A method and composition for treating MPS IH based on LEAPER technology
By using LEAPER technology to edit RNA with endogenous ADAR in target cells, the problems of low expression efficiency and carcinogenic risk of exogenous nucleases in existing technologies have been solved, enabling precise repair of IDUA gene mutations and disease treatment.
Patent Information
- Application Number
- CN202011626234.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-12-30
- Filing Date
- 2020-12-30
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2040-12-30
AI Technical Summary
Existing gene editing technologies such as CRISPR and RESTORE have problems such as low expression efficiency of exogenous nucleases, potential carcinogenic risks and immune responses when treating Heller syndrome, and cannot effectively repair the G to A mutation in the IDUA gene, thus failing to completely cure Heller syndrome.
Using LEAPER technology, RNA (arRNA) is recruited to target cells by delivering adenosine deaminase containing complementary RNA sequences. Endogenous ADAR is used for RNA editing to precisely repair the G-to-A mutation in the IDUA gene and restore the activity of α-L-iduronase.
This technology enables the safe and efficient editing of RNA within target cells, precisely repairing pathogenic mutations, restoring protein expression, and achieving the goal of treating MPS IH, while avoiding the risks associated with exogenous protein expression.
Smart Images

Figure BDA0002874917180000221 
Figure BDA0002874917180000231 
Figure BDA0002874917180000232
Abstract
Description
Technical Field
[0001] This application belongs to the field of gene editing therapy, specifically, it relates to a method for targeted RNA editing to treat MPS IH based on LEAPER (Leveraging Endogenous ADAR for Programmable Editing on RNA) technology, which includes using LEAPER technology to perform in vivo site-directed editing of A to I bases on RNA to treat diseases caused by G>A mutations, such as MPS IH. Background Technology
[0002] Hurler syndrome, also known as mucopolysaccharidoses IH (MPS IH) or mucopolysaccharidosis IH, is the most severe of the three subtypes of MPSI: IH, IH / S, and IS. It is a disabling and fatal inherited metabolic disease caused by a deficiency of α-L-iduronidase (IDUA) in patients. It is an autosomal recessive (AR) genetic disorder. The root cause of Heller's syndrome is a mutation in the IDUA gene, located on chromosome 4p16.3, which encodes the IDUA protein. To date, there are over 200 pathogenic mutations, the most common being a G-to-A mutation at position 1205 of the α-L-idurolucuronidase cDNA. This mutation causes tryptophan to become a stop codon, resulting in the protein lacking all amino acids following this site (NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter)) and thus losing all IDUA enzyme activity. This mutation type accounts for 63% of all cases (Worldwide distribution of common IDUA pathogenic variants, Poletto, Edina (2018). Clinical Genetics. 94.10.1111 / cge.13224.). α-L-iduronidase is responsible for the degradation of glycosaminoglycans (GAGs) in lysosomes. There is significant individual variation in Hurler syndrome. Patients may be normal at birth, with the earliest signs appearing between 3 and 6 months of age as a rough facial contour, followed by prominent frontal bone, skeletal deformities, growth retardation, and speech disorders. Patients typically do not live past the age of 10.
[0003] There is no cure for Hurler syndrome. Two treatment options are currently known and approved: enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT). ERT has shown good results in terms of visceral phenotype, including reduced liver size, improved respiratory function, and overall improved patient activity. However, it does not reach the central nervous system and therefore cannot prevent cognitive impairment. On the other hand, successful HSCT can prevent most clinical symptoms, including neurological symptoms, but treatment must be initiated before the onset of clinical symptoms (ideally before 8 months of age). However, due to its high mortality rate, this treatment is only suitable for severely ill patients (Combination of enzyme replacement and hematopoietic stem cell transplantation as therapy for Hurler Syndrome. Tolar, J (2008). Bone marrow transplantation. 41.531-5.10.1038 / sj.bmt.1705934).
[0004] Currently, the principle behind gene editing technology researched for treating Heller's syndrome is to use zinc finger nuclease (ZFN) and adeno-associated virus (AAV) to insert the cDNA sequence encoding the normal IDUA protein into the genome of hepatocytes. However, this method still cannot resolve the symptoms of Heller's syndrome in the brain, skeletal system, and other systems. In addition, off-target effects caused by DNA editing are a problem that requires high attention.
[0005] Theoretically, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), a genome editing technology that has been developing rapidly in recent years, could also be used to treat Heller's syndrome. Many researchers and biotechnology companies are also working to bring this technology to clinical practice. For example, in September 2019, the first clinical trial results were reported using CRISPR to edit stem cells and reinfuse them into patients to treat AIDS and leukemia, making a significant contribution to the translation of CRISPR technology into gene therapy. Despite the enormous potential applications of CRISPR technology, it also has a series of limitations, making its translation from research to clinical application extremely difficult. One of these problems is the core enzyme used in CRISPR: Cas9. CRISPR-based DNA editing technology requires the exogenous expression of Cas9 or other nucleases with similar functions, leading to several issues. First, the nucleases that typically require exogenous expression usually have a large molecular weight, which drastically reduces the efficiency of delivering them into the body via viral vectors. Secondly, the exogenous expression of nucleases carries the potential for off-target effects, posing a potential carcinogenic risk during their application. Finally, the exogenously expressed nucleases are found in bacteria, not naturally occurring in humans or other mammals. This could trigger an immune response in the patient, potentially causing harm or neutralizing the exogenously expressed nuclease, thus rendering it inactive or hindering further intervention.
[0006] In 2017, Zhang Feng's research group reported an RNA editing technology called REPAIR (RNA Editing for Programmable Ato I Replacement) (RNA editing with CRISPR-Cas13, Cox et al., 2017). This technology can achieve A-to-I editing of target RNA by exogenously expressing the Cas13-ADAR fusion protein and a single guide RNA (sgRNA). However, like CRISPR technology, this method still requires the expression of exogenous proteins, thus failing to solve the problems caused by the expression of exogenous proteins.
[0007] In January 2019, Thorsten Stafforst's research group reported a nucleic acid editing technology called RESTORE (recruiting endogenous ADAR to specific trans for oligonucleotide-mediated RNA editing, Merkle et al., 2019). This technology can eliminate dependence on exogenous proteins. However, firstly, RESTORE technology requires the presence of IFN-γ to achieve high editing efficiency, and IFN-γ is a key factor determining the development and severity of autoimmunity (Interferon-γ and systemic autoimmunity, Pollard et al., 2013), which significantly reduces the application of this technology in the medical field. On the other hand, RESTORE technology also uses a guide RNA, which is a chemically synthesized oligonucleotide, and the synthesized oligonucleotide requires a large amount of artificial chemical modification to ensure its stability.
[0008] In 2019, PCT / CN2019 / 110782 and PCT / CN2020 / 084922 applied for a method of engineering RNA that is partially complementary to a target transcript to recruit native ADAR1 or ADAR2 to convert adenosine to inosine at a specific site in the target RNA. This method is called "LEAPER (Leveraging Endogenous ADAR for Programmable Editing on RNA)," and the RNA that recruits ADAR can be called "dRNA" or "arRNA." The dRNA contains a complementary RNA sequence that hybridizes with the target RNA, and the dRNA is capable of recruiting adenosine deaminase (ADAR) that acts on RNA to deaminate the target adenosine (A) in the target RNA. Summary of the Invention
[0009] This application provides a novel technical solution for the G-to-A mutation in the IDUA gene that causes Hurler syndrome, especially the most prevalent mutant (NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter)), which enables precise editing of mutation sites on target RNA.
[0010] Specifically, this application provides at least the following technical solutions:
[0011] 1. A method for targeted editing of target RNA in target cells based on LEAPER technology, wherein the target RNA is RNA containing a G-to-A mutation in the IDUA gene transcript, the method comprising:
[0012] An adenosine deaminase recruiting RNA (arRNA) or a construct encoding the arRNA for editing target RNA is delivered to the target cell, wherein the arRNA contains a complementary RNA sequence that hybridizes with the target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase (ADAR) that acts on RNA to deaminate the target adenosine (A) in the target RNA.
[0013] 2. The method as described in item 1, wherein the arRNA introduces a base C, A, U or G that pairs with the target A.
[0014] In some embodiments, the arRNA introduces a base C that pairs with target A. In some embodiments, the arRNA introduces a base A that pairs with target A. In some embodiments, the arRNA introduces a base U that pairs with target A. 3. The method of any one of claims 1-2, wherein the arRNA is about 151-61 nt, 131-66 nt, 121-66 nt, 111-66 nt, 91-66 nt, or 81-66 nt in length. This application discloses and covers any natural number within the range of said numbers.
[0015] 4. The method as described in item 3, wherein the distance from the 3' end of the target base in the arRNA is 45-5 nt, 40-5 nt, 35-10 nt, 25-15 nt, or 24-11 nt. This application discloses and covers any natural number within the range of said numbers.
[0016] 5. The method as described in item 3 or 4, wherein the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55 nt-35 nt, or 55 nt-45 nt. This application discloses and covers any natural number within the range of said numbers.
[0017] 6. The method as described in items 1-5, wherein the target cell is a human cell.
[0018] 7. The method of any one of items 1-6, wherein the target RNA is RNA containing the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site.
[0019] 8. The method of any one of items 1-7, wherein the arRNA comprises the following sequences: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31 or SEQ ID NO: 34.
[0020] 9. The method of any one of items 1-5, wherein the arRNA comprises a sequence selected from: SEQ ID NO: 44 or SEQ ID NO: 52.
[0021] 10. The method of any one of items 1-9, wherein the arRNA is chemically modified.
[0022] 11. The method of claim 10, wherein the chemical modification comprises 2-O'-methylation (2'-OMe) or thiophosphate modification.
[0023] 12. The method as described in item 11, wherein the chemical modification is selected from one or more of the following:
[0024] The first three and last three nucleotides of the sequence are modified with 2'-OMe, respectively.
[0025] The first three nucleotides and the last three nucleotides are linked by phosphate thioester bonds.
[0026] All Us in the sequence are modified by 2'-OMe.
[0027] The 3' nearest neighbor of the targeted base is an A base modified with 2'-OMe.
[0028] The 5' nearest neighbor of the target base is a C base modified with 2'-OMe.
[0029] The target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases via thiophosphate bonds.
[0030] The first 5 and last 5 nucleotides are modified with 2'-OMe, and
[0031] The first 5 nucleotides and the last 5 nucleotides are linked by phosphate thioester bonds.
[0032] In some specific embodiments, the chemical modification is selected from one or more of the following:
[0033] CM1: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, all U in the sequence are modified with 2'-OMe.
[0034] CM2: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 3' nearest neighbor of the target base is the A modified with 2'-OMe.
[0035] CM3: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 5' nearest neighbor of the target base is a C modified with 2'-OMe.
[0036] CM4: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; simultaneously, the target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases by phosphate thioester bonds; and
[0037] CM6: The first 5 and last 5 nucleotides of the sequence are modified with 2'-OMe, and the first 5 and last 5 nucleotides are linked by a phosphate thioester bond. 13. The method of any one of items 1-9, wherein the construct encoding the arRNA is a linear nucleic acid strand, a viral vector, or a plasmid.
[0038] 14. The method as described in item 13, wherein the viral vector is an adeno-associated virus (AAV) vector or a lentiviral expression vector.
[0039] 15. The method of any one of items 1-14, wherein the delivery method is electroporation, liposome transfection, lipid nanoparticle (LNP) delivery, or infection.
[0040] 16. The method of item 15, wherein an adenosine deaminase recruiting RNA (arRNA) for editing target RNA or a construct encoding said arRNA is delivered to the target cell via an LNP.
[0041] 17. The method of any one of items 1-16, wherein the delivery concentration of said arRNA is ≥2.5, ≥5 nM, ≥10 nM, ≥15 nM, or ≥20 nM.
[0042] In the above embodiments, the target cells include hepatocytes or fibroblasts.
[0043] 18. An arRNA or its coding sequence for targeted editing of target RNA in target cells via LEAPER technology, said arRNA comprising or consisting of any of the following sequences: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 44 or SEQ ID NO: 52.
[0044] 19. Plasmids, viral vectors, liposomes, or lipid nanoparticles comprising the arRNA or its coding sequence described in item 18.
[0045] 20. A composition, formulation, kit, or biological product comprising the arRNA or its coding sequence as described in item 18, or the plasmid, viral vector, liposome, or lipid nanoparticle as described in item 19.
[0046] 21. A method for treating MPS IH in an individual, comprising correcting a G-to-A mutation associated with MPS IH disease in the target cells of the individual using the method described in any one of items 1-17.
[0047] 22. The method of item 20, wherein the mutation is the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation.
[0048] 23. The method of item 20 or 21, wherein the frequency of use of said arRNA is ≥21 days / time, ≥17 days / time, ≥14 days / time, or ≥10 days / time.
[0049] In some embodiments, this application also relates to the use of sequences selected from the following in the preparation of a medicament for treating MPS IH disease: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 44 or SEQ ID NO: 52.
[0050] Using the technical solution of this application, in vivo editing of A to I bases on RNA in target cells (such as hepatocytes or fibroblasts) can be performed safely and effectively, precisely repairing pathogenic mutation sites, such as the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation, restoring the normal expression of RNA-encoded proteins in vivo, and achieving the goal of treating MSP IH. Attached Figure Description
[0051] Figure 1 The results show the detection of the IDUA genotype on GM06214 cells.
[0052] Figure 2 The cell electroporation conditions were shown.
[0053] Figure 3A -B shows the use of arRNA designed for IDUA pre-mRNA and mRNA to detect post-edited cell function; and the use of arRNA designed for IDUA pre-mRNA and mRNA to detect cell editing efficiency.
[0054] Figure 4A The design of the IDUA-reporter cell line was shown; and Figure 4B The editing efficiency of arRNAs of different lengths (symmetrically truncated) was detected on 293T-IDUA-Reporter.
[0055] Figure 5A -B shows the enzyme activity and editing efficiency at different time points after transfection of arRNAs of different lengths (symmetrically truncated) in GM06214 cells.
[0056] Figure 6 The results show the detection of IDUA enzyme activity and editing efficiency in GM06214 cells after transfection with arRNA (symmetrical truncated, 3' truncated, and 5' truncated) using lipofectmine RNAiMAX.
[0057] Figure 7A The results show that the arRNA targeting the human IDUA mutation site is preferably between 55-c-25 and 55-c-10, with bases progressively reduced at the 3' end. The optimal length was selected using GM06214 cells by enzyme activity assay. 7B shows that the arRNA targeting the mouse IDUA mutation site is between 55-c-55 and 55-c-10, with bases progressively reduced at the 3' end in 5-base increments. The optimal arRNA length sequence was selected using MPSI mouse MEF cells (MSPI MEF (MSPI mouse embryo fibroblast)) by enzyme activity assay.
[0058] Figure 8A This demonstrates how, with two preferred 3' end lengths, the 5' end length is gradually shortened to filter out the optimal length range. Figure 8B This study showed the effect of arRNAs formed by truncating the 5' end base by base after fixing the 3' end length to 14 nt on enzyme activity, and summarized the results. Figure 8A and 8B The optimal arRNA length was selected.
[0059] Figure 9 The study showed the effect of different chemical modifications on arRNA editing efficiency (represented by enzyme activity) at a preferred 2 arRNA length.
[0060] Figure 10A -D shows the editing efficiency of human and mouse arRNA editing of IDUA mRNA and the ability to produce functional IDUA protein after editing, under preferred length and preferred chemical modification combinations and at different arRNA concentrations.
[0061] Figure 11A -D shows the IDUA enzyme activity measured at different times after a single transfection in human or mouse cells, under the preferred combination of length and preferred chemical modification.
[0062] Figure 12A -B shows the efficiency of target site editing achieved by delivering arRNA in different ways in primary liver cells of humans and mice.
[0063] Figure 13 The editing efficiency of arRNA targeting IDUA delivered using LNP was demonstrated in primary cultured human and mouse liver cells.
[0064] Figure 14 This study demonstrates the IDUA editing efficiency in mouse liver cells after the selected arRNA (SEQ ID NO: 52) targeting mouse IDUA mutations was packaged into LNPs and administered to mice via the tail vein at different concentrations for 24 hours. Detailed Implementation
[0065] definition
[0066] RNA editing is a natural process in eukaryotic cells. It occurs at the RNA level after DNA transcription and before protein translation, involving the editing of bases from A (adenine) to I (hypoxanthine). Hypoxanthine is recognized as G during translation. This A-to-I editing in RNA diversifies the transcriptome. It increases the total amount of RNA several times over by specifically and precisely altering RNA molecules at specific sites. This editing is catalyzed by the ADAR (Adenosine Deaminase Acting on RNA) protease and is called site-directed RNA editing. Editing can occur in coding regions, including introns and exons, as well as in non-coding regions. Editing in coding regions can redefine protein-coding sequences.
[0067] As used herein, "LEAPER technology" refers to RNA editing using engineered RNA to recruit endogenous ADAR, specifically the RNA editing technology reported in WO2020074001A1. The engineered RNA is adenosine deaminase recruiting RNA (arRNA), which, as used herein, refers to RNA capable of deamination of target adenosine in RNA by recruiting ADAR or certain complexes containing ADAR domains.
[0068] As used in this article, the term "adenosine deaminase (ADAR)" refers to a class of adenosine deaminases widely expressed in various tissues of eukaryotes (including mammals such as humans), which catalyze the conversion of adenosine A in RNA molecules to inosine I. In eukaryotic protein synthesis, I is typically translated as G.
[0069] As used herein, “complementarity” of nucleic acids refers to the ability of one nucleic acid to form hydrogen bonds with another nucleic acid through conventional Watson-Crick base pairing. Percentage complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairing) with another nucleic acid molecule (e.g., approximately 50%, 60%, 70%, 80%, 90%, and 100% complementarity out of 10, respectively). “Complete complementarity” means that all consecutive residues in a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, “substantially complementary” means the degree of complementarity of at least approximately 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% in a region of approximately 40, 50, 60, 70, 80, 100, 150, 200, 250, or more nucleotides, or refers to two nucleic acids hybridized under stringent conditions. For a single base or a single nucleotide, according to the Watson-Crick base pairing rule, when A is paired with T or U, or C with G or I, it is called complementary or matched, and vice versa; all other base pairings are called non-complementary or mismatched.
[0070] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of the nucleotide residues. These hydrogen bonds can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. A sequence capable of hybridizing with a given sequence is called its "complementary sequence."
[0071] As used in this article, the term "electroporation" refers to electroporation transfection technology, which uses an electric field to temporarily create pores or openings in the cell membrane after a few microseconds to a few milliseconds to deliver macromolecules such as DNA into the cell.
[0072] As used herein, the term "liposome transfection (Lipo)" refers to a transfection technique that uses liposomes as in vivo and in vitro delivery carriers. Liposomes include neutral liposomes and cationic liposomes. Neutral liposomes utilize a lipid membrane to encapsulate macromolecules, such as nucleic acids, and deliver these macromolecules into the cell membrane via the lipid membrane. Cationic liposomes are positively charged, and the macromolecules they transport are not pre-encapsulated within them. Instead, the macromolecules themselves are negatively charged and automatically bind to the positively charged liposomes, forming a macromolecule-cationic liposome complex. This complex is then adsorbed onto the negatively charged cell membrane surface and delivered into the cell via endocytosis.
[0073] As used herein, the term "lipid-nanoparticle (LNP) delivery" refers to the transmembrane delivery of macromolecules, such as nucleic acids and proteins, into cells via lipid nanoparticles. Lipid nanoparticles are particles synthesized from a two-phase mixture comprising an ethanol phase containing ionizable lipids, cofactor phospholipids, cholesterol, and PEG esters, and an acidic aqueous phase containing macromolecules such as nucleic acids and proteins. For example, LNPs encapsulating RNA can enter the cytoplasm via endocytosis.
[0074] In this paper, the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation refers to a mutation from G to A at position 1205 in the transcript of IDUA gene number 000203.4. This mutation causes the tryptophan (Trp) coding sequence at position 402 of the peptide chain translated from this transcript to be replaced by a stop codon (Ter), resulting in the final translated amino acid sequence lacking all amino acids after position 402, thereby losing the enzymatic activity of IDUA. Patients with this mutation will have impaired degradation of glucosamine in lysosomes due to the lack of active α-L-iduronase, ultimately leading to teratogenicity or even death. The protocol in this application can reverse this mutation at the transcriptional level, restoring the activity of the IDUA enzyme.
[0075] As used herein, the term "target RNA" refers to the target RNA to be edited, which contains the adenosine (A) to be edited. The target RNA can be mature mRNA or an mRNA precursor. In this application, an mRNA precursor is preferred. In this document, the cell containing the "target RNA" is referred to as the target cell. The adenosine to be edited is referred to as the "target base," "target adenosine," or "target A." In this application, "target base," "target adenosine," or "target A" can be used interchangeably. The base adjacent to the target adenosine at the 5' end of the target RNA is referred to as the "5' adjacent base"; the base adjacent to the target adenosine at the 3' end of the target RNA is referred to as the "3' adjacent base"; the base triplet consisting of the target base and its 3' and 5' adjacent bases is referred to herein as the "target base triplet." When arRNA hybridizes with target RNA, the base on the arRNA that is opposite to the target base is called the "target base". The base adjacent to the target base at the 5' end of the arRNA is called the "5' nearest neighbor base". The base adjacent to the target base at the 3' end of the arRNA is called the "3' nearest neighbor base". The base triplet composed of the target base and its 3' and 5' nearest neighbors is referred to as the "target base triplet" in this paper.
[0076] As used herein, the term "construct" refers to a nucleic acid vector containing a specific nucleic acid sequence, which may be a linear nucleic acid molecule, plasmid, or viral vector, etc. The nucleic acid molecule may be single-stranded or double-stranded. The nucleic acid sequence may be a DNA sequence or an RNA sequence. In some embodiments, the nucleic acid sequence functions directly without transcription, translation, or expression. In some embodiments, the nucleic acid sequence is a DNA sequence that functions as an RNA molecule after transcription to form RNA. In some embodiments, the nucleic acid sequence is RNA that functions as a polypeptide or protein after translation. In some embodiments, the nucleic acid sequence is DNA that functions as a protein after transcription and translation to form a protein. The construct may enter target cells by packaging as a virus, lipid nanoparticle, or exosome, or by electroporation, microinjection, chemical transformation, etc.
[0077] As used herein, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples of "delivery" include electroporation, liposome transfection, lipid-nanoparticle delivery, viral delivery, and exosome delivery.
[0078] As used in this application, the term "modification" refers to altering the composition or structure of a nucleic acid or protein through chemical or biological methods, such as genetic engineering, thereby changing one or more properties or functions of the nucleic acid or protein.
[0079] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0080] RNA editing methods
[0081] This application provides a method for targeted editing of IDUA target RNA containing a G-to-A mutation in target cells based on LEAPER technology. The method includes: delivering an adenosine deaminase recruiting RNA (arRNA) or a construct encoding the arRNA to the target cells, wherein the arRNA contains a complementary RNA sequence that hybridizes with the target RNA, and wherein the arRNA is capable of recruiting an RNA-acting adenosine deaminase (ADAR) to deaminate the target adenosine (A) in the target RNA. In some embodiments, the target RNA is a precursor mRNA. In some embodiments, the target RNA is mature mRNA. In some embodiments, the target RNA is IDUA target RNA transcribed to contain the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site.
[0082] In some embodiments, the arRNA contains bases C, A, U, or G that pair with target A. The preferred order of the bases pairing with target A is C, A, U, G. That is, when the arRNA length is consistent, the distance of the target base from the 5' end is consistent, the distance of the target base from the 3' end is consistent, and the arRNA sequence is completely identical except for the target base, the preferred order of the target bases is C > A > U > G. When the target base is C, the arRNA can be represented as X nt - cY nt, where X represents the distance of the target base from the 5' end of the arRNA as X nt, and Y represents the distance of the target base from the 3' end of the arRNA as Y nt, where X and Y can represent any natural number.
[0083] In some embodiments, the target cells are eukaryotic cells. In some embodiments, the target cells are mammalian cells. In some embodiments, the target cells are hepatocytes or fibroblasts. In some embodiments, the target cells are human or mouse cells.
[0084] In some embodiments, the arRNA is approximately 151-61 nt, 131-66 nt, 121-66 nt, 111-66 nt, 91-66 nt, or 81-66 nt long. In some embodiments, the distance from the 3' end of the target base in the arRNA is 45-5 nt, 40-5 nt, 35-10 nt, 25-15 nt, or 24-11 nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55-35 nt, or 55-45 nt. The distance from the 3' end of the target base refers to the number of bases from the 3' nearest neighbor to the 3' terminal base; the distance from the 5' end of the target base refers to the number of bases from the 5' nearest neighbor to the 5' terminal base.
[0085] In some embodiments, the target cell is a human cell, and the target RNA is an IDUA target RNA transcribed with an NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site. In this case, the full-length arRNA is ≥66 nt, for example, approximately 121-66 nt, 111-66 nt, 101-66 nt, 91-66 nt, or 81-66 nt, meaning the full-length arRNA is selected from... Any natural number within the above length range, for example: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120nt. In some embodiments, the distance from the 3' end of the target base in the arRNA is 45-5nt, 40-5nt, 35-10nt, 25nt-15nt, or 24nt-11nt. That is, the distance from the 3' end of the target base in the arRNA is selected from any natural number within the above range of the distance from the 3' end of the target base, such as 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, or 23nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55-35 nt, or 55-45 nt, meaning the distance from the 5' end of the target base in the arRNA is selected from any natural number within the aforementioned range, such as 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, or 54 nt. In some embodiments, the arRNA comprises sequences selected from the following: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 34.
[0086] In some embodiments, the target cells are mouse cells (e.g., W392X mouse cells), and the target RNA is transcribed with a target RNA containing an IDUA mutation corresponding to the human W402X mutation. In some embodiments, the target cells are W392X mouse cells. In some implementations, the arRNA is approximately 121-53 nt, 111-61 nt, 101-61 nt, 91-61 nt, 81-61 nt, 111-66 nt, or 105-66 nt in length. That is, the full length of the arRNA is selected from any natural number within the above length range, for example: 67 nt, 68 nt, 69 nt, 70 nt, 71 nt, 72 nt, 73 nt, 74 nt, 75 nt, 76 nt, 77 nt, 78 nt, 79 nt, 80 nt, 81 nt, 82 nt, 83 nt, 84 nt, 85 nt, 86 nt, 87 nt, 88 nt, 89 nt, 90 nt, 91 nt, 95 nt, 100 nt, 110 nt, 115 nt, 120 nt. In some embodiments, the distance from the 3' end of the target base in the arRNA is 55nt-10nt or 50nt-10nt, that is, the distance from the 3' end of the target base in the arRNA is selected from any natural number within the range of the aforementioned distances from the 3' end of the target base, for example: 11nt, 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 35nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55 nt-35 nt, or 55 nt-45 nt. That is, the distance from the 5' end of the target base in the arRNA is selected from any natural number within the aforementioned range, such as 33 nt, 36 nt, 47 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, 54 nt, 60 nt, 65 nt, or 75 nt. In some embodiments, the arRNA comprises a sequence selected from SEQ ID NO: 44 or SEQ ID NO: 52.
[0087] In some embodiments, the arRNA is chemically modified. In some embodiments, the chemical modification is 2-O'-methylation and / or phosphate thioester modification. In some embodiments, the chemical modification is selected from one or more of the following:
[0088] The first three and last three nucleotides of the sequence are modified with 2'-OMe, respectively.
[0089] The first three nucleotides and the last three nucleotides are linked by phosphate thioester bonds.
[0090] All Us in the sequence are modified by 2'-OMe.
[0091] The 3' nearest neighbor of the targeted base is an A base modified with 2'-OMe.
[0092] The 5' nearest neighbor of the target base is a C base modified with 2'-OMe.
[0093] The target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases via thiophosphate bonds.
[0094] The first 5 and last 5 nucleotides are modified with 2'-OMe, and
[0095] The first 5 nucleotides and the last 5 nucleotides are linked by phosphate thioester bonds.
[0096] As described herein, the construct encoding the arRNA is a construct containing the arRNA coding sequence. In some embodiments, the arRNA is transcribed from the construct encoding the arRNA after it is delivered to a target cell. In some embodiments, the construct encoding the arRNA is a linear nucleic acid strand, a viral vector, or a plasmid. In some embodiments, the viral vector is adeno-associated virus (AAV) or lentivirus. In some embodiments, when the construct encoding the arRNA is delivered to a target cell, it inserts the sequence encoding the arRNA into the target cell genome through homologous recombination or non-homologous recombination, thereby continuously transcribing and generating the arRNA. In some embodiments, when the construct encoding the arRNA is delivered to a target cell, it makes the sequence encoding the arRNA exist as part of the free nucleic acid in the target cell, so that the sequence encoding the arRNA can be transcribed and generated into the arRNA within a certain period of time.
[0097] In some embodiments, the delivery is performed by electrotransfection, liposome transfection, or lipid nanoparticle (LNP) delivery or infection. In some embodiments, when the target cells are hepatocytes, the delivery is LNP delivery. In some embodiments, when the target cells are fibroblasts, the delivery is liposome transfection. In some embodiments, the delivery concentration of the arRNA is ≥2.5-5 nM, preferably ≥10-20 nM, for example ≥15 nM. In this application, the delivery concentration refers to the amount of arRNA contained in a delivery system containing one volume unit of arRNA and the target cells when the arRNA construct is delivered to the target cells. The delivery system comprises arRNA or its construct, target cells, and a liquid matrix surrounding the arRNA and target cells. In some embodiments, the liquid matrix may be cell culture medium, PBS, or other isotonic solutions that can maintain stable cell viability for a certain period of time. In some embodiments, the delivery system further comprises a delivery-enhancing agent.
[0098] arRNA
[0099] This application also provides an arRNA that can be used to target and edit target RNA in target cells based on LEAPER technology. For example, it can transcribe target RNA containing the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site, causing the target A in the target RNA to be deaminated to form hypoxanthine I. During subsequent translation in the target cell, I is recognized as G, thereby restoring the G>A mutation to G, so that the target RNA edited by the arRNA can be translated into the correct protein. In some embodiments, the target RNA is a precursor mRNA. In some embodiments, the target RNA is mature mRNA.
[0100] In some embodiments, the editing efficiency of the arRNA introducing a base paired with target A (target base) is C, A, U, and G, from highest to lowest. In some embodiments, all bases in the arRNA except the target base can be complementary to the target RNA. In some embodiments, one or more bases in the arRNA, besides the target base, form mismatches with the target RNA.
[0101] In some embodiments, the target cells are eukaryotic cells. In some embodiments, the target cells are mammalian cells. In some embodiments, the target cells are hepatocytes or fibroblasts. In some embodiments, the target cells are human or mouse cells (e.g., W392X mouse cells).
[0102] In some embodiments, the arRNA is approximately 151-61 nt, 131-66 nt, 121-66 nt, 111-66 nt, 91-66 nt, or 81-66 nt long. In some embodiments, the distance from the 3' end of the target base in the arRNA is 45-5 nt, 40-5 nt, 35-10 nt, 25-15 nt, or 24-11 nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55-35 nt, or 55-45 nt. The distance from the 3' end of the target base refers to the number of bases from the 3' nearest neighbor to the 3' terminal base; the distance from the 5' end of the target base refers to the number of bases from the 5' nearest neighbor to the 5' terminal base.
[0103] In some embodiments, the target cell is a human cell, and the target RNA is an IDUA target RNA transcribed with an NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site. In this case, the full-length arRNA is ≥66 nt, for example, approximately 121-66 nt, 111-66 nt, 101-66 nt, 91-66 nt, or 81-66 nt, meaning the full-length arRNA is selected from... Any natural number within the above length range, for example: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120nt. In some embodiments, the distance from the 3' end of the target base in the arRNA is 45-5nt, 40-5nt, 35-10nt, 25nt-15nt, or 24nt-11nt. That is, the distance from the 3' end of the target base in the arRNA is selected from any natural number within the above range of the distance from the 3' end of the target base, such as 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, or 23nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55-35 nt, or 55-45 nt, meaning the distance from the 5' end of the target base in the arRNA is selected from any natural number within the aforementioned range, such as 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, or 54 nt. In some embodiments, the arRNA comprises sequences selected from the following: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 34.
[0104] In some embodiments, the target cell is a mouse cell (e.g., W392X mouse cell), and the target RNA is transcribed with an IDUA mutation corresponding to the human W402X mutation. In this case, the arRNA is approximately 121-53 nt, 111-61 nt, 101-61 nt, 91-61 nt, 81-61 nt, 111-66 nt, or 105-66 nt long; that is, the full length of the arRNA is selected from the above length range. Any natural number within the range, for example: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120nt. In some embodiments, the distance from the 3' end of the target base in the arRNA is 55nt-10nt or 50nt-10nt, that is, the distance from the 3' end of the target base in the arRNA is selected from any natural number within the range of the aforementioned distances from the 3' end of the target base, for example: 11nt, 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 35nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50nt. In some embodiments, the distance from the 5' end of the target base in the arRNA is 80-30 nt, 70-35 nt, 60-40 nt, 55 nt-35 nt, or 55 nt-45 nt. That is, the distance from the 5' end of the target base in the arRNA is selected from any natural number within the aforementioned range, such as 33 nt, 36 nt, 47 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, 51 nt, 52 nt, 53 nt, 54 nt, 60 nt, 65 nt, or 75 nt. In some embodiments, the arRNA comprises a sequence selected from SEQ ID NO: 44 or SEQ ID NO: 52.
[0105] In some embodiments, the arRNA is transcribed and expressed from a construct encoding the arRNA. In some embodiments, the arRNA is transcribed and expressed in vitro from a construct encoding the arRNA and then purified. In some embodiments, the arRNA is directly expressed in vivo from a construct encoding the arRNA and exerts an editing function. In some embodiments, the construct is selected from viral vectors, plasmids, and linear nucleic acids. In some embodiments, the virus is AAV or lentivirus.
[0106] In some embodiments, the arRNA is chemically synthesized. In some embodiments, the arRNA is chemically modified. In some embodiments, the chemical modification is 2-O'-methylation and / or phosphate thioester modification. In some embodiments, the chemical modification is selected from one or more of the following:
[0107] The first three and last three nucleotides of the sequence are modified with 2'-OMe, respectively.
[0108] The first three nucleotides and the last three nucleotides are linked by phosphate thioester bonds.
[0109] All Us in the sequence are modified by 2'-OMe.
[0110] The 3' nearest neighbor of the targeted base is an A base modified with 2'-OMe.
[0111] The 5' nearest neighbor of the target base is a C base modified with 2'-OMe.
[0112] The target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases via thiophosphate bonds.
[0113] The first 5 and last 5 nucleotides are modified with 2'-OMe, and
[0114] The first 5 nucleotides and the last 5 nucleotides are linked by phosphate thioester bonds.
[0115] In some embodiments, the chemical modification is selected from one or more of the following:
[0116] CM1: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, all U in the sequence are modified with 2'-OMe.
[0117] CM2: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 3' nearest neighbor of the target base is the A modified with 2'-OMe.
[0118] CM3: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 5' nearest neighbor of the target base is a C modified with 2'-OMe.
[0119] CM4: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; simultaneously, the target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases by phosphate thioester bonds; and
[0120] CM6: The first 5 and last 5 nucleotides of the sequence are modified with 2'-OMe, and the first 5 and last 5 nucleotides are linked by phosphate thioester bonds.
[0121] Construct
[0122] This application also provides a construct encoding the aforementioned arRNA. In some embodiments, the construct is selected from viral vectors, plasmids, and linear nucleic acids. In some embodiments, the viral vector is an AAV vector or a lentiviral expression vector.
[0123] This application further provides viruses, up to nanoparticles, liposomes, exosomes, or cells comprising the said construct.
[0124] Pharmaceutical preparations and biological products
[0125] This application also provides compositions, formulations, and biological products comprising any of the aforementioned arRNAs or constructs, which can be used to edit target RNA transcribed in target cells containing the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site to restore normal function of the IDUA gene. In some embodiments, the arRNA or construct is encapsulated in liposomes. In some embodiments, the arRNA or construct is prepared to form lipid nanoparticles. In some embodiments, the arRNA or construct is introduced into a subject via viral delivery (e.g., adeno-associated virus or lentivirus).
[0126] In some embodiments, the preparation containing an RNA is a therapeutic agent that can be administered to a patient for the treatment of a disease. In some embodiments, the administration is a local injection, local perfusion, or intravenous infusion, local perfusion, or local injection. In some embodiments, the agent is a dosage form suitable for local injection into the liver, such as hepatic artery perfusion. In some embodiments, the agent is a dosage form suitable for intramuscular injection. In some embodiments, the agent is a dosage form suitable for intravenous injection.
[0127] Reagent test kit
[0128] This application also provides a kit for editing target RNA in target cells, comprising the arRNA as described above, a construct encoding the arRNA as described above, or a formulation as described above. The kit can be used to target and edit target RNA transcribed in target cells containing the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation site.
[0129] In some embodiments, the kit comprises the arRNA or a construct encoding the arRNA as described above, and a staining agent, wherein the arRNA or construct and the staining agent are aliquoted into different containers. In some embodiments, the staining agent is a lipid solution, such as Invitrogen's Lipo (lipofectmine RNAiMAX, catalog number: 13778150) or a reagent having the same functional components.
[0130] In some implementations, the kit also includes instructions for use to inform the user of the various ingredients contained in the kit and their amounts, and / or how to use the kit.
[0131] therapy
[0132] This application further provides a method for treating mucopolysaccharidosis type IH in an individual, comprising correcting a G-to-A mutation in the IDUA gene in the individual's cells, such as the NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation, using the method described above. In some embodiments, the disease includes Heller's syndrome. In some embodiments, when the individual is human, the arRNA is used at a frequency of ≥21 days / time, ≥17 days / time, ≥14 days / time, or ≥10 days / time. In some embodiments, when the individual is a mouse, the arRNA is used at a frequency of ≥8 days / time. In some embodiments, the therapy uses a construct encoding the arRNA, and the construct can integrate the sequence encoding the arRNA into target cells, in which case the arRNA is used once.
[0133] The method for targeted RNA editing using LEAPER technology provided in this application has the following advantages:
[0134] 1. This method does not rely on the expression of exogenous proteins. Therefore, it will not be difficult to load and deliver the protein into the human body through viral vectors due to its large molecular weight; it will not cause off-target effects due to overexpression of exogenous proteins; it will not cause immune responses and damage caused by the expression of exogenous proteins; and it will not cause gene editing failure due to the neutralization of exogenous editing enzymes or effector proteins by pre-existing antibodies in the body.
[0135] 2. The enzyme-guided site-specific RNA editing method provided in this application differs from DNA editing in that RNA editing is reversible and controllable. Diseases can be treated and protein and RNA functions can be studied by recoding amino acid codons. Because the potential side effects of RNA editing are reversible, it is therefore safer.
[0136] 3. Compared with existing technologies, this method can not only be completed by chemically synthesizing arRNA and then performing electroporation or liposome transfection, but also delivered to patients through vectors such as adeno-associated virus (AAV) and lentivirus to exert its function. This makes the choice of delivery method more flexible and the editing efficiency higher.
[0137] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
[0138] The technical solution of the present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, all reagents involved below can be purchased commercially. For the sake of simplicity, some operations have not been described in detail in terms of parameters, steps and instruments used. It should be understood that these are well known and reproducible by those skilled in the art. The cells (GM06214) used in this article were purchased from Coriell, Inc., USA, and are fibroblasts derived from patients with Hurler syndrome. The arRNA used for editing was synthesized by Synthego, Inc., USA or Suzhou Beixin Biotechnology Co., Ltd., Sanger sequencing was performed by Beijing Ruibo Biotechnology Co., Ltd., and next-generation sequencing was performed by Novogene Bioinformatics Technology Co., Ltd. or the sequencing platform of the Rice Research Institute of the Chinese Academy of Sciences.
[0139] Example
[0140] Example 1: Detection of GM06214 mutant genotype
[0141] GM06214 cells (fibroblasts derived from Hurler syndrome patients) were placed in fibroblast culture medium (ScienCell, FM medium, catalog number: 2301) containing 15% serum, and 1% fibroblast growth additive (ScienCell, GFS, catalog number: 2301) was added. The cells were cultured at 37°C in a 5% CO2 incubator for 2-3 days. When the cell confluence reached 90%, the cells were digested with 0.25% trypsin, and the digestion was terminated with fibroblast culture medium containing 15% serum. (TIANGEN Biotech (Beijing) Co., Ltd.) Cell DNA Extraction Kit (Catalog No.: DP304-03) Perform DNA extraction according to the instructions.
[0142] Primers for the upstream and downstream sequences of the IDUA mutation site were designed using NCBI-Primer blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). SEQ ID NO 1: CGCTTCCAGGTCAACAACAC (forward primer hIDUA-F1); SEQ ID NO 2: CTCGCGTAGATCAGCACCG (reverse primer hIDUA-R1). PCR was performed, and the PCR products were sequenced using Sanger sequencing. The cellular mutation was determined to be the pathogenic type, with the G-to-A change at position 15704 of the IDUA genome. Figure 1 As shown.
[0143] Example 2: Screening of electroporation conditions for GM06214 cells
[0144] When GM06214 cells reached approximately 90% confluence, the cells were digested, and cell counts were performed after digestion was terminated. For electroporation, 6 million cells were resuspended in 400 μL of premixed electroporation buffer (Lonza, catalog number: V4XP-3024), and 20 μg of GFP plasmid (Lonza, catalog number: V4XP-3024) was added. After mixing, each 20 μL volume was used as one electroporation system, and seven electroporation conditions were tested using the Lonza nuclear electroporation instrument (see [link to relevant documentation]). Figure 2Eight conditions were included, with one negative control, and two replicates were performed for each condition. After electrotransfection, cells were rapidly transferred to 2 ml of fibroblast culture medium (ScienCell, FM medium, catalog number: 2301) containing 15% serum. Cells from each condition were seeded in two wells (6-well plate) and incubated at 37°C in a 5% CO2 incubator. 24 hours after electrotransfection, one well of cells from each electrotransfection condition was digested, and the proportion of GFP-positive cells was measured using flow cytometry. 48 hours after electrotransfection, the other well of cells from each electrotransfection condition was digested, and the proportion of GFP-positive cells was measured using flow cytometry. The optimal electrotransfection conditions for obtaining cells were those for the CA-137 group, as shown below. Figure 2 As shown.
[0145] Example 3: Study on IDUA enzyme activity and editing efficiency after electroporation of arRNA in GM06214 cells
[0146] Targeting the upstream and downstream sequences of the pre-mRNA (mRNA precursor) and mature-mRNA (mature mRNA) mutation sites of the IDUA gene, the following arRNA sequences were designed and synthesized: SEQ ID NO 3: GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCCAGCAGCGCCAGCAGCCCCAUGGCCGUGAGCACCGGCUU (Pre-55nt-c-55nt); SEQ ID NO 4: GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCUGCGGGGCGGGGGGGGCCGUCGCCGCGUGGGGUCGUUG (m-55nt-c-55nt); SEQ ID NO 5: UACCGCUACAGCCACGCUGAUUUCAGCUAUACCUGCCCGGUAUAAAGGGACGUUCACACCGCGAUGUUCUCUGCUGGGGAAUUGCGCGAUAUUCAGGAUUAAAAGAAGUGC (Random-111nt), wherein the base corresponding to the mutation site in the synthesized arRNA is changed from T to C, forming an AC mismatch. The length of the synthesized arRNA is preferably 111nt. Cells were electrotransfected using the optimal electrotransfection conditions obtained in Example 2. 48 hours after electrotransfection, cells were collected for enzyme activity assay and editing efficiency detection.
[0147] Editing efficiency test:
[0148] The designed and synthesized arRNA was dissolved to the required concentration in RNase-free water (TransGold, catalog number: GI201-01) and stored at -80°C. When GM06214 cells reached approximately 90% confluence, the cells were digested, and cell counts were performed after digestion. One million cells were taken, and 200 pmol of arRNA was added to a volume of 100 μL. Electrotransfection was performed under CA-137 conditions. Forty-eight hours after electrotransfection, cell counts and viability were determined. Cells were transferred to RNase-free centrifuge tubes, centrifuged, and the supernatant was discarded. RNA was extracted using the QIAGEN RNA extraction kit (QIAGEN, catalog number: 74134). Following the instructions, the extraction was performed at 5 × 10⁻⁶ cells / day. 5 Add 0.35 ml of Buffer RLTPlus to each cell and mix by pipetting (if directly extracting RNA from frozen cells, it is recommended to wash once with PBS). Add the lysed cell solution to a gDNAEliminator spin column and centrifuge at ≥8000g for 30s. Discard the column and keep the liquid. Add one volume of 70% ethanol, mix by pipetting, and immediately proceed to the next step. Add the liquid to an RNeasyMinElute spin column and centrifuge at ≥8000g for 15s. Discard the waste liquid. Add 700 μl of Buffer RW1 to the RNeasyMinElute spin column and centrifuge at ≥8000g for 15s. Discard the waste liquid. Add 500 μl of Buffer RPE to the RNeasyMinElute spin column and centrifuge at ≥8000g for 15s. Discard the waste liquid. Add 500 μl of 80% ethanol to the RNeasyMinElute spin column and centrifuge at ≥8000g for 2 minutes. Discard the waste liquid. Transfer the RNeasyMinElute rotary column to a new 2ml collection column, open the cap, and centrifuge at maximum speed for 5 minutes to allow the column to dry. Transfer the RNeasyMinElute rotary column to a new 1.5ml collection column, add 14μl of RNase-free water to the center of the column membrane, and centrifuge at maximum speed for 1 minute to elute RNA.
[0149] The extracted RNA concentration was measured using Nanodrop (Thermo, catalog number: Nanodrop2000), and 1 μg of RNA was used for reverse transcription (Thermo, reverse transcriptase catalog number: 28025013). The reverse transcription system was prepared as shown in Table 1. After incubation at 65°C for 5 minutes, the mixture was immediately cooled to ice. Incubation continued at 37°C for 50 minutes. The reverse transcriptase was then inactivated at 70°C for 15 minutes. PCR was performed under the conditions shown in Table 3. After PCR, 2 μL of the PCR product was subjected to agarose gel electrophoresis. The electrophoresis results were used to preliminarily determine the concentration of the PCR product and the accuracy of the band sizes. After purification, the PCR product was used to construct a library and sent for next-generation sequencing.
[0150] Table 1. Reverse Transcription System Configuration - 1
[0151] Total RNA (1ug) X Oligo dT 1 10nM dNTP 1 RNase-Free Water 10-X Total volume 12
[0152] 65℃ for 5 minutes, then immediately transfer to ice.
[0153] Table 2. Reverse Transcription System Configuration - 2
[0154]
[0155]
[0156] Table 3. PCR conditions
[0157]
[0158] Enzyme activity assay:
[0159] GM06214 cells were digested and centrifuged, then resuspended in 28 μL of 1×PBS containing 0.1% Triton X-100 and lysed on ice for 30 min. Then, 25 μL of the cell lysis buffer was added to 25 μL of substrate containing 190 μM 4-methylumbelliferyl-α-L-iduronidase (Cayman, 2A-19543-500, dissolved in 0.4 M sodium formate buffer containing 0.2% Triton X-100, pH 3.5). The cells were incubated in the dark at 37°C for 90 min. 200 μL of 0.5 M NaOH / Glycine solution (Beijing Chemical Industry, NaOH, catalog number: AR500G; Solarbio, Glycine, catalog number: G8200) was added to pH 10.3 to inactivate the catalytic reaction. The cells were centrifuged at 4°C for 2 min. The supernatant was transferred to a 96-well plate, and fluorescence values were measured using an Infinite M200 instrument (TECAN) with excitation wavelengths of 365 nm and 450 nm.
[0160] In this application, all enzyme activity assay results are expressed as multiples of enzyme activity in GM01323 cells. GM01323 cells are fibroblasts derived from patients with Scheie syndrome. Scheie syndrome is a milder form of mucopolysaccharidosis, with symptoms much milder than Hurler syndrome. Patients with Scheie syndrome generally have a good prognosis, with normal lifespans and can live into adulthood. The IDUA enzyme activity in fibroblasts from Scheie syndrome patients is 0.3% of that in wild-type fibroblasts from healthy individuals.
[0161] As shown in Figure 3, the results indicate that arRNAs targeting pre-mRNA exhibit higher enzyme activity and editing efficiency, while arRNAs targeting mature mRNA show significantly lower enzyme activity and editing efficiency. Therefore, the arRNAs involved in the following examples all target pre-mRNAs.
[0162] Example 4: Detection of IDUA target site editing efficiency after electroporation of arRNA in IDUA-reporter cell lines
[0163] like Figure 4A As shown, a sequence carrying an IDUA mutation site and approximately 100 bp upstream and downstream sequences was inserted between the sequences expressing mCherry and GFP proteins in a lentiviral plasmid to construct the plasmid. The constructed plasmid was packaged into a virus and used to infect 293T cells. After integration into the genome, IDUA-reporter monoclonal cells were selected. These monoclonal cells, affected by the TAG stop codon at the IDUA mutation site in the inserted sequence, only expressed mCherry protein. However, after the cells were edited with arRNA, a TAG->TGG process occurred, allowing the subsequent GFP protein to be expressed normally. The expression of GFP protein can be considered as the editing efficiency of arRNA-edited cells. We optimally designed four arRNAs of different lengths from 51 nt to 111 nt, as shown in Table 4. After electrotransfection of cells with different lengths of arRNA under the electrotransfection conditions described in Example 2, the GFP ratio in the cells was detected on days 1-7 to preliminarily assess the editing efficiency. Figure 4B The data shows that the sequence with the highest editing efficiency is 91nt:45-c-45, and the peak editing occurred on day 2 (48h). This demonstrates that, regarding the length of an arRNA, longer sequences do not necessarily lead to higher editing efficiency.
[0164] Table 4:
[0165]
[0166]
[0167] Example 5: Detection of intracellular IDUA at different time points after electrotransfection of GM06214 cells with arRNA of different lengths. Enzyme activity and intracellular RNA editing efficiency
[0168] Using the electrotransfection conditions of Example 2, arRNAs of different lengths were electrotransfected into GM06214 cells (see Table 4). Following the method described in Example 3, intracellular enzyme activity was measured on days 2, 4, 6, 8, 10, 12, and 14 post-electrotransfection. The efficiency of RNA editing was assessed on days 2 and 4. As shown in Figure 5, the 91nt:45-c-45 arRNA exhibited the highest enzyme activity, which remained high even on day 6 post-electrotransfection. In terms of editing efficiency, the 91nt and 111nt arRNAs showed approximately the same efficiency.
[0169] Example 6: Editing efficiency of editing site A corresponding to different positions on arRNA
[0170] Taking a 111nt arRNA as an example, we studied the editing efficiency of the target base corresponding to different positions of the arRNA by simultaneously truncating from both ends of the mutation site and separately truncating from the 5' end or the 3' end.
[0171] This study investigated the introduction of arRNA into cells using the lipofectmine RNAiMAX method. First, the arRNA sequences were simultaneously shortened from both ends. Then, the sequence was extended to a fixed end and shortened again from the other end, resulting in 14 arRNAs and 4 equal-length random sequences, as shown in Table 5. Detection of IDUA enzyme activity and RNA editing efficiency 48 hours post-transfection revealed that the following sequences showed superior IDUA enzyme activity and RNA editing efficiency compared to other sequences: 81nt: 55nt-c-25nt (SEQ ID NO: 14), 71nt: 55nt-c-15nt (SEQ ID NO: 15), 91nt: 45nt-c-45nt (SEQ ID NO: 9), 91nt: 55nt-c-35nt (SEQ ID NO: 13), and 101nt: 45nt-c-55nt (SEQ ID NO: 17). Figure 6 As shown.
[0172] Table 5:
[0173]
[0174]
[0175]
[0176] Example 7: The effect of the distance from the 3' end of the target base on editing efficiency
[0177] In Example 6, high IDUA enzyme activity and editing efficiency were detected on the 81nt:55-c-25 and 71nt:55-c-15 sequences. To find the shortest and optimal 3' end length, sequences from 25nt (81nt:55-c-25) to 10nt (66nt:55nt-c-10nt) from the 3' end relative to the target base were truncated one by one, as shown in Table 6. Finally, the optimal length of the target base from the 3' end was determined to be 24nt-11nt by IDUA enzyme activity assay. Figure 7A As shown. Furthermore, comparisons show that 80nt:55nt-c-24nt (SEQ ID NO: 22), 79nt:55nt-c-23nt (SEQ ID NO: 23), 72nt:55nt-c-16nt (SEQ ID NO: 30), 70nt:55nt-c-14nt (SEQ ID NO: 31), and 67nt:55nt-c-11nt (SEQ ID NO: 34) can result in IDUA enzyme activities similar to or higher than those of SEQ ID NO: 14 and SEQ ID NO: 15.
[0178] In addition, we screened the optimal 3' distance from the target base in arRNA targeting the IDUA mutation site in mice (the mutation site corresponding to the human IDUA-W402X mutation). The 3' distance from the target base in the arRNA started at 55 nt and was shortened every 5 bases, as shown in Table 7. By measuring IDUA enzyme activity, the optimal 3' distance from the target base in mice was determined to be 55 nt-10 nt. Figure 7B As shown. Among them, 111nt:55nt-c-50nt (SEQ ID NO: 44) and 66nt:55nt-c-10nt (SEQ ID NO: 52) showed better editing efficiency.
[0179] Table 6:
[0180]
[0181]
[0182]
[0183] Table 7:
[0184]
[0185]
[0186] Example 8: The impact of 5' end length on editing efficiency
[0187] We selected two arRNAs of different lengths: 76nt: 55-c-20 and 71nt: 55-c-15. With the 3' end length remaining constant, the 5' end was gradually shortened, as shown in Table 8. IDUA enzyme activity assays determined that cells edited with arRNA exhibited higher IDUA enzyme activity when the 5' end length was between 55nt and 45nt. Conversely, IDUA enzyme activity significantly decreased when the total arRNA length was between 65nt and 61nt. Figure 8A As shown. When the 3' end length is fixed at 14 nt, the 5' end length is truncated base by base starting from 51 nt (i.e., the total length is 66 nt). When the 5' end length is truncated from 51 nt to 50 nt (i.e., the total length is 65 nt), the IDUA enzyme activity decreases significantly. Therefore, the truncation of the 5' end of the arRNA requires that the total arRNA length not be less than 66 nt. Figure 8B As shown.
[0188] Table 8:
[0189]
[0190]
[0191] Example 9: The effect of RNA chemical modification on editing efficiency
[0192] Different types of chemical modifications to RNA during synthesis can increase its stability and reduce the possibility of off-target effects. Common RNA modifications include 2'-OMe and thiolation. In our experiment, we selected two arRNAs of different lengths: 71nt and 76nt, and performed different combinations of these two chemical modifications, as shown in Table 8. The specific meanings of each modification are as follows:
[0193] CM1: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, all U in the sequence are modified with 2'-OMe.
[0194] CM2: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 3' nearest neighbor of the target base is an A modified with 2'-OMe.
[0195] CM3: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all phosphate thioester bonds; at the same time, the 5' nearest neighbor of the target base is a C modified with 2'-OMe.
[0196] CM4: The first three and last three nucleotides of the sequence are modified with 2'-OMe, and the links between the first three and last three nucleotides are all thiophosphate bonds; at the same time, the target base is linked to its 3' nearest neighbor base and 5' nearest neighbor base by thiophosphate bonds.
[0197] CM5: Except for the target base and the five bases adjacent to it at the 5' end and the five bases closest to it at the 3' end, all nucleotides are modified with 2'-OMe; at the same time, the first three nucleotides and the last three nucleotides of the sequence are linked by phosphate thioester bonds.
[0198] CM6: The first 5 and last 5 nucleotides of the sequence are modified with 2'-OMe, and the first 5 and last 5 nucleotides are linked by phosphate thioester bonds.
[0199] Different arRNAs were transfected into GM06214 cells to edit intracellular IDUA. Cells were collected 48 hours after transfection for IDUA enzyme activity assays. The results showed that, except for CM5 (the fifth modification: all 2'-OMe except for the 11 nt near the target base), the other modification combinations exhibited relatively good enzyme activity. Figure 9 As shown.
[0200] Table 9
[0201]
[0202]
[0203]
[0204] Note: ro means no modification to the nucleotide and no modification to the ester bond between the nucleotides; r* means no modification to the nucleotide and the ester bond between the nucleotides is a thiophosphate bond; mo means nucleotides are modified with 2'-OMe and the ester bond between the nucleotides is not modified; m* means nucleotides are modified with 2'-OMe and the ester bond between the nucleotides is a thiophosphate bond.
[0205] Example 10: The effect of chemical modification on editing efficiency
[0206] This embodiment involves three preferred arRNAs targeting the mutation site of human IDUA and one preferred arRNA targeting the mutation site of mouse IDUA. A CM1-based chemical modification method was used to isolate arRNAs from GM06214 cells and MSPI MEF (MSPI mouse embryo fibroblasts, MEF) fetal mice with homozygous IDUA mutations (iduaW392X mice, B6.129S-Idua). tm1.1Kmke / J)(Wang D,Shukla C,Liu X,et al.Characterization of an MPS IH knock-in mouse that carries a nonsense mutation analogous to the human IDUA-W402X mutation[published correction appears in Mol Genet Metab.2010 Apr;99(4):439].Mol Genet Metab.2010;99(1):62-71.doi:10.1016 / j.ymgme.2009.08.002))Concentration gradient experiments were performed on cells.
[0207] From the experimental results of Example 7, we selected three arRNAs targeting human IDUA with lengths of 55nt-c-16nt, 55nt-c-14nt, and 55nt-c-11nt, and one arRNA targeting mouse IDUA with lengths of 55nt-c-10nt. In addition, we selected the random arRNA sequence RM-67CM1 as a control. From Example 9, we synthesized the above-mentioned arRNAs targeting IDUA using a chemical modification method of CM1 (all u: 2'-OMe), as shown in Table 9. We performed arRNA concentration gradient transfections in human GM06214 cells and MSPI mouse MEF cells. The arRNA concentrations were: 160 nM, 80 nM, 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, and 0.625 nM, a total of nine concentrations. Cells were seeded in 6-well plates and transfected 24 hours later. 48 hours after transfection, the cells were digested. Half of the cells were used for IDUA enzyme activity assay, and the other half were used to extract RNA for editing efficiency assay. The enzyme activity assay results showed that a high enzyme activity was achieved at a transfection concentration of 2.5-5 nM or higher, while the enzyme activity reached a plateau at 10-20 nM or higher. Figure 10A and 10C As shown, the IDUA enzyme activity and editing efficiency produced by transfection with the same concentration of arRNA in human cells (GM06214) and mouse cells (MSPI MEF) differed, such as... Figure 10B and 10D As shown.
[0208] Table 10:
[0209]
[0210]
[0211] Note: ro represents no modification on the nucleotide and no modification of the ester bond between nucleotides; r* represents no modification on the nucleotide and nucleotides are connected by a thiophosphate bond; mo represents nucleotides modified with 2'-OMe and nucleotides are connected by no modification; m* represents nucleotides modified with 2'-OMe and nucleotides are connected by a thiophosphate bond.
[0212] Example 11: IDUA can sustain protease activity after arRNA editing.
[0213] This experiment used three preferred arRNAs targeting the mutation site of human IDUA and one preferred arRNA targeting the mutation site of mouse IDUA, and chemically modified them in a CM1 manner, to obtain significantly enhanced IDUA enzyme activity in GM06214 cells and MSPI MEF (mouseembryo fibroblast) cells, which could be sustained for more than 3 weeks.
[0214] In Example 10, we compared different concentrations of the selected IDUA-targeting arRNA transfected in humans and mice 48 hours later. In this example, we selected a concentration of 20 nM and compared IDUA enzyme activity and editing efficiency at different time points. Figure 11A As shown, after transfecting GM06214 cells with arRNA, we continuously measured the activity of IDUA enzyme for 14 days. The peak enzyme activity was observed from day 4 to day 9 post-transfection, and the enzyme activity on day 14 was still higher than that on day 2. Subsequently, we measured the activity at two longer time points, day 17 and day 21 post-transfection. As can be seen from the 10A graph, the enzyme activity on day 21 was still higher than that on day 1 post-transfection, and the enzyme activity was approximately 6 to 10 times that of GM01323. (Editing efficiency needs to be supplemented) Figure 11B We continuously measured IDUA enzyme activity for 8 days after arRNA transfection in MSPI MEF cells. Figure 11C As can be seen, 24 hours after arRNA transfection, the enzyme activity was approximately twice that of GM1323 cells until day 8. Figure 11D The editing efficiency test shows that IDUA's editing efficiency peaks at 24 hours, and then continues to decline.
[0215] By comparing human and mouse data, we found that the peak of arRNA editing in mice was 24 hours after transfection, while in humans it was 48 hours. The duration of IDUA protease activity after editing was greater than 21 days in human cells and greater than 8 days in mice.
[0216] Example 12: The impact of arRNA delivery method on editing efficiency
[0217] This experiment involved editing the wild-type PPIB gene locus in primary cultured human and mouse liver cells using LEAPER technology, delivering arRNA through different methods, and screening for the optimal delivery method.
[0218] "PPIB" refers to the wild-type site of the UTR region in human NM_000942 (PPIB Genomic chr15(-): 64163082) or mouse NM_011149 (PPIB Genomic chr9(+): 66066490). It can be mature mRNA or an mRNA precursor. The UTR region of PPIB contains a TAG; in this embodiment, the A term in the TAG is used as the target for editing to test the editing efficiency of the arRNA in liver cells.
[0219] We designed and synthesized an arRNA (55nt-c-15nt) targeting the PPIB UTR region, as shown in Table 11. Part of the synthesized arRNA was dissolved, aliquoted, and stored at -80°C for Lipo (lipofectmine RNAiMAX) transfection; the remainder was packaged as LNPs. Methods in the packaging reference literature of LNP (Reference: Witzigmann D, Kulkarni JA, Leung J, etal. Lipid nanoparticle technology for therapeutic gene regulation in the liver [J]. Advanced Drug Delivery Reviews, 2020.; Kauffman KJ, Dorkin JR, Yang JH, et al. Optimization of lipid nanoparticle formulations for mRNA delivery in vivo with fractional factorial and definitive screening designs [J]. Nano letters, 2015, 15(11): 7300-7306.; Reis J, Kanagaraj S, Fonseca A, et al. In vitro studies of multiwalled carbon nanotube / ultrahigh molecular weight polyethylenenanocomposites with osteoblast-like MG63 cells [J]. Brazilian Journal of Medical and Biological Research, 2010, 43(5): 476-482.).
[0220] Human primary liver cells were purchased from LONZA (catalog number: HUCPI). Cells were revived and cultured according to the manufacturer's instructions (revival medium catalog number: MCHT50; plating medium catalog number: MP100). After cell adhesion, the medium was replaced with hepatocyte maintenance medium at 5°C (Reference: Xiang C, Du Y, Meng G, et al. Long-term functional maintenance of primary human hepatocytes in vitro[J]. Science, 2019, 364(6438): 399-402).
[0221] Primary mouse liver cells were isolated from C57BJ mice (Reference: Charni-Natan M, Goldstein I. Protocol for Primary Mouse Hepatocyte Isolation[J]. STAR protocols, 2020, 1(2): 1000-86.). After the liver cells adhered to the culture medium, the medium was replaced with 5C maintenance medium.
[0222] Human liver cells were delivered 24 hours after resuscitation, with both LNP and Lipo delivered at a concentration of 20 nM. Mouse liver cells were also delivered 24 hours after isolation and culture, with both LNP and Lipo delivered at a concentration of 20 nM. RNA was collected from human and mouse liver cells at 24 and 48 hours after delivery, respectively, and editing efficiency was assessed using next-generation sequencing. Figure 12A As can be seen, in human liver cells, the editing efficiency of both arRNA delivery methods was higher at 48 hours than at 24 hours. Furthermore, the editing efficiency of arRNA delivered by LNP was superior to that of Lipo delivery at 24 hours, while the editing efficiencies of the two delivery methods were similar at 48 hours. Figure 12B As can be seen, in mouse liver cells, the editing efficiency of both arRNA delivery methods was higher at 24 hours than at 48 hours. At the same time, the editing efficiency of arRNA delivered by Lipo was higher than that of LNP delivery at both 24 hours and 48 hours.
[0223] Therefore, by comparing the editing efficiency of PPIB sites in primary liver cells, we can conclude that the peak editing in mouse liver cells occurs 24 hours after arRNA delivery, while in human liver cells it occurs 48 hours. This is consistent with data from human GM06214 cells and mouse MSPI MEF cells. In human liver cells, LNP delivery is superior to or equal to Lipo delivery of arRNA. In mouse liver cells, Lipo delivery is significantly superior to LNP delivery of arRNA.
[0224] Table 11:
[0225]
[0226] Example 13: Editing efficiency of LNP delivery
[0227] This experiment involves investigating the editing efficiency of IDUA by delivering arRNA containing IDUA via LNP in primary cultured human and mouse liver cells.
[0228] We designed and synthesized arRNAs targeting the wild-type site of the human IDUA CDS region, as shown in Table 12. Human and mouse arRNAs (20 nM) were delivered to human and mouse primary hepatocytes via LNP, respectively. Editing efficiency was assessed at 24 and 48 hours post-delivery. Figure 13 As shown in the figure, we can see that in primary cultured liver cells in vitro, the editing efficiency of human IDUA can reach about 30% after 48 hours, while the highest editing efficiency in mice is about 15% after 24 hours. This further indicates that LNP can achieve higher delivery efficiency in human cells, especially in primary human liver cells.
[0229] Table 12
[0230]
[0231] Example 14: Therapeutic effect of arRNA against IDUA in MSPI model mice
[0232] This experiment used the MPSI model mouse (idua W392X mouse, B6.129S-Idua). tm1.1Kmke / J)(WangD,Shukla C,Liu X,et al.Characterization of an MPS IH knock-in mouse that carries a nonsense mutation analogous to the human IDUA-W402X mutation[published correction appears in Mol Genet Metab.2010
[0233] Apr;99(4):439].Mol Genet Metab.2010;99(1):62-71.
[0234] (doi:10.1016 / j.ymgme.2009.08.002) This mutation corresponds to the human IDUA-W402X mutation, which prematurely terminates protein synthesis and is prevalent in patients with Hurler's mucopolysaccharidosis (MPS IH) syndrome. The deficiency of the α-l-iduronidase enzyme leads to this lysosomal storage disorder. α-l-iduronidase activity was not detected in the brain and liver tissues of homozygous mice at 5, 10, and 30 weeks of age. Although homozygous mice with this mutation are viable and fertile, their average lifespan is 69 weeks. Homozygotes exhibit a progressive increase in urinary glycosaminoglycan (GAG) excretion and progressive accumulation of GAGs in tissues. Homeostatic IDUA mRNA levels are reduced by 30-50%. Histological analysis revealed the progressive accumulation of lysosomal storage contents in the cytoplasm of Purkinje cells and medullary neurons, as well as increased foamy macrophage infiltration with age. X-rays showed thickening of the zygomatic arch and femur at 15 weeks of age and continued until 35 weeks of age. At 35 weeks of age, femoral bone density increased, while body fat percentage decreased. We packaged the selected arRNA targeting mouse mutant IDUA, 55nt-c-10ntCM1 (SEQ ID NO: 52), into an LNP. Different concentrations of arRNA were injected via the tail vein: 0.1 mg / kg; 0.5 mg / kg; 2 mg / kg; and 10 mg / kg. 24 hours after administration, mouse liver cells were harvested for IDUA editing efficiency testing. Figure 14 As shown, an editing efficiency of approximately 2% was detected in the 10 mg / kg group 24 hours after administration. This example demonstrates that arRNA targeting IDUA in MSPI model mice can achieve precise editing of the mutated IDUA gene in liver cells in vivo, correcting the IDUA mutation and achieving the therapeutic goal of MPSI. sequence list <110> Boyagene (Beijing) Biotechnology Co., Ltd. <120> A method and composition for treating MPS IH based on LEAPER technology <130> PD01321 <150> 201911397570.8 <151> 2019-12-30 <160> 62 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 1 cgcttccagg tcaacaacac 20 <210> 2 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 ctcgcgtaga tcagcaccg 19 <210> 3 <211> 111 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 3 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca uccagcagcg ccagcagccc cauggccgug agcaccggcu u 111 <210> 4 <211> 111 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 4 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggggc ggggggggggc cgucgccgcg uggggucguu g 111 <210> 5 <211> 111 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 5 uaccgcuaca gccacgcuga uuucagcuau accugcccgg uauaaaggga cguucacacc 60 gcgauguucu cugcugggga auugcgcgau auucaggauu aaaagaagug c 111 <210> 6 <211> 91 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 6 uaauccugaa uaucgcgcaa uuccccagca gagaacaucg cggugugaac gucccuuuau 60 accgggcagg uauagcugaa aucagcgugg c 91 <210> 7 <211> 71 <212> RNA <213> Artificial sequence<<212> RNA <213> Artificial sequence <220> <223> arRNA <400> 9 gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60 ucugcggggc gggggggggc cgucgccgcg u 91 <210> 10 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 10 uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc 60 gggggggggc c 71 <210> 11 <211> 51 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 11 ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc g 51 <210> 12 <211> 101 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 12 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggggc gggggggggc cgucgccgcg u 101 <210> 13 <211> 91 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 13 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggggc gggggggggc c 91 <210> 14 <211> 81 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 14 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggggc g 81 <210> 15 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 15 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca u 71 <210> 16 <211> 61 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 16 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 c 61 <210> 17 <211> 101 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 17 gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60 ucugcggggc gggggggggc cgucgccgcg uggggucguu g 101 <210> 18 <211> 91 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 18 uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc 60 gggggggggc cgucgccgcg uggggucguu g 91 <210> 19 <211> 81 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 19 ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc gggggggggc 60 cgucgccgcg uggggucguu g 81 <210> 20 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 20 ugcgacacuu cggcccagag cugcuccuca ucugcggggc gggggggggc cgucgccgcg 60 uggggucguu g 71 <210> 21 <211> 61 <212> RNA <213> Artificial sequence <220>[[ID= / / ]] <223> arRNA <400> 21 cggcccagag cugcuccuca ucugcggggc gggggggggc cgucgccgcg uggggucguu 60 g 61 <210> 22 <211> 80 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 22 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggggc 80< / / ]] <210> 23 <2 / / / ]]<211> 79 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 23 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcgggg 79 <210> 24 <211> 78 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> twenty four gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcggg 78 <210> 25 <211> 77 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 25 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcgg 77 <210> 26 <211> 76 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 26 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugcg 76 <210> 27 <211> 75 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 27 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucugc 75 <210> 28 <211> 74 <212> RNA <213> Artificial sequence [[ID=]12]<220> <223> arRNA <400> 28 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucug 74 <210> 29 <211> 73 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 29 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca ucu 73 <210> 30 <211> 72 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 30 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca uc 72 <210> 31 <211> 70 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 31 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuca 70 <210> 32 <211> 69 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 32 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccuc 69 <210> 33 <211> 68 <212> RNA <213> Artificial sequence <{220}> <223> arRNA <400> 33\n gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuccu 68 <210> 34 <211> 67 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 34 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcucc 67 <210> 35 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 35 gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60 cugcuc 66 <210> 36 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 36 ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60 ccucaucugc g 71 <210> 37 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 37 gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60 ucugcg 66 <210> 38 <211> 61 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 38 guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu ccucaucugc 60 g 61 <210> 39 <211> 56 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 39 ugccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcg 56 <210> 40 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 40 ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60 ccucau 66 <210> 41 <211> 61 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 41 gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60 u 61 <210> 42 <211> 56 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 42 guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu ccucau 56 <210> 43 <211> 51 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 43 uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca u 51 <210> 44 <211> 106 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 44 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcagaggg cugaggcugu uggcuc 106 <210> 45 <211> 101 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 45 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcagaggg cugaggcugu u 101 <210> 46 <211> 96 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 46 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcagaggg cugagg 96 <210> 47 <211> 91 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 47 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcagaggg c 91 <210> 48 <211> 86 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 48 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcag 86 <210> 49 <211> 81 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 49 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc a 81 <210> 50 <211> 76 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 50 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuaua 76 <210> 51 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 51 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca u 71 <210> 52 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 52 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguuc 66 <210> 53 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 53 uaccgcuaca gccacgcuga uuucagcuau accugcccgg uauaaaggga cguucacaccc 60 gcgaug 66 <210> 54 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 54 caccccauca gauggaagca cuagggccag gguggcacag aaccuuguga cuggccaccu 60 ucgucugugu g 71 <210> 55 <211> 71 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 55 ggaggcgaaa gcagcccgga cagcugaggc cggaagaggg uggggccgcg guggccaggg 60 agccggcgcc g 71 <210> 56 <211> 66 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 56 cccaccgugu gguugcuguc caggacgguc ccggccugcg acacuucggc ccagagcugc 60 uccuca 66 <210> 57 <211> 65 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 57 ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60 ccuca 65 <210> 58 <211> 64 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 58 caccgugugg uugcugucca ggacgguccc ggccugcgac acuucggccc agagcugcuc 60 cuca 64 <210> 59 <211> 63 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 59 accguguggu ugcuguccag gacggucccg gccugcgaca cuucggccca gagcugcucc 60 uca 63 <210> 60 <211> 62 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 60 ccgugugguu gcuguccagg acggucccgg ccugcgacac uucggcccag agcugcuccu 60 ca 62 <210> 61 <211> 61 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 61 cgugugguug cuguccagga cggucccggc cugcgacacu ucggcccaga gcugcuccuc 60 a 61 <210> 62 <211> 111 <212> RNA <213> Artificial sequence <220> <223> arRNA <400> 62 gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60 uuguucucca ucuauaagcc aagcagaggg cugaggcugu uggcucucuc a 111
Claims
1. A method for in vitro targeted editing of target RNA in target cells based on LEAPER technology, wherein the target RNA is RNA containing a G-to-A mutation in the IDUA gene transcript, the method comprising: Delivering an adenosine deaminase recruiting RNA (arRNA) or a construct encoding the arRNA to the target cell, wherein the arRNA contains a complementary RNA sequence that hybridizes with the target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase (ADAR) that acts on RNA to deaminate the target adenosine (A) in the target RNA. The arRNA is 66-91 nt in length, and the distance between the target base and the 3' end of the arRNA is 10-35 nt, and the distance between the target base and the 5' end of the arRNA is 45-55 nt. The arRNA contains a base C that pairs with target A, and the mutation site of the target RNA targeted by the arRNA is NM_000203.4(IDUA)-c.1205G-A (p.Trp402Ter).
2. The method of claim 1, wherein the arRNA is 81-66 nt in length.
3. The method of claim 2, wherein the distance from the target base in the arRNA to the 3' end is 25nt-15n.
4. The method of claim 2, wherein the distance of the target base from the 3' end in the arRNA is 24nt-11nt.
5. The method of claim 1, wherein the target cell is a human cell.
6. The method of claim 1, wherein the arRNA comprises the following sequences: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 13, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34 or SEQ ID NO:
52.
7. The method of claim 1, wherein the arRNA is chemically modified.
8. The method of claim 7, wherein the chemical modification comprises 2-O'-methylation (2'-OMe) or thiophosphate modification.
9. The method of claim 8, wherein the chemical modification is selected from one or more of the following: the first three and last three nucleotides of the sequence are modified with 2'-OMe, respectively. The first three nucleotides and the last three nucleotides are linked by phosphate thioester bonds. All Us in the sequence are modified by 2'-OMe. The 3' nearest neighbor of the targeted base is an A base modified with 2'-OMe. The 5' nearest neighbor of the target base is a C base modified with 2'-OMe. The target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases via thiophosphate bonds. The first 5 and last 5 nucleotides are modified with 2'-OMe, and The first 5 nucleotides and the last 5 nucleotides are linked by phosphate thioester bonds.
10. The method of claim 1, wherein the construct encoding the arRNA is a linear nucleic acid strand, a viral vector, or a plasmid.
11. The method of claim 10, wherein the viral vector is an adeno-associated virus (AAV) vector or a lentiviral expression vector.
12. The method of claim 1, wherein the delivery method is electrotransfection, liposome transfection, lipid nanoparticle (LNP) delivery, or infection.
13. The method of claim 12, wherein an adenosine deaminase recruiting RNA (arRNA) for editing target RNA or a construct encoding said arRNA is delivered to the target cell via an LNP.
14. The method of claim 1, wherein the delivery concentration of the arRNA is ≥2.5 nM.
15. The method of claim 1, wherein the delivery concentration of the arRNA is ≥5 nM or ≥10 nM.
16. The method of claim 1, wherein the delivery concentration of the arRNA is ≥15 nM.
17. The method of claim 1, wherein the delivery concentration of the arRNA is ≥20 nM.
18. An arRNA or its coding sequence for targeted editing of target RNA in target cells via LEAPER technology, wherein the target RNA is an RNA containing a G-to-A mutation in the IDUA gene transcript, the arRNA comprises a complementary RNA sequence that hybridizes with the target RNA, and wherein the arRNA is capable of recruiting an adenosine deaminase (ADAR) that acts on RNA to deaminate target adenosine (A) in the target RNA; The arRNA is 66-91 nt in length, and the distance between the target base and the 3' end of the arRNA is 10-35 nt, and the distance between the target base and the 5' end of the arRNA is 45-55 nt; the arRNA contains a base C that pairs with target A, and the mutation site of the target RNA targeted by the arRNA is NM_000203.4(IDUA)-c.1205G-A (p.Trp402Ter).
19. The arRNA or its coding sequence as claimed in claim 18, wherein the arRNA comprises the following sequences: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 13, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34 or SEQ ID NO:
52.
20. The arRNA or its coding sequence as claimed in claim 18, wherein the arRNA is chemically modified.
21. The arRNA or its coding sequence as claimed in claim 20, wherein the chemical modification comprises 2-O'-methylation (2'-OMe) or thiophosphate modification.
22. The arRNA or its coding sequence as claimed in claim 21, wherein the chemical modification is selected from one or more of the following: The first three and last three nucleotides of the sequence are modified with 2'-OMe, respectively. The first three nucleotides and the last three nucleotides are linked by phosphate thioester bonds. All Us in the sequence are modified by 2'-OMe. The 3' nearest neighbor of the targeted base is an A base modified with 2'-OMe. The 5' nearest neighbor of the target base is a C base modified with 2'-OMe. The target base is linked to its 3' nearest neighbor and 5' nearest neighbor bases via thiophosphate bonds. The first 5 and last 5 nucleotides are modified with 2'-OMe, and The first 5 nucleotides and the last 5 nucleotides are linked by phosphate thioester bonds.
23. Plasmids, viral vectors, liposomes, or lipid nanoparticles comprising the arRNA or its coding sequence as described in claim 18.
24. A composition or biological product comprising the arRNA or its coding sequence as described in claim 18, or the plasmid, viral vector, liposome or lipid nanoparticle as described in claim 23.
25. Use of the arRNA of claim 18 or its encoding sequence in the preparation of a medicament for treating MPS IH in an individual, said use correcting a G-to-A mutation associated with MPS IH disease in the target cells of said individual.
26. The use as claimed in claim 25, wherein the mutation is an NM_000203.4(IDUA)-c.1205G-A(p.Trp402Ter) mutation.
27. The use as described in claim 25, wherein the frequency of use of the drug is ≥21 days / time.
28. The use as described in claim 25, wherein the frequency of use of the drug is ≥17 days / time.
29. The use as described in claim 25, wherein the frequency of use of the drug is ≥14 days / time.
30. The use as described in claim 25, wherein the frequency of use of the drug is ≥10 days / time.
Citation Information
Patent Citations
Methods and Compositions for Editing RNAs
WO2020074001A1
Treatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua
CN103180445A
Chemically modified single-stranded RNA-editing oligonucleotides
CN110352244A