significant microRNAs (q < 0.05) are plotted in red. Fold change values ​​are counted as HBV genotype A / uninfected (C) or HBV genotype C / uninfected (D).

[0085] (E and F) Log2 (fold difference) plots of each significantly (q < 0.05) changed microRNA.

[0086] Next, the inventors found from the HBV replication / infection system of cultured cells that the expression changes of miR-210-5p, miR-3648 and miR-4453 caused by HBV were similar to those in the animal model ( Figure 4 ),

[0087] Figure 4 MicroRNA expression profiles during in vitro HBV replication and infection are shown. Figure 4 The contents of Tables A to F are as follows.

[0088] (A) Cloning of HepG2.2.15-58 was performed by limiting dilution. The HBV DNA titer of each cell line cloned from HepG2.2.15 is shown. The position of HepG2.2.15-58 is indicated by a circle.

[0089] (B) HBV infection of HepG2-derived cells ectopically expressing human NTCP. HepG2-hNTCP-C4 and HepG2-hNTCP-30 were infected with HBV at the indicated GEq / cell, and the HBV DNA titer in the culture medium recovered every 7 days was quantified. Normal HepG2 cells were used as negative control.

[0090] (C, D, and E) The expression levels of miR-210-5p, miR-3648, and miR-4453 were compared between HepG2 and HepG2.2.15-58 cells, between naive cells and HBV-infected HepG2-hNTCP-C4 cells, or between naive cells and HBV-infected HepG2-hNTCP-30 cells, respectively. HBV inoculation was performed at the indicated genome equivalents (GEq) / cell.

[0091] In addition, by observing the effects of the above microRNAs on HBV replication in HepG2.2.15-derived cells, it was found that miR-4453 has the function of increasing the amount of HBV DNA and HBs protein ( Figure 5 ),

[0092] Figure 5 is a graph showing the effects of selected microRNAs on HBV in an in vitro HBV replication model. Figure 5 The contents of Tables A to F are as follows.

[0093] (AC) Gain-of-function analysis of microRNA was performed by transfecting HepG2.2.15-58 cells with exogenous microRNA. After microRNA transfection, the amount of HBV DNA in the culture medium was quantified (A), and the cell viability of each transfection was measured (B). Immunoblotting of HBs and actin (loading control) was performed (C). (DF) Loss-of-function analysis of microRNA was performed by transfecting HepG2.2.15-58 cells with LNA inhibitors of microRNA. After LNA inhibitor transfection, the amount of HBV DNA (D), cell viability (E), and the amount of HBs (F) were observed.

[0094] In contrast, in the analysis using miR-4453 inhibitor, the amount of HBV DNA and HBs protein decreased. In the HBV infection experiment of PXB cells, miR-4453 increased viral replication, while the miR-4453 inhibitor inhibited viral replication, which suggests that the target of miR-4453 is a factor that plays an important role in HBV replication.

[0095] Figure 6 is a graph showing the effects of selected microRNAs on HBV in primary human hepatocytes infected with HBV. Figure 6 The contents of Tables A to I are as follows.

[0096] (A) Schematic diagram of HBV infection of primary human hepatocytes (PHH). (B) HBV DNA amount in the culture medium after infection. (CE) Exogenous microRNA was transfected into PHH for microRNA gain-of-function analysis. Ten days after transfection, the amount of HBV DNA in the culture medium (C) or cells (E) was quantified, and the cell survival rate of each transfection was measured (D). (F-1) Loss-of-function analysis of microRNA was performed by transfecting LNA inhibitors of microRNA into primary human hepatocytes (PHH). After transfection of 100 nM inhibitor, the amount of HBV DNA in the culture medium was quantified (F), and the cell survival rate of each transfection was measured (G). IFN-λ1 was added at a concentration of 100 ng / mL as a positive control for HBV replication inhibitors. The amount of HBV DNA in uninfected and HBV-infected PHH was measured (H), and immunoblotting for HBs and actin (loading control) was performed under the same conditions (I),

[0097] Based on the consideration of the targets of miR-4453 ( Figure 6 ), we first explored whether it has the same mechanism as the effect of miR-122 on HCV in enhancing viral replication, and explored whether there are candidate target sequences in HBV-derived RNA.

[0098] The results are as follows Figure 7 shown. Figure 7 It is a figure which shows the target of miR-4453 in HBV RNA. The content of Tables A to F is as follows.

[0099] (A) Predicted miR-4453 binding sites in HBV RNA. The RNA22v2 microRNA target detection program was used to identify miR-4453 binding sites. miR-210-5p has been reported to interact with HBV RNA. miR-122 and HCV RNA were used for validation of the program. In addition, the base sequences of the target RNA and microRNA shown in Table A are shown in sequence numbers 3 to 12. (B) Comparison of HBV ε domains taken from 5 different genotypes. The miR-4453 seed matching sequence is marked in red. The EcoR1 restriction enzyme cleavage site of X02763 (HBV genotype A) is used as +1 for the HBV genome number. It should be noted that the base sequence of the ε domain shown in Table B is shown in sequence numbers 13 to 22. (C) Interaction between miR-4453 and HBV RNA. Extracts prepared from the indicated cells after microRNA transfection were analyzed by RNA immunoprecipitation using anti-Ago2 mAb, and coprecipitated HBV RNA was quantified by qRT-PCR.

[0100] (D) Enhancement of HBV pgRNA reporter gene activity based on miR-4453. The HBV pgRNA reporter gene pHBV / Gluc was transfected into HepG2 cells with or without miR-4453, and its secreted luciferase activity was measured. As a negative control, pCMV / Gluc driven by the cytomegalovirus (CMV) promoter for Gluc expression was used. (E) Effects of mutations in the miR-4453 binding site in the ε domain on the pgRNA reporter gene. 5′εMT and 3′εMT represent point mutations in the ε domain of the 5′UTR and 3′UTR, respectively. The enhancement of the pgRNA reporter gene requires the miR-4453 binding site at 5'ε. (F) Effects of mutations in the miR-4453 binding site in the ε domain on HBV capsid formation. The infectious titer of the HBV reporter gene was measured by secreted luciferase activity. There was no difference between the 5'ε mutation and the 3'ε mutation.

[0101] from Figure 7 The results shown in the figure show that the miR-4453 target candidate sequence that can be most stably bound is present in the ε signal that is conserved in all genotypes and is essential for HBV capsid formation and DNA synthesis ( Figure 7 A, 7B). Therefore, RNA immunoprecipitation analysis using antibodies against Ago2 was performed, and the results showed that HBV RNA interacted with miR-4453 ( Figure 7 C),

[0102] In addition, the inventors conducted pgRNA reporter gene analysis to study how miR-4453 activates viral replication and found that miR-4453 increased luciferase activity regardless of HBpol ( Figure 7 D), since the reporter gene contains two ε signals, mutations were introduced into the candidate sequence of the miR-4453 target, and pgRNA reporter gene analysis was also performed. The results showed that the increase in luciferase activity dependent on miR-4453 disappeared with the mutation of the ε sequence on the 5' side ( Figure 7 E), therefore, miR-4453 may bind to the 5'ε signal of HBV pgRNA to activate HBV translation or increase the stability of pgRNA. The miR-4453 binding sequence mutant in the ε signal did not affect the formation of viral particles ( Figure 7 F), in other words, it can be considered that the higher-order structure of ε has not changed significantly even after the introduction of the mutation.

[0103] 3. Investigation

[0104] Although HCV and miR-122 are examples of microRNAs that have a positive effect on viral RNA, this is the first time that it has been discovered in HBV ( Figure 8),

[0105] Figure 8 It is a diagram showing the HBV replication regulation model based on miR-4453.

[0106] HBV pgRNA has two ε signals, and the ε located in the 5'UTR is the target of miR-4453, which enhances HBV replication by activating the translation of pgRNA or stabilizing pgRNA. HBV replication leads to downregulation of miR-4453 expression, showing a negative feedback loop. However, low levels of miR-4453 still maintain HBV replication.

[0107] Since inhibitors of miR-4453 can inhibit viral replication, it is expected that a new method for treating HBV infection such as miravirsen (miR-122 inhibitor: HCV infection therapeutic agent) (Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, Munk ME, Kauppinen S, Orum H. Science. 2010 Jan 8; 327(5962): 198-201. Therapeutic silencing of microRNA-122 in priority with chronic hepatitis C virus infection) can be developed. In the case of miR-122, there are two viewpoints: one is the mechanism that acts on the stability of HCV RNA and the other is the mechanism that contributes to the translation of HCV RNA. In the case of miR-4453, according to its functional analysis, it is also possible to have these two mechanisms.

[0108] Example 2

[0109] About the mechanism

[0110] Since miR-4453 was found to target the 5'ε of pgRNA, the inventors analyzed the behavior of 3.5kb pgRNA by Northern blotting. The results showed that in HepG2.2.15 cells where HBV constitutively replicates, the amount of pgRNA increased when miR-4453 was added, while the amount of pgRNA decreased when an inhibitor of miR-4453 was added. In addition, we analyzed the stability of pgRNA by Northern blotting when actinomycin D was added to the culture system to stop the synthesis of new RNA. The results showed that the stability of pgRNA increased with the increase of miR-4453 ( Fig. 9 ).

[0111] Effects of different miR-4453 inhibitors

[0112] So far, when analyzing miR-4453 inhibitors, the inhibitors manufactured by Exicon have been used to study their effects on HBV. In order to exclude the possibility that the effect of inhibiting miR-4453 is specific to Exicon's product, we conducted the same inhibition experiment with another miR-4453 inhibitor. First, the inhibitor miRIDIAN microRNA Hairpin Inhibitor manufactured by Dharmacon was used to analyze HepG2.2.15 cells. As a result, the inhibitor of miR-4453 inhibited HBV replication in a concentration-dependent manner as before ( Fig.10 ). The same experiment was conducted using the microRNA inhibitor S-TuD manufactured by Sigma. As a result, it was observed that the inhibition of HBV replication in HepG2.2.15 cells was concentration-dependent ( Fig.11 In the infection experiment using HepG2-hNTCP-30 cells, S-TuD of miR-4453 also inhibited the replication of HBV. It did not affect the cell survival rate ( Fig.12 ). From these results, it was determined that three different inhibitors of miR-4453 all inhibited HBV replication.

[0113] Analysis of the effect of miR-4453 inhibitor on animal models of HBV infection

[0114] Humanized liver chimeric mice were used to test whether the miR-4453 inhibitor has an anti-HBV effect during persistent HBV infection. The inhibitor (Exicon) was administered to chimeric mice that reached persistent infection after 10 weeks of HBV infection, and the amount of HBV DNA in the serum was measured at regular intervals. As a result, after 14 days of administration, the control group and the group administered with the miR-4453 inhibitor were compared, and it was found that miR-4453 significantly reduced the amount of HBV DNA. On the other hand, there was no change in the amount of human serum albumin and body weight ( Fig.13 ), therefore, miR-4453 inhibitors have anti-HBV effects not only in cultured cell lines but also in animal models of HBV infection.

[0115] Sequence numbers 1, 3 to 12: synthetic RNA

[0116] SEQ ID NOs. 2, 13 to 22: Synthetic DNA

Claims

1. Use of a composition in the manufacture of a hepatitis B virus replication inhibitor, wherein: The composition comprises: Inhibitory substance for microRNA binding to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus, The microRNA is miR-4453, The inhibitory substance is an artificial cross-linked nucleic acid represented by the base sequence of sequence number 2: AACCGCTACAGACCAAGCTC.

2. Use of a composition in the manufacture of a therapeutic agent for hepatitis B, wherein: The composition comprises: Inhibitory substance for microRNA binding to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus, The microRNA is miR-4453, The inhibitory substance is an artificial cross-linked nucleic acid represented by the base sequence of sequence number 2: AACCGCTACAGACCAAGCTC.

3. Use of a composition in the manufacture of a therapeutic agent for hepatitis B virus infection, wherein: The composition comprises: Inhibitory substance for microRNA binding to the 5' epsilon signal sequence of the pregenomic RNA of hepatitis B virus, The microRNA is miR-4453, The inhibitory substance is an artificial cross-linked nucleic acid represented by the base sequence of sequence number 2: AACCGCTACAGACCAAGCTC.

4. The use according to any one of claims 1 to 3, wherein miR-4453 includes the base sequence represented by Sequence ID 1: GAGCUUGGUCUGUAGCGGUU.

Images