Wheat Ms1 polynucleotides, polypeptides and methods of use

Abstract

The present invention relates to wheat Ms1 polynucleotides, polypeptides and methods of use. The present invention provides compositions and methods capable of regulating the male fertility of plants. The compositions comprise polynucleotides and polypeptides and fragments and variants thereof that regulate male fertility. The expression cassette comprises a male fertility polynucleotide or a fragment or variant thereof operably linked to a promoter, wherein the expression of the polynucleotide regulates the male fertility of the plant. The level and / or activity of the polynucleotide affecting male fertility is regulated in a plant or plant part. The regulatory sequence drives expression in a male tissue-preferred manner and can be a target for downregulating operably linked genes. The present invention also provides methods for tracking mutations that induce nuclear recessive male sterility in subsequent selfing and hybridization of wheat lines containing the mutation. Male sterile plants can be maintained by pollination with maintainer plants.

Description

[0001] This application is a divisional application of Chinese patent application 201580051730.7 "Wheat Ms1 polynucleotides, polypeptides and methods of use" with a filing date of September 21, 2015. Technical Field

[0002] The present invention relates to the field of plant molecular biology, and more particularly to influencing male fertility.

[0003] References to sequence listings submitted electronically

[0004] The official text of the sequence table is submitted electronically through EFS-Web as a sequence table file in ASCII format, the file name is RTS20250D-PCT_ST25.txt, the last modification date is September 21, 2015, the file size is 79KB, and the file is submitted at the same time as this specification. The sequence table contained in the file in ASCII format is part of this specification and is incorporated herein by reference in its entirety. Background Art

[0005] The development of hybrid plant breeding has made it possible to achieve considerable advances in the quality and quantity of crops produced. As a result of the hybridization process, yields are increased, combinations of desirable characteristics such as resistance to disease and pests, heat and drought tolerance, and changes in plant composition are possible. These processes in many cases rely primarily on providing a male parent that contributes pollen to the female parent to produce the resulting hybrid.

[0006] Field crops are bred using techniques that exploit the plant's method of pollination. A plant is self-pollinating if pollen from one flower of the plant is transferred to the same or another flower of the same plant or a genetically identical plant. A plant is cross-pollinating if pollen comes from a flower of a genetically different plant.

[0007] In some species, such as Brassica campestris, plants are generally self-sterile and are only capable of cross-pollination. In species that are primarily self-pollinating (such as soybean, wheat, and cotton), male and female plants are in an anatomically juxtaposed relationship so that during natural pollination, the male reproductive organs of a given flower pollinate the female reproductive organs of the same flower.

[0008] Common wheat (Triticum aestivum) is a hexaploid plant with three pairs of homologous chromosomes defining genomes A, B and D. The endosperm of wheat grains includes two haploid complements from maternal cells and one haploid complement from paternal cells. The embryo of wheat grains includes a haploid complement from each of maternal cells and paternal cells. Hexaploidy is considered a major obstacle in the process of studying and developing available variants of wheat. In fact, little is known about how homologous genes in wheat interact, how to regulate the expression of these homologous genes, and how different proteins produced by homologous genes work independently or synergistically. Strategies for manipulating the expression of male fertility polynucleotides in wheat will need to consider the ploidy level of each wheat variety. Common wheat is a hexaploid (N=21) containing three genomes designated as A, B and D; each genome contains seven pairs of non-homologous chromosomes. Einkorn wheat varieties are diploid (N=7), while emmer wheat varieties are tetraploid (N=14).

[0009] An essential aspect of most work with genetic male sterility systems is the identification of genes that affect male fertility. Such genes can be used in a variety of systems, including those described herein, to control male fertility. Summary of the invention

[0010] The present invention provides compositions and methods for regulating male fertility in plants. The composition comprises an expression cassette comprising one or more male fertility polynucleotides or fragments or variants thereof operably linked to a promoter, wherein expression of the polynucleotides regulates the male fertility of the plant. The present invention provides various methods, wherein the level and / or activity of a polynucleotide or polypeptide affecting male fertility is regulated in a plant or plant part. The present invention also provides methods for identifying and / or selecting wheat plants that are homozygous or heterozygous for a mutation that induces nuclear recessive male sterility.

[0011] Specifically, the present invention relates to the following aspects:

[0012] 1. An expression cassette comprising a first polynucleotide operably linked to a heterologous promoter

[0013] nucleotides, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:

[0014] (a) comprising the nucleotide sequence of SEQ ID 1, 2, 4, 7 or 9;

[0015] (b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 3, 5, 39 or 40;

[0016] (c) a nucleotide sequence having at least 85% sequence identity to the full length of SEQ ID NO: 1, 2, 4, 7 or 9, wherein the polynucleotide encodes a polypeptide that modulates male fertility;

[0017] (d) a nucleotide sequence comprising at least 500 consecutive nucleotides of SEQ ID NO: 1, 2, 4, 7 or 9, wherein the polynucleotide encodes a polypeptide that modulates male fertility; and

[0018] (e) A nucleotide sequence encoding a polypeptide having at least 85% identity to the full length of SEQ ID NO: 3, 5, 39 or 40, wherein the polypeptide modulates male fertility.

[0019] 2. The expression cassette according to item 1, wherein the expression cassette comprises a first polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0020] (a) comprising a nucleotide sequence of SEQ ID NO: 2 or 4;

[0021] (b) a nucleotide sequence having at least 95% sequence identity to the full length of SEQ ID NO: 2 or 4;

[0022] (c) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 3, 5, 39 or 40; and

[0023] (d) a nucleotide sequence encoding an amino acid sequence having at least 95% sequence identity to the full length of SEQ ID NO: 3, 5, 39 or 40.

[0024] 3. The expression cassette according to item 1 or 2, wherein the heterologous promoter is a constitutive promoter, an inducible promoter, a tissue-preferred promoter, a tissue-specific promoter or a growth phase-preferred promoter.

[0025] 4. The expression cassette according to item 3, wherein the heterologous promoter is a male tissue preferred promoter.

[0026] 5. The expression cassette according to any one of items 1 to 4, further comprising a second polynucleotide operably linked to a second promoter, which drives expression in a plant.

[0027] 6. The expression cassette according to item 5, wherein the second polynucleotide encodes a polynucleotide or polypeptide that interferes with the function, formation or propagation of male gametes.

[0028] 7. The expression cassette according to item 6, wherein the second polynucleotide encodes a barnase, a DAM-methylase, an amylase or an ADP-ribosylase.

[0029] 8. The expression cassette according to any one of items 5 to 7, further comprising a third polynucleotide operably linked to a promoter, wherein the third polynucleotide encodes a marker gene product.

[0030] 9. The expression cassette according to item 8, wherein the marker gene product comprises an antibiotic resistance marker gene product or a visible marker gene product.

[0031] 10. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:

[0032] (a) comprising an amino acid sequence of SEQ ID NO: 3, 5, 39 or 40;

[0033] (b) an amino acid sequence having at least 85% sequence identity to the full length of SEQ ID NO: 3, 5, 39 or 40, wherein the polypeptide modulates male fertility; and

[0034] (c) an amino acid sequence comprising at least 200 consecutive amino acids of SEQ ID NO: 3, 5, 39 or 40, wherein the polypeptide modulates male fertility.

[0035] 11. The isolated polypeptide according to item 10, comprising an amino acid sequence selected from SEQ ID NO: 3 and 5.

[0036] 12. A vector comprising the expression cassette according to any one of items 1 to 9.

[0037] 13. A plant cell comprising the expression cassette according to any one of items 1 to 2.

[0038] 14. A plant cell comprising the expression cassette according to any one of items 5 to 9.

[0039] 15. The plant cell according to any one of items 13 to 14, wherein the plant cell is from a monocotyledonous plant or a dicotyledonous plant.

[0040] 16. The plant cell according to item 13, wherein the plant is corn, barley, millet, wheat, rice, sorghum, rye, soybean, canola, alfalfa, sunflower, safflower, sugarcane, tobacco, Arabidopsis or cotton.

[0041] 17. A plant comprising the plant cell according to any one of items 13 to 16.

[0042] 18. The plant according to item 17, wherein the male fertility of said plant is modulated when compared to a control plant.

[0043] 19. The plant according to item 18, wherein said plant has enhanced male fertility when compared to control plants.

[0044] 20. The plant according to any one of items 17 to 19, wherein expression of said polynucleotide confers male fertility to a male sterile plant.

[0045] 21. The plant according to any one of items 17 to 20, wherein said plant is a female fertile plant.

[0046] 22. The plant according to any one of items 17 to 21, wherein the formation of at least one male tissue of said plant is modulated when compared to a control plant.

[0047] 23. The plant according to item 22, wherein the male tissue comprises stamens, anthers, filaments or pollen.

[0048] 24. The plant according to item 22 or 23, wherein said modulated formation of at least one male tissue comprises increased formation of at least one male tissue.

[0049] 25. The plant according to any one of items 17 to 24, wherein said first polynucleotide is stably incorporated into the genome of said plant.

[0050] 28. A seed of the plant according to any one of items 19 to 25, wherein said seed comprises said first heterologous polynucleotide.

[0051] 29. A method for increasing the activity and / or level of a polypeptide in a plant, the method comprising providing the polypeptide according to item 10 or item 11 to the plant.

[0052] 30. A method for increasing the activity and / or level of a polypeptide in a plant, the method comprising introducing into the plant a polynucleotide operably linked to a promoter active in the plant, the polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0053] (a) comprising a nucleotide sequence of SEQ ID NO: 1, 2, 4, 7 or 9;

[0054] (b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 3, 5, 39 or 40;

[0055] (c) a nucleotide sequence having at least 85% sequence identity to the full length of SEQ ID NO: 1, 2, 4, 7 or 9, wherein the polynucleotide encodes a polypeptide that modulates male fertility;

[0056] (d) a nucleotide sequence comprising at least 500 consecutive nucleotides of SEQ ID NO: 1, 2, 4, 7 or 9, wherein the polynucleotide encodes a polypeptide that modulates male fertility; and

[0057] (e) A nucleotide sequence encoding a polypeptide having at least 85% sequence identity to the full length of SEQ ID NO: 3, 5, 39 or 40, wherein the polypeptide modulates male fertility.

[0058] 31. The method according to item 30, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 1, 2, 4, 7 or 9.

[0059] 32. Method according to any one of items 30 to 31, wherein expression of said polynucleotide modulates male fertility in said plant when compared to control plants.

[0060] 33. The method according to item 32, wherein expression of said polynucleotide enhances male fertility in said plant when compared to control plants.

[0061] 34. Method according to any one of items 30 to 33, wherein expression of said polynucleotide confers male fertility to a male sterile plant.

[0062] 35. Method according to any one of items 30 to 34, wherein the plant is a female fertile plant.

[0063] 36. The method according to any one of items 30 to 35, wherein the promoter is a constitutive promoter, an inducible promoter, a tissue-preferred promoter, a tissue-specific promoter or a growth phase-preferred promoter.

[0064] 37. The method according to item 36, wherein the promoter is a male tissue preferred promoter.

[0065] 38. Method according to any one of items 30 to 37, wherein expression of said polynucleotide modulates the formation of at least one male tissue when compared to a control plant.

[0066] 39. The method according to item 38, wherein the male tissue comprises stamens, anthers, filaments or pollen.

[0067] 40. The method according to item 38 or 39, wherein said regulated formation of at least one male tissue comprises increased formation of at least one male tissue.

[0068] 41. An expression cassette comprising a regulatory element operably linked to a heterologous polynucleotide, wherein the regulatory element is a polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0069] (a) comprising a nucleotide sequence of SEQ ID NO: 6 or 8;

[0070] (b) a nucleotide sequence that is at least 95% identical to the full length of SEQ ID NO: 6 or 8, and that drives expression of an operably linked polynucleotide; and

[0071] (c) a nucleotide sequence comprising at least about 1250 consecutive nucleotides of SEQ ID NO: 6 or 8, and which drives expression of an operably linked polynucleotide.

[0072] 42. A method of regulating the expression of a polynucleotide, the method comprising operably linking the polynucleotide to a regulatory element, wherein the regulatory element is a polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0073] (a) comprising a nucleotide sequence of SEQ ID NO: 6 or 8;

[0074] (b) a nucleotide sequence that is at least 95% identical to the full length of SEQ ID NO: 6 or 8, and that is capable of driving expression of an operably linked polynucleotide;

[0075] as well as

[0076] (c) a nucleotide sequence comprising at least about 1250 consecutive nucleotides of SEQ ID NO: 6 or 8, and said nucleotide sequence is capable of driving the expression of an operably linked polynucleotide.

[0077] 43. A method of downregulating expression of a polynucleotide, the method comprising targeting a regulatory element associated with the polynucleotide, wherein the regulatory element is a polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0078] (a) comprising a nucleotide sequence of SEQ ID NO: 6 or 8;

[0079] (b) a nucleotide sequence that is at least 95% identical to the full length of SEQ ID NO: 6 or 8, and that is capable of driving expression of an operably linked polynucleotide;

[0080] as well as

[0081] (c) a nucleotide sequence comprising at least about 1250 consecutive nucleotides of SEQ ID NO: 6 or 8, and said nucleotide sequence is capable of driving the expression of an operably linked polynucleotide.

[0082] 44. A method for identifying and / or selecting wheat plants that are homozygous or heterozygous for a mutation in the Ms1 gene, wherein the mutation induces nuclear recessive male sterility, the method comprising:

[0083] a. detecting at least one marker allele that is linked to and associated with a mutation in Ms1; and

[0084] b. Selecting plants having said at least one marker allele.

[0085] 45. A method according to item 44, wherein the marker allele is linked to a mutation in the Ms1 gene and is associated with it at 5 cM.

[0086] 46. ​​A method according to item 44, wherein the marker allele is linked to a mutation in the Ms1 gene and is associated therewith at 1 cM.

[0087] 47. A method according to item 44, wherein the mutation is msld, msle or mslf.

[0088] 48. A method according to item 44, wherein the marker allele linked to and associated with the mutation in Ms1 is an allele at marker ET0487, ET0488, ET0489, ET0490, ET0491, ET0495, 007-0033.1 or 007-0046.1.

[0089] 49. A method for propagating a male sterile plant, the method comprising pollinating the male sterile plant with a maintainer plant, wherein the maintainer plant comprises a DNA construct comprising

[0090] (a) a first nucleotide construct that will restore male fertility;

[0091] (b) a second nucleotide construct that inhibits the formation, function or propagation of male gametes in the maintainer plant.

[0092] 50. A method according to item 49, wherein the male sterile plant is homozygous for msl.

[0093] 51. The method according to item 50, wherein the first nucleotide construct of the maintainer plant comprises a polynucleotide having at least 95% identity to the full length of SEQ ID NO: 1, 2, 4, 7, 9, 42, 43, 44 or 45.

[0094] 52. The method according to item 50, wherein the DNA construct of the maintainer plant further comprises a polynucleotide encoding a seed color marker.

[0095] 53. A method of producing hybrid progeny, wherein the plant produced by the method according to item 50 is pollinated by an inbred plant carrying the Ms1 allele.

[0096] 54. The method according to item 53, wherein the plant is wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 The results of the alignment of barley (SEQ ID NO: 3) and wheat (SEQ ID NO: 5) MS1 amino acid sequences are shown.

[0098] Figure 2 Allelic series sequence traces of msld, msle and mslf are shown. Coordinate numbers correspond to positions in SEQ ID NO:7.

[0099] Figure 3 is a schematic representation of the structure of wheat MS1 (also known as TaLTPG1).

[0100] Figure 4 It is the result of alignment of MS1 homologs of Hordeum vulgare (SEQ ID NO: 3), Triticum aestivum (SEQ ID NO: 5), Brachypodium distachyon (SEQ ID NO: 39) and Oryza sativa (SEQ ID NO: 40). DETAILED DESCRIPTION

[0101] The present invention will now be described more fully hereinafter; some but not all embodiments of the invention are shown. Indeed, these inventive contents may be presented in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout.

[0102] With the aid of the teachings given in the foregoing description and the accompanying drawings, those skilled in the art will recognize various modifications and other embodiments of the invention shown herein. Therefore, it should be understood that the present invention is not limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are used herein, these terms are used only in a general and descriptive sense and not for limiting purposes.

[0103] I. Male Fertility Polynucleotides

[0104] The compositions disclosed herein include polynucleotides and polypeptides that affect male fertility. Specifically, the present invention provides isolated polynucleotides comprising a nucleotide sequence encoding an amino acid sequence shown in SEQ ID NO: 3, 5, 39 or 40, or an active fragment or variant thereof. The present invention also provides polypeptides having an amino acid sequence encoded by a polynucleotide described herein (e.g., an amino acid sequence shown in SEQ ID NO: 3, 5, 39 or 40, or an active fragment or variant thereof).

[0105] Sexually reproducing plants develop specialized tissues for producing male and female gametes. The successful production of male gametes depends on the correct formation of male reproductive tissue. The stamens that embody the male reproductive organs of plants contain various cell types, including, for example, filaments, pollen sacs, tapetum and pollen. As used herein, "male tissue" refers to the specialized tissues responsible for producing male gametes in sexually reproducing plants. Male tissues include, but are not limited to, stamens, filaments, pollen sacs, tapetum and pollen.

[0106] The process of mature pollen grain formation begins with microsporogenesis, in which the mother cell is formed in the sporogenous tissue of the pollen sac. This is followed by microgametogenesis, in which the microspore nucleus undergoes asymmetric mitosis to form a microgametophyte or pollen grain. The state of "male fertility" or "male fertility" refers to those plants that produce mature pollen grains, which are capable of fertilizing female gametes to produce subsequent generations of offspring. As used herein, the term "affecting male fertility" or "regulating male fertility" refers to any enhancement or decline in the ability of a plant to produce mature pollen grains when compared to a suitable control. "Mature pollen grains" or "mature pollen" refers to any pollen grain that is capable of fertilizing female gametes to produce subsequent generations of offspring. Similarly, the term "male fertility polynucleotide" or "male fertility polypeptide" refers to a polynucleotide or polypeptide that regulates male fertility. Male fertility polynucleotides can, for example, encode polypeptides that participate in microsporogenesis or microgametogenesis.

[0107] Certain male sterility genes such as MACl, EMSl or GNE2 (Sorensen et al. (2002) Plant J. 29: 581-594) prevent cell growth in the tetraspore stage. Mutations in SPOROCYTELESS / NOZZLE genes act early in development but affect not only anther formation but also ovule formation, rendering the plant both male- and female-sterile. The SPOROCYTELESS gene of Arabidopsis is required for the initiation of sporogenesis and encodes a novel nuclear protein (Genes Dev. 1999 Aug 15; 13(16): 2108-17).

[0108] Male fertility polynucleotides disclosed herein include homologs and orthologs of polynucleotides shown to affect male fertility. For example, male fertility polynucleotides disclosed herein and active fragments and variants thereof include homologs and orthologs of Ms1. Plants lacking functional Ms1 show physiological changes in reproductive tissue development and are male sterile. Phenotypic analysis of msl mutants is performed using techniques known in the art. For example, screening for male sterile phenotypes in Gladius wheat is performed as follows: to prevent seed formation from open pollination, the spikes are covered with paper bags before flowering and fixed with paper clips. At least three spikes are covered per plant for quantitative analysis of fertility scores. In order to determine the quantitative analysis of fertility scores, the number of florets per spike and the number of seeds per spike are counted and expressed as the number of seeds formed per floret.

[0109] As disclosed elsewhere herein, SEQ ID NO: 4 provides a wheat Msl coding sequence. SEQ ID NO: 7 provides a native wheat Msl genomic sequence. SEQ ID NO: 9 provides a variant Msl genomic sequence. SEQ ID NO: 39 provides a MSl homolog from Brachypodium. SEQ ID NO: 40 provides a MSl homolog from rice.

[0110] Mutants at the common wheat msl locus on chromosome arm 4BS include:

[0111] Pugsley (msla); see

[0112] ○ Pugsley, AT and RN Oram (1959) Genic male sterility in wheat. Aust. Pl. Breed. Genet. Newsl. No. 14: 10-11 (Pugsley AT and RN Oram, 1959, "Genetic male sterility in wheat", Aust. Pl. Breed. Genet. Newsl., Vol. 14, pp. 10-11);

[0113] o Suneson, CA (1962) Use of Pugsley's sterile wheat in crossbreeding. Crop Sci. 2: 534-535 (Suneson CA, 1962, "The use of Pugsley sterile wheat in crossbreeding", "Crop Science", Vol. 2, pp. 534-535); and

[0114] ○ Waninge, J. and Zeven, AC (1968) Chromosome numbers in Pugley's (sic) male sterile wheat. Euphytica 17: 378-380 (Waninge J. and Zeven AC, 1968, "Chromosome numbers in Pugley (sic) male sterile wheat", Euphytica, Vol. 17, pp. 378-380).

[0115] Probus (mslb); see Fossati, A. and M. Ingold (1970) A male sterile mutant in Triticum aestivum. Wheat Information Service (Kyoto) 30: 3-10.

[0116] Cornerstone (mslc); see Driscoll, CJ and KK Barlow (1976) Malesterility in plants: Induction, isolation and utilization. pp. 123-131 in Induced Mutation in Cross-Breeding, IAEA, Vienna, Austria.

[0117] The mutations in Probus and Cornerstone are radiation-induced and are presumed to be caused by a terminal deletion of chromosome arm 4BS. The Pugsley mutant is classified as a spontaneous mutant alone. The location of the msl gene has been physically mapped to a region encompassing 16% of the distal 4BS chromosome arm (Endo et al. (1991) The Japanese Journal of Genetics 66(3):291-295; Klindworth et al. (2002) Crop Sci. 42:1447-1450; Cenci et al. (2003) Theor. Appl. Genet 107(5):931-9).

[0118] Provided herein are causal changes for the Ms1 mutations msld, msle, mslf and mslh, and markers closely linked to the Ms1 gene on chromosome 4BS. Markers include ET0487, ET0488, ET0489, ET0490, ET0491, ET0495, 007-0033.1 and 007-0046.1; see SEQ ID NOs: 24-29 and 32-33. These markers can be used to track msld, msle, mslf or mslh in subsequent selfing and crossing of wheat lines containing msld, msle, mslf or mslh mutations, thereby ensuring that the male sterility trait is advantageously inherited in a wheat breeding program.

[0119] Ms1 mutations msld, msle and mslf are recessive mutations of the Ms1 gene induced in the Chris wheat variety using ethyl methanesulfonate (Klindworth et al. 2002. Crop Sci. 42: 1447-1450). The mslh mutation in exon 1 was generated by TILLING (targeted induced local mutation technology in the genome) (McCallum et al. (2000) Nat. Biotechnol. 18: 455-457).

[0120] Advantageously, plant breeders can use molecular markers to identify individuals containing the Ms1 mutation by identifying marker alleles that show a statistically significant probability of co-segregation with male sterility, manifesting as linkage disequilibrium. This is known as marker-assisted selection (MAS). Therefore, the present invention also provides methods for selecting mutant wheat plants that are homozygous or heterozygous for mutations in the Ms1 gene (such as, but not limited to, msld, msle, and mslf).

[0121] In order to perform MAS, nucleic acids corresponding to marker nucleic acid alleles are detected in biological samples from plants to be selected. Such detection can take the form of hybridization of probe nucleic acids with marker alleles or their amplicons, for example, using allele-specific hybridization, Southern analysis, Northern analysis, in situ hybridization, primer hybridization followed by PCR amplification of the marker region, DNA sequencing of the PCR amplification product, etc. For any marker sequence described herein, one of ordinary skill in the art will understand how to use known DNA amplification and sequencing techniques to obtain alleles at the marker locus of a particular wheat strain or variety. For the purposes described herein, the strains or varieties used are publicly available. Therefore, DNA can be obtained, and one of ordinary skill in the art can use the provided primers or develop primers from the provided reference sequences to amplify and obtain sequences at each marker locus of each strain or variety.

[0122] After verifying the presence (or absence) of a specific marker allele in the biological sample, a plant is selected and hybridized with a second plant (optionally a wheat plant from an elite line). The specific marker allele in the progeny plants produced by the hybridization can be evaluated, and only those progeny plants with the desired marker allele will be selected.

[0123] Through marker-assisted selection, plant breeders can track the presence of the male sterility trait by controlling crosses to obtain new plants containing the Ms1 mutation in the homozygous or heterozygous state when necessary, thereby maintaining the Ms1 mutation. In addition, marker-assisted selection can be used to produce mutant male sterile seed parents that will be used as female plants (i.e., plants that require pollen donor plants for pollination) to produce seeds with commercial value. Alternatively, marker-assisted selection can be used to produce F1 hybrids containing the Ms1 mutation in the heterozygous state.

[0124] Any of the markers provided herein, as well as any markers linked and associated with any of these markers, can be used for marker-assisted selection for the male sterility trait.

[0125] The term "linkage" is used to describe the degree to which one marker locus is "associated" with another marker locus or some other locus (e.g., a male sterility locus). A common measure of linkage is the frequency with which traits co-segregate. This can be expressed as a co-segregation percentage (recombination frequency), or expressed in centimorgans (cM). cM is a unit of measure for the frequency of genetic recombination. 1 cM is equal to a 1% probability that a trait at one locus will segregate with a trait at another locus due to exchange in one generation (meaning that the traits co-segregate in 99% of cases).

[0126] In some embodiments, linkage can be expressed as desired limit or scope.For example, in some embodiments, when the interval distance of mark is less than 50,40,30,25,20 or 15 map distance units (or cM), any mark is connected (hereditarily and physically) with any other mark (or locus such as Ms1).Further linkage can be described by interval 14,13,12,11,10,9,8,7,6,5,4,3,2,1 map distance units (or cM).In some aspects, it is favourable to limit the linkage of equal scope (for example between 10cM and 20cM, between 10cM and 30cM or between 10cM and 40cM).

[0127] The mark is connected more tightly with the second locus, and the mark is more likely to become the indication of the second locus.Therefore, the locus frequency of recombination shown by " the locus that is tightly connected " (such as the marker locus and the second locus) is 10% or lower, or about 9% or lower, or about 8% or lower, or about 7% or lower, or about 6% or lower, or about 5% or lower, or about 4% or lower, or about 3% or lower, or about 2% or lower.In other embodiments, the recombination frequency shown by the associated locus is about 1% or lower, for example, about 0.75% or lower, or about 0.5% or lower, or about 0.25% or lower.If two loci are located on the same chromosome, and the distance between them makes the recombination frequency between the two loci less than 10% (for example about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25% or lower), so the two loci are also said to be "adjacent" to each other. Since 1 cM is the distance between two genetic markers at a recombination frequency of 1%, any marker is closely linked (genetically and physically) to any other marker in close proximity, for example, at a distance equal to or less than 10 cM. ​​Two closely linked markers on the same chromosome may be located 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, 0.25, 0.1, 0.075, 0.05, 0.025, or 0.01 cM or closer to each other.

[0128] Although specific marker alleles can be shown to co-segregate with male sterility phenotypes, it is important to note that markers are not necessarily part of the locus responsible for expressing male sterility. For example, there is no requirement that the marker polynucleotide sequence be part of the Ms1 gene. The association between specific marker alleles and male sterility phenotypes is due to the initial "coupling" linkage phase between the marker allele and the Ms1 mutation in the wheat line from which the Ms1 mutation originated. Because msld, msle, and mslf originated from variety Chris, marker alleles in Chris within the Ms1 region can be used to track msld, msle, and mslf mutations in subsequent generations.

[0129] Disclosed herein are isolated or substantially purified nucleic acid molecules or protein compositions. "Isolated" or "purified" nucleic acid molecules, polynucleotides, polypeptides or proteins, or their biologically active parts, are substantially or substantially free of components that are usually present in the naturally occurring environment of the polynucleotide or protein, that accompany or interact with the polynucleotide or protein. Therefore, isolated or purified polynucleotides or polypeptides or proteins are substantially free of other cellular materials or culture media when produced by recombinant technology, or substantially free of chemical precursors or other chemicals when synthesized by chemical methods. Most preferably, the "isolated" polynucleotide does not contain sequences that are naturally located on the side of the polynucleotide in the genomic DNA of the organism from which the polynucleotide is derived (i.e., sequences that are located at the 5' and 3' ends of the polynucleotide) (the best being protein coding sequences). For example, in various embodiments, the isolated polynucleotide may contain less than about 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb or 0.1kb of nucleotide sequences that are naturally located on the side of the polynucleotide in the genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes a protein preparation having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When the polypeptides disclosed herein, or biologically active portions thereof, are recombinantly produced, optimally, the culture medium has less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or chemicals other than the protein of interest.

[0130] A "test plant" or "test plant cell" is a plant or plant cell in which a genetic alteration (such as transformation) has been achieved for a gene of interest, or a plant or plant cell inherited from and containing a plant or cell so altered. A "control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in a test plant or plant cell.

[0131] Control plants or plant cells may include, for example: (a) wild-type plants or plant cells, i.e., plants or plant cells having the same genotype as the starting material used to make the genetic alteration that results in the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an ineffective construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) plants or plant cells that are non-transformed segregants among the progeny of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but that have not been exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the test plant or plant cell itself under conditions where the gene of interest is not expressed.

[0132] Also provided are fragments and variants of the polynucleotides disclosed in the present invention and proteins encoded therefrom. By "fragment" is meant a portion of a polynucleotide or an amino acid sequence encoded therefrom and thereby a portion of a protein encoded therefrom. Fragments of polynucleotides can encode protein fragments that retain the biological activity of the native protein and thus affect male fertility; these fragments may be referred to herein as "active fragments". Alternatively, polynucleotide fragments that can be used as hybridization probes or are useful in constructs and strategies for downregulating or targeting sequence modifications generally do not encode protein fragments that retain biological activity, but can still affect male fertility. Therefore, the range of a fragment of a nucleotide sequence can be at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, up to the full-length polynucleotide of the encoded polypeptide disclosed herein.

[0133] Fragments of polynucleotides encoding biologically active portions of polypeptides that affect male fertility will encode at least 15, 25, 30, 50, 100, 150 or 200 consecutive amino acids, or up to the total number of amino acids present in the full-length polypeptide that affects male fertility (e.g., SEQ ID NO: 3, 5, 39 or 40). Fragments of male fertility polynucleotides that are useful as hybridization probes or PCR primers or in down-regulation constructs or targeted modification methods generally need not encode biologically active portions of a polypeptide, but can affect male fertility.

[0134] Thus, fragments of the male fertility polynucleotides disclosed herein may encode biologically active portions of male fertility polypeptides, or they may be fragments that can be used as hybridization probes or PCR primers or in down-regulation constructs or targeted modification methods using methods known in the art or disclosed below. Biologically active portions of male fertility polypeptides can be prepared by isolating a portion of one of the male fertility polynucleotides disclosed herein, expressing the coding portion of the male fertility protein (e.g., by in vitro recombinant expression), and evaluating the activity of the coding portion of the male fertility polypeptide. A polynucleotide that is a fragment of a male fertility polynucleotide comprises at least 16, 20, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, or 4000 nucleotides, or up to the number of nucleotides present in a full-length male fertility polynucleotide disclosed herein (e.g., SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45, or a polynucleotide encoding SEQ ID NO: 39 or 40).

[0135] "Variant" is intended to mean substantially similar sequences. For polynucleotides, variants include deletions and / or additions of one or more nucleotides at one or more sites within natural polynucleotides, and / or substitutions of one or more nucleotides at one or more sites in natural polynucleotides. As used herein, "natural" or "wild-type" polynucleotides or polypeptides include naturally occurring nucleotide sequences or amino acid sequences, respectively. For polynucleotides, conservative variants include those sequences that encode the amino acid sequence of the male fertility polypeptide disclosed herein due to the degeneracy of the genetic code. Natural allelic variants (such as these) can be identified with well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques described below. Variant polynucleotides also include polynucleotides of synthetic origin, such as those produced, for example, by using site-directed mutagenesis and polynucleotides that can encode male fertility polypeptides. Generally, variants of a particular polynucleotide disclosed herein will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide (e.g., SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45) as determined by sequence alignment programs and parameters described elsewhere herein or known in the art.

[0136] Variants of a particular polynucleotide disclosed herein (i.e., a reference polynucleotide) can also be evaluated by comparing the percent sequence identity between a polypeptide encoded by the variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, an isolated polynucleotide can encode a polypeptide having a given percent sequence identity to a polypeptide of SEQ ID NO: 3, 5, 39 or 40. The percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Any given pair of polynucleotides disclosed herein is evaluated by comparing the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides being at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0137] "Variant" proteins are intended to mean proteins derived from native proteins by deleting or adding one or more amino acids at one or more sites in the native protein and / or replacing one or more amino acids at one or more sites in the native protein. Variant proteins disclosed herein are biologically active, i.e., they still have the biological activity of the native protein, i.e., the male fertility activity described herein. Such variants may be obtained, for example, by genetic polymorphism or human manipulation. The biologically active variants of the male fertility proteins disclosed herein will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the amino acid sequence of the native protein (e.g., SEQ ID NO: 3, 5, 39 or 40), as determined by sequence alignment programs and parameters described elsewhere herein or known in the art. Biologically active variants of a protein disclosed herein may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10 (such as 6-10), as few as 5, as few as 4, 3, 2 or even 1 amino acid residue.

[0138] The proteins disclosed herein can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are well known in the art. For example, amino acid sequence variants and fragments of male fertility polypeptides can be prepared by mutations in DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, e.g., Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York), and references cited therein. Guidance for appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model described in Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, may be optimal.

[0139] Therefore, the genes and polynucleotides disclosed herein include both naturally occurring sequences and DNA sequence variants. Likewise, male fertility polypeptides and proteins encompass both naturally occurring polypeptides and variant and modified forms thereof. Such polynucleotide and polypeptide variants may still have the desired male fertility activity, in which case the mutations to be made in the DNA encoding the variant should not place the sequence out of the reading frame and preferably do not form complementary regions that can produce secondary mRNA structure. See EP Patent Application Publication 75,444.

[0140] Certain deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the properties of the protein. However, while it is difficult to predict the exact effect of a substitution, deletion, or insertion before it is made, one skilled in the art will recognize that the effect will be assessed by conventional screening assays. That is, the activity can be assessed by measuring male fertility activity.

[0141] The enhancement or reduction of male fertility can be determined in a variety of ways. One of ordinary skill in the art can easily evaluate the activity of a variant or fragment by introducing the polynucleotide into a plant that is homozygous for a stable male sterile allele of the polynucleotide, followed by observation of male tissue development in the plant. For example, to determine the male fertility activity conferred by a fragment or variant of SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45, one of skill in the art can start by identifying plants that express an ms1 phenotype or by constructing plants that are homozygous for a mutation in a natural Ms1 gene, resulting in male sterility. Subsequently, a technician can compensate for the mutation by providing an Ms1 polynucleotide or a fragment or variant thereof, followed by observation of whether the male tissue of the plant develops normally and is able to produce mature pollen.

[0142] Variant functional polynucleotides and proteins also encompass sequences and proteins obtained by mutagenesis and recombination processes such as DNA shuffling. Using this process, one or more different male fertility sequences can be manipulated to produce new male fertility polypeptides with desired properties. In this way, a library of recombinant polynucleotides is generated from a group of related sequence polynucleotides that contain sequence regions with significant sequence identity and that can undergo homologous recombination in vitro or in vivo. For example, using this method, sequence motifs encoding a domain of interest can be reorganized between the male fertility polynucleotides disclosed herein and other known male fertility polynucleotides to obtain polypeptides encoding improved properties of interest (such as, in the case of enzymes, increased K m) proteins. Such strategies for DNA shuffling are known in the art. See, e.g., Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer (1994) Nature 370: 389-391; Crameri et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1994) Nature 370: 389-391; Crameri ... al. (1997) J. Mol. Biol. 272: 336-347 (Moore et al., 1997, Journal of Molecular Biology, Vol. 272, pp. 336-347); Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94: 4504-4509 (Zhang et al., 1997, Proceedings of the National Academy of Sciences of the United States of America, Vol. 94, pp. 4504-4509); Crameri et al. (1998) Nature 391: 288-291 (Crameri et al., 1998, Nature, Vol. 391, pp. 288-291); and U.S. Patents 5,605,793 and 5,837,458.

[0143] II. Sequence Analysis

[0144] As used herein, "sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to the same residues in the two sequences when aligned over a specified comparison window to obtain maximum correspondence. When the percentage of sequence identity is used for proteins, it should be recognized that the residue positions that are not identical often differ in conservative amino acid substitutions, in which the amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and therefore do not change the functional properties of the molecule. When the sequence difference is conservative substitution, the percentage sequence identity can be adjusted upward to correct the conservative nature of the substitution. The difference is that the sequence of such conservative substitutions is referred to as having "sequence similarity" or "similarity". The means for making this adjustment are well known to those skilled in the art. Typically, this involves assessing conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Therefore, for example, if the same amino acid is given 1 point and non-conservative substitutions are given 0 points, then conservative substitutions are given a score between 0 and 1. The scoring of conservative substitutions is calculated as performed, for example, in the program PC / GENE (Intelligenetics, Mountain View, California, USA).

[0145] As used herein, "sequence identity percentage" means a value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to a reference sequence (not including additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleic acid base or amino acid residue appears in the two sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the sequence identity percentage.

[0146] Unless otherwise indicated, the sequence identity / similarity values ​​provided herein refer to the values ​​obtained using GAP version 10 or any equivalent program thereof using the following parameters: the identity percentage and similarity percentage of nucleotide sequences use GAP weight 50 and length weight 3 and nwsgapdna.cmp scoring matrix; the identity percentage and similarity percentage of amino acid sequences use GAP weight 8 and length weight 2 and BLOSUM62 scoring matrix. By "equivalent program" is meant any such sequence comparison program that, for any two sequences under consideration, can generate an alignment having the same nucleotide or amino acid residue matches and the same percentage sequence identity compared to the corresponding alignment generated by GAP version 10.

[0147] The use of the term "polynucleotide" is not intended to limit the present disclosure to polynucleotides comprising DNA. One of ordinary skill in the art will recognize that polynucleotides may comprise ribonucleotides as well as combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogs. The polynucleotides disclosed herein also encompass all forms of sequences, including but not limited to single-stranded forms, double-stranded forms, hairpin structures, stem-loop structures, and the like.

[0148] III. Expression Cassette

[0149] The male fertility polynucleotides disclosed herein can be provided in an expression cassette for expression in a target organism. The expression cassette can include 5' and 3' regulatory sequences operably connected to the male fertility polynucleotides disclosed herein. "Operably connected" is intended to mean a functional connection between two or more elements. For example, an operably connected between a target polynucleotide and a regulatory sequence (e.g., a promoter) is a functional connection that enables the target polynucleotide to be expressed. Operably connected elements can be continuous or non-continuous. When used to refer to the connection of two protein coding regions, so-called operably connected means that the coding regions are in the same reading frame.

[0150] The expression cassette disclosed herein may include a transcriptional and translational initiation region (i.e., a promoter), a polynucleotide of interest, and a transcriptional and translational termination region (i.e., a termination region) that function in a host cell (e.g., a plant cell) in the 5'-3' transcriptional direction. The expression cassette is also provided with a plurality of restriction sites and / or recombination sites so that the insertion of the male fertility polynucleotide is under the transcriptional regulation of the regulatory regions described elsewhere herein. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and / or the polynucleotide of interest may be native / similar to the host cell or to each other. Alternatively, the regulatory regions and / or the polynucleotide of interest may be heterologous to the host cell or to each other. As used herein, "heterologous" with respect to a polynucleotide or polypeptide sequence is a sequence that originates from an alien species, or, if originating from the same species, is a sequence that is substantially modified in composition and / or locus from its native form by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from that from which the polynucleotide is derived, or, if from the same / similar species, one or both are substantially different from their native form and / or genomic modifications, or the promoter is not a native promoter of the operably linked polynucleotide. As used herein, unless otherwise indicated, a chimeric polynucleotide comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

[0151] In certain embodiments, the polynucleotides disclosed herein can be stacked with any combination or expression cassette of target polynucleotide sequences disclosed elsewhere herein or known in the art. For example, the male fertility polynucleotides disclosed herein can be stacked with any other polynucleotides encoding male gamete destructive polynucleotides or polypeptides, cytotoxins, markers, or other male fertility sequences disclosed elsewhere herein or known in the art. The stacked polynucleotides can be operably linked to the same promoter as the male fertility polynucleotides, or can be operably linked to a separate promoter polynucleotide.

[0152] As described elsewhere herein, the expression cassette may comprise a promoter operably linked to the polynucleotide of interest, together with a corresponding terminator. The terminator may be native to the transcription initiation region, native to the operably linked male fertility polynucleotide of interest or male fertility promoter sequence, native to the plant host, or may be derived from another source (i.e., foreign or heterologous). Easily available terminators may be obtained from the Ti plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase terminators. See also Guerineau et al. (1991) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1991) Plant Cell 3: 1361-1372; Munroe et al. (1991) Plant Cell 4: 1471-1372; Munroe et al. (1991) Plant Cell 5: 1361-1372; Munroe et al. (1991) Plant Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1991) Plant Cell 64: 671-674; al. (1990) Gene 91: 151-158 (Munroe et al., 1990, Gene, Vol. 91, pp. 151-158); Ballas et al. (1989) Nucleic Acids Res. 17: 7891-7903 (Ballas et al., 1989, Nucleic Acids Research, Vol. 17, pp. 7891-7903); and Joshi et al. (1987) Nucleic Acids Res. 15: 9627-9639 (Joshi et al., 1987, Nucleic Acids Research, Vol. 15, pp. 9627-9639).

[0153] If appropriate, the polynucleotide of interest may be optimized for increased expression in the transformed plant. That is, the polynucleotide may be synthesized or altered using plant-preferred codons in order to increase its expression. For a discussion of host-preferred codon usage, see, e.g., Campbell and Gowri (1990) Plant Physiol. 92: 1-11. Methods for synthesizing plant-preferred genes are available in the art. See, e.g., U.S. Pat. Nos. 5,380,831 and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17: 477-498, which are incorporated herein by reference.

[0154] Other sequence modifications that are known to enhance gene expression in cellular hosts. These sequence modifications include elimination of sequences encoding false polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be harmful to gene expression. The GC content of the sequence can be adjusted to the average level of a given cellular host, which is calculated by reference to known genes expressed in host cells. When possible, the sequence is modified to avoid foreseeable hairpin secondary mRNA structures.

[0155] The expression cassette may additionally contain a 5' leader sequence. Such a leader sequence may serve to enhance translation. Translation leader sequences are known in the art and include: picornavirus leader sequences, such as the EMCV leader (encephalomyocarditis 5′ noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leader sequences, such as the TEV leader (tobacco etch virus) (Gallie et al. (1995) Gene 165(2):233-238), the MDMV leader (maize dwarf mosaic virus) (Johnson, et al., (1986) Virology 154:9-20 (Johnson et al., 1986, Virology, Vol. 154, pp. 9-20) and human immunoglobulin heavy chain binding protein (BiP) (Macejak, et al., (1991) Nature 353:90-94 (Macejak et al., 1991, Nature, Vol. 353, pp. 90-94)); the untranslated leader sequence from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625 (Jobling et al., 1987, Nature, Vol. 325, pp. 622-625)); the tobacco mosaic virus leader sequence (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256 (Gallie et al., 1989, in "Molecular Biology of RNA", Cech ed. (Liss, New York), pp. 237-256); and the maize yellow spot virus leader sequence (MCMV) (Lommel et al. (1991) Virology 81: 382-385). See also Della-Cioppa et al. (1987) Plant Physiol. 84: 965-968 (Della-Cioppa et al., 1987, "Plant Physiology", Vol. 84, pp. 965-968). Other known methods for enhancing translation, such as introns, etc., can also be used.

[0156] In preparing the expression cassette, multiple DNA fragments may be manipulated to provide a DNA sequence in the correct orientation and, where appropriate, in the correct reading frame. For this purpose, adapters or linkers may be used to connect the DNA fragments together, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction enzyme digestion, annealing, re-displacement (e.g., conversion and transversion) may be involved.

[0157] In certain embodiments, the expression cassette disclosed herein comprises a promoter operably linked to a male fertility polynucleotide, or a fragment or variant thereof, as disclosed herein. In certain embodiments, the male fertility promoter is operably linked to a male fertility polynucleotide disclosed herein, such as a polynucleotide set forth in SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45, or an active fragment or variant thereof.

[0158] In certain embodiments, a plant promoter may preferentially initiate transcription in certain tissues (such as stamens, anthers, filaments, and pollen) or developmental growth stages (such as sporogenous tissues, microspores, and microgametophytes). Such plant promoters are referred to as "tissue preferred," "cell type preferred," or "growth stage preferred." Promoters that initiate transcription only in certain tissues are referred to as "tissue specific." Similarly, promoters that initiate transcription only in certain growth stages are referred to as "growth stage specific." "Cell type specific" promoters drive expression only in certain cell types in one or more organs, such as stamen cells, or individual cell types within a stamen, such as anthers, filaments, or pollen cells.

[0159] A "male fertility promoter" can initiate transcription exclusively or preferentially in cells or tissues involved in the process of microsporogenesis or microgametogenesis. Male fertility polynucleotides disclosed herein and active fragments and variants thereof can be operably linked to male tissue-specific or male tissue-preferred promoters, including, for example, stamen-specific or stamen-preferred promoters, anther-specific or anther-preferred promoters, pollen-specific or pollen-preferred promoters, tapetum-specific or tapetum-preferred promoters, and the like. Promoters can be selected based on the desired results. For example, the polynucleotide of interest can be operably linked to a constitutive promoter, a tissue-preferred promoter, a growth stage-preferred promoter, or other promoters for expression in plants.

[0160] In one embodiment, the promoters may be those that express the operably linked polynucleotide of interest exclusively or preferentially in the male tissue of the plant. It is not necessary to use a promoter that is preferred or tissue-specific for a particular male fertile tissue in the process; and any of a variety of such promoters known to those skilled in the art may be used. One such promoter is the 5126 promoter, which preferentially directs the expression of the polynucleotide to which it is linked to the male tissue of the plant, as described in U.S. Pat. Nos. 5,837,851 and 5,689,051. Other examples include the maize Ms45 promoter described in U.S. Pat. No. 6,037,523; the SF3 promoter described in U.S. Pat. No. 6,452,069; the BS92-7 promoter described in WO 02 / 063021; ​​and the SGB6 regulatory element described in U.S. Pat. No. 5,470,359; the TA29 promoter (Koltunow, et al., (1990) Plant Cell 2:1201-1224; Nature 347:737 (1990); Goldberg, et al., (1993) Plant Cell 5: 1217-1229 (Goldberg et al., 1993, Plant Cell, Vol. 5, pp. 1217-1229) and U.S. Pat. No. 6,399,856); SB200 gene promoter (WO 2002 / 26789), PG47 gene promoter (U.S. Pat. No. 5,412,085; U.S. Pat. No. 5,545,546; Plant J 3(2): 261-271 (1993)), G9 gene promoter (U.S. Pat. Nos. 5,837,850; 5,589,610); Type 2 metallothionein-like gene promoter (Charbonnel-Campaa, et al., 1993). al., Gene (2000) 254: 199-208 (Charbonnel-Campaa et al., Gene, 2000, Vol. 254, pp. 199-208); Brassica Bca9 promoter (Lee, et al., (2003) Plant Cell Rep. 22: 268-273 (Lee et al., 2003, Plant Cell Reports, Vol. 22, pp. 268-273)); ZM13 promoter (Hamilton, et al., (1998) Plant Mol. Biol.38:663-669 (Hamilton et al., 1998, Plant Mol. Biol., Vol. 38, pp. 663-669); promoters of actin depolymerizing factors (such as Zmabp1, Zmabp2; see, e.g., Lopez, et al., (1996) Proc. Natl. Acad. Sci. USA 93:7415-7420); promoter of maize pectin methylesterase-like gene ZmC5 (Wakeley, et al., (1998) Plant Mol. Biol. 37:187-192); promoter of inhibitory protein gene Zmprol (Kovar, et al., (1998) Plant Mol. Biol. 37:187-192); promoter of inhibitory protein gene Zmprol (Kovar, et al., (1998) Plant Mol. Biol. 37:187-192); promoter of inhibitory protein gene Zmprol (Kovar, et al., (1996) Proc. Natl. Acad. Sci. USA 93:7415-7420); promoter of maize pectin methylesterase-like gene ZmC5 (Wakeley ... al., (2000) The Plant Cell 12:583-598); the sulfated pentapeptide phytosulphokine gene ZmPSK1 (Lorbiecke, et al., (2005) Journal of Experimental Botany 56(417):1805-1819); the promoter of calmodulin binding protein Mpcbp (Reddy, et al., (2005) Journal of Experimental Botany 56(417):1805-1819); al., (2000) J. Biol. Chem. 275(45): 35457-70 (Reddy et al., 2000, Journal of Biological Chemistry, Vol. 275, No. 45, pp. 35457-35470). .

[0161] As disclosed herein, constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99 / 43838 and U.S. Pat. No. 6,072,050; the CaMV35S core promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Cell 3:164-172); Mol. Biol. 12: 619-632 (Christensen et al., 1989, Plant Molecular Biology, Vol. 12, pp. 619-632) and Christensen et al. (1992) Plant Mol. Biol. 18: 675-689 (Christensen et al., 1992, Plant Molecular Biology, Vol. 18, pp. 675-689)); pEMU (Last et al. (1991) Theor. Appl. Genet. 81: 581-588 (Last et al., 1991, Theoretical and Applied Genetics, Vol. 81, pp. 581-588)); MAS (Velten et al. (1992) Plant Molecular Biology, Vol. 12, pp. 619-632) and Christensen et al. (1992) Plant Molecular Biology, Vol. 18, pp. 675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81: 581-588); MAS (Velten et al. (1992) Plant Molecular Biology, Vol. 18, pp. 675-689)); al. (1984) EMBO J. 3: 2723-2730 (Velten et al., 1984, "European Molecular Biology Organization Journal", Vol. 3, pp. 2723-2730); ALS promoter (U.S. Pat. No. 5,659,026), etc. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149, 5,608,144, 5,604,121, 5,569,597, 5,466,785, 5,399,680, 5,268,463, 5,608,142, and 6,177,611.

[0162] "Seed preferred" promoters include those active during seed development (such as promoters of seed storage proteins) and those active during seed germination. See Thompson et al. (1989) BioEssays 10: 108, which is incorporated herein by reference. Such seed preferred promoters include, but are not limited to, Ciml (cytokinin inducible message); cZ19B1 (maize 19 kDa zein); milps (inositol-1-phosphate synthase) (see WO 00 / 11177 and U.S. Pat. No. 6,225,529; which are incorporated herein by reference). The gamma-zein gene promoter is an endosperm-specific promoter. The globulin-1 (Glob-1) gene promoter is a representative embryo-specific promoter. For dicots, seed-specific promoters include, but are not limited to, bean β-phaseolin gene promoter, rapeseed protein (napin) gene promoter, β-conglycinin gene promoter, soybean lectin gene promoter, cruciferin gene promoter, etc. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, γ-zein, waxy protein gene (waxy), shrunken 1, shrunken 2, globulin 1, etc. See also WO 00 / 12733, which discloses seed-preferred promoters from end1 and end2 genes. Additional embryo-specific promoters are disclosed in the following literature: Sato et al. (1996) Proc. Natl. Acad. Sci. 93:8117-8122; Nakase et al. (1997) Plant J 12:235-46; and Postma-Haarsma et al. (1999) Plant Mol. Biol. 39:257-71.Additional endosperm-specific promoters are disclosed in the following references: Albani et al. (1984) EMBO 3: 1405-15; Albani et al. (1999) Theor. Appl. Gen. 98: 1253-62; Albani et al. (1993) Plant J. 4: 343-55; Mena et al. (1998) The Plant Journal 116: 53-62 and Wu et al. (1999) Theor. Appl. Gen. 98: 1253-62. et al. (1998) Plant Cell Physiology 39: 885-889 (Wu et al., 1998, Plant Cell Physiology, Vol. 39, pp. 885-889).

[0163] Promoters preferred for dividing cells or meristems are disclosed in the following references: Ito et al. (1994) Plant Mol. Biol. 24: 863-878; Reyad et al. (1995) Mo. Gen. Genet. 248: 703-711; Shaul et al. (1996) Proc. Natl. Acad. Sci. 93: 4868-4872; Ito et al. (1997) Plant Mol. Biol. 24: 863-878; Reyad et al. (1995) Mo. Gen. Genet. 248: 703-711; Shaul et al. (1996) Proc. Natl. Acad. Sci. 93: 4868-4872; J.11:983-992 (Ito et al., 1997, "Plant Journal", Vol. 11, pp. 983-992); and Trehin et al. (1997) Plant Mol. Biol. 35:667-672 (Trehin et al., 1997, "Plant Molecular Biology", Vol. 35, pp. 667-672).

[0164] Stress-inducible promoters include salt / water stress-inducible promoters, such as P5CS (Zang et al. (1997) Plant Sciences 129:81-89); cold-inducible promoters, such as cor15a (Hajela et al. (1990) Plant Physiol. 93:1246-1252), cor15b (Wlihelm et al. (1993) Plant Mol Biol 23:1073-1077), wsc120 (Ouellet et al. (1998) FEBS Lett. 423-324-328 (Ouellet et al., 1998, FEBS Letters, Vol. 423, pp. 324-328)), ci7 (Kirch et al. (1997) Plant Mol Biol. 33: 897-909), ci21A (Schneider et al. (1997) Plant Physiol. 113: 335-45); drought-inducible promoters, such as Trg-31 (Chaudhary et al. (1996) Plant Mol. Biol. 30: 1247-57 (Chaudhary et al., 1996, Plant Molecular Biology, Vol. 30, pp. 1247-1257)), rd29 (Kasuga et al. (1999) Nature Biotechnology 18: 287-291 (Kasuga et al., 1999, Nature Biotechnology, Vol. 18, pp. 287-291)); osmotic inducible promoters such as Rab17 (Vilardell et al. (1991) Plant Mol. Biol. 17: 985-93 (Vilardell et al., 1991, Plant Molecular Biology, Vol. 17, pp. 985-993)) and osmotic proteins (Raghothama et al.(1993) Plant Mol Biol 23: 1117-28 (Raghothama et al., 1993, Plant Molecular Biology, Vol. 23, pp. 1117-1128)); and heat-inducible promoters, such as heat shock proteins (Barros et al. (1992) Plant Mol. 19: 665-75 (Barros et al., 1992, Plant Molecular Biology, Vol. 19, pp. 665-675); Marrs et al. (1993) Dev. Genet. 14: 27-41 (Marrs et al., 1993, Developmental Genetics, Vol. 14, pp. 27-41)) and smHSP (Waters et al. (1996) J. Experimental Botany 47:325-338 (Waters et al., 1996, Journal of Experimental Botany, Vol. 47, pp. 325-338)). Other stress-inducible promoters include rip2 (U.S. Pat. No. 5,332,808 and U.S. Patent Publication No. 2003 / 0217393) and rd29A (Yamaguchi-Shinozaki et al. (1993) Mol. Gen. Genetics 236:331-340). .

[0165] As described elsewhere herein, expression cassettes comprising male fertility polynucleotides can be stacked with other polynucleotides of interest.Any polynucleotide of interest can be stacked with a male fertility polynucleotide, including, for example, male gamete disrupting polynucleotides and marker polynucleotides.

[0166] Male fertility polynucleotides disclosed herein can be stacked in an expression cassette comprising a promoter operably linked to a polynucleotide having male gamete destruction (i.e., a polynucleotide that interferes with the function, formation or propagation of male gametes), or with the expression cassette. Male gamete destruction polynucleotides can be operated by any of a variety of methods to prevent the function, formation or propagation of male gametes. By way of example and not limitation, this can include the use of polynucleotides encoding gene products such as DAM-methylase or barnase (see, e.g., U.S. Pat. Nos. 5,792,853 or 5,689,049, PCT / EP89 / 00495); encoding gene products that interfere with starch accumulation, degrade starch, or affect osmotic balance in pollen, such as α-amylase (see, e.g., U.S. Pat. Nos. 7,875,764, 8,013,218, 7,696,405, 8,614,367); inhibiting the formation of gene products that are important for the function, formation or dispersal of male gametes (see, e.g., U.S. Pat. Nos. 5,859,341, 6,297,426, ); encodes a gene product that binds to another gene product to prevent the formation or function of male gametes (see, e.g., U.S. Pat. Nos. 6,162,964, 6,013,859, 6,281,348, 6,399,856, 6,248,935, 6,750,868, 5,792,853); is antisense to, or causes co-suppression of, a gene that is essential for the function, formation, or dissemination of male gametes (see, e.g., U.S. Pat. Nos. 6,184,439, 5,728,926, 6,191,343, 5,728,558, 5,741,684); interferes with the expression of a male fertility polynucleotide by using a hairpin formation (see, e.g., Smith et al. et al. (2000) Nature 407:319-320 (Smith et al., 2000, Nature, Vol. 407, pp. 319-320), WO 99 / 53050 and WO 98 / 53083), etc.

[0167] Male gamete disrupting polynucleotides include dominant negative genes, such as methylase genes and growth inhibitory genes. See U.S. Pat. No. 6,399,856. Dominant negative genes include diphtheria toxin A chain gene (Czako and An (1991) Plant Physiol. 95687-692; Greenfield et al. (1983) PNAS 80: 6853); cell cycle division mutants, such as CDC in corn (Colasanti et al. (1991) PNAS 88: 3377-3381); WT gene (Farmer et al. (1991) PNAS 89: 3477-3481); al. (1994) Mol. Genet. 3: 723-728 (Farmer et al., 1994, Molecular Genetics, Vol. 3, pp. 723-728); and P68 (Chen et al. (1991) PNAS 88: 315-319 (Chen et al., 1991, Proceedings of the National Academy of Sciences of the United States of America, Vol. 88, pp. 315-319)).

[0168] Additional examples of male gamete-destroying polynucleotides include, but are not limited to, the pectate lyase gene pelE from Erwinia chrysanthermi (Kenn et al (1986) J. Bacteriol. 168: 595); the CytA toxin gene from Bacillus thuringiensis israelensis (McLean et al (1987) J. Bacteriol. 169: 1017 (1987), U.S. Pat. No. 4,918,006); a DNA enzyme, an RNA enzyme, a protease, or a polynucleotide expressing an antisense RNA. The male gamete-destroying polynucleotide may encode a protein involved in inhibiting the interaction of pollen and stigma, pollen tube growth, fertilization, or a combination thereof.

[0169] The male fertility polynucleotides disclosed herein can be stacked with an expression cassette disclosed herein comprising a promoter operably linked to a polynucleotide of interest encoding a reporter gene or a marker product. Examples of suitable reporter gene polynucleotides known in the art can be found, for example, in the following literature: Jefferson et al. (1991) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic Publishers), pp. 1-33; DeWet et al. Mol. Cell. Biol. 7: 725-737 (1987); Goff et al. EMBO J. 9: 2517-2522 (1990); Kain et al. BioTechniques 19:650-655 (1995) (Kain et al., 1995, Biotechnology, Vol. 19, pp. 650-655); and Chiu et al. Current Biology 6:325-330 (1996) (Chiu et al., 1996, Contemporary Biology, Vol. 6, pp. 325-330). In certain embodiments, the polynucleotide of interest encodes a selective reporter gene. These polynucleotides may include polynucleotides that confer antibiotic resistance or herbicide resistance. Examples of suitable selective marker polynucleotides include, but are not limited to, genes encoding resistance to chloramphenicol, methotrexate, hygromycin, streptomycin, spectinomycin, bleomycin, sulfonamide, bromoxynil, glyphosate, and glufosinate.

[0170] In some embodiments, the expression cassette disclosed herein comprises a polynucleotide of interest encoding a recordable or screenable marker, wherein the presence of the polynucleotide produces a measurable product. Examples include β-glucuronidase or uidA gene (GUS), which encodes enzymes for which various chromogenic substrates are known (e.g., U.S. Patents 5,268,463 and 5,599,670); chloramphenicol acetyltransferase and alkaline phosphatase. Other screenable markers include anthocyanin / flavonoid polynucleotides, including, for example, R-locus polynucleotides encoding products that regulate the production of anthocyanin pigments (red) in plant tissues, genes that control the biosynthesis of flavonoid pigments, such as maize C1 and C2, B genes, p1 genes, and bronze locus genes, etc. Additional examples of suitable markers encoded by the polynucleotide of interest include cyan fluorescent protein (CYP) genes, yellow fluorescent protein genes, luminescent genes encoding luciferase (the presence of which can be detected using, for example, X-ray film, scintillation counting, fluorophotometry, low-light video cameras, photon counting cameras, or multi-well luminescence assays), green fluorescent protein (GFP), and DsRed2 (Clontech Laboratories, Inc., Mountain View, California), wherein plant cells transformed with the marker gene fluoresce red and can thus be selected visually. Additional examples include the p-lactamase gene encoding an enzyme for which various chromogenic substrates (e.g., PADAC, chromogenic cephalosporins) are known, the xylE gene encoding a catechol dioxygenase that can convert chromogenic catechols, and the tyrosinase gene encoding an enzyme capable of oxidizing tyrosine to dopa and dopaquinone (which in turn condense to form the easily detectable compound melanin).

[0171] The expression cassette may also comprise a selectable marker gene for selecting transformed cells. Selectable marker genes are used to select transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), and genes conferring resistance to herbicidal compounds, such as glufosinate, bromoxynil, imidazolinone and 2,4-dichlorophenoxyacetic acid (2,4-D). Additional selectable markers include phenotypic markers such as β-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan fluorescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129: 913-42 (Kato et al., 2002, Plant Physiology, Vol. 129, pp. 913-942)) and yellow fluorescent protein (PhiYFP from Evrogen TM, see Bolte et al. (2004) J. Cell Science 117:943-54. For additional selectable markers, see generally Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell Science 117:943-54. For additional selectable markers, see generally Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell Science 117:943-54. 71:63-72 (Yao et al., 1992, Cell, Vol. 71, pp. 63-72); Reznikoff (1992) Mol. Microbiol. 6:2419-2422 (Reznikoff, 1992, Molecular Microbiology, Vol. 6, pp. 2419-2422); Barkley et al. (1980) in The Operon, pp. 177-220 (Barkley et al., 1980, in The Operon, pp. 177-220); Hu et al. (1987) Cell 48:555-566 (Hu et al., 1987, Cell, Vol. 48, pp. 555-566); Brown et al. (1987) Cell 49:603-612 (Brown et al., 1987, Cell, Vol. 49, pp. 603-612); Figge et al. (1988) Cell 52:713-722 (Figge et al., 1988, Cell, Vol. 52, pp. 713-722); Deuschle et al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404 (Deuschle et al., 1989, Proceedings of the National Academy of Sciences of the United States of America, Vol. 86, pp. 5400-5404); Fuerst et al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404); al. (1989) Proc. Natl. Acad. Sci. USA 86: 2549-2553 (Fuerst et al., 1989, Proceedings of the National Academy of Sciences of the United States of America, Vol. 86, pp. 2549-2553); Deuschle et al.(Deuschle et al., 1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1990) Proc. Natl. Acad. Sci. USA 90:1917-1921; al. (1992) Proc. Natl. Acad. Sci. USA 89: 3952-3956 (Zambretti et al., 1992, Proceedings of the National Academy of Sciences of the United States of America, Vol. 89, pp. 3952-3956); Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88: 5072-5076 (Baim et al., 1991, Proceedings of the National Academy of Sciences of the United States of America, Vol. 88, pp. 5072-5076); Wyborski et al. (1991) Nucleic Acids Res. 19: 4647-4653 (Wyborski et al., 1991, Nucleic Acids Research, Vol. 19, pp. 4647-4653); Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10: 143-162 (Hillenand-Wissman, 1989, "Topics in Molecular Structural Biology", Vol. 10, pp. 143-162); Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35: 1591-1595 (Degenkolb et al., 1991, "Antimicrobial Agents and Chemotherapy", Vol. 35, pp. 1591-1595); Kleinschnidt et al. (1988) Biochemistry 27: 1094-1104 (Kleinschnidt et al., 1988, "Biochemistry", Vol. 27, pp. 1094-1104); Bonin (1993) Ph.D.Thesis, University of Heidelberg (Bonin, 1993); Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89: 5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36: 913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); al. (1988) Nature 334: 721-724 (Gill et al., 1988, Nature, Vol. 334, pp. 721-724). These disclosures are incorporated herein by reference. The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the compositions and methods disclosed herein. .

[0172] In some embodiments, the expression cassette disclosed herein comprises a first polynucleotide of interest encoding a male fertility polynucleotide operably linked to a first promoter polynucleotide, the first polynucleotide of interest being stacked with a second polynucleotide of interest encoding a male gamete destructive gene product operably linked to a male tissue preferred promoter polynucleotide. In certain embodiments, the expression cassette described herein may also be stacked with a third polynucleotide of interest encoding a marker polynucleotide operably linked to a promoter polynucleotide.

[0173] In a specific embodiment, the expression cassette disclosed herein comprises a first polynucleotide of interest encoding a male fertility gene (such as wheat or barley Ms1) operably linked to a constitutive promoter (such as the cauliflower mosaic virus (CaMV) 35S promoter) disclosed herein. The expression cassette may also comprise a second polynucleotide of interest encoding a male gamete-destructive gene product operably linked to a male tissue-preferred promoter. In certain embodiments, the expression cassette disclosed herein may also comprise a third polynucleotide of interest encoding a marker gene (such as the phosphinothricin acetyltransferase (PAT) gene from Streptomyces viridochomagenes) operably linked to a constitutive promoter (such as the cauliflower mosaic virus (CaMV) 35S promoter).

[0174] IV. Plants

[0175] A. Plants Having Altered Levels of Male Fertility Polypeptide Activity

[0176] Plants with altered male fertility polypeptide levels and / or activities and / or altered male fertility levels are also provided. In some embodiments, the plants disclosed herein have stably incorporated into their genomes a heterologous male fertility polynucleotide as disclosed herein, or an active fragment or variant thereof. Thus, plants, plant cells, plant parts and seeds are provided, comprising at least one heterologous male fertility polynucleotide set forth in any one of SEQ ID NOs: 1, 2, 4, 7, 42, 43, 44 or 45, or any active fragment or variant thereof.

[0177] Also provided are plants comprising an expression cassette disclosed herein, the expression cassette comprising a male fertility polynucleotide operably linked to a promoter active in a plant. In some embodiments, the expression of the male fertility polynucleotide modulates the male fertility of the plant. In certain embodiments, the expression of the male fertility polynucleotide enhances the male fertility of the plant. For example, provided are plants comprising an expression cassette comprising an Ms1 polynucleotide shown in SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45 operably linked to a constitutive promoter (such as a CaMV 35S promoter), or an active fragment or variant thereof. When the Ms1 polynucleotide is expressed, the male fertility of the plant is enhanced.

[0178] In certain embodiments, an expression cassette is provided to a male sterile plant, the expression cassette comprising a heterologous male fertility polynucleotide or an active fragment or variant thereof operably linked to a promoter active in a plant as disclosed herein. When the heterologous male fertility polynucleotide is expressed, male fertility is conferred; this can be referred to as restoring the male fertility of a plant. In a specific embodiment, a plant disclosed herein comprises an expression cassette having a heterologous male fertility polynucleotide, or an active fragment or variant thereof operably linked to a promoter as disclosed herein, which is stacked with one or more expression cassettes comprising a polynucleotide of interest operably linked to a promoter active in a plant. For example, the stacked polynucleotide of interest may include a male gamete destructive polynucleotide and / or a marker polynucleotide.

[0179] Plants disclosed herein may also include stacked expression cassettes with at least two polynucleotides as described herein, so that the at least two polynucleotides are inherited together in more than 50% of meiosis (i.e., not randomly). Therefore, when a plant or plant cell comprising a stacked expression cassette with two polynucleotides undergoes meiosis, the two polynucleotides are separated into the same daughter (daughter) cell. In this way, the stacked polynucleotides will likely be expressed together in any cell to which they are presented. For example, a plant may include an expression cassette with a male fertility polynucleotide, which is stacked with an expression cassette comprising a male gamete-destructive polynucleotide, so that the male fertility polynucleotide and the male gamete-destructive polynucleotide are inherited together. Specifically, a male sterile plant may include an expression cassette with a male fertility polynucleotide operably connected to a constitutive promoter disclosed herein, which is stacked with an expression cassette comprising a male gamete-destructive polynucleotide operably connected to a male tissue-preferred promoter, so that the plant produces mature pollen grains. However, in such plants, the development of pollen comprising the male fertility polynucleotide will be inhibited by the expression of the male gamete disrupting polynucleotide.

[0180] B. Plants and Introduction Methods

[0181] As used herein, the term "plant" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, intact plant pieces and plant cells in plants or plant parts such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, spikes, cobs, shells, stems, roots, root tips, pollen sacs, grains, etc. As used herein, so-called "grains" means mature seeds produced by commercial growers for purposes other than cultivation or propagation of species. Progeny, variants and mutants of regenerated plants are also included within the scope of the present disclosure, provided that these parts contain the introduced nucleic acid sequences.

[0182] The methods disclosed herein include introducing a polypeptide or polynucleotide into a plant cell. "Introducing" is intended to mean presenting a polynucleotide or polypeptide to a plant in a manner such that the sequence of the polynucleotide or polypeptide is able to enter the interior of the cell. The methods disclosed herein do not rely on a specific method for introducing a sequence into a host cell, as long as the polynucleotide or polypeptide enters the interior of at least one cell of the host. Methods for introducing a polynucleotide or polypeptide into a host cell (i.e., a plant cell) are known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0183] "Stable transformation" is intended to mean that a nucleotide construct introduced into a host (i.e., a plant) is integrated into the genome of the plant and can be inherited by its progeny. "Transient transformation" is intended to mean that a polynucleotide or polypeptide is introduced into a host (i.e., a plant) and transiently expressed.

[0184] Transformation protocols, as well as protocols for introducing polypeptide or polynucleotide sequences into plants, may vary depending on the type of plant or plant cell to be transformed (eg, monocot or dicot). Suitable methods for introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al., U.S. Pat. No. 5,563,055; Zhao et al., U.S. Pat. No. 5,981,840), direct gene transfer (Paszkowski et al., U.S. Pat. No. 5,981,840), and cytotoxicity (Crossway et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606). al. (1984) EMBO J. 3: 2717-2722 (Paszkowski et al., 1984, Journal of the European Molecular Biology Organization, Vol. 3, pp. 2717-2722)) and ballistic particle acceleration (see, for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al., U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244; Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin) (Tomes et al., 1995, "Direct DNA transfer into intact plant cells by microprojectile bombardment," in Plant Cell, Tissue and Organ Culture: Basic Methods, Gamborg and Phillips, eds., Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926; and Lec1 transformation (WO 00 / 28058). See also Weissinger et al. (1988) Ann. Rev. Genet.22:421-477 (Weissinger et al., 1988, Annual Review of Genetics, Vol. 22, pp. 421-477); Sanford et al. (1987) Particulate Science and Technology 5:27-37 (Sanford et al., 1987, "Particle Science and Technology", Vol. 5, pp. 27-37) (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (Christou et al., 1988, "Plant Physiol.", Vol. 87, pp. 671-674) (soybean); McCabe et al. (1988) Bio / Technology 6:923-926 (McCabe et al., 1988, "Biotechnology", Vol. 6, pp. 923-926) (soybean); Finer and McMullen (1991) In Vitro Cell. Dev.Biol.27P:175-182 (Finer and McMullen, 1991, "In Vitro Cell Developmental Biology", Volume 27P, Pages 175-182) (soybean); Singh et al. (1998) Theor.Appl.Genet.96:319-324 (Singh et al., 1998, "Theoretical and Applied Genetics", Volume 96, Pages 319-324) (soybean); Datta et al. (1990) Biotechnology8:736-740 (Datta et al., 1990, "Biotechnology", Volume 8, Pages 736-740) (rice); Klein et al. (1998) Theor.Appl.Genet.96:319-324 (Singh et al., 1998, "Theoretical and Applied Genetics", Volume 96, Pages 319-324) (soybean); Datta et al. (1990) Biotechnology8:736-740 (Datta et al., 1990, "Biotechnology", Volume 8, Pages 736-740) (rice); al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305-4309 (maize); Klein et al. (1988) Biotechnology 6: 559-563 (maize); Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Tomes et al.(1995) "Direct DNA Transfer into Intact Plant Cells Via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1991) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1991) Plant Physiol. 91:440-444 (maize); et al. (1984) Nature (London) 311: 763-764; Bowen et al., U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84: 5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (De Wet et al., 1985, in Experimental Manipulation of Ovule Tissue, Chapman et al., ed., Longman, New York, pp. 197-209) (pollen); Kaeppler et al. (1990) Plant Cell Reports 9: 415-418 and Kaeppler et al. (1992) Theor. Appl. Genet.=Kaeppler et al., 1992, Theoretical and Applied Genetics, vol. 84: 560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-413 (rice); Osjoda et al. (1995) Plant Cell Reports 12: 250-255 (electroporation); Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-413 (rice); et al. (1996) Nature Biotechnology 14:745-750 (maize, transformed by Agrobacterium tumefaciens); all of which are incorporated herein by reference.

[0185] In specific embodiments, a variety of transient transformation methods can be used to provide plants with the male fertility polynucleotides or expression cassettes disclosed herein. Such transient transformation methods include, but are not limited to, directly introducing male fertility polypeptides or variants and fragments thereof into plants, or introducing male fertility transcripts into plants. Such methods include, for example, microinjection or particle bombardment. See, e.g., Crossway et al. (1986) Mol Gen. Genet. 202: 179-185; Nomura et al. (1986) Plant Sci. 44: 53-58; Hepler et al. (1994) Proc. Natl. Acad. Sci. 91: 2176-2180 and Hush et al. (1994) The Journal of Cell Biology. Science 107: 775-784 (Hush et al., 1994, Journal of Cell Science, Vol. 107, pp. 775-784), all of which are incorporated herein by reference. Alternatively, the male fertility polynucleotides or expression cassettes disclosed herein can be transiently transformed into plants using techniques known in the art. Such techniques include the use of viral vector systems, and precipitation of the polynucleotides in a manner that avoids subsequent release of the DNA. Thus, while transcription from particle-bound DNA may still be initiated, the frequency of subsequent integration of such DNA release into the genome is greatly reduced. Such methods include the use of particles coated with polyethyleneimine (PEI, Sigma #P3143).

[0186] In other embodiments, the male fertility polynucleotides or expression cassettes disclosed herein can be introduced into plants by contacting the plants with viruses or viral nucleic acids. Generally, such methods involve incorporating the nucleotide constructs disclosed herein into viral DNA or RNA molecules. It should be recognized that the male fertility sequences disclosed herein can be initially synthesized as part of a viral polyprotein, which can then be processed by in vivo or in vitro proteolysis to produce the desired recombinant protein. Methods for introducing polynucleotides into plants and expressing proteins encoded therein involving viral DNA or RNA molecules are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5: 209-221 (Porta et al., 1996, "Molecular Biotechnology", Vol. 5, pp. 209-221); the above documents are incorporated herein by reference.

[0187] The method for inserting polynucleotides at a specific position in a plant genome is known in the art. In one embodiment, inserting polynucleotides at a desired genome position is achieved using a site-specific recombination system. See, for example, WO99 / 25821, WO99 / 25854, WO99 / 25840, WO99 / 25855 and WO99 / 25853, which are all incorporated herein by reference. In short, polynucleotides disclosed herein may be included in a transfer box having two different recombination sites distributed on the side. Transfer boxes are introduced into a plant that stably incorporates such a target site in its genome, and the target site is distributed with two different recombination sites corresponding to the site of the transfer box on the side. Suitable recombinase is provided, and the transfer box is integrated at the target site. The target polynucleotide is therefore integrated at the specific chromosome position in the plant genome.

[0188] The transformed cells can be grown into plants according to conventional methods. See, for example, McCormick et al. (1986) Plant Cell Reports 5: 81-84. These plants can then be pollinated with the same transformed plant or a different plant, and the resulting progeny have the desired expression of the identified desired phenotypic characteristics. Two or more generations can be grown to ensure that the expression of the desired phenotypic characteristics is stably maintained and inherited, and then seeds are harvested to ensure that the expression of the desired phenotypic characteristics has been achieved. In this way, the present disclosure provides transformed seeds (also referred to as "transgenic seeds") that have stably incorporated into their genomes the male fertility polynucleotides disclosed herein (e.g., the expression cassettes disclosed herein).

[0189] The terms "target site," "target sequence," "target DNA," "target locus," "genomic target site," "genomic target sequence," and "genomic target locus" are used interchangeably herein and refer to a polynucleotide sequence in the genome of a cell at a location in the genome of the cell (including chloroplast and mitochondrial DNA) that induces a double-strand break. The target site may be an endogenous site in the genome of a cell or organism, or the target site may be heterologous to the cell or organism and thus not naturally present in the genome, or the target site may be present in a heterologous genomic location compared to the location present in nature. As used herein, the terms "endogenous target sequence" and "native target sequence" are used interchangeably herein and refer to a target sequence that is endogenous or native to the genome of a cell or organism and is located in the genome of the cell or organism at the endogenous or native location of the target sequence. Cells include plant cells and plants and seeds produced by the methods described herein.

[0190] In one embodiment, the target site associated with the particular gene editing system being used may be similar to a DNA recognition site or target site that is specifically recognized and / or bound by a double-strand break inducing agent, such as but not limited to a zinc finger endonuclease, a meganuclease, a TALEN endonuclease, a CRISPR-Cas guide RNA, or other polynucleotide-guided double-strand break agent.

[0191] The terms "artificial target site" and "artificial target sequence" are used interchangeably herein to refer to a target sequence that has been introduced into the genome of a cell or organism. Such an artificial target sequence may be identical in sequence to an endogenous or native target sequence in the genome of the cell, but may be located at a different position in the genome of the cell or organism (i.e., a non-endogenous or non-native position).

[0192] The terms "altered target site," "altered target sequence," "modified target site," and "modified target sequence" are used interchangeably herein to refer to a target sequence as disclosed herein that includes at least one alteration compared to an unaltered target sequence. Such "alterations" include, for example: (i) replacement of at least one nucleotide, (ii) deletion of at least one nucleotide, (iii) insertion of at least one nucleotide, or (iv) any combination of (i)-(iii). For example, point mutations in msld, msle, mslf, or mslh have been shown to cause male sterility; similar mutations can be directed to occur within the exons of Ms1 to provide alternative alleles that cause male sterility. In addition, multiple mutations can be used in combination.

[0193] Certain embodiments include polynucleotides disclosed herein modified using endonucleases. Endonucleases are enzymes that cleave phosphodiester bonds within polynucleotide chains, and include restriction endonucleases that cleave DNA at specific sites without damaging bases. Restriction endonucleases include type I, type II, type III, and type IV endonucleases, which further include subtypes. In type I and type III systems, both methylase activity and restriction enzyme activity are contained in a single complex.

[0194] Endonucleases also include meganucleases, also known as homing endonucleases (HEases). Similar to restriction endonucleases, HEases bind and cut at specific recognition sites. However, the recognition sites of meganucleases are usually longer, about 18 bp or longer. (See patent publication WO2012 / 129373 filed on March 22, 2012). Based on conserved sequence motifs, meganucleases have been classified into four families (Belfort M, and Perlman P SJ.Biol.Chem.1995; 270: 30237-30240). These motifs are involved in the coordination of metal ions and the hydrolysis of phosphodiester bonds. HEases are notable in that their recognition sites are long and can tolerate certain sequence polymorphisms in their DNA substrates.

[0195] The naming convention for meganucleases is similar to that for other restriction endonucleases. For meganucleases encoded by free-standing ORFs, introns, and inteins, respectively, they are also characterized by the prefixes F-, I-, or PI-. One step in the recombination process involves polynucleotide cleavage at or near the recognition site. This cleavage activity can be used to produce double-strand breaks. For a review of site-specific recombinases and their recognition sites, see Sauer (1994) Curr. Op. Biotechnol. 5: 521-7 (Sauer et al., 1994, "Current Reviews in Biotechnology", Vol. 5, pp. 521-527); and Sadowski (1993) FASEB 7: 760-7 (Sadowski, 1993, "Federation of American Societies for Experimental Biology", Vol. 7, pp. 760-767). In some examples, the recombinase is from the integrase or resolvase family.

[0196] TAL effector nucleases are a class of sequence-specific nucleases that can be used to generate double-strand breaks at specific target sequences in the genome of plants or other organisms (Miller et al. (2011) Nature Biotechnology 29: 143-148). Zinc finger nucleases (ZFNs) are engineered double-strand break inducers consisting of a zinc finger DNA binding domain and a double-strand break inducer domain. Recognition site specificity is conferred by the zinc finger domain, which typically contains two, three or four zinc fingers, for example, having a C2H2 structure; however, other zinc finger structures are also known and have been engineered. Zinc finger domains are readily designed to specifically bind to a selected polynucleotide recognition sequence. ZFNs include an engineered DNA-binding zinc finger domain connected to a non-specific endonuclease domain, such as a nuclease domain from a type II endonuclease (such as FokI). Additional functionality can be fused to the zinc finger binding domain, including transcription activator domains, transcription repressor domains, and methylases. In some examples, dimerization of the nuclease domain is required for cleavage activity. Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3-zinc finger domain recognizes a sequence of 9 consecutive nucleotides; since the nuclease requires dimerization, two sets of zinc finger triplets are used to bind an 18-nucleotide recognition sequence.

[0197] The CRISPR locus (Clustered Regularly Interspaced Short Palindromic Repeats) (also known as SPIDR-SPacer Interspersed Direct Repeats) constitutes a family of recently described DNA loci. The CRISPR locus consists of short and highly conserved DNA repeats (usually 24bp to 40bp, repeated 1 to 140 times, also known as CRISPR repeats), which are partially palindromic. The repeated sequences (usually species-specific) are spaced by variable sequences of constant length (usually 20 to 58, depending on the CRISPR locus (WO2007 / 025097 published on March 1, 2007)).

[0198] The CRISPR locus was first identified in Escherichia coli (Ishino et al. (1987) J. Bacterial. 169:5429-5433; Nakata et al. (1989) J. Bacterial. 171:3553-3556). Similar interspersed short sequence repeats have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (Groenen et al. (1993) Mol. Microbiol. 10: 1057-1065; Hoe et al. (1999) Emerg. Infect. Dis. 5: 254-263; Masepohl et al. (1996) Biochim. Biophys. Acta 1307: 26-30 (Masepohl et al., 1996, "Biochimica et Biophysica Sinica", Vol. 1307, pp. 26-30); Mojica et al. (1995) Mol. Microbiol. 17: 85-93 (Mojica et al., 1995, "Molecular Microbiology", Vol. 17, pp. 85-93)). The CRISPR locus differs from other SSRs in the structure of the repeat sequence, which is also named short regularly interspaced repeats (SRSR) (Janssen et al. (2002) OMICS J. Integ. Biol. 6: 23-33; Mojica et al. (2000) Mol. Microbiol. 36: 244-246).Repeat sequences are short elements that occur in clusters and are usually regularly interspersed by variable sequences of constant length (Mojica et al. (2000) Mol. Microbiol. 36:244-246).

[0199] Cas gene refers to a gene that is usually coupled, associated or close to or near a flanking CRISPR locus. The terms "Cas gene", "CRISPR-related (Cas) gene" are used interchangeably herein. A review of the Cas protein family is presented in Haft et al. (2005) Computational Biology, PLoS Comput Biol 1 (6): e60.doi: 10.1371 / journal.pcbi.0010060 (Haft et al., 2005, "Computational Biology", Mathematics and Computational Biology, Vol. 1, No. 6, p. e60, doi: 10.1371 / journal.pcbi.0010060). As described in the document, in addition to four previously known gene families, 41 CRISPR-related (Cas) gene families are described. The document shows that CRISPR systems belong to different categories, with different repeat sequence patterns, different groups of genes, and different species ranges. The number of Cas genes in a given CRISPR locus can vary from species to species.

[0200] Cas endonucleases refer to Cas proteins encoded by Cas genes, wherein the Cas proteins are capable of introducing double-strand breaks into a DNA target sequence. Cas endonucleases are guided by guide polynucleotides to recognize and optionally introduce double-strand breaks into the cell genome at a specific target site (U.S. Provisional Application 62 / 023239 filed on July 11, 2014). The guide polynucleotide / Cas endonuclease system includes a complex of a Cas endonuclease and a guide polynucleotide capable of introducing double-strand breaks into a DNA target sequence. Cas endonucleases unravel DNA duplexes near the genomic target site, and if the correct protospacer sequence adjacent motif (PAM) is roughly oriented at the 3′ end of the target sequence, then after the guide RNA recognizes the target sequence, the Cas endonuclease cleaves the two DNA chains.

[0201] The Cas endonuclease gene can be a Cas9 endonuclease or a functional fragment thereof, such as, but not limited to, the Cas9 genes listed in SEQ ID NOs: 462, 474, 489, 494, 499, 505, and 518 in WO2007 / 025097 published on March 1, 2007. The Cas endonuclease gene can be a plant, corn, or soybean optimized Cas9 endonuclease, such as, but not limited to, a plant codon optimized Streptococcus pyogenes Cas9 gene, which can recognize any genomic sequence of the form N(12-30)NGG. The Cas endonuclease can be directly introduced into the cell by any method known in the art, such as, but not limited to, transient introduction, transfection, and / or topical administration.

[0202] As used herein, the term "guide RNA" refers to a synthetic fusion of two RNA molecules, crRNA (CRISPR RNA) (which comprises a variable targeting domain) and tracrRNA. In one embodiment, the guide RNA comprises a variable targeting domain of 12 to 30 nucleotide sequences and an RNA fragment that can interact with a Cas endonuclease.

[0203] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can form a complex with a Cas endonuclease and enable the Cas endonuclease to recognize and optionally cleave a DNA target site (U.S. Provisional Application 62 / 023239 filed on July 11, 2014). A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). Optionally, a guide polynucleotide may comprise at least one nucleotide, a phosphodiester bond, or a linkage modification, such as, but not limited to, a locked nucleic acid (LNA), 5-methyldeoxycytosine, 2,6-diaminopurine, 2'-fluoroadenine, 2'-fluorouracil, 2'-O-methyl RNA, a phosphorothioate bond, a connection to a cholesterol molecule, a connection to a polyethylene glycol molecule, a connection to a spacer 18 (hexaethylene glycol chain) molecule, or a 5' to 3' covalent connection resulting in cyclization. A guide polynucleotide comprising only ribonucleic acid is also referred to as a "guide RNA".

[0204] The guide polynucleotide can be a double molecule (also called a duplex guide polynucleotide) comprising a first nucleotide sequence domain complementary to a nucleotide sequence in a target DNA (called a variable targeting domain or VT domain) and a second nucleotide sequence domain (called a Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide. The CER domain of the double-molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region. The two separate molecules can be RNA, DNA, and / or RNA-DNA combination sequences. In some embodiments, the first molecule of a duplex guide polynucleotide comprising a VT domain connected to a CER domain is referred to as "crDNA" (when composed of a continuous DNA nucleotide segment) or "crRNA" (when composed of a continuous RNA nucleotide segment) or "crDNA-RNA" (when composed of a combination of DNA and RNA nucleotides). The cr nucleotides may comprise fragments of cRNA naturally present in bacteria and archaea. In one embodiment, the size of the fragments of cRNA naturally occurring in bacteria and archaea present in the cr nucleotides disclosed herein can range from, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some embodiments, the second molecule of the duplex guide polynucleotide comprising the CER domain is referred to as "tracrRNA" (when consisting of a continuous RNA nucleotide segment) or "tracrDNA" (when consisting of a continuous DNA nucleotide segment) or "tracrDNA-RNA" (when consisting of a combination of DNA and RNA nucleotides). In one embodiment, the RNA of the guide RNA / Cas9 endonuclease complex is a duplex RNA comprising a duplex crRNA-tracrRNA.

[0205] The guide polynucleotide may also be a single molecule comprising a first nucleotide sequence domain complementary to a nucleotide sequence in a target DNA (referred to as a variable targeting domain or VT domain) and a second nucleotide domain that interacts with a Cas endonuclease polypeptide (referred to as a Cas endonuclease recognition domain or CER domain). By "domain" is meant a continuous nucleotide segment that may be an RNA, DNA, and / or RNA-DNA combination sequence. The VT domain and / or CER domain of a single guide polynucleotide may comprise an RNA sequence, a DNA sequence, or an RNA-DNA combination sequence. In some embodiments, a single guide polynucleotide comprises a cr nucleotide (comprising a VT domain connected to a CER domain) connected to a tracr nucleotide (comprising a CER domain), wherein the connection is a nucleotide sequence comprising an RNA sequence, a DNA sequence, or an RNA-DNA combination sequence. A single guide polynucleotide consisting of a sequence from a cr nucleotide and a tracr nucleotide may be referred to as a "single guide RNA" (when consisting of a continuous RNA nucleotide segment) or a "single guide DNA" (when consisting of a continuous DNA nucleotide segment) or a "single guide RNA-DNA" (when consisting of a combination of RNA and DNA nucleotides). In one embodiment of the present disclosure, a single guide RNA comprises a cRNA or a cRNA fragment of a type II / Cas system that can form a complex with a type II Cas endonuclease and a tracrRNA or a tracrRNA fragment, wherein the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to a plant genomic target site, enabling the Cas endonuclease to introduce a double-strand break into the genomic target site. One aspect of using a single guide polynucleotide compared to a duplex guide polynucleotide is that only one expression cassette needs to be prepared to express the single guide polynucleotide.

[0206] The terms "variable targeting domain" or "VT domain" are used interchangeably herein and include a nucleotide sequence that is complementary to one strand (nucleotide sequence) of a double-stranded DNA target site. The percent complementarity between the first nucleotide sequence domain (VT domain) and the target sequence may be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The variable targeting domain may be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a continuous segment of 12 to 30 nucleotides. The variable targeting domain may be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

[0207] The terms "Cas endonuclease recognition domain" or "CER domain" of a guide polynucleotide are used interchangeably herein and include a nucleotide sequence (such as a second nucleotide sequence domain of a guide polynucleotide) that interacts with a Cas endonuclease polypeptide. The CER domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence (see, e.g., modifications described herein), or any combination thereof.

[0208] The nucleotide sequence connecting the cr nucleotides and the tracr nucleotides of the single guide polynucleotide can comprise an RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. In one embodiment, the nucleotide sequence connecting the cr nucleotides and the tracr nucleotides of the single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides. In another embodiment, the nucleotide sequence linking the cr nucleotides and the tracr nucleotides of the single guide polynucleotide can comprise a tetraloop sequence, such as, but not limited to, a GAAA tetraloop sequence.

[0209] The nucleotide sequence modifications of the guide polynucleotide, VT domain and / or CER domain can be selected from, but are not limited to, a 5′ cap, a 3′ poly(A) tail, a riboswitch sequence, a stability control sequence, a sequence that forms a dsRNA duplex, a modification or sequence that targets the guide polynucleotide to a subcellular location, a modification or sequence that provides tracking, a modification or sequence that provides a protein binding site, a locked nucleic acid (LNA), a 5-methyldeoxycytidine nucleotide, a 2,6-diaminopurine nucleotide, a 2′-fluoroadenine nucleotide, a 2′-fluorouracil nucleotide; a 2′-O-methyl RNA nucleotide, a phosphorothioate bond, a linkage to a cholesterol molecule, a linkage to a polyethylene glycol molecule, a linkage to a spacer 18 molecule, a 5′ to 3′ covalent linkage, or any combination thereof. These modifications may result in at least one additional beneficial feature, wherein the additional beneficial feature is selected from modified or regulated stability, subcellular targeting, tracking, fluorescent labeling, binding sites for proteins or protein complexes, modified binding affinity for complementary target sequences, modified resistance to cellular degradation, and increased cellular permeability.

[0210] In certain embodiments, the nucleotide sequence to be modified can be a regulatory sequence, such as a promoter, wherein the editing of the promoter includes replacing the promoter with a different promoter (also referred to as a replacement promoter) or a promoter fragment (also referred to as a replacement promoter fragment) (also referred to as "promoter replacement" or "promoter replacement"), wherein the promoter replacement results in any of the following, or any combination of the following: increased promoter activity, increased promoter tissue specificity, decreased promoter activity, decreased promoter tissue specificity, new promoter activity, inducible promoter activity, expansion of the window of gene expression, changes in the timing of gene expression in the same cell layer or other cell layers, or developmental progression (such as, but not limited to, extending the timing of gene expression in the tapetum of corn pollen sacs; see, e.g., US 5,837,850, published on November 17, 1998), DNA binding element mutations, and / or DNA binding element deletions or additions. The promoter (or promoter fragment) to be modified can be a promoter (or promoter fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell being edited. The replacement promoter (or replacement promoter fragment) can be a promoter (or promoter fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell being edited.

[0211] The promoter element to be inserted may be, but is not limited to, a promoter core element (such as, but not limited to, a CAAT box, a CCAAT box, a Pribnow box, and / or a TATA box), a translational regulatory sequence, and / or an inducible expression repressor system (such as a TET operator repressor / operator / inducer element or a sulfonylurea (Su) repressor / operator / inducer element). The dehydration response element (DRE) was first identified as a cis-acting promoter element in the promoter of the drought response gene rd29A, which contains a 9 bp conserved core sequence TACCGACAT (Yamaguchi-Shinozaki, K., and Shinozaki, K. (1994) Plant Cell 6, 251-264). Inserting a DRE into an endogenous promoter can confer drought-induced expression of downstream genes. Another example is the ABA response element (ABRE), which contains a (C / T)ACGTGGC consensus sequence found in many ABA and / or stress-regulated genes (Busk PK, Pages M. (1998) Plant Mol. Biol. 37: 425-435). Inserting the 35S enhancer or MMV enhancer into an endogenous promoter region will increase gene expression (U.S. Pat. No. 5,196,525). The promoter (or promoter element) to be inserted can be endogenous, artificial, pre-existing, or transgenic to the cell being edited.

[0212] The male fertility polynucleotides and expression cassettes disclosed herein can be used for transformation of any plant species, including but not limited to monocots and dicots. Examples of plant species of interest include, but are not limited to, corn (Zea mays), Brassica species (e.g., B. napus, B. rapa, B. juncea), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., Pennisetum glaucum, Panicum miliaceum, Setaria italica, Eleusine coracana), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (see below for species), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocosnucifera), pineapple (Ananas comosus), citrus (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus caslca), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beet (Beta vulgaris), sugar cane (Saccharum spp.), oats (Avena sativa), barley (Hordeum vulgare), vegetables, ornamentals, grasses, and conifers.

[0213] In a particular embodiment, wheat plants are used in the methods and compositions disclosed herein. As used herein, the term "wheat" refers to any species of the genus Triticum, including its parents and its progeny obtained by hybridization with other species. Wheat includes "hexaploid wheat" and "tetraploid wheat", the former having a genome structure of AABBDD and consisting of 42 chromosomes, and the latter having a genome structure of AABB and consisting of 28 chromosomes. Hexaploid wheat includes common wheat (T.aestivum), spelta (T.spelta), mocha wheat (T.mocha), dense spike wheat (T.compactum), Indian round grain wheat (T.sphaerococcum), Vavilov wheat (T.vavilovii), and their interspecific hybrids. Tetraploid wheat includes T. durum (also known as durum wheat or Triticumturgidum ssp. durum), wild emmer wheat (T. dicoccoides), cultivated emmer wheat (T. dicoccum), Polish wheat (T. polonicum), and their interspecific hybrids. In addition, the term "wheat" includes possible parents of hexaploid or tetraploid Triticum species, such as T. uartu, cultivated emmer wheat (T. monococcum) or wild emmer wheat (T. boeoticum), providing the A genome, Aegilops speltoides, providing the B genome, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii), providing the D genome. The wheat cultivars used in the present disclosure may belong to, but are not limited to, any of the species listed above. Also contemplated are plants produced by sexual crosses using Triticum species as parents with non-Triticum species, such as rye (Secale cereale), including but not limited to triticale, by conventional techniques. In some embodiments, the wheat plants are suitable for commercial production of cereals, such as commercial varieties of hexaploid wheat or durum wheat, having suitable agronomic characteristics known to those skilled in the art.

[0214] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and muskmelon (C. melo). Ornamental plants include azaleas (Rhododendron spp.), hydrangea (Macrophyllahydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnations (Dianthus caryophyllus), poinsettias (Euphorbia pulcherrima), and chrysanthemums.

[0215] Conifers that can be used to practice the methods and compositions of the invention include, for example, pines such as Pinus taeda, Pinus elliotii, Pinus ponderosa, Pinus contorta, and Pinus radiata; Douglas fir (Pseudotsuga menziesii); Tsugacanadensis; Sitka spruce (Picea glauca); Sequoia sempervirens; firs such as Abies amabilis and Abies balsamea; and cedars such as Thuja plicata and Chamaecyparis nootkatensis. In specific embodiments, the plants disclosed herein are crop plants (e.g., corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). Other target plants include cereal plants, oil seed plants and legumes that provide target seeds. Target seeds include cereal seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil seed plants include cotton, soybean, safflower, sunflower, Brassica, corn, alfalfa, palm, coconut, etc. Legumes include kidney beans and peas. Kidney beans include guar beans, locust beans, fenugreek, soybeans, French beans, cowpeas, mung beans, lima beans, broad beans, lentils, chickpeas, etc.

[0216] Typically, an intermediate host cell will be used to implement the methods and compositions disclosed herein to increase the copy number of the cloning vector. As the copy number increases, a large number of vectors containing the target nucleic acid can be isolated for introduction into the desired plant cells. In one embodiment, a plant promoter that does not cause the polypeptide to be expressed in bacteria is used.

[0217] Prokaryotes are most commonly represented by various strains of E. coli; however, other microbial strains may also be used. Commonly used prokaryotic control sequences defined herein include a promoter for transcription initiation (optionally with an operator) and a ribosome binding sequence, including common promoters such as the β-lactamase (penicillinase) promoter system and the lactose (lac) promoter system (Chang et al. (1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel et al. (1980) Nucleic Acids Res. 8:4057) and the lambda-derived PL promoter, and the N-gene ribosome binding site (Shimatake et al. (1981) Nature 292:128). It is also useful to include a selectable marker in the DNA vector transfected into E. coli. Examples of such markers include genes specific for resistance to ampicillin, tetracycline or chloramphenicol.

[0218] The vector is selected so that it can be introduced into an appropriate host cell. Bacterial vectors are usually of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with naked phage vector DNA. If a plasmid vector is used, the bacterial cells are transfected with plasmid vector DNA. Expression systems for expressing proteins disclosed herein using Bacillus sp. and Salmonella (Palva et al. (1983) Gene 22: 229-235; Mosbach et al. (1983) Nature 302: 543-545).

[0219] In some embodiments, expression cassettes disclosed herein or male fertility polynucleotides maintain a hemizygous state in plants. Hemizygous state is a genetic state that exists when there is only one copy of a gene (or genome) and there is no corresponding allele. In certain embodiments, expression cassettes disclosed herein include a first promoter operably connected to male fertility polynucleotides, which are stacked with male gamete destructive polynucleotides operably connected to male tissue preferred promoters, and such expression cassettes are introduced into male sterile plants in a hemizygous state. When male fertility polynucleotides are expressed, because male fertility polynucleotides restore the plant to a fertile state, the plant can successfully produce mature pollen grains. In view of the fact that the expression cassette is in a hemizygous state, only some daughter cells will inherit the expression cassette during pollen grain formation. Due to the preferred expression of male tissues of the encoded male gamete destructive gene products stacked, the daughter cells that have inherited the expression cassettes comprising male fertility polynucleotides will not develop into mature pollen grains. Those pollen grains that do not inherit the expression cassette will continue to develop into mature pollen grains and be functional, but they will not contain the male fertility polynucleotide of the expression cassette and therefore will not pass the male fertility polynucleotide to progeny through pollen.

[0220] V. Modulating the concentration and / or activity of male fertility polypeptides

[0221] Provided are methods for regulating the concentration and / or activity of the male fertility polypeptides disclosed herein in plants. The terms "affect" or "regulate" used herein for the concentration and / or activity of male fertility polypeptides refer to any increase or decrease in the concentration and / or activity of male fertility polypeptides when compared to an appropriate control. Generally speaking, the concentration and / or activity of the male fertility polypeptides disclosed herein are increased or decreased by at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% relative to control plants, plant parts or cells. The regulation disclosed herein can be performed before, during and / or after the plant grows to a specific developmental stage. In a specific embodiment, the male fertility polypeptides disclosed herein are regulated in monocots (particularly wheat).

[0222] A variety of methods can be used to measure the concentration and / or activity of male fertility polypeptides. For example, the expression level of male fertility polypeptides can be measured directly (i.e., Western blotting or Northern blotting) by measuring the level of male fertility polypeptides or RNA in plants, or indirectly measured by measuring the male fertility activity of male fertility polypeptides in plants. Methods for measuring male fertility activity are described elsewhere herein or are known in the art. In specific embodiments, the regulation of male fertility polypeptide concentration and / or activity includes the regulation of the level of male fertility polypeptides in plants (i.e., increase or decrease). The method for measuring the level and / or activity of male fertility polypeptides is known in the art and is discussed elsewhere herein. In other embodiments, the level and / or activity of male fertility polypeptides in vegetative tissues, in reproductive tissues, or in both vegetative tissues and reproductive tissues are regulated.

[0223] In one embodiment, the activity and / or concentration of male fertility polypeptides are increased by introducing polypeptides or corresponding male fertility polynucleotides into plants. Subsequently, plants with introduced male fertility sequences are selected using methods known to those skilled in the art, such as but not limited to Southern blot analysis, DNA sequencing, PCR analysis or phenotypic analysis. In certain embodiments, marker polynucleotides are introduced together with male fertility polynucleotides to help select plants with or lacking male fertility polynucleotides disclosed herein. Plants or plant parts that have been changed or modified by the aforementioned embodiments are cultivated under conditions that form plants to be sufficient to regulate the concentration and / or active time of male fertility polypeptides in the plant. Conditions that form plants are well known in the art.

[0224] As discussed elsewhere herein, many methods for providing polypeptides to plants are known in the art, including but not limited to introducing the polypeptide directly into the plant, or introducing a polynucleotide construct encoding a male fertility polypeptide into the plant (transiently or stably). It should also be recognized that the methods disclosed herein may employ polynucleotides that are not capable of directing the expression of proteins or RNA in transformed plants. The level and / or activity of the male fertility polypeptide may be increased, for example, by altering the gene encoding the male fertility polypeptide or its promoter. See, for example, U.S. Pat. No. 5,565,350 to Kmiec; Zarling et al., PCT / US93 / 03868. Thus, a mutagenized plant carrying a mutation in a male fertility gene is provided, wherein the mutation regulates the expression of the male fertility gene or regulates the activity of the encoded male fertility polypeptide.

[0225] In certain embodiments, the concentration and / or activity of a male fertility polypeptide is increased by introducing into a plant an expression cassette comprising a male fertility polynucleotide as disclosed elsewhere herein (e.g., SEQ ID NO: 1, 2, 4, 7, 42, 43, 44 or 45, or an active fragment or variant thereof). The male fertility polynucleotide may be operably linked to a promoter that is heterologous to the plant or native to the plant. By increasing the concentration and / or activity of the male fertility polypeptide in the plant, the male fertility of the plant is also increased. Thus, the male fertility of a plant may be increased by increasing the concentration and / or activity of the male fertility polypeptide. For example, male sterile plants may be restored to male fertility by increasing the concentration and / or activity of the male fertility polypeptide.

[0226] It should also be recognized that the level and / or activity of the polypeptide can be regulated by using polynucleotides that are not capable of directing the expression of proteins or RNA in transformed plants. For example, the polynucleotides disclosed herein can be used to design polynucleotide constructs that can be used in methods for changing or mutagenizing genomic nucleotide sequences in organisms. Such polynucleotide constructs include, but are not limited to, RNA: DNA vectors, RNA: DNA mutation vectors, RNA: DNA repair vectors, mixed duplex oligonucleotides, self-complementary RNA: DNA oligonucleotides, and oligonucleotides that cause recombination. Such nucleotide constructs and methods of use are known in the art. See U.S. Patents 5,565,350, 5,731,181, 5,756,325, 5,760,012, 5,795,972, and 5,871,984, all of which are incorporated herein by reference. See also WO 98 / 49350, WO 99 / 07865, WO 99 / 25821 and Beetham et al. (1999) Proc. Natl. Acad. Sci. USA 96:8774-8778, the contents of which are incorporated herein by reference. In some embodiments, virus-induced gene silencing can be used; see, e.g., Ratcliff et al. (2001) Plant J. 25:237-245; Dinesh-Kumar et al. (2003) Methods Mol. Biol. 236:287-294; Lu et al. (2003) Methods 30:296-303; Burch-Smith et al. (2006) Plant J. 25:237-245; Dinesh-Kumar et al. (2003) Methods Mol. Biol. 236:287-294; Lu et al. (2003) Methods 30:296-303; Burch-Smith et al. (2006) Plant J. 25:237-245; Dinesh-Kumar et al. (2003) Methods Mol. Biol. 236:287-294; Lu et al. (2003) Methods 30:296-303; Burch-Smith et al. (2006) Plant J. 25:237-245; Dinesh-Kumar et al. (2003) Methods Mol. Biol. 236:287-294; Lu et al. (2003) Methods 30:296-303; Burch-Smith et al. (2006) Plant J. 25:237-245; Physiol. 142: 21-27 (Burch-Smith et al., 2006, Plant Physiology, Vol. 142, pp. 21-27)). It should be appreciated that the methods disclosed herein do not rely on the incorporation of the entire polynucleotide into the genome, but only on the introduction of the polynucleotide into the cell so that the plant or its cells are altered.

[0227] In other embodiments, the level and / or activity of the polypeptide is modulated by methods that do not require introduction of the polynucleotide into the plant, such as by exogenous application of dsRNA to the surface of the plant; see, e.g., WO 2013 / 025670.

[0228] In one embodiment, the genome can be altered after the polynucleotide is introduced into the cell. For example, the polynucleotide or any portion thereof can be incorporated into the genome of the plant. The alteration of the genome disclosed herein includes, but is not limited to, the addition, deletion and substitution of nucleotides in the genome. Although the methods disclosed herein do not rely on the addition, deletion and substitution of any specific number of nucleotides, it should be recognized that such addition, deletion or substitution comprises at least one nucleotide.

[0229] VI. Definitions

[0230] The term "allele" refers to one of two or more different nucleotide sequences occurring at a particular genetic locus.

[0231] The term "amplification" in the context of nucleic acid amplification is any process in which additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. Typical amplification methods include various polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., by transcription) methods.

[0232] A "BAC" or bacterial artificial chromosome is a cloning vector derived from the naturally occurring F factor of E. coli, which itself is a DNA element that can exist as a circular plasmid or can be integrated into the bacterial chromosome. A BAC can accept larger DNA sequence insertions.

[0233] Centimorgan ("cM") is a unit of measure of recombination frequency. One cM equals a 1% probability that a marker at one locus will segregate with a marker at a second locus due to hybridization in one generation.

[0234] A "chromosome" is a coiled stretch of DNA containing many genes that function and move as a unit during cell division and can therefore be said to be linked. A "chromosome" can also be called a "linkage group."

[0235] "Gene map" is a description of the gene linkage relationship between the loci on one or more chromosomes (or linkage groups) in a given species, generally described in a diagram or table form. For each gene map, the distance between the loci is measured by the frequency (that is, their recombination frequency) of their alleles occurring together in the population. Utilizing DNA or protein markers or observable phenotypes, alleles can be detected. Gene map is the product of the polymorphic potential of each marker between the population of mapping, the type of marker used and different populations. The genetic distance between the loci of a gene map and another gene map can be different. However, a map can be associated with the information of another map using a common marker. Those of ordinary skill in the art can use a common marker position to identify the position of the target marker and other loci on each individual gene map. The order of the loci should be constant between the maps, but due to, for example, the difference, new mutation or experimental error of the statistical method for detecting alternative repeat loci in different populations, the statistical method for sorting markers, there is often a small change in the order of markers.

[0236] A "genetic map position" is the position on a genetic map relative to surrounding genetic markers on the same linkage group where a given marker can be found in a given species.

[0237] "Gene mapping" is a process of defining the linkage relationships of genetic loci using standard genetic principles of genetic markers, population segregation of markers, and recombination frequencies.

[0238] "Genetic marker" is a polymorphic nucleic acid in a population, and wherein their alleles can be detected and distinguished by one or more analytical methods, such as RFLP, AFLP, isozymes, SNP, SSR, HRM, etc. The term also refers to a nucleic acid sequence complementary to a genomic sequence, such as a nucleic acid used as a probe. The marker corresponding to the genetic polymorphism between population members can be detected by the established methods in the art. These methods include, for example, sequence-specific amplification methods based on PCR, restriction fragment length polymorphism detection (RFLP), isozyme marker detection, polynucleotide polymorphism detection by allele-specific hybridization (ASH), amplification variable sequence detection of plant genomes, autonomous sequence replication detection, simple repeat sequence detection (SSR), single nucleotide polymorphism detection (SNP) or amplified fragment length polymorphism detection (AFLP). The established method is also known for detecting expressed sequence tags (EST) and SSR markers derived from EST sequences and randomly amplified polymorphic DNA (RAPD).

[0239] "Genome" refers to the total DNA or complete set of genes carried by a chromosome or set of chromosomes.

[0240] The term "genotype" is the genetic makeup of an individual (or group of individuals) defined by the alleles of one or more known loci that the individual inherits from its parents. More generally, the term "genotype" can be used to refer to the genetic makeup of all genes in an individual's genome.

[0241] A "locus" is a position on a chromosome, eg, where a nucleotide, gene, sequence, or marker is located.

[0242] "Mark" is to find the position on a gene or physical map or to find the means of linkage between a mark and a trait locus (the locus that affects trait). The position detected by the mark can be known by detecting polymorphic alleles and gene mapping thereof, or by hybridizing, sequence matching or amplification of the sequence that has been physically mapped. The mark can be a DNA marker (detecting DNA polymorphism), a protein (detecting the variation of the encoded polypeptide) or a simple genetic phenotype (such as a "waxy" phenotype). DNA markers can be developed by genomic nucleotide sequence or expressed nucleotide sequence (for example, by RNA or cDNA of splicing). According to DNA marker technology, the mark will be composed of complementary primers of the locus described in the side joint or complementary probes hybridized with the polymorphic alleles at the locus. DNA markers, or genetic markers, can also be used to describe genes, DNA sequences or nucleotides (rather than components for detecting genes or DNA sequences) on its own chromosome, and are often used (for example, for the mark of breast cancer) when the DNA marker is associated with the specific traits in human genetics. The term marker locus refers to the locus (gene, sequence or nucleotide) detected by the marker.

[0243] The markers for detecting genetic polymorphisms between population members are established in the art. The markers can be limited by the type of polymorphism detected by it and the marker technology for detecting the polymorphism. The marker types include, but are not limited to, for example, restriction fragment length polymorphism detection (RFLP), isozyme marker detection, randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism detection (AFLP), simple repeat sequence detection (SSR), amplification variable sequence detection of plant genome, autonomous sequence replication detection or single nucleotide polymorphism detection (SNP). SNP can be detected by the following method: for example DNA sequencing, sequence-specific amplification method based on PCR, detection of polynucleotide polymorphism by allele-specific hybridization (ASH), dynamic allele-specific hybridization (DASH), competitive allele-specific polymerase chain reaction (KASPar), molecular beacons, microarray hybridization, oligonucleotide ligase assay, Flap endonuclease, 5' endonuclease, primer extension, single-stranded conformation polymorphism (SSCP) or temperature gradient gel electrophoresis (TGGE). DNA sequencing (such as pyrosequencing techniques) has the advantage of being able to detect a series of linked SNP alleles that make up a haplotype. Haplotypes tend to be more informative (detect higher levels of polymorphism) than SNPs.

[0244] A "marker allele" or an "allele detected by a marker" or an "allele at a marker locus" may refer to one or more polymorphic nucleotide sequences found at a marker locus in a population.

[0245] A "marker locus" is a specific chromosomal location in the genome of a species detected by a specific marker. The marker locus can be used to track the presence of a second linked locus, such as a locus that affects the expression of a phenotypic trait. For example, a marker locus can be used to monitor the separation of alleles at a genetically or physically linked locus, such as a QTL.

[0246] "Label probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of an allele at a marker locus by nucleic acid hybridization, such as a nucleic acid probe that is complementary to a marker locus sequence. A label probe comprising 30 or more consecutive nucleotides ("all or part" of a marker locus sequence) of a marker locus can be used for nucleic acid hybridization. Alternatively, in some aspects, a label probe refers to any type of probe that can distinguish (i.e., genotype) a specific allele present at a marker locus. When nucleic acids are specifically hybridized or paired in a solution, such as hybridized or paired according to the Watson-Crick base pairing principle, nucleic acids are "complementary".

[0247] As mentioned above, when identifying the connection locus, the term "molecular marker" can be used to refer to a genetic marker as defined above, or a coded product (e.g., protein) thereof as a reference point. The marker can be derived from a genomic nucleotide sequence or from an expressed nucleotide sequence (e.g., RNA, cDNA, etc. derived from splicing), or from a coded polypeptide. The term also refers to a nucleic acid sequence complementary to a marker sequence or a flanking marker sequence, such as a nucleic acid used as a probe or a primer pair capable of amplifying a marker sequence. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, such as a nucleic acid probe complementary to a marker locus sequence. Alternatively, in some aspects, a molecular probe refers to any type of probe that can distinguish (i.e., genotyping) a specific allele present at a marker locus. When nucleic acid specifically hybridizes in a solution, such as hybridizing according to the Watson-Crick base pairing principle, nucleic acid is "complementary". When some markers described herein are located in an insertion-deletion region, these markers are also referred to as hybridization markers. This is because, by definition, the insertion region is a polymorphism about a plant without insertion. Therefore, the marker only needs to indicate whether the insertion-deletion region exists. Any suitable marker detection technology can be used to identify such hybridization markers, for example SNP technology is used in the examples provided herein.

[0248] A "physical map" of a genome is a map showing the linear order of identifiable landmarks (including genes, markers, etc.) on chromosomal DNA. However, in contrast to a genetic map, the distances between landmarks are absolute (e.g., measured in base pairs or isolated and overlapping contiguous gene fragments) and are not based on genetic recombination (which may vary in different populations).

[0249] "Plant" can be a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term "plant" can refer to any of the following: a whole plant, a plant component or organ (e.g., leaves, stems, roots, etc.), a plant tissue, a seed, a plant cell, and / or their progeny. A plant cell is a plant cell obtained from a plant or a culture derived from a cell obtained from a plant.

[0250] A "polymorphism" is a variation in DNA between two or more individuals within a population. A polymorphism preferably has a frequency of at least 1% in a population. Available polymorphisms may include single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs), or insertion / deletion polymorphisms, also referred to herein as "indels."

[0251] A "reference sequence" or "consensus sequence" is a defined sequence used as a basis for sequence comparison.

[0252] Table 1. Summary of SEQ ID NOs

[0253]

[0254]

[0255] As used herein, the articles "a" and "an" refer to one or more than one (ie, to at least one) of the grammatical object of the article. By way of example, "an element" means one or more elements.

[0256] All publications and patent applications mentioned in this specification are indicative of the levels of those skilled in the art to which the disclosure pertains, and all such publications and patent applications are herein incorporated by reference as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0257] Although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.

[0258] Example

[0259] The following examples are provided to illustrate, but not to limit the appended claims. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and those skilled in the art will recognize that various reagents or parameters can be changed without departing from the spirit of the present invention or the scope of the appended claims.

[0260] Example 1: Gene mapping of Ms1

[0261] This example demonstrates that the causal locus for the male sterility phenotype of wheat msl can be mapped to a 1 cM region on the short arm of chromosome 4 of the B genome by using recombinant mapping populations of wild-type and male sterile wheat.

[0262] Male sterile (msms) heteroplasmic wheat (variety Chris) carrying the FS2 mutant gene (also known as msld) was crossed with plants of variety Gladius to generate an F2 mapping population. Based on alignment with wheat chromosome 4AL (Hernandez et al. 2011. Plant Journal 69(3):377-386), barley chromosome 4HS (Mayer et al. 2011. Plant Cell 23(4):1249-1263), Brachypodium chromosome 1, and rice chromosome 3 or bin mapping wheat ESTs (Sorrells et al., 2003 Genome Research 13:1818-1827; La Rota & Sorrells, 2004 Funct Integr Sequences in the Ms1 region on chromosome 4BS were identified by synteny with the synteny of the 100 sequences in La Rota and Sorrells, 2004, Functional Genomics and Integrative Genomics, Vol. 4, pp. 34-46. Corresponding wheat sequence contigs from reference synthetic sequences (e.g., barley SNP marker 11_21056, SEQ ID NO: 10 represents its reference sequence) or bin-mapped ESTs (e.g., BF292015, SEQ ID NO: 14 represents its reference sequence) were identified by BLAST as chromosome 4BS-derived IWGSC (International Wheat Genome Sequencing Consortium) research assembly sequences (Mayer, 2014 Science 345(6194): 1251788). IWGSC contigs were developed for high-resolution melting (HR) markers or insertion site based polymorphism (ISBP-HRM) markers. ISBP-HRM primers were designed using the ISBP Finder tool (Paux et al., 2010 Plant Biotechnology Journal 8: 196-210).

[0263] Polymerase chain reaction (PCR) amplifications were performed using DNA from the parents of the mapping population, the 4B null chromosome line, and the radiation-induced deletions Probus and Cornerstone. Because genetic and physical mapping studies have shown that Cornerstone and Probus may differ in the size of terminal deletions and the extent of telomere repair, comparative analyses were performed to identify Ms1 flanking markers (Barlow & Driscoll (1981) Genetics. 98(4): 791-799; Zhong-an & Darvey (1999) Acta Agriculturae Boreali-Occidentalis Sinica. cnki: ISSN: 1004-1389.0.1999-04-006). Primers flanking Ms1 were determined experimentally by the lack of a PCR product with the following characteristics: the DNA from chromosome 4B was missing and homozygous for the radiation-induced deletion mutant Cornerstone, but appeared homozygous for the radiation-induced deletion mutant Probus. HRM markers that met the above criteria were used for mapping.

[0264] Phenotypic analysis of genetic male sterility was performed by securely covering at least three ears per plant with sealed white paper bags before anthesis, and then determining a quantitative fertility score by counting the number of florets per ear and the number of seeds per ear and expressing the score as the number of seeds formed per floret.

[0265] First, 509 F2 individuals were screened with markers identified as flanking the Ms1 region on chromosome 4BS and showing polymorphism between Chris and Gladius. The F2 individuals were evaluated for genetic male sterility in terms of phenotype using the aforementioned process. 21 recombinants were identified, and the Ms1 locus was found to be located between HRM marker 21056 (SEQ ID NO: 11 is a reference sequence) and BF292015 (SEQ ID NO: 15 is a reference sequence). HRM marker 21056 and BF292015 were designated as 4BS-derived IWGSC sequence contigs lcl | 4BS_4947956 and lcl | 4BS_4925422, respectively (Mayer, 2014 Science 345 (6194): 1251788 (Mayer, 2014, Science, Vol. 345, No. 6194, p. 1251788)). The region was determined to cover a genetic distance of 14 cM on a 90K consensus map.

[0266] Then a marker was formed in the region between marker 21056 and BF292015 and tested for association with a genetic male sterility phenotype. A consensus wheat single nucleotide polymorphism (SNP) map of 9K (Cavanagh et al. 2013 PNAS 110: 8057-8062) was used to identify sequences containing SNPs and corresponding IWGSC contigs in the Ms1 region genetically located on the short arm of chromosome 4BS in wheat (Mayer 2014. Science 345 (6194): 1251788). Sequences containing SNPs or chromosome 4BS-derived IWGSC contigs were developed for HRM markers or insertion site-based polymorphism (ISBP-HRM) markers. A total of 3000 F2 individuals were screened, 54 recombinants were identified, and the region containing Ms1 was narrowed down to the region defined by markers wsnp_Ex_c18318_27140346 (SEQ ID NO: 18 is the reference sequence) and wsnp_Ku_c7153_12360198 (SEQ ID NO: 21 is the reference sequence). Markers wsnp_Ex_c18318_27140346 and wsnp_Ku_c7153_12360198 correspond to 4BS-derived IWGSC sequence contigs lcl|4BS_4920499 and lcl|4BS_4954867, respectively (Mayer, 2014 Science 345(6194): 1251788). According to the 9K consensus wheat SNP map, this region spans a genetic interval of 0.5 cM.

[0267] Example 2: Identification of 4BS BACs for Ms1 sequencing

[0268] Using synteny with Brachypodium and rice, 18 probes were designed within a 0.5 cM region defined by markers wsnp_Ex_c18318_27140346 (SEQ ID NO: 18) and wsnp_Ku_c7153_12360198 (SEQ ID NO: 21). Probes were designed to be non-repetitive based on BLAST analysis of the target sequence. The probes were then PCR amplified and separated by agarose gel electrophoresis, and fragments of the desired size were eluted from the gel using a Qiaquick Gel Extraction kit (Qiagen, Germantown, Md., USA). PCR fragments were combined to equimolar concentrations and then radiolabeled with 32P-dATP using a NEBlot kit (New England Biolabs) using the manufacturer's protocol. The labeled probes were purified in Sephadex G50 columns (GE Healthcare) and denatured at 100°C for 10 minutes. 28 high density BAC clone colony filters hybridized to Hybond N+ nylon membranes (GE Healthcare, Piscataway, NJ, USA) were used for hybridization. This represents coverage of the 5.1-genome equivalent from durum wheat variety Langdon (Cenci et al. 2003. Theor Appl Genet 107(5):931-9). For prehybridization, the following process was done at 65°C in a rotating glass tube: the colony filter was incubated overnight in a hybridization solution (2×SSPE, 0.5% SDS, 5×Denhardt's reagent (Sambrook & Russel (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, NY, USA), 40 μg / ml salmon sperm DNA). The labeled probe was mixed with 5 ml of the hybridization solution and the colony filter was incubated overnight at 65°C. To remove unbound probe, the filter was washed twice in a washing solution containing 2×SSPE and 0.5% SDS and rinsed with 1×SSC. The washed filter was exposed to X-ray film for one to three days depending on the signal intensity to identify positive clones. (2011)Journal ofBiomedicine and Biotechnology.http: / / dx.doi.org / 10.1155 / 2011 / 302543( 2011, Journal of Biomedicine and Biotechnology, http: / / dx.doi.org / 10.1155 / 2011 / 302543). These probes identified a public BAC spanning the Ms1 region.

[0269] BACs showing positive signals were isolated from the plate. Restriction mapping, PCR experiments using primers corresponding to the markers used above, and sequences obtained from the ends of each BAC were used to determine the order of BACs covering the target region. Three BACs (accounting for 251 kB) spanning the Ms1 region were selected from the Langdon library for sequencing. In addition, proprietary BACs were sequenced to cover the key region. Standard shotgun sequencing techniques were used to sequence these BACs, and the sequences were assembled using the Phred / Phrap / Consed software package (Ewing et al. (1998) Genome Research, 8: 175-185 (Ewing et al., 1998, "Genome Research", Vol. 8, pp. 175-185). After assembly, according to the mapping data, the sequences that were considered to be located closest to the locus in the region were annotated, meaning possible gene coding regions and regions representing repeat elements were inferred. The fGenesH software package (Softberry, Mount Kisco, New York, USA) was used to search for genes in coding regions.

[0270] Example 3: Identification of candidate Ms1 genes

[0271] By mapping cDNA from wheat root, leaf and anther tissues, 10 potential coding regions were detected within the 251 kB sequence. Table 2 provides the physical locations of these 10 possible coding sequences and their putative peptide functions.

[0272] Table 2.

[0273]

[0274] Of these 10 open reading frames, three encoded polypeptides with similarity to nonspecific lipotransfer protein (nsLTP) (Edstam et al., 2014 Physiologia Plantarum doi: 10.1111 / ppl.12156) were identified. When examining the anther transcripts from male sterile homozygous msl Cornerstone plants, no cDNA corresponding to SEQ ID NO: 4 was observed. The lack of transcripts from SEQ ID NO: 4 suggests a close association between the msl sterility phenotype and this cDNA. This specific sequence is predicted to encode a glycosylphosphatidylinositol (GPI) anchored nsLTP (LTPG) polypeptide (SEQ ID NO: 5 is the amino acid sequence of the encoded protein), and this specific sequence has been named TaLTPG1, also known as Ms1.

[0275] Analysis of the Ms1 polypeptide (SEQ ID NO: 5) indicated that the signal peptide was located at positions 1-23; the LTP domain was located at positions 24-108; and the GPI anchor domain was located at positions 195- 220. Structural modeling using the primary polypeptide sequence indicated that a hydrophobic pocket formed within the LTP domain by a disulfide bond (Cys-Cys) might bind fatty acids, while the GPI anchor domain was predicted to anchor TaLTPG1 to the cell surface.

[0276] The primary polypeptide sequence encoded by the C-terminus directly connected to the signal peptide through 12 amino acids passing through the LTP domain (i.e., position 24 to position 120) was used in a Protein Homology / analogY Recognition Engine V2.0 (Phyre2; Kelley et al. (2015) Nature Protocols 10:845-858) search for appropriate crystal structure templates. The search identified the dirl protein (pdb: c2rknA) with 29% identity at 96% confidence. A 48-residue portion of the used Ms1 polypeptide sequence was modeled with 96.2% confidence for the template c2rknA.

[0277] The hydrophobic pocket formed by disulfide bonds within the LTP domain was detected by a combination of the fpocket2 program (Schmidtke et al., (2011) Bioinformatics 27(23): 3276-3285) and 3DLigandSite (3DLigandSite: Predicting ligand binding sites using similar structures (Wass et al. (2010) Nucleic Acids Res. 38: W469-73). The structural models of Ms1, mslf and mslh were visualized and annotated using a standard pdb viewer with surface hydrophobicity and calculated using the Colony method. The structures of the LTP domains of the msld, msle, mslf and mslh mutants were analyzed using the same techniques used to determine the hydrophobic pocket and knowledge of the importance of disulfide bonds in tertiary conformation (see, e.g., José-Estanyol et al. (2004) Plant Physiology and Biochemistry 42: 355-365).

[0278] Prediction of GPI anchor domains and cell surface aggregation inferred from the BIG-PI plant predictor (Eisenhaber et al. (2003) Plant Physiology 133(4): 1691-701)

[0279] Example 4: Isolation and sequence of wheat mutant msl alleles

[0280] The full-length coding sequence of TaLTPG1 from chromosome 4BS was PCR amplified using a high-fidelity proofreading enzyme (Klindworth et al. 2002. Crop Sci. 42: 1447-1450) from genomic DNA isolated from the male-sterile homozygous ethyl methanesulfonate (EMS)-induced mutants msld, msle, and mslf, as well as the wild-type (Ms1) male fertile genotype (cultivar Chris). Both strands of the PCR amplicons were sequenced using standard Sanger sequencing techniques for GC-rich products. Comparison of the obtained msl and Ms1 Sanger sequencing chromatograms showed that there was a SNP ( Figure 2 , Figure 3 ). Sequence analysis predicted that protein function was disrupted in each of these mutants.

[0281] When compared to the wild-type Ms1 genomic DNA sequence (SEQ ID NO: 7), msld exhibits a SNP at position 1856 (G1856A). This SNP is predicted to eliminate the first exon / intron splice junction, leading to read-through of a premature stop codon within the first intron, thereby eliminating the conserved C-terminal GPI anchor domain within the encoded polypeptide.

[0282] When compared to the wild-type Ms1 genomic DNA sequence (SEQ ID NO: 7), msle exhibits a SNP at position 2962 and a 1 bp deletion (G2962A, C2963del) at position 2963. The 1 bp deletion in msle is predicted to cause a frameshift within the encoded polypeptide and elimination of the conserved C-terminal GPI anchor domain.

[0283] When compared to the wild-type Ms1 genomic DNA sequence (SEQ ID NO: 7), mslf exhibits a SNP at position 1682 (G1682A). This SNP is predicted to convert a conserved cysteine ​​to a tyrosine (C52Y) within the encoded wild-type Ms1 polypeptide (SEQ ID NO: 5). This amino acid change is predicted to disrupt the tertiary conformation of the mature protein mediated by disulfide bonds.

[0284] When compared to the wild-type Ms1 genomic DNA sequence (SEQ ID NO: 7), mslh exhibits a SNP at position 1705 (G1705A). This SNP is predicted to convert aspartic acid to asparagine within the encoded wild-type Ms1 polypeptide (SEQ ID NO: 5). This amino acid change is predicted to disrupt the function or activity of the encoded Ms1 polypeptide.

[0285] Example 5: Cytological and metabolite analysis of Ms1 and ms1 pollen

[0286] Cytological examination of msl anthers revealed fragmented spheroids localized on the surface of tapetal cells and collapsed pollen with defective exine architecture and ornamentation. Metabolic analysis of fertile and sterile anthers revealed accumulation of C16-C22 fatty acids, consistent with a role for Ms1 in sporopollenin biosynthesis and / or transport to developing microspores.

[0287] Cytology

[0288] For transmission electron microscopy (TEM) or scanning electron microscopy (SEM), sterile (msld) and fertile (Ms1) mature pollen sacs from the late meiotic period were fixed to dicellular pollen. TEM samples were infiltrated with 3% glutaraldehyde in phosphate buffered saline (PBS) at pH 7.4 for 16 hours at 4°C, while SEM samples were infiltrated with 4% paraformaldehyde, 1.25% glutaraldehyde and 4% sucrose in phosphate buffered saline (PBS) at pH 7.4 for 16 hours at 4°C. TEM samples were slowly infiltrated with LR White Resin and embedded in gelatin capsules. SEM samples were rinsed twice with PBS pH 7.4 for 5 minutes each, and then dehydrated for 60 minutes using a series of graded ethanol solutions (30%, 50%, 70%, 85%, 90% and 95%). SEM samples were then infiltrated 3 times in 100% ethanol for 60 minutes each. Ultrathin sections of 70 nm were prepared on an ultramicrotome (EM UC6, Leica, Germany), mounted on copper grids and stained with 4% aqueous uranyl acetate followed by lead citrate according to Bozzola and Russell 1999 (Specimen staining and contrast methods for transmission electron microscopy. Electron microscopy: Principles and techniques for biologists. The Jones and Bartlett Series in Biology, pp. 120-147. Jones and Bartlett Publishers, Boston, MA, USA). Ultrathin sections were observed and images were collected using a TEM (Philips CM100, The University of Adelaide microscopy) at an accelerating voltage of 80 kV. SEM samples were cut and then critical point dried and sputter coated with platinum (BalTec CPD030 Critical Point Dryer).SEM observation and image acquisition were performed at an accelerating voltage of 10 kV (Philips XL20 SEM, EDAX EDS, The University of Adelaide microscopy).

[0289] Glycophosphatidylinositol (GPI)-anchored lipid transfer proteins are often required for the accumulation or export of cuticular waxes onto the surface of stems and siliques. (Borner et al. (2003) Plant Physiology 132: 568-577; Kim et al. (2012) Plant and Cell Physiology 53: 1391-1403) The exocuticular wax has the same lipid precursor as sporopollenin, the major component of the pollen exine, which is produced in the sporophytic tissue of the pollen sac and transported to the developing microspores in a structure called a spheroid. Analysis of sterile msld pollen sacs by TEM and SEM revealed localized spheroids on the surface of broken tapetum cells and collapsed pollen with defective exine structure and ornamentation compared to fertile Ms1 pollen sacs.

[0290] Metabolite analysis

[0291] Pollen sacs were isolated from two sterile (msld / msld) and one fertile (Ms1 / Ms1) plants at three developmental stages (early meiosis to late mononuclear stage), including three biological replicates, and snap frozen on dry ice. The composition and quantity of chloroform-extractable waxes were analyzed using gas chromatography-mass spectrometry (GC-MS). (Jung et al. (2006) Plant Cell 18: 3015-3032 (Jung et al., 2006, Plant Cell, Vol. 18, pp. 3015-3032) The extracts were treated with the transesterification reagent Meth-Prep II to derive fatty acids and compared with sample spiked fatty acid standards.

[0292] Analysis of sterile msld anthers versus fertile Ms1 anthers at three developmental stages revealed a more than two-fold increase in palmitic acid (C16:0), palmitoleic acid (C16:1), oleic acid (C18:1n9c), elaidic acid (C18:1n9t), linoleic acid (C18:2n6c), gamma-linoleic acid (C18:3n6), alpha-linoleic acid (C18:3n6), arachidic acid (C20:0), eicosenoic acid (C20:1), eicosadienoic acid (C20:2), and docosanoic acid (C22:0). The increase in long-chain (C16-C22) fatty acids in the mutant anthers is typical of a disruption in sporopollenin biosynthesis and / or its transport to the developing microspores.

[0293] Example 6: Markers of the Ms1 region and their use in identifying and selecting wheat plants containing Ms1 mutations

[0294] It was found that the Ms1 gene was closely linked to markers ET0487, ET0488, ET0489, ET0490, ET0491, ET0495, 007-0033.1 and 007-0046.1 located in the Ms1 region. See SEQ ID NOs: 24-29, 32 and 33. Since the male sterility trait is controlled by a single nuclear recessive gene, all crosses between male sterile mutants and wild-type pollinators will result in 100% male fertile F1 progeny (Ms1ms1), while F2 and BC1 progeny will segregate for this trait. It is desirable to determine the genotype of the progeny so that one can assess whether the plant itself has the mutation, or whether one or more alleles are linked to and associated with the mutation in the Ms1 gene (i.e., in linkage disequilibrium with the mutation). For example, one or more alleles at markers ET0487, ET0488, ET0489, ET0490, ET0491, ET0495, 007-0033.1, or 007-0046.1 can be tested to determine if a plant has the ms1 mutation in a homozygous or heterozygous state. For msld, msle, or mslf, the mutation occurs in the Chris variety; thus, the Chris alleles located near the Ms1 gene are in linkage disequilibrium with the causal mutation, and thus the presence can be assessed to determine if msld, msle, or mslf is present. Through marker-assisted selection, plant breeders will be able to follow up on the presence of the male sterility trait through controlled crosses to obtain new plants containing the ms1 mutation in a homozygous or heterozygous state, if desired, thereby maintaining the ms1 mutation. Plant breeders can also use markers in the Ms1 region to produce mutant male sterile seed parents to be used as females, i.e., plants that require pollen donor plants for pollination, to produce seeds of commercial interest or to produce F1 hybrids containing the ms1 mutation in the heterozygous state.

[0295] Example 7: Wheat transformation

[0296] Wheat transformation protocols are known to those skilled in the art. See, for example, He, et al., (2010) J. Exp. Botany 61(6): 1567-1581; Wu, et al., (2008) Transgenic Res. 17: 425-436; Nehra, et al., (1994) Plant J. 5(2): 285-297; Rasco-Gaunt, et al., (2001) J. Exp. Botany 52(357):865-874 (Rasco-Gaunt et al., 2001, Journal of Experimental Botany, Vol. 52, No. 357, pp. 865-874); Razzaq, et al., (2011) African J. Biotech. 10(5):740-750 (Razzaq et al., 2011, African Journal of Biotechnology, Vol. 10, No. 5, pp. 740-750); Tamás-Nyitrai, et al., (2012) Plant Cell Culture Protocols. Methods in Molecular Biology 877:357-384 (Tamás-Nyitrai et al., 2012, Plant Cell Culture Protocols - Molecular Biology Methods, Vol. 877, pp. 357-384); and U.S. Patent Publication No. 2014 / 0173781.

[0297] Example 8: Restoration of wheat ms1 homozygous recessive plants by expressing a transformed copy of the Ms1 gene or an ortholog Male fertility .

[0298] In the previous example, nucleotide sequence differences were detected in the DNA regions corresponding to the Ms1 candidate genes from msld, msle and mslf plants. In the present example, various strategies for restoring male fertility to the homozygous recessive msld plants are described. Male sterile wheat plants containing the ms1 mutation were restored to male fertility when transformed with a DNA vector comprising a functional copy of the Ms1 gene. This indicates that the candidate Ms1 gene is effective in providing a supplement to the ms1 mutation that causes the male sterile phenotype.

[0299] Although wheat is an allohexaploid containing three related genomes (ABD) with similar gene content, it behaves as a diploid during meiosis. Normally related wheat genomes contain homologous genes with similar gene structure and function, requiring triple mutants to obtain loss-of-function phenotypes. However, the wheat male sterility phenotype observed in the msld mutant segregates in a 3:1 ratio of fertile to sterile plants. This suggests that in this mutant, a single recessive locus under homozygous conditions induces the male sterility phenotype and that this locus segregates according to Mendelian inheritance. The lack of functional redundancy with other homologs of Ms1 suggests that the functions of the A and D genome copies of this gene have diverged.

[0300] Marker development and evaluation showed that the heterozygous msl locus segregates in a ratio of 1:2:1 between homozygous wild type and heterozygous mutants and homozygous mutants. The correlation of phenotypic and genotypic data supports that the msl mutation follows Mendelian inheritance.

[0301] The Mendelian nature of the msl mutation will result in the introgression of the male sterility trait into different genetic backgrounds.

[0302] One strategy to restore male fertility in ms1 plants is to express one or more genes that can overcome the loss of function or activity caused by the Ms1 mutation or deletion. Genes from wheat or from another plant species that have the same or similar function as Ms1 are used to restore gene activity in transformed wheat plants. For example, Figure 1 As shown, the gene from barley encodes a protein with high amino acid sequence similarity to the wheat Ms1 gene product and has about 79% sequence identity. The barley gene present in SEQ ID NO: 1 is introduced into wheat ms1 mutant plants to restore male fertility. The barley gene can be expressed using its native promoter (see SEQ ID NO: 1, nucleotides 1-902, SEQ ID NO: 41) or a non-native promoter (e.g., a tissue-preferred promoter, a constitutive promoter, or a conditional promoter) to restore male fertility. Other monocots or dicots can also serve as a source of complementary genes and promoters to restore male fertility to ms1 mutant male sterile wheat plants. The genes and promoters can be from one source or from a combination of multiple source species, such as from one or more of wheat, barley, rice, and Brachypodium.

[0303] In another strategy, the wild-type wheat Ms1 gene or a variant thereof (see, e.g., SEQ ID NO: 1, 2, 4, 7, 9, 42, 43, 44 or 45) is used to restore male fertility in homozygous recessive ms1 plants. The variant Ms1 gene comprises changes in one or more DNA restriction sites to allow compatibility with DNA vectors for plant transformation. See, e.g., SEQ ID NO: 9, which comprises nucleotide changes introduced at positions 2, 3, 1209 and 1301 to facilitate vector construction. The Ms1 gene is introduced into ms1 plants by known plant transformation methods to generate plants containing the Ms1 gene in a stably integrated form for fertility complementation. As an alternative to using the native Ms1 promoter (SEQ ID NO:6), a promoter variant (e.g., see SEQ ID NO:8, which contains nucleotide changes introduced to facilitate vector construction) or other plant (e.g., SEQ ID NO:41) or non-plant constitutive promoters, conditional promoters, or tissue-preferred promoters are used to express wild-type or variant forms of the Ms1 gene or cDNA to restore male fertility in homozygous recessive msl wheat plants. The gene and promoter can be from one source species or a combination of multiple source species. In some embodiments, the promoter is an Ms1 promoter from wheat, rice, barley, or Brachypodium. The genomic Ms1 sequence 3' of the translation stop codon contains a functional terminator region; see UTR at positions 3384-4335 of SEQ ID NO:7 (SEQ ID NO:46). See also UTR at positions 2838-3838 of SEQ ID NO:1 (SEQ ID NO:47).

[0304] Constructs and transformation

[0305] To restore fertility of ms1d / ms1d homozygous mutants, a wheat Ms1 gene under the control of the native wheat Ms1 promoter and terminator was linked to a DsRed2 gene (see, e.g., U.S. Patent No. 5,525,716) under the control of the barley LTP2 promoter and also carrying a PINII terminator sequence (TaMs1-DsRED). The construct was directly transformed into wheat embryos harvested from Ms1 / ms1d heterozygous plants by an Agrobacterium-mediated transformation method cited elsewhere herein. Several independent T-DNA insertion events containing TaMs1-DsRED were obtained for construct evaluation in ms1d plants.

[0306] T0 plant generation and analysis

[0307] The TO wheat plants containing a single copy of the TaMs1-DsRED cassette were identified and genotyped as being homozygous or heterozygous for the msld mutation. The selfed seeds from these individual plants were counted as a qualitative measure of male fertility. As shown in Table 4, no seed setting was observed in the msld / msld homozygous plants lacking the TaMs1-DsRED cassette. In contrast, seed setting was observed when the msld / msld homozygous plants contained a transformed copy of the TaMs1-DsRED cassette. These results indicate that the transformed copy of TaMs1 is functional and can restore the fertility of the msld / msld homozygous male sterile plants.

[0308] Table 3: Seed set in TO wheat plants containing TaMs1 complementary T-DNA insertion.

[0309]

[0310]

[0311] T1 plant analysis; molecular and phenotypic

[0312] Inheritance of complementation of the TaMs1 T-DNA insertion was confirmed by analyzing T1 plants from two separate T0 plants with independent T-DNA insertions (Event 1 and Event 7). A set of T1 progeny was derived from the complement of the TaMs1 T-DNA insertion with the TaMs1-DsRED cassette (Event 1). ms1d mutation( ms1d / ms1d ) are homozygous T0 plants. The second set of T1 progeny is derived from pairs with the TaMs1-DsRED cassette (event 7). ms1d mutation( Ms1 / ms1d ) were heterozygous T0 plants. Plants from these two groups were genotyped for ms1d and T-DNA insertion. In both groups of T1 progeny, the genotype ms1d / ms1 All plants with T-DNA insertion (event 1 or event 7) were confirmed to be fertile by seed production (Table 4). ms1d / ms1d All progeny without T-DNA insertion were male sterile and did not produce seeds. This clearly shows that TaMs1 complementary T-DNA insertion can restore ms1d / ms1d The mutant plants are fertile and this ability is passed on to their offspring.

[0313] Table 4: Fertility of T1 plants with or without TaMs1 complementary T-DNA insertion .

[0314]

[0315]

[0316] In summary, analysis of T0 and T1 plants with a T-DNA insertion containing the native wheat MS1 gene showed that this gene is able to restore fertility to the msld / msld homozygous recessive mutation. This example further demonstrates that the msld mutation is located in the wheat Ms1 gene.

[0317] Example 9: Inbred maintenance and enhancement of wheat msl male sterile plants using hemizygous maintainer lines .

[0318] This example demonstrates that wheat plants homozygous recessive for msl can be maintained as male sterile plants using a functional copy of Ms1 linked to a seed marker gene and a pollen suppressor gene.

[0319] It would be advantageous to produce pure lines of male sterile plants in order to produce hybrid seeds by cross-pollination with different inbred wheat varieties. Typically, strategies integrating recessive male sterility result in plants that cannot self-pollinate. In order to accomplish self-pollination and produce pure line male sterile plants for cross-pollination, an expression cassette (Ms1-AA-Red) was constructed, comprising a functional copy of Ms1 connected to a maize PG47 promoter (see, e.g., SEQ ID NO: 30) expressing a functional α-amylase gene, and further connected to a color marker gene (e.g., encoding a red fluorescent protein) under the control of a barley LTP2 promoter (see, e.g., U.S. Patent No. 5,525,716) and also carrying a PINII terminator sequence. Using bioballistic or Agrobacterium-mediated transformation, the construct was directly transformed into embryos of self-pollinating Ms1 / ms1 wheat plants. The transformed embryos were regenerated into plants. Wheat plants containing a single copy of the Ms1-AA-Red cassette (ms1 / ms1), which can be identified using markers flanking the ms1 locus as described above, are male fertile and allow self-pollination. Since PG47:AA inhibits pollen function and thus prevents the action of the Ms1-AA-Red expression cassette through pollen transmission, seeds from this generation of progeny will be separated at a frequency of 1:1 red fluorescence and non-fluorescence. Progeny grown from red fluorescent seeds are hemizygous for Ms1-AA-Red, homozygous for ms1, and male fertile; these are used to propagate (i.e., "maintain") male sterile inbred lines. Progeny of non-fluorescent seeds do not contain a transformed copy of the Ms1 complementing gene, are homozygous for ms1 and are male sterile. These male sterile inbred lines are used as female inbred lines for producing hybrid seeds when planted adjacent to wild-type male inbred wheat plants for the Ms1 gene.

[0320] Example 10: Targeted regulation or mutagenesis of genes .

[0321] For male fertility applications, it may be advantageous to mutate the endogenous Ms1 gene or alter its expression, for example by the methods described in this Example.

[0322] Introduction of RNA into living cells has been demonstrated to inhibit the expression of a target gene in that cell. (Bae et al. (2010) Plant Breeding 129(6):647-651); Beetham et al. (1999) Proceedings of the National Academy of Sciences 96(15):8774-8778, doi:10.1073 / pnas.96.15.8774); Cigan et al., 2010, U.S. Patent 7,696,405; Cigan et al. (2005) The Plant Journal 43(6):929-940 (Cigan et al., 2005, The Plant Journal, Vol. 43, No. 6, pp. 929-940); Dalacouras et al. (2009) The Plant Journal 60(5):840-851, doi:10.1111 / j.1365-313X.2009.04003.x (Dalakouras et al., 2009, The Plant Journal, Vol. 60, No. 5, pp. 840-851, doi:10.1111 / j.1365-313X.2009.04003.x); Fire et al. (2009) The Plant Journal 60(5):840-851, doi:10.1111 / j.1365-313X.2009.04003.x); al. (1998) Nature 391(6669): 806-811 (Fire et al., 1998, Nature, Vol. 391, No. 6669, pp. 806-811); Fire et al., 1999, WO 1999032619 A1; Mette et al. (2000) EMBO J 19(19): 5194-5201 (Mette et al., 2000, Journal of the European Molecular Biology Organization, Vol. 19, No. 19, pp. 5194-5201); Okuzaki and Toriyama (2004) Plant Cell Reports 22(7): 509-512. doi: 10.1007 / s00299-003-0698-2 (Okuzaki and Toriyama, 2004, Plant Cell Reports, Vol. 22, No. 7, pp. 509-512, doi: 10.1007 / s00299-003-0698-2)1007 / s00299-003-0698-2); Tang, 2013, WO 2013025670 A1; Timmons and Fire (1998) Nature 395: 854 (Timmons and Fire, 1998, Nature, Vol. 395, p. 854); Yu et al. (2002) PNAS 99 (9): 6047-6052 (Yu et al., 2002, Proceedings of the National Academy of Sciences of the United States of America, Vol. 99, No. 9, pp. 6047-6052). The skilled person will appreciate that RNA can be expressed intracellularly or applied exogenously (Tang WO 2013025670 A1). .

[0323] Interfering RNA can target transcription, translation or mRNA stability, thereby altering the expression of the target gene. In this example, the expression of the Ms1 gene is In plants RNA targeting the promoter region (as previously demonstrated in monocots including wheat (U.S. Patent Application 14 / 203,698) (Cigan et al., 2010)) or RNA targeting the expressed mRNA is expressed alone or in combination to reduce or silence. For the promoter inverted repeat approach, a portion of the Ms1 promoter region can be tandemly duplicated, juxtaposed and oriented in opposite directions and placed under the control of a constitutive tissue-preferred promoter or a conditional promoter in a plant transformation vector to express the promoter inverted repeat RNA in plant cells to silence a gene operably linked to the target promoter.

[0324] The skilled person will also understand that changes can be introduced by mutation of the nucleic acid sequence, thereby resulting in changes in the expression of the encoded mRNA or changes in the amino acid sequence of the encoded Ms1 polypeptide, resulting in changes in the biological activity of the mRNA and / or protein. See, for example, the methods described in U.S. patent application 14 / 463,687 filed on August 20, 2014, which is incorporated herein by reference in its entirety. Thus, variant nucleic acid molecules can be generated by introducing substitutions, additions and / or deletions of one or more nucleotides into the corresponding nucleic acid sequences disclosed herein or surrounding sequences. Such variant nucleic acid sequences are also encompassed by the present invention.

[0325] Variant nucleic acid sequences can be prepared by randomly introducing sequence changes along all or part of the Ms1 gene region, including but not limited to chemical or radiation mutagenesis and oligonucleotide-mediated mutagenesis (OMM) (Beetham et al., 1999; Okuzaki and Toriyama, 2004). Alternatively or in addition, double-strand break technology, such as but not limited to ZNF, custom-designed homing endonucleases, TALEN, CRISPR / CAS (also known as guide RNA / Cas endonuclease system (U.S. patent application 14 / 463,687 filed on August 20, 2014)), or other protein-based, or polynucleotide-, or coupled polynucleotide-protein-based mutagenesis technology, can be used to introduce sequence changes at specific selected sites. The resulting variants can be screened for altered Ms1 activity. It should be understood that these techniques are generally not mutually exclusive. In fact, various methods can be used alone or in combination, in parallel or in series, to produce or obtain a variety of sequence variants.

[0326] Example 11: Induction of male sterility by post-transcriptional gene silencing of TaLTPG1

[0327] The polynucleotide fragment (SEQ ID NO: 38) was isolated from the 3'UTR of TaLTPG1 and subcloned into the constitutive expression vector PHP1 within an RNAi cassette (entry ZmUbi::TaLTPG1-IR:SbActin).

[0328] Plants for transformation donor material were sown in 6L (8 inch diameter) pots of 5-6 plants filled with soil mixture. The soil mixture consisted of 75% (v / v) coconut mud, 25% (v / v) nursery cut sand (sharp), 750mg / L CaSO4.2H2O (gypsum), 750mg / L Ca(H2PO4)2.H2O (superphosphate), 1.9g / L FeSO4, 125mg / L FeEDTA, 1.9g / L Ca(NO3)2, 750mg / L Scotts Micromax micronutrients and 2.5g / L OsmocotePlus slow release fertilizer (16:3:9) (Scotts Australia Pty. Ltd.). The pH was adjusted to 6.0 to 6.5 using 2 parts agricultural lime and 1 part slaked lime. Potted plants were grown in a controlled environment growth chamber at 23°C (day) and 16°C (night) using a 400W high pressure sodium lamp in combination with a metal halide lamp with an extended photoperiod of up to 12 hours during the winter months.

[0329] Co-bombardment of RNAi cassettes with constitutively expressed hpt selectable marker gene sequences was performed according to the published method. Ismagul et al. in Crop Breeding Vol. 1145 Methods in Molecular Biology (eds D. Fleury & R. Whitford) Ch 14, 239-252 (Springer, 2014) (Ismagul et al., "Crop Breeding", Vol. 1145, Molecular Biology Methods, D. Fleury and R. Whitford, eds., Chapter 14, pp. 239-252, Springer, 2014). T0 regenerated plants were recovered by selection on MS medium containing 100 mg / L hygromycin B.

[0330] Pollen grain viability tests were performed on mature anthers collected from different spikelets of each plant before dehiscence. The anthers were placed on moistened filter paper in a petri dish for transport to the laboratory, where they were crushed on a clean glass slide in a drop of 2% potassium iodide solution. Pollen grains located between the slide and the cover glass were protected from drying by surrounding the edges of the cover glass with clear nail polish. Samples were examined and documented using an Axio Imager M2 microscope connected to an AxioCam MRm3 S / N5669 camera.

[0331] The self-fertility of individual plants was assessed by placing a cellophane bag on each plant head before flowering. Three to ten plant heads were collected per plant for seed counting. The two basal and two apical spikelets per plant head were removed from the analysis due to their incomplete development. The total seed set and the number of florets were counted on a per plant head basis. The fertility percentage of each spike or plant was calculated as follows:

[0332]

[0333] DNA extraction from all transgenic regenerated plants was performed using either phenol-chloroform or freeze-dried extraction protocols. (Kovalchuk, N. in Crop Breeding Vol. 1145 Methods in Molecular Biology (eds D. Fleury & R. Whitford) 239-252 (Springer, 2014)). 15 cm leaves from 2-week-old plants were frozen in liquid nitrogen and the tissue was ground into a fine powder using 1 large ball (9 mm) and 3 small balls (3 mm) and a vortex machine. 700 μL extraction buffer (1% sarkosyl, 100 mM Tris-HCl pH 8.5, 100 mM NaCl, 10 mM EDTA, 2% PVPP) was added to each sample and the samples were mixed on a rotary shaker for 20 min. 700 μL phenol / chloroform / isoamyl alcohol (25: 24: 1) was added and the extract was transferred to a silica matrix tube and spun at 4000 rpm for 10 min. DNA was precipitated by adding 60 μL 3M sodium acetate pH 4.8 and 600 μL isopropanol and centrifuged at 13000 rpm for 10 minutes. The DNA precipitate was washed with 1 mL 70% ethanol, centrifuged at 13000 rpm for 2 minutes and air dried for 20 minutes. The purified DNA was resuspended in 50 μL R40 (1×TE, 40 μg / mL RNase A). The presence of the RNAi box in the T0 regenerated plantlets was evaluated by PCR using transgene-specific primers.

[0334] Ninety-nine T0 regenerated plantlets were identified as resistant to hygromycin, of which 73 were thought to contain the RNAi cassette. Of the 73 PCR-positive T0 transgenic plants, 26 (about 36%) were observed to be completely sterile or expressed partial sterility when self-fertility was assessed. These results indicate that TaLTPG1-specific post-transcriptional gene silencing can induce sterility.

[0335] Example 12: Restoration of fertility of msld homozygotes using genomic TaLTPG1 .

[0336] The genomic fragment of TaLTPG1 in the vector PHP2 was introduced into the genotype msld×Gladius (F2 / F3 generation) by bioballistic transformation.

[0337] Transformation was performed as in Example 11. Regenerated TO plantlets were genetically analyzed by KASPar analysis using Ms1 linked markers ET0292 (SEQ ID NO: 34), ET0294 (SEQ ID NO: 35), 007-0042.1 (SEQ ID NO: 36), 007-0046.1 (SEQ ID NO: 33), and 007-0182.1 (SEQ ID NO: 37), which target the Ms1 4BS variant promoter (artificial) from SEQ ID NO: 8. Plants identified as ms1 homozygous and containing the Ms1 4BS variant promoter were evaluated for self-fertility according to the method of Example 11.

[0338] Eighty T0 regenerated plantlets were identified as resistant to hygromycin, and 69 of them were identified by KASP analysis using 007-0182.1 as containing the transgenic derived Ms1 4BS variant promoter. Of these 69 T0 transgenic plants, 4 plants were identified by KASP analysis using 007-0009.1, 007-0011.1, 007-0042.1 and 007-0046.1 markers as being homozygous for the Chris haplotype (msld / msld). Analysis of the ears bagged before flowering showed that three lines were self-fertile. These results suggest that the genomic fragment of TaLTPG1 can restore the fertility of msld homozygotes.

[0339] Example 13: Inverted repeat expression of Ms1 promoter affects wheat fertility

[0340] This example demonstrates that plant fertility can be altered by expression of the Ms1 promoter-specific inverted repeat (promoter inverted repeat, pIR) molecule. This provides further evidence that expression of the Ms1 gene is required for male fertility in wheat.

[0341] The pIR construct (SEQ ID NO: 6) was generated by linking the ubiquitin promoter to an inverted repeat sequence targeting a portion of the wheat Ms1 promoter, including a NOS spacer segment between the inverted repeat sequences. Nucleic acid molecules and methods for preparing vectors have been previously described (Cigan et al Plant Journal (2005) 43, 929-940). The construct was introduced into the wheat Fielder variety by Agrobacterium-mediated transformation using methods known in the art and mentioned elsewhere herein.

[0342] Plants were grown in a greenhouse. Transgenic copy number was determined by quantitative polymerase chain reaction (QPCR). Plants were grown to maturity and male fertility phenotypes were recorded.

[0343] Suppression was sufficient to cause male sterility in 100% of the events. Both single-copy and multi-copy T-DNA insertion events were male sterile, indicating that both single-copy and multi-copy insertion events were effective. This example further demonstrates that the Ms1 gene is a male fertility gene in wheat and that its suppression results in male sterility. Sequence Listing <110> Pioneer International Hi-Bred <120> Wheat Ms1 polynucleotides, polypeptides and methods of use <130> RTS20250D-US-NP <140> US14866078 <141> 2015-09-25 <150> US 62 / 056365 <151> 2014-09-26 <150> US 62 / 187591 <151> 2015-07-01 <160> 51 <170> PatentIn Version 3.5 <210> 1 <211> 3838 <212> DNA <213> Hordeum vulgare <220> <221> Promoter <222> (1)..(902) <400> 1 cgcacatcaa cataaactca tcagatggga ataatcggat ctacgaagga cataaaactc 60 tttaatctca tgacaacgcc agaagagcaa gagtaaatat attctcataa aaaacaatga 120 acactagatg atgacgaaga acataagatt cttcaaggag aaattgcggc agcggagatg 180 gcagccggag gcgagggggc caaaaactct gttgcggcgg cagcggtagc cttggtgaaa 240 cccacacgtt tgcacaccat ataagttgtt tgcaagggtt acatgggcct cgctctcgtg 300 aaaaagaagg tcatacatgg gtcttggtct cgtgcaaaac gaaaggtcag cagtccatgg 360 gccggaggaa aaaccgggca acaacacgcc atgtgtgttt tcgcgggaac ccaattccga 420 aatcactcac cggcacctcg tcccgatgcc ttccagaacg ttctacgtgc ttccacaggg 480 ccagcccagc cgtgggatca gatcaggatc agcacgaaca ttgaagctag cgcggcgata 540 tttttcccag cctccgcctc gctcgacgac tgcatttcat ttcgaaaaca aaaaaaagag 600 ctttctcctt ctcatcccga gcgccagagg agcaccagaa aggccaccca cccaccctca 660 cgtaccgccc tcgcacccgc gcggccacat ctgggccgtc cacttgggca gctggccgtt 720 ccattcccga actgacgggc aggatcgagc gagcggcgcg cccacggctc ctccggctat 780 ataacccgcc acccacacca ctcccctccg gcgttccacc agagccttcc tccctccacc 840 gcaccaccac caccaccgcg ccaaaaaccc tagggagcga gcgagctcac ctcgccccgc 900 ccatggagag atcccgccgc ctgctgctcg tggcggggct cctcgccgcg ctgctcccgg 960 cggcggccgc caccttcggg ctgcagcagg gggcgcagtg cgaccccacg ttcctggcga 1020 cgcaggccgc gctcttctgc gcccccgaca tgcccacggc ccagtgctgc gagcccgtcg 1080 tcgccgcctt cgacctcggg ggcggcgtcc cctgcctctg ccgcgtcgcc gccgagccgc 1140 agctggtcat ggcggggctc aacgccaccc acctcttcgc gctgtacacc tcctgcggcg 1200 gcatccgtcc cggtggcgcc cacctcgccg ccgcctgcca aggtacgttc acgttcaccg 1260 cctccctccc tctccttctc tctttgcacc tgtaccagcc gattcggcgt tcgctttcgc 1320 gtttcccggt agttttgatg gtttctcgag tcgccagtgc tccgatttgg gttcggtttc 1380 cttgcgttgt accggatctg cctgtacggc gcgcggcgtc ggggttctcg ttgtttcccg 1440 tggcgagcat ccccgcgcgc ccacggccta gctagcttac cttcagatac gcggagcgat 1500 ttaggatcag tatgaggagt tcgtcgtaga agaatgcatg cggaacgcgc gattgtttgt 1560 ttcatcgatt ttggatctgt gataggcctg cttgttcccg agtttttgca cgtagaagaa 1620 tcatgtgcag aacccctggt ccattatttg ttatgtatat acacgattac ttgtgcatat 1680 gcagaagtct tagttatctg ctacccttcc agaattattc gtggtgtttt tgttcctcta 1740 gttaaacttc agatgatctt tcgttcgagt ttattttcct gcctgtaact gagatcgata 1800 tacctatcac cgtgactgtg agagagacag agagttgttg ccgtttaact gctatatata 1860 tgtacgtttt ctgctactgt ttaatcgact gctccatccc gttcgcgata ggacttgttt 1920 caaaccgtca cgcagctctg cttcctgcag tgtcttttgt cttcgtttgg tcaaaactga 1980 aaacgcttgc tatcgaggcc agaggcaggg caaaagctcc ccgtactttt cgctttgcag 2040 tggcatctct ttcttttttt ttgccgaaaa ttgtttccac gttcatcccc gggtgtcgta 2100 ctacttaatt atctgcatgc agttttcgtg tccttcctcc gtcgtgaaaa aaaggttggg 2160 tcaaatgaat caaccgtgta tgcagggcag cagcaacaga gatagagtag ctggctgtcg 2220 cagctttaac aaaagcagtc tgtggcctgc cacagttttc ctgatttttg tttaatctgg 2280 cctgggcttc ttttcttgtt gcgcacgtcg tcgcctcctt cttttttccc aattttttga 2340 tttcttttga gataaggaca cgaacggctg gtaactgact tttcttgttg ttttttactg 2400 tgggttttgg acgcaggacc ggctcccccg gccgccgtcg tcagcagccc cccgccacca 2460 tcgccagcac ctcgccgcaa acaggcagcg cgtacgaacc tctcgctctc tctctctccc 2520 tctcgcctgc atctcgctct gtacataacc tattgggttc atatgctgat cagcgttgac 2580 atactaactt gttcatttga ttctcagacg acgcgcctcc accgccgccg tccagcgaga 2640 agccatcccc gccgccccag gagcatgacg gcgccgcaca cgccaagagc gcccccgccc 2700 tcgcggctcc taccccgctc gcgcccgctg ccgctactgc cccgccgccc gaggcgccac 2760 actccgccgc gtcgtcgtcc gattcggcct tcatcttcat cgccgcggcc atgctcgcca 2820 tttacatcgt cctctgaatg gccgaccccc aaggcagcag agtacttgtc atctgattcc 2880 gtttcatgct tgtcgccgtt tgttgaggtt cgtttctgca gtccgaacaa gacggtgggg 2940 ttttgatcgg gtacccagat ttctatgtcg atcgcgcgta ctagtactag tagttgctta 3000 gcagatgaac gaacattggg ttttgggatt cctctagctg atgaaccact gctattttcc 3060 atgtgatcga tggatatgat ctgaatggat ggatgaagtt ttggtttctg atgctgatga 3120 tgtgctgctt cttcatttgc atgctcgatc tattccttca attttgtgga gcaacagttt 3180 gtttagcttc tgttctgcta tgaataatgc cgcttgcatc ttgtcattgc tgataatctg 3240 cttaatgcag acattgcttc cgtcccaaac aatctgttgc ttaccaggta atgcatataa 3300 tctgtacctc accttcgcac aacaacagaa gctaccctgc taaaaaaaca cacacacaca 3360 cacaaaaaaa acagaagctg gtctcacacg gaagccgctt cggggactgt ttgcagcttt 3420 ttattgccat tttgtttttc atgcaggtac aaatcgaggg tgttgcttga tttgatcatg 3480 gatgatcact tagagcaaca tgtgtgtttt gtctgtgttt tattcgttgc tcgtccatcc 3540 aatttaaact tgaaatggat cgtgtgtgga taaaagaaga cgtgcgtcag tttgaatcga 3600 cgcgttgggt tatattttgt gtctgtgacg accgaaacga agacaaaata tatcgtccgg 3660 ttagaattgc tctaatgcta gctttctctc ctaccatcgc attccgtggt aggaaaaagt 3720 actagaacca caggaaactg gaacgcaaga aaagcatatc taccgttggc cgttgatctt 3780 gtttcacatt cggtatggct ccggtcatat tgttggagat tcacattcat gcacgcaa 3838 <210> 2 <211> 642 <212> DNA <213> Hordeum vulgare <400> 2 atggagagat cccgccgcct gctgctcgtg gcggggctcc tcgccgcgct gctcccggcg 60 gcggccgcca ccttcgggct gcagcagggg gcgcagtgcg accccacgtt cctggcgacg 120 caggccgcgc tcttctgcgc ccccgacatg cccacggccc agtgctgcga gcccgtcgtc 180 gccgccttcg acctcggggg cggcgtcccc tgcctctgcc gcgtcgccgc cgagccgcag 240 ctggtcatgg cggggctcaa cgccacccac ctcttcgcgc tgtacacctc ctgcggcggc 300 atccgtcccg gtggcgccca cctcgccgcc gcctgccaag gaccggctcc cccggccgcc 360 gtcgtcagca gccccccgcc accatcgcca gcacctcgcc gcaaacaggc agcgcacgac 420 gcgcctccac cgccgccgtc cagcgagaag ccatccccgc cgccccagga gcatgacggc 480 gccgcacacg ccaagagcgc ccccgccctc gcggctccta ccccgctcgc gcccgctgcc 540 gctactgccc cgccgcccga ggcgccacac tccgccgcgt cgtcgtccga ttcggccttc 600 atcttcatcg ccgcggccat gctcgccatt tacatcgtcc tc 642 <210> 3 <211> 214 <212> PRT <213> Hordeum vulgare <400> 3 Met Glu Arg Ser Arg Arg Leu Leu Leu Val Ala Gly Leu Leu Ala Ala 1 5 10 15 Leu Leu Pro Ala Ala Ala Ala Thr Phe Gly Leu Gln Gln Gly Ala Gln 20 25 30 Cys Asp Pro Thr Phe Leu Ala Thr Gln Ala Ala Leu Phe Cys Ala Pro 35 40 45 Asp Met Pro Thr Ala Gln Cys Cys Glu Pro Val Val Ala Ala Phe Asp 50 55 60 Leu Gly Gly Gly Val Pro Cys Leu Cys Arg Val Ala Ala Glu Pro Gln 65 70 75 80 Leu Val Met Ala Gly Leu Asn Ala Thr His Leu Phe Ala Leu Tyr Thr 85 90 95 Ser Cys Gly Gly Ile Arg Pro Gly Gly Ala His Leu Ala Ala Ala Cys 100 105 110 Gln Gly Pro Ala Pro Pro Ala Ala Val Val Ser Ser Pro Pro Pro Pro 115 120 125 Ser Pro Ala Pro Arg Arg Lys Gln Ala Ala His Asp Ala Pro Pro Pro 130 135 140 Pro Pro Ser Ser Glu Lys Pro Ser Pro Pro Pro Gln Glu His Asp Gly 145 150 155 160 Ala Ala His Ala Lys Ser Ala Pro Ala Leu Ala Ala Pro Thr Pro Leu 165 170 175 Ala Pro Ala Ala Ala Thr Ala Pro Pro Pro Glu Ala Pro His Ser Ala 180 185 190 Ala Ser Ser Ser Asp Ser Ala Phe Ile Phe Ile Ala Ala Ala Met Leu 195 200 205 Ala Ile Tyr Ile Val Leu 210 <210> 4 <211> 660 <212> DNA <213> Common wheat (Triticum aestivum) <400> 4 atggagagat cccgcgggct gctgctggtg gcggggctgc tggcggcgct gctgccggcg 60 gcggcggcgc agccgggggc gccgtgcgag cccgcgctgc tggcgacgca ggtggcgctc 120 ttctgcgcgc ccgacatgcc gacggcccag tgctgcgagc ccgtcgtcgc cgccgtcgac 180 ctcggcggcg gggtgccctg cctctgccgc gtcgccgccg agccgcagct cgtcatggcg 240 ggcctcaacg ccacccacct cctcacgctc tacagctcct gcggcggcct ccgccccggc 300 ggcgcccacc tcgccgccgc ctgcgaagga cccgctcccc cggccgccgt cgtcagcagc 360 ggcgcccacc tcgccgccgc ctgcgaagga cccgctcccc cggccgccgt cgtcagcagc 360 cccccgcccc cgcctccacc gtccgccgca cctcgccgca agcagccagc gcacgacgca 420 cccccgcccc cgcctccacc gtccgccgca cctcgccgca agcagccagc gcacgacgca 420 ccaccgccgc caccgccgtc gagcgagaag ccgtcgtccc cgccgccgtc ccaggaccac 480 ccaccgccgc caccgccgtc gagcgagaag ccgtcgtccc cgccgccgtc ccaggaccac 480 gacggcgccg ccccccgcgc caaggccgcg cccgcccagg cggccacctc cacgctcgcg 540 gacggcgccg ccccccgcgc caaggccgcg cccgcccagg cggccacctc cacgctcgcg 540 cccgccgccg ccgccaccgc cccgccgccc caggcgccgc actccgccgc gcccacggcg 600 cccgccgccg ccgccaccgc cccgccgccc caggcgccgc actccgccgc gcccacggcg 600 ccgtccaagg cggccttctt cttcgtcgcc acggccatgc tcggcctcta catcatcctc 660 ccgtccaagg cggccttctt cttcgtcgcc acggccatgc tcggcctcta catcatcctc 660 <210> 5<210> 5 <211> 220<211> 220 <212> PRT<212> PRT <213> 普通小麦(Triticum aestivum)<213> Common wheat (Triticum aestivum) <400> 5<400> 5 Met Glu Arg Ser Arg Gly Leu Leu Leu Val Ala Gly Leu Leu Ala Ala Met Glu Arg Ser Arg Gly Leu Leu Leu Val Ala Gly Leu Leu Ala Ala 1 5 10 15 1 5 10 15 Leu Leu Pro Ala Ala Ala Ala Gln Pro Gly Ala Pro Cys Glu Pro Ala Leu Leu Pro Ala Ala Ala Ala Gln Pro Gly Ala Pro Cys Glu Pro Ala 20 25 30 20 25 30 Leu Leu Ala Thr Gln Val Ala Leu Phe Cys Ala Pro Asp Met Pro Thr Leu Leu Ala Thr Gln Val Ala Leu Phe Cys Ala Pro Asp Met Pro Thr 35 40 45 35 40 45 Ala Gln Cys Cys Glu Pro Val Val Ala Ala Val Asp Leu Gly Gly Gly Ala Gln Cys Cys Glu Pro Val Val Ala Ala Val Asp Leu Gly Gly Gly 50 55 60 50 55 60 Val Pro Cys Leu Cys Arg Val Ala Ala Glu Pro Gln Leu Val Met Ala 65 70 75 80 Gly Leu Asn Ala Thr His Leu Leu Thr Leu Tyr Ser Ser Cys Gly Gly 85 90 95 Leu Arg Pro Gly Gly Ala His Leu Ala Ala Ala Cys Glu Gly Pro Ala 100 105 110 Pro Pro Ala Ala Val Val Ser Ser Pro Pro Pro Pro Pro Pro Pro Ser 115 120 125 Ala Ala Pro Arg Arg Lys Gln Pro Ala His Asp Ala Pro Pro Pro Pro 130 135 140 Pro Pro Ser Ser Glu Lys Pro Ser Ser Pro Pro Pro Ser Gln Asp His 145 150 155 160 Asp Gly Ala Ala Pro Arg Ala Lys Ala Ala Pro Ala Gln Ala Ala Thr 165 170 175 Ser Thr Leu Ala Pro Ala Ala Ala Ala Thr Ala Pro Pro Pro Gln Ala 180 185 190 Pro His Ser Ala Ala Pro Thr Ala Pro Ser Lys Ala Ala Phe Phe Phe 195 200 205 Val Ala Thr Ala Met Leu Gly Leu Tyr Ile Ile Leu 210 215 220 <210> 6 <211> 1527 <212> DNA <213> Common wheat (Triticum aestivum) <400> 6 agacttaaac catttagtta caaatatcga tgcacacctt cggtggggcg ttgtgaaaaa 60 gcatgttttt tgggtcgaca agcccctttt gcaacgtatc ctcttctaat cctattcaga 120 tcattaacat cataagctgc aattgacatg ctcttctgag gatcaggttc atgcaattaa 180 acatcataaa ctgcatcttt gatgtcatcc ttttcctata ttttttccag attattggct 240 tgcttcgttt tcaatatcag gttctatgat tcgacttctg ttgttgccag taataatttg 300 tagttgctgc ggaatatgaa ctcaaggaga gctgatggtg ctatgaagtt gatttgatgg 360 gaggttgttc tacacctgca cttgctgctc gacttaaata catgccttgg atttcttccc 420 agctctagta cataatattt ttcaaattaa tgttccacga cataaaattt aaatccacaa 480 acatattttt agtacatgaa caattttcta atatagggca aacatttttc atatacaaac 540 cgatcatttt aatatatggt gaaaatcagt gtaatatatg ctgaaatgtt ttcaaataca 600 tattgaacat attatata aatggtgaac attatttttta attattgatg accatttta 660 aaatgcatat tgaacatttt atatataca ctgtacagtt ttatatat cgacgaacat 720 cttttggagt tctgaacatt ttttcaaaaacaagcca ttttccagga agaatacaaa 780 tgcaaaagaa atgagatatc aaaaaaaaaaaaaaaaaaaaacc 840 tacaggaaaa tccaaacaga aaagcaaag aagaacccg aactggggcca ggcaatgttt 900 ccaacggcct cgctcttcct gaacagaag gccagtcagc ccatggggctg ctcccagtac 960 tcgggccccg ctgtggcagc acgccatgta atagttttcg cgggaatcca acgccgaat 1020 cgcccgcagc gggaacccga cgtcggtctg gtgcgttctg gcgccttcca gaactctcca 1080 caggctcccg cagccgtccg atcagatcag cacgaagcac gacattggc gcgcggcgat 1140 atttctttc ctcgcccgac gacggccgca ctgcattca tttgaattt caaaattcgg 1200 aaacggaaaa gctttctcgc atcccgaggc gaggcggtta cgggcgccag aggggccacc 1260 ccaccaccc acccccgcccccgtgccccgcgcggccg catccgggcc gtccgcgcgg 1320 acagctggcc gcgcccagcc cgaaccgacg cccaggatcg agcgagggcg gcgcgcccgg 1380 ggcttggctt agcgtccacg ccacctccgg ctatataagc cgccccacac ccgctccccc 1440 tccggcattc cattccgcca ccgcaccacc accaccacca aaccctagcg agcgagcgag 1500 ggagagagag accgccccgc cgcgacg 1527 <210> 7 <211> 4335 <212> DNA <213> Triticum aestivum <220> <221> Exon <222> (1528)..(1855) <220> <221> Exon <222> (2925)..(3008) <220> <221> Exon <222> (3133)..(3380) <400> 7 agacttaaac catttagtta caaatatcga tgcacacctt cggtggggcg ttgtgaaaaa 60 gcatgttttt tgggtcgaca agcccctttt gcaacgtatc ctcttctaat cctattcaga 120 tcattaacat cataagctgc aattgacatg ctcttctgag gatcaggttc atgcaattaa 180 acatcataaa ctgcatcttt gatgtcatcc ttttcctata ttttttccag attattggct 240 tgcttcgttt tcaatcag gttctatgat tcgacttg tgttgccag taataatttg 300 tagttgctgc ggaatatgaa ctcaggaga gctgatggtg ctgaagtt gatttgatgg 360 gaggttgttc tacacctgca cttgctgctc gacttaata catgccttgg atttctccc 420 agctctagta cataatattt ttcaattaa tgttccacga cataaaattt aaatccacaa 480 acatattttt agtacatgaa caatttcta atatagggca aacattttc atatacaaac 540 cgatcatttt atatatggt gaaatcagt gtaatatatg ctgaaatgtt ttcaataca 600 tattgaacat attatata aatggtgaac attatttttta attattgatg accatttta 660 aaatgcatat tgaacatttt atatataca ctgtacagtt ttatatat cgacgaacat 720 cttttggagt tctgaacatt ttttcaaaaacaagcca ttttccagga agaatacaaa 780 tgcaaaagaa atgagatatc aaaaaaaaaaaaaaaaaaaaacc 840 tacaggaaaa tccaaacaga aaagcaaag aagaacccg aactggggcca ggcaatgttt 900 ccaacggcct cgctcttcct gaacagaag gccagtcagc ccatggggctg ctcccagtac 960 tcgggccccg ctgtggcagc acgccatgta atagttttcg cgggaatcca acgccgaaat 1020 cgcccgcagc gggaacccga cgtcggtctg gtgcgttctg gcgccttcca gaactctcca 1080 caggctcccg cagccgtccg atcagatcag cacgaagcac gaacattggc gcgcggcgat 1140 attttctttc ctcgcccgac gacggccgca ctgcatttca ttttgaattt caaaattcgg 1200 aaacggaaaa gctttctcgc atcccgaggc gaggcggtta cgggcgccag aggggccacc 1260 ccacccaccc accccgccc tcacgtgccc cgcgcggccg catccgggcc gtccgcgcgg 1320 acagctggcc gcgcccagcc cgaaccgacg cccaggatcg agcgagggcg gcgcgcccgg 1380 ggcttggctt agcgtccacg ccacctccgg ctatataagc cgccccacac ccgctccccc 1440 tccggcattc cattccgcca ccgcaccacc accaccacca aaccctagcg agcgagcgag 1500 ggagagagag accgccccgc cgcgacgatg gagagatccc gcgggctgct gctg 1554 Met Glu Arg Ser Arg Gly Leu Leu Leu 1 5 gtg gcg ggg ctg ctg gcg gcg ctg ctg ccg gcg gcg gcg cag ccg 1602 Val Ala Gly Leu Leu Ala Ala Leu Leu Pro Ala Ala Ala Ala Gln Pro 10 15 20 25 ggg gcg ccg tgc gag ccc gcg ctg ctg gcg acg cag gtg gcg ctc ttc 1650 Gly Ala Pro Cys Glu Pro Ala Leu Leu Ala Thr Gln Val Ala Leu Phe 30 35 40 tgc gcg ccc gac atg ccg acg gcc cag tgc tgc gag ccc gtc gtc gcc 1698 Cys Ala Pro Asp Met Pro Thr Ala Gln Cys Cys Glu Pro Val Val Ala 45 50 55 gcc gtc gac ctc ggc ggc ggg gtg ccc tgc ctc tgc cgc gtc gcc gcc 1746 Ala Val Asp Leu Gly Gly Gly Val Pro Cys Leu Cys Arg Val Ala Ala 60 65 70 gag ccg cag ctc gtc atg gcg ggc ctc aac gcc acc cac ctc ctc acg 1794 Glu Pro Gln Leu Val Met Ala Gly Leu Asn Ala Thr His Leu Leu Thr 75 80 85 ctc tac agc tcc tgc ggc ggc ctc cgc ccc ggc ggc gcc cac ctc gcc 1842 Leu Tyr Ser Ser Cys Gly Gly Leu Arg Pro Gly Gly Ala His Leu Ala 90 95 100 105 gcc gcc tgc not g gtacgttgtc cgcctcctcc cctccctccc tccctccctc 1895 God God Cys Glu tctctctacg tgctcgcttt cctgcttacc tagtagtag tagtttccca tgccttcttg actcgctaga agtgctccgg tttgggtctg ttaatttcct cgctgtacta ccggatctgt cgtcggcacg gcgcgcggcg tcgggtcctc gccttctccc gtggcgaccg acctgcgcag cgcgcgcgcg gcctagctag cttcataccg ctgtacctcg acatacacgg agcgatctat ggtctactct gagtatttcc tcatcgtaga acgcatgcgc cgctcgcgat tgtttcgtcg attctagatc cgtgcttgtt cccgcgagtt agtatgcatc tgcgtgcata tgccgtacgc 2255. acgcagatgc agagtctgtt gctcgagtta tctactgtcg ttcgctcgac catatttgcc 2315 tgttaattc ctgttcatcg tgcatgcagt agtagtagcc atgtccacgc cttcttgttt 2375. tgaggcgatc atcgtcgaga tccatggctt tgctttctgc actatcttct gccttgtttt gttctccgca gtacgtacgt cttgcttggt caaaactgaa aaacgctttg ctgtttgttt gatcggcaag agctggccgt gctttggca ccgcagtgcg tcgcctctgc cgcttttgcg 2555 aaacatttcc atgttgatcc tctggcggaa ctactttttc gcgtgcggtt tgcgtggcct 2615 tcctctcg tgaaaagagg tcgggtcaaa ccaaatggat cgcctcttg cagagcagcg 2675 gcagcagata gctggccgtc tcgcagcttt ggcagaaccg gtctgtggcc atctgtcgcc 2735 gcctgccacc gtttccctga tgtttgtttc tctctcgcct gccactgttt cttttcttgt 2795 tgcgcacgta cgtcgtcacc tcctcctact ttttgccag ttttgtttac ttttgatgaa 2855 atatacggat gaatcggctg gtgattaact ttggctgctg ctgttaatta ctgtggattt 2915 tggatgcag ga ccc gct ccc ccg gcc gct gtc agc agc ccc ccg ccc 2965 Gly Pro Ala Pro Pro Ala Ala Val Val Expensive Expensive Pro Pro Pro 110 115 120 ccg cct cca ccg tcc gcc gca cct cgc cgc aag cag ca gcg c 3008 Pro Pro Pro Pro Sister Ala Ala Pro Arg Arg Lys Gln Pro Ala 125 130 135 gtaagaacct ctccctctc ctctctct cctctcgcc tgcatctcgc tatgttatc 3068 catgtccata tgttgatcag ccttgtttag ttactaacat gtgcaccgga tcgggttctc 3128 gcag ac gac gca cca ccg ccg cca ccg ccg tcg agc gag aag ccg tcg 3176 His Asp Ala Pro Pro Pro Pro Pro Pro Ser Ser Glu Lys Pro Ser 140 145 150 tcc ccg ccg ccg tcc cag gac cac gac ggc gcc gcc ccc cgc gcc aag 3224 Ser Pro Pro Pro Ser Gln Asp His Asp Gly Ala Ala Pro Arg Ala Lys 155 160 165 gcc gcg ccc gcc cag gcg gcc acc tcc acg ctc gcg ccc gcc gcc gcc 3272 Ala Ala Pro Ala Gln Ala Ala Thr Ser Thr Leu Ala Pro Ala Ala Ala 170 175 180 gcc acc gcc ccg ccg ccc cag gcg ccg cac tcc gcc gcg ccc acg gcg 3320 Ala Thr Ala Pro Pro Pro Gln Ala Pro His Ser Ala Ala Pro Thr Ala 185 190 195 200 ccg tcc aag gcg gcc ttc ttc ttc gtc gcc acg gcc atg ctc ggc ctc 3368 Pro Ser Lys Ala Ala Phe Phe Phe Val Ala Thr Ala Met Leu Gly Leu 205 210 215 tac atc atc ctc tgagtcgcgc gccgaccccg cgagagaccg tggtccgtcc 3420 Tyr Ile Ile Leu 220 agtcgcagta gagtagagcg ctcgtcgtct cgttccgttt cgtgcctgtc gccgttcgag 3480 gttcgtttct gcgtgcagtc cggtcgaaga agccggtggg ttttgagtac tagtggtagt 3540 agtagcagca gctatcgttt ctgtccgctc gtacgtgttt gcgtggtcgc ggagaacaat 3600 taattgggtg tttgcgagtc ctctggttaa gatgaaccac tgatgctatg tgatcgatcg 3660 atcggtatga tctgaatgga aatggatcaa gttttgcgtt ctgctgatga tgtgatccat 3720 ttggatctgt gtggggcaac agtttcgctt gcttttgctc tgcgatgaac gaatgcttct 3780 tgcatgcatc ttgtctttgc ttaatttgaa ctgtagaacg gatgcagtac tgatttctgc 3840 ttatgatgtg acgattcgtc gtacgcatat catctcttca aatttgtgta gcagctgttt 3900 gtagcttcca ttctgctatg gacgaatgcc tgttttcac ggagaaccgc gcgcggggac 3960 cgatgcggct ttgtgttgcc atgttgttt ccacgccagg acaaaataga tggtgcggtt 4020 ttgatcccca atcccaccat caccatgttc cggagagcca catggaactc acgtcaagcg 4080 gtcacttttt gcagaatcac tcttaccatt ttaccctttt gttgaaacct ctctcctcat 4140 ccccaaaagt tgatgcaaca gtgctatgcg cgcccaccca tgctttttca tatgattgta 4200 aaatttggat cgattttatc ttttgaaccc taagtccggt ttacaatctg tttgcatgtt 4260 tatgttcctt gcggcgagga ccattaaaca agactactat tggatatatt tcgacaggct 4320 ttgaaatccg aattc 4335 <210> 8 <211> 1527 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 8 aagcttaaac catttagtta caaatatcga tgcacacctt cggtggggcg ttgtgaaaaa 60 gcatgttttt tgggtcgaca agcccctttt gcaacgtatc ctcttctaat cctattcaga 120 tcattaacat cataagctgc aattgacatg ctcttctgag gatcaggttc atgcaattaa 180 acatcataaa ctgcatcttt gatgtcatcc ttttcctata ttttttccag attattggct 240 tgcttcgttt tcaatatcag gttctatgat tcgacttctg ttgttgccag taataatttg 300 tagttgctgc ggaatatgaa ctcaggaga gctgatggtg ctgaagtt gatttgatgg 360 gaggttgttc tacacctgca cttgctgctc gacttaata catgccttgg atttctccc 420 agctctagta cataatattt ttcaattaa tgttccacga cataaaattt aaatccacaa 480 acatattttt agtacatgaa caatttcta atatagggca aacattttc atatacaaac 540 cgatcatttt atatatggt gaaatcagt gtaatatatg ctgaaatgtt ttcaataca 600 tattgaacat attatata aatggtgaac attatttttta attattgatg accatttta 660 aaatgcatat tgaacatttt atatataca ctgtacagtt ttatatat cgacgaacat 720 cttttggagt tctgaacatt ttttcaaaaacaagcca ttttccagga agaatacaaa 780 tgcaaaagaa atgagatatc aaaaaaaaaaaaaaaaaaaaacc 840 tacaggaaaa tccaaacaga aaagcaaag aagaacccg aactggggcca ggcaatgttt 900 ccaacggcct cgctcttcct gaacagaag gccagtcagc ccatggggctg ctcccagtac 960 tcgggccccg ctgtggcagc acgccatgta atagttttcg cgggaatcca acgccgaat 1020 cgcccgcagc gggaacccga cgtcggtctg gtgcgttctg gcgccttcca gaactctcca 1080 caggctcccg cagccgtccg atcagatcag cacgaagcac gaacattggc gcgcggcgat 1140 attttctttc ctcgcccgac gacggccgca ctgcatttca ttttgaattt caaaattcgg 1200 aaacggaata gctttctcgc atcccgaggc gaggcggtta cgggcgccag aggggccacc 1260 ccacccaccc acccccgccc tcacgtgccc cgcgcggccg aatccgggcc gtccgcgcgg 1320 acagctggcc gcgcccagcc cgaaccgacg cccaggatcg agcgagggcg gcgcgcccgg 1380 ggcttggctt agcgtccacg ccacctccgg ctatataagc cgccccacac ccgctccccc 1440 tccggcattc cattccgcca ccgcaccacc accaccacca aaccctagcg agcgagcgag 1500 ggagagagag accgccccgc cgcgacg 1527 <210> 9 <211> 4335 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 9 aagcttaaac catttagtta caaatatcga tgcacacctt cggtggggcg ttgtgaaaaa 60 gcatgtttt tgggtcgaca agcccctttt gcaacgtatc ctcttctaat cctattcaga 120 tcattaacat cataagctgc aattgacatg ctcttctgag gatcaggttc atgcaattaa 180 acatcataaa ctgcatcttt gatgtcatcc ttttcctata ttttccag attattggct 240 tgcttcgttt tcaatcag gttctatgat tcgacttg tgttgccag taataatttg 300 tagttgctgc ggaatatgaa ctcaggaga gctgatggtg ctgaagtt gatttgatgg 360 gaggttgttc tacacctgca cttgctgctc gacttaata catgccttgg atttctccc 420 agctctagta cataatattt ttcaattaa tgttccacga cataaaattt aaatccacaa 480 acatattttt agtacatgaa caatttcta atatagggca aacattttc atatacaaac 540 cgatcatttt atatatggt gaaatcagt gtaatatatg ctgaaatgtt ttcaataca 600 tattgaacat attatata aatggtgaac attatttttta attattgatg accatttta 660 aaatgcatat tgaacatttt atatataca ctgtacagtt ttatatat cgacgaacat 720 cttttggagt tctgaacatt ttttcaaaaacaagcca ttttccagga agaatacaaa 780 tgcaaaagaa atgagatatc caaaaagcaa aaaagaaaaa caaaacaaaa cagagaaacc 840 tacaggaaaa tccaaacaga aaaggcaaag aaagaacccg aactgggcca ggcaatgttt 900 ccaacggcct cgctcttcct gaacaagaag gccagtcagc ccatgggctg ctcccagtac 960 tcgggccccg ctgtggcagc acgccatgta atagttttcg cgggaatcca acgccgaaat 1020 cgcccgcagc gggaacccga cgtcggtctg gtgcgttctg gcgccttcca gaactctcca 1080 caggctcccg cagccgtccg atcagatcag cacgaagcac gaacattggc gcgcggcgat 1140 attttctttc ctcgcccgac gacggccgca ctgcatttca ttttgaattt caaaattcgg 1200 aaacggaata gctttctcgc atcccgaggc gaggcggtta cgggcgccag aggggccacc 1260 ccacccaccc acccccgccc tcacgtgccc cgcgcggccg aatccgggcc gtccgcgcgg 1320 acagctggcc gcgcccagcc cgaaccgacg cccaggatcg agcgagggcg gcgcgcccgg 1380 ggcttggctt agcgtccacg ccacctccgg ctatataagc cgccccacac ccgctccccc 1440 tccggcattc cattccgcca ccgcaccacc accaccacca aaccctagcg agcgagcgag 1500 ggagagagag accgccccgc cgcgacgatg gagagatccc gcgggctgct gctggtggcg 1560 gggctgctgg cggcgctgct gccggcggcg gcggcgcagc cggggcgcc gtgcgagccc 1620 gcgctgctgg cgacgcaggt ggcgctcttc tgcgcgcccg acatgccgac ggcccagtgc 1680 tgcgagcccg tcgtcgccgc cgtcgacctc ggcggcgggg tgccctgcct ctgccgcgtc 1740 gccgccgagc cgcagctcgt catggcgggc ctcaacgcca cccacctcct cacgctctac 1800 agctcctgcg gcggcctccg ccccggcggc gcccacctcg ccgccgcctg cgaaggtacg 1860 ttgtccgcct cctcccctcc ctcctccct ccctctctct ctacgtgctc gctttcctgc 1920 ttacctagta gtacgtagtt tcccatgcct tcttgactcg ctagaagtgc tccggtttgg 1980 gtctgttaat ttcctcgctg tactaccgga tctgtcgtcg gcacggcgcg cggcgtcggg 2040 tcctcgcctt ctcccgtggc gaccgacctg cgcagcgcgc gcgcggccta gctagcttca 2100 taccgctgta cctcgacata cacggagcga tctatggtct actctgagta tttcctcatc 2160 gtagaacgca tgcgccgctc gcgattgttt cgtcgattct agatccgtgc ttgttcccgc 2220 gagttagtat gcatctgcgt gcatatgccg tacgcacgca gatgcagagt ctgttgctcg 2280 agttatctac tgtcgttcgc tcgaccatat ttgcctgtta atttcctgtt catcgtgcat 2340 gcagtagtag tagccatgtc cacgccttct tgttttgagg cgatcatcgt cgagatccat 2400 ggctttgctt tctgcactat cttctgcctt gttttgttct ccgcagtacg tacgtcttgc 2460 ttggtcaaaa ctgaaaaacg ctttgctgtt tgtttgatcg gcaagagctg gccgtgcttt 2520 tggcaccgca gtgcgtcgcc tctgccgctt ttgcgaaaca tttccatgtt gatcctctgg 2580 cggaactact ttttcgcgtg cggtttgcgt ggccttcctc tctcgtgaaa agaggtcggg 2640 tcaaaccaaa tggatcgcct cttggcagag cagcggcagc agatagctgg ccgtctcgca 2700 gctttggcag aaccggtctg tggccatctg tcgccgcctg ccaccgtttc cctgatgttt 2760 gtttctctct cgcctgccac tgtttctttt cttgttgcgc acgtacgtcg tcacctcctc 2820 ctactttttt gccagttttg tttacttttg atgaaatata cggatgaatc ggctggtgat 2880 taactttggc tgctgctgtt aattactgtg gattttggat gcaggacccg ctcccccggc 2940 cgccgtcgtc agcagccccc cgcccccgcc tccaccgtcc gccgcacctc gccgcaagca 3000 gccagcgcgt aagaacctct ccctctccct ctctctctcc ctctcgcctg catctcgcta 3060 tgtttatcca tgtccatatg ttgatcagcc ttgtttagtt actaacatgt gcaccggatc 3120 gggttctcgc agacgacgca ccaccgccgc caccgccgtc gagcgagaag ccgtcgtccc 3180 cgccgccgtc ccaggaccac gacggcgccg ccccccgcgc caaggccgcg cccgcccagg 3240 cggccacctc cacgctcgcg cccgccgccg ccgccaccgc cccgccgccc caggcgccgc 3300 actccgccgc gcccacggcg ccgtccaagg cggccttctt cttcgtcgcc acggccatgc 3360 tcggcctcta catcatcctc tgagtcgcgc gccgaccccg cgagagaccg tggtccgtcc 3420 agtcgcagta gagtagagcg ctcgtcgtct cgttccgttt cgtgcctgtc gccgttcgag 3480 gttcgtttct gcgtgcagtc cggtcgaaga agccggtggg ttttgagtac tagtggtagt 3540 agtagcagca gctatcgttt ctgtccgctc gtacgtgttt gcgtggtcgc ggagaacaat 3600 taattgggtg tttgcgagtc ctctggttaa gatgaaccac tgatgctatg tgatcgatcg 3660 atcggtatga tctgaatgga aatggatcaa gttttgcgtt ctgctgatga tgtgatccat 3720 ttggatctgt gtggggcaac agttcgctt gctttgctc tgcgatgaac gaatgcttct 3780 tgcatgcatc ttgtctttgc ttaatttgaa ctgtagaacg gatgcagtac tgatttctgc 3840 ttatgatgtg acgattcgtc gtacgcatat catctcttca aatttgtgta gcagctgttt 3900 gtagcttcca ttctgctatg gacgaatgcc tgtttttcac ggagaaccgc gcgcggggac 3960 cgatgcggct ttgtgttgcc atgttgtttt ccacgccagg acaaataga tggtgcggtt 4020 ttgatcccca atcccaccat caccatgttc cggagagcca catggaactc acgtcaagcg 4080 gtcacttttt gcagaatcac tcttaccatt ttacccttt gttgaaacct ctctcctcat 4140 ccccaaaagt tgatgcaaca gtgctatgcg cgcccaccca tgctttttca tatgattgta 4200 aaatttggat cgattttatc ttttgaaccc taagtccggt ttacaatctg tttgcatgtt 4260 tatgttcctt gcggcgagga ccattaaaca agactactat tggatatatt tcgacaggct 4320 ttgaaatccg aattc 4335 <210> 10 <211> 241 <212> DNA <213> Hordeum vulgare <220> <221> Variants <222> (121)..(121) <223> a or c <400> 10 ttttacagca gcaacaacaa caacaaaacc caagtcacca gtaagagctt acacgcagcc 60 tgagggcggg cacgacacaa acgggtataa ggttgacacg tacatccaac acagggcaaa 120 maagttccgt ttcaaggggt cgcgagcccg gagttccacc gctggaatcg gtcaatccgg 180 ttctgcacac acacagccgt tacactgcct acaaacaagt ttaagggata catacacact 240 g 241 <210> 11 <211> 274 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (34)..(34) <223> c (Chris) or t (Gladius) <220> <221> Variants <222> (54)..(54) <223> g (Chris) or t (Gladius) <220> <221> Variants <222> (83)..(83) <223> t (Chris) or c (Gladius) <220> <221> Variants <222> (130)..(130) <223> g (Chris) or a (Gladius) <220> <221> Variants <222> (165)..(165) <223> a (Chris) or empty (Gladius) <220> <221> Variants <222> (174)..(174) <223> a (Chris) or t (Gladius, 173rd) <220> <221> Variants <222> (186)..(186) <223> t (Chris) or g (Gladius, 185th) <220> <221> Variants <222> (253)..(253) <223> t (Chris) or c (Gladius, 252nd) <400> 11 atgatggatg gacggatgat gctctgtggt gccytgtatt tatatttgtt gagktctttg 60 atacaggatg atatgtctcc aaygtatcta taattttttg ttgttccatg ttgttatatt 120 atcattttgr atgttttaca atcattttat aatcattcta tatcattttt tgtwactaac 180 ctattkacat agtgccaagt gctagttgtt gttttctgct tgttttttac atcgcaggaa 240 atcaatacca aayggagtcc aaacgcagca aaac 274 <210> 12 <211> 273 <212> DNA <213> Common wheat (Triticum aestivum) <400> 12 atgatggatg gacggatgat gctctgtggt gccttgtatt tatatttgtt gagttctttg 60 atacaggatg atatgtctcc aacgtatcta taattttttg ttgttccatg ttgttatatt 120 atcattttga atgttttaca atcattttat aatcattcta tatctttttt gttactaacc 180 tattgacata gtgccaagtg ctagttgttg ttttctgctt gttttttaca tcgcaggaaa 240 tcaataccaa acggagtcca aacgcagcaa aac 273 <210> 13 <211> 274 <212> DNA <213> Common wheat (Triticum aestivum) <400> 13 atgatggatg gacggatgat gctctgtggt gccctgtatt tatatttgtt gaggtctttg 60 atacaggatg atatgtctcc aatgtatcta taattttttg ttgttccatg ttgttatatt 120 atcattttgg atgttttaca atcattttat aatcattcta tatcattttt tgtaactaac 180 ctatttacat agtgccaagt gctagttgtt gttttctgct tgttttttac atcgcaggaa 240 atcaatacca aatggagtcc aaacgcagca aaac 274 <210> 14 <211> 415 <212> DNA <213> Aegilops speltoides <400> 14 accaggcctc ccgaccccac cgtgagcatg cgcttcgcgt gcacggcggc accactccgc 60 tacggcctcg gcccttcttc ttccttctcc gacaacgccg cctcctcgtg ttgttcttct 120 tcgtctcgga ttctatctac aaggagctag ctagctagcg cgattcactg atctctagct 180 ggggaggggt acaaccgtac aagcatggag cccggagctt tagcgacgtg cggggcggtg 240 gccttctcct gggagcagga gccgggggtg tccaaggaga gcccggcggc cgaggcgagg 300 aagccctccg gtggaaggac gccggacagc accaggaagg tggaggtgca gacggacagg 360 ctgctcgtgc cccctccacc gggagggccc ggagcgccgt ctctgtcgcc ggtga 415 <210> 15 <211> 281 <212> DNA <213> Triticum aestivum <220> <221> Variant <222> (224)..(224) <223> t (Chris) or a (Gladius) <220> <221> Variant <222> (229)..(229) <223> c (Chris) or a (Gladius) <220> <221> Variant <222> (253)..(253) <223> a (Chris) or c (Gladius) <400> 15 ttaatagtgt tccgccctgc gtggcacaga ccgtaacgaa tgattgtacg aacgtttttc 60 actaatcatt acataggtgt ggtttaagaa aaaatcaacc accttaacgc cgtaatcccc 120 tctacagaat aaccacacaa gtcatgaaaa ggaactatta acaaaaatag atgataaaat 180 aaatctcaaa tccaaattca taaagcacct ctagtctata aacwcgacma atctagctat 240 gtttagtact tcmtccgttc caaaatactt gtcgtggttt t 281 <210> 16 <211> 281 <212> DNA <213> Common wheat (Triticum aestivum) <400> 16 ttaatagtgt tccgccctgc gtggcacaga ccgtaacgaa tgattgtacg aacgtttttc 60 actaatcatt acataggtgt ggtttaagaa aaaatcaacc accttaacgc cgtaatcccc 120 tctacagaat aaccacacaa gtcatgaaaa ggaactatta acaaaaatag atgataaaat 180 aaatctcaaa tccaaattca taaagcacct ctagtctata aacacgacaa atctagctat 240 gtttagtact tcctccgttc caaaatactt gtcgtggttt t 281 <210> 17 <211> 281 <212> DNA <213> Common wheat (Triticum aestivum) <400> 17 ttaatagtgt tccgccctgc gtggcacaga ccgtaacgaa tgattgtacg aacgtttttc 60 actaatcatt acataggtgt ggtttaagaa aaaatcaacc accttaacgc cgtaatcccc 120 tctacagaat aaccacacaa gtcatgaaaa ggaactatta acaaaaatag atgataaaat 180 aaatctcaaa tccaaattca taaagcacct ctagtctata aactcgacca atctagctat 240 gtttagtact tcatccgttc caaaatactt gtcgtggttt t 281 <210> 18 <211> 199 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variant <222> (101)..(101) <223> t (Gladius) or c (Chris) <400> 18 atgctcatgg tgcacgcgac gagaagtggc cagagacaat ccttgaccat gatcgaataa 60 tatggctcgg ggatttgaat taccggatag cgctttccta ycgctctgtg aaggctttgg 120 ttgagatgca caattggaaa caattgttgg aaaaagatca gcttcgtata gagcaaaggt 180 ttggtcgggt attcgcggg 199 <210> 19 <211> 199 <212> DNA <213> Common wheat (Triticum aestivum) <400> 19 atgctcatgg tgcacgcgac gagaagtggc cagagacaat ccttgaccat gatcgaataa 60 tatggctcgg ggatttgaat taccggatag cgctttccta tcgctctgtg aaggctttgg 120 ttgagatgca caattggaaa caattgttgg aaaaagatca gcttcgtata gagcaaaggt 180 ttggtcgggt attcgcggg 199 <210> 20 <211> 199 <212> DNA <213> Common wheat (Triticum aestivum) <400> 20 atgctcatgg tgcacgcgac gagaagtggc cagagacaat ccttgaccat gatcgaataa 60 tatggctcgg ggatttgaat taccggatag cgctttccta ccgctctgtg aaggctttgg 120 ttgagatgca caattggaaa caattgttgg aaaaagatca gcttcgtata gagcaaaggt 180 ttggtcgggt attcgcggg 199 <210> 21 <211> 198 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variant <222> (101)..(101) <223> a (Gladius) or g (Chris) <220> <221> Variant <222> (165)..(165) <223> c (Gladius) or t (Chris) <400> 21 tatatgaatt aggctttgcg gaccggaagt acaacgccaa cttgcttggt gttcctgcac 60 tgctgcttga gaccttgatg tgcaaagtta tgaacatatc rgcgtaacta gggaaagtga 120 atatgtataa tactagcaaa caagttagat taggctaaat cgcgytattt tccggtgagc 180 tgggatttcc tggccagt 198 <210> 22 <211> 198 <212> DNA <213> Common wheat (Triticum aestivum) <400> 22 tatatgaatt aggctttgcg gaccggaagt acaacgccaa cttgcttggt gttcctgcac 60 tgctgcttga gaccttgatg tgcaaagtta tgaacatatc agcgtaacta gggaaagtga 120 atatgtataa tactagcaaa caagttagat taggctaaat cgcgctattt tccggtgagc 180 tgggatttcc tggccagt 198 <210> 23 <211> 198 <212> DNA <213> Common wheat (Triticum aestivum) <400> twenty three tatatgaatt aggctttgcg gaccggaagt acaacgccaa cttgcttggt gttcctgcac 60 tgctgcttga gaccttgatg tgcaaagtta tgaacatatc ggcgtaacta gggaaagtga 120 atatgtataa tactagcaaa caagttagat taggctaaat cgcgttatattt tccggtgagc 180 tgggatttcc tggccagt 198 <210> twenty four <211> 58 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (22)..(22) <223> t (Chris) or c (Gladius) <400> twenty four atgtggacct tggcaagatt tyatatgcat tttgagagaa atagaagtaa tgtgattg 58 <210> 25 <211> 56 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (27)..(27) <223> g (Chris) or a (Gladius) <400> 25 ggttttgggt ttactttgag tcatagraga agccatacta taaagagggg gttgct 56 <210> 26 <211> 53 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (31)..(31) <223> t (Chris) or g (Gladius) <400> 26 acttgattgt actttttggt tagcaacaat kgcaatgact tgacaaggga aag 53 <210> 27 <211> 50 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (30)..(30) <223> g (Chris) or c (Gladius) <400> 27 ctcgccttgg ctatagggtc ctctgtgags aaggaaaagg tcgaggaggc 50 <210> 28 <211> 59 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (38)..(38) <223> a (Chris) or g (Gladius) <400> 28 caacgctatc ccttaaaacg gatacactat ccatccgrga agcatgttcg gatgtgttg 59 <210> 29 <211> 39 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variant <222> (20)..(20) <223> a (Chris) or G (Gladius) <400> 29 ctcgccgccg cctgcgaagr tacgttgtcc gcctcctcc 39 <210> 30 <211> 1618 <212> DNA <213> Maize (Zea mays) <220> <221> CDS <222> (108)..(1430) <400> 30 ggcacgagcc ggcgagccca ctcggcagtc ggcacaacca cacacacctc cacccactct 60 ctgagataag tgaagcatct cgcgcactgt cgcagtcgca gacggag atg atg aag 116 Met Met Lys 1 cac tcg agc agc ttg tgc ttg ctc ttc ctc ttg gcg ctc tgc acc acc 164 His Ser Ser Ser Leu Cys Leu Leu Phe Leu Leu Ala Leu Cys Thr Thr 5 10 15 ctg ctg gcc tgc ggc ctg gtc cag gca caa gtc ctc ttc cag ggg ttt 212 Leu Leu Ala Cys Gly Leu Val Gln Ala Gln Val Leu Phe Gln Gly Phe 20 25 30 35 aac tgg gag tcg tgc aag cag cag gga ggc tgg tac aac agg ctc aag 260 Asn Trp Glu Ser Cys Lys Gln Gly Gly Trp Tyr Asn Arg Leu Lys 40 45 50 gcc cag gtc gac gac atc gcc aag gcc gcc gtc acg cac gtc tgg ctg 308 Ala Gln Val Asp Asp Ile Ala Lys Ala Gly Val Thr His Val Trp Leu 55 60 65 cct cca ccc tcg cac tcc gtc tcg CA ggc tac atg cca ggc cgc 356 Pro Pro Pro Ser His Ser Val Ser Pro Gln Gly Tyr Met Pro Gly Arg 70 75 80 cta tac gac ctg gac gcg tcc aag tac ggc acg gcg gcg gag ctc aag 404 Leu Tyr Asp Leu Asp Ala Ser Lys Tyr Gly Thr Ala Ala Glu Leu Lys 85 90 95 tcc ctg ata gcg gcg ttc cac ggc agg ggc gtg cag tgc gtg gcg gac 452 Ser Leu Ile Ala Ala Phe His Gly Arg Gly Val Gln Cys Val Ala Asp 100 105 110 115 atc gtc atc aac cac cgg tgc gcg gaa aag aag gac gcg cgc ggc gtg 500 Ile Val Ile Asn His Arg Cys Ala Glu Lys Lys Asp Ala Arg Gly Val 120 125 130 tac tgc atc ttc gag ggc ggg act ccc gac gac cgc ctg gac tgg ggc 548 Tyr Cys Ile Phe Glu Gly Gly Thr Pro Asp Asp Arg Leu Asp Trp Gly 135 140 145 ccc ggg atg atc tgc agc gac gac acg cag tac tcg gac ggg acg ggg 596 Pro Gly Met Ile Cys Ser Asp Asp Thr Gln Tyr Ser Asp Gly Thr Gly 150 155 160 cac cgc gac acg ggc gag ggg ttc gcg gcg gcg ccc gac atc gac cac 644 His Arg Asp Thr Gly Glu Gly Phe Ala Ala Ala Pro Asp Ile Asp His 165 170 175 ctc aac ccg cgc gtg cag cgg gag ctc tcc gcc tgg ctc aac tgg ctc 692 Leu Asn Pro Arg Val Gln Arg Glu Leu Ser Ala Trp Leu Asn Trp Leu 180 185 190 195 agg tcc gac gcc gtg ggg ttc gac ggc tgg cgc ctc gac ttc gcc aag 740 Arg Ser Asp Ala Val Gly Phe Asp Gly Trp Arg Leu Asp Phe Ala Lys 200 205 210 ggc tac tcg ccg gcc gtc gcc aga atg tac gtg gag agc acg ggg ccg 788 Gly Tyr Ser Pro Ala Val Ala Arg Met Tyr Val Glu Ser Thr Gly Pro 215 220 225 ccg agc ttc gtc gtc gcg gag ata tgg aac tcg ctg agc tac agc ggg 836 Pro Ser Phe Val Val Ala Glu Ile Trp Asn Ser Leu Ser Tyr Ser Gly 230 235 240 gac ggc aag ccg gcg ccc aac cag gac cag tgc cgg cag gag ctg ctg 884 Asp Gly Lys Pro Ala Pro Asn Gln Asp Gln Cys Arg Gln Glu Leu Leu 245 250 255 gac tgg acg cgg gcc gtc ggc ggg ccc gcc atg gcg ttc gac ttc ccc 932 Asp Trp Thr Arg Ala Val Gly Gly Pro Ala Met Ala Phe Asp Phe Pro 260 265 270 275 acc aag ggc ctg ctg cag gcg ggc gtg cag ggg gag ctg tgg cgg ctg 980 Thr Lys Gly Leu Leu Gln Ala Gly Val Gln Gly Glu Leu Trp Arg Leu 280 285 290 cgc gac agc tcc ggc aac gcg gcc ggc ctg atc ggg tgg gcg ccc gag 1028 Arg Asp Ser Ser Gly Asn Ala Ala Gly Leu Ile Gly Trp Ala Pro Glu 295 300 305 aag gcc gtc acc ttc gtc gac aac cat gac acc ggg tcg acg cag aag 1076 Lys Ala Val Thr Phe Val Asp Asn His Asp Thr Gly Ser Thr Gln Lys 310 315 320 ctc tgg ccg ttc cca tcc gac aag gtc atg cag ggc tac gcc tac atc 1124 Leu Trp Pro Phe Pro Ser Asp Lys Val Met Gln Gly Tyr Ala Tyr Ile 325 330 335 ctc acc cat cca gga gtc ccc tgc att ttc tac gac cac atg ttc gac 1172 Leu Thr His Pro Gly Val Pro Cys Ile Phe Tyr Asp His Met Phe Asp 340 345 350 355 tgg aac ctg aag cag gag ata tcc acg ctg tct gcc atc agg gcg cgg 1220 Trp Asn Leu Lys Gln Glu Ile Ser Thr Leu Ser Ala Ile Arg Ala Arg 360 365 370 aac ggc atc cgc gcc ggg agc aag ctg cgg atc ctc gtg gcg gac gcg 1268 Asn Gly Ile Arg Ala Gly Ser Lys Leu Arg Ile Leu Val Ala Asp Ala 375 380 385 gac gcg tac gtg gcc gtc gtc gac gag aag gtc atg gtg aag atc ggg 1316 Asp Ala Tyr Val Ala Val Val Asp Glu Lys Val Met Val Lys Ile Gly 390,395,400 aca agg tac ggc gtg agc agc gtg gtc ccg tcg gat ttc cac ccg gcg 1364 Thr Arg Tyr Gly Val Ser Ser Val Val Pro Ser Asp Phe His Pro Ala 405 410 415 gcg cac gcc aag gac tac tgc gtc tgg gag aaa gcg agc ctc cgc gtc 1412 Only His Gly Lys Asp Tyr Cys Val Trp Gly Lys Ala Ser Leu Arg Val 420 425 430 435 ccg gcg ggg cgc cac ctc tagcagctca gattgctcag tcttgtgctg 1460 Pro Ala Gly Arg His Leu 440 cattgcaaac acagcagcac icactgcat aacgtcttt ccttaatttc ctgaatttta 1520 ccttttccta gttcaatttc atatatgtat ttctacatgt acacactatc acaatcagat 1580 aaaaaaaaaaaaaaaaaaaaaaa 1618 <210> 31 <211> 441 <212> PRT <213> Zea mays <400> 31 Met Met Lys His Ser Ser Ser Leu Cys Leu Leu Phe Leu Leu Ala Leu 1 5 10 15 Cys Thr Thr Leu Leu Ala Cys Gly Leu Val Gln Ala Gln Val Leu Phe 20 25 30 Gln Gly Phe Asn Trp Glu Ser Cys Lys Gln Gln Gly Gly Trp Tyr Asn 35 40 45 Arg Leu Lys Ala Gln Val Asp Asp Ile Ala Lys Ala Gly Val Thr His 50 55 60 Val Trp Leu Pro Pro Pro Ser His Ser Val Ser Pro Gln Gly Tyr Met 65 70 75 80 Pro Gly Arg Leu Tyr Asp Leu Asp Ala Ser Lys Tyr Gly Thr Ala Ala 85 90 95 Glu Leu Lys Ser Leu Ile Ala Ala Phe His Gly Arg Gly Val Gln Cys 100 105 110 Val Ala Asp Ile Val Ile Asn His Arg Cys Ala Glu Lys Lys Asp Ala 115 120 125 Arg Gly Val Tyr Cys Ile Phe Glu Gly Gly Thr Pro Asp Asp Arg Leu 130 135 140 Asp Trp Gly Pro Gly Met Ile Cys Ser Asp Asp Thr Gln Tyr Ser Asp 145 150 155 160 Gly Thr Gly His Arg Asp Thr Gly Glu Gly Phe Ala Ala Ala Pro Asp 165 170 175 Ile Asp His Leu Asn Pro Arg Val Gln Arg Glu Leu Ser Ala Trp Leu 180 185 190 Asn Trp Leu Arg Ser Asp Ala Val Gly Phe Asp Gly Trp Arg Leu Asp 195 200 205 Phe Ala Lys Gly Tyr Ser Pro Ala Val Ala Arg Met Tyr Val Glu Ser 210 215 220 Thr Gly Pro Pro Ser Phe Val Val Ala Glu Ile Trp Asn Ser Leu Ser 225 230 235 240 Tyr Ser Gly Asp Gly Lys Pro Ala Pro Asn Gln Asp Gln Cys Arg Gln 245 250 255 Glu Leu Leu Asp Trp Thr Arg Ala Val Gly Gly Pro Ala Met Ala Phe 260 265 270 Asp Phe Pro Thr Lys Gly Leu Leu Gln Ala Gly Val Gln Gly Glu Leu 275 280 285 Trp Arg Leu Arg Asp Ser Ser Gly Asn Ala Ala Gly Leu Ile Gly Trp 290 295 300 Ala Pro Glu Lys Ala Val Thr Phe Val Asp Asn His Asp Thr Gly Ser 305 310 315 320 Thr Gln Lys Leu Trp Pro Phe Pro Ser Asp Lys Val Met Gln Gly Tyr 325 330 335 Ala Tyr Ile Leu Thr His Pro Gly Val Pro Cys Ile Phe Tyr Asp His 340 345 350 Met Phe Asp Trp Asn Leu Lys Gln Glu Ile Ser Thr Leu Ser Ala Ile 355 360 365 Arg Ala Arg Asn Gly Ile Arg Ala Gly Ser Lys Leu Arg Ile Leu Val 370 375 380 Ala Asp Ala Asp Ala Tyr Val Ala Val Val Asp Glu Lys Val Met Val 385 390 395 400 Lys Ile Gly Thr Arg Tyr Gly Val Ser Ser Val Val Pro Ser Asp Phe 405 410 415 His Pro Ala Ala His Gly Lys Asp Tyr Cys Val Trp Glu Lys Ala Ser 420 425 430 Leu Arg Val Pro Ala Gly Arg His Leu 435 440 <210> 32 <211> 55 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (30)..(30) <223> c (Gladius) or a (Chris) <400> 32 atcacattgc acaagttaat agtccggtam tgggtaatta cctttggact ttcca 55 <210> 33 <211> 61 <212> DNA <213> Common wheat (Triticum aestivum) <220> <221> Variants <222> (27)..(27) <223> a (Gladius) or t (Chris) <400> 33 tgtttctgct gcttgctctg cttatawaat gataatgata tgtgcgaatg gtctgttcat 60 g 61 <210> 34 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Flanking marker amplicon <400> 34 ggttttccct agtagtgtga ggrgaacgcc tcatcccact cgctc 45 <210> 35 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Flanking marker 007-0011.1 amplicon <400> 35 gtatatacta gtaaatcaat aaggtcgatr ctaaagatag aaaaatacct gaagtggtgc 60 c 61 <210> 36 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Amplicon <400> 36 ggcctaaaat ttgagcccga aggttgrgcc gggcttgggc ttga 44 <210> 37 <211> 79 <212> DNA <213> Artificial sequence <220> <223> Amplicon <400> 37 tcattttgaa tttcaaaatt cggaaacgga awagctttct cgcatcccga ggcgaggcgg 60 ttacgggcgc cagaggggc 79 <210> 38 <211> 196 <212> DNA <213> Common wheat (Triticum aestivum) <400> 38 tgtcgccgtt cgaggttcgt ttctgcgtgc agtccggtcg aagaagccgg tgggttttga 60 gtactagtgg tagtagtagc agcagctatc gtttctgtcc gctcgtacgt gtttgcgtgg 120 tcgcggagaa caattaattg ggtgtttgcg agtcctctgg ttaagatgaa ccactgatgc 180 tatgtgatcg atcgat 196 <210> 39 <211> 228 <212> PRT <213> Brachypodium distachyon <400> 39 Met Glu Arg Ser His His Leu Leu Leu Val Leu Gly Leu Leu Ala Ala 1 5 10 15 Leu Leu Pro Ala Ala Ala Ala Thr Phe Gly Thr Thr Gln Pro Glu Pro 20 25 30 Gly Ala Pro Cys Glu Pro Thr Leu Leu Ala Thr Gln Val Ser Leu Phe 35 40 45 Cys Ala Pro Asp Met Pro Thr Ala Gln Cys Cys Glu Pro Val Val Ala 50 55 60 Ser Val Asp Leu Gly Gly Gly Val Pro Cys Leu Cys Arg Val Ala Ala 65 70 75 80 Glu Pro Gln Leu Val Met Ala Gly Leu Asn Ala Thr His Leu Leu Thr 85 90 95 Leu Tyr Thr Ser Cys Gly Gly Leu Arg Pro Gly Gly Ala His Leu Ala 100 105 110 Ala Ala Cys Glu Gly Pro Ala Pro Pro Ala Ala Val Val Ser Ala Pro 115 120 125 Pro Pro Ser Ala Ala Pro Arg Arg Lys Gln Pro Ala His Glu Ala Pro 130 135 140 Pro Pro Pro Pro Ser Thr Glu Lys Pro Ser Pro Pro Pro Gln Gln Asp 145 150 155 160 Asn Val Thr Ala His Gly Lys Ala Ile Pro Thr His Ala Ala Thr Ser 165 170 175 Pro Leu Ala Pro Ala Ala Ser Met Ile His Met Ser Pro Pro Pro Ala 180 185 190 Cys Asn Pro Cys Ser Gly Ser Ala Ala Ser Ser Ala Glu Gly Pro Leu 195 200 205 Leu Ile Ala Ala Leu Leu Leu Val Ile Thr Ala Ile Ile Val Gly Thr 210 215 220 Leo Asp Asp Lys 225 <210> 40 <211> 228 <212> PRT <213> Rice (Oryza sativa) <400> 40 Met Glu Arg Ser His Leu Ala Val Leu Leu Gly Leu Leu Ala Phe Ala 1 5 10 15 Ala Gly Val Pro Ala Ala Ala Ala Ala Thr Ala Val Glu Gly Ala Gln 20 25 30 Ala Ala Thr Ala Glu Ala Ser Cys Glu Pro Ser Ile Leu Ala Thr Gln 35 40 45 Val Ser Leu Phe Cys Ala Pro Asp Met Pro Thr Ala Gln Cys Cys Glu 50 55 60 Pro Val Val Ala Ser Val Asp Leu Gly Gly Gly Val Pro Cys Leu Cys 65 70 75 80 Arg Val Ala Ala Glu Pro Gln Leu Ile Ile Ser Gly Leu Asn Ala Thr 85 90 95 His Leu Leu Thr Leu Tyr Ala Ala Cys Gly Gly Leu Arg Pro Gly Gly 100 105 110 Ala Arg Leu Ala Ala Ala Cys Glu Gly Pro Ala Pro Pro Ala Ser Ile 115 120 125 Val Thr Ala Pro Pro Pro Pro Val Ala Phe Arg Arg Lys Pro Pro Ala 130 135 140 Arg Glu Ala Pro Pro Pro Pro Pro Ala Ala Glu Lys Leu Ser Pro Pro 145 150 155 160 Pro Gln Gln His Asp Asp Ser Asp His Asn Lys Arg Val Gly Pro Leu 165 170 175 Pro Arg Gly Ser Pro Pro Pro Tyr Ala Gln Ser Val Pro Val Gly Pro 180 185 190 Ala Ala Ala Pro Pro Pro Pro Arg Ser Gly Ala Ser Ser Ser Leu Gln 195 200 205 Ala Pro Leu Ala Ala Thr Thr Thr Ile Val Ala Ile Thr Leu Ile Ala 210 215 220 Ala Ala Gln Tyr 225 <210> 41 <211> 902 <212> DNA <213> Hordeum vulgare <400> 41 cgcacatcaa cataaactca tcagatggga ataatcggat ctacgaagga cataaaactc 60 tttaatctca tgacaacgcc agaagagcaa gagtaaatat attctcataa aaaacaatga 120 acactagatg atgacgaaga acataagatt cttcaaggag aaattgcggc agcggagatg 180 gcagccggag gcgagggggc caaaaactct gttgcggcgg cagcggtagc cttggtgaaa 240 cccacacgtt tgcacaccat ataagttgtt tgcaagggtt acatgggcct cgctctcgtg 300 aaaaagaagg tcatacatgg gtcttggtct cgtgcaaaac gaaaggtcag cagtccatgg 360 gccggaggaa aaaccgggca acaacacgcc atgtgtgttt tcgcgggaac ccaattccga 420 aatcactcac cggcacctcg tcccgatgcc ttccagaacg ttctacgtgc ttccacaggg 480 ccagcccagc cgtgggatca gatcaggatc agcacgaaca ttgaagctag cgcggcgata 540 tttttcccag cctccgcctc gctcgacgac tgcatttcat ttcgaaaaca aaaaaaagag 600 ctttctcctt ctcatcccga gcgccagagg agcaccagaa aggccaccca cccaccctca 660 cgtaccgccc tcgcacccgc gcggccacat ctgggccgtc cacttgggca gctggccgtt 720 ccattcccga actgacgggc aggatcgagc gagcggcgcg cccacggctc ctccggctat 780 ataacccgcc acccacacca ctcccctccg gcgttccacc agagccttcc tccctccacc 840 gcaccaccac caccaccgcg ccaaaaaccc tagggagcga gcgagctcac ctcgccccgc 900 cc 902 <210> 42 <211> 4504 <212> DNA <213> Oryza sativa <220> <221> Exon <222> (1001)..(1363) <220> <221> Exon <222> (3093)..(3164) <220> <221> Exon <222> (3253)..(3505) <400> 42 gaacagtgca ctggttggga taacaagaag ttagaaattg ggcatatata tagaagggta 60 agacacctct aatggatagg gtggacaatc catcaaagat gactattttg gcacctctga 120 ggccgtgaca agttgcctat cttcgcaccc ttcacaagtg actccctact tgtgatgggt 180 cgtgagatgt gagccggtga tctttctcag atgtaaattt cggcctctca caagtgactc 240 cttatctgtg ataggtcttg ccctcacagc ctcatctgta acggcctcta attcaatccg 300 ttacagatta aatcattcat gacaagacac tttgacccat cataggtggg ttgttaatgt 360 tgaaccgagg tagcgtggtg gtggcttctt tgattgttga gcgggttgtg ttcttcatca 420 cttggtagga agtaggaacc caagaaggtt agaagcccac aactattata tcgtcggcct 480 cattggtaaa tgggctagaa gcctagaggc aatctgattc aatagtgtcg gaaatttgtg 540 gatgggccag agacgttgcg tcgtcttcga ctcttcgagt gcctggccta cggatctgca 600 cgaatcttag agcaagtaga aaatcgcata tcgtcgtgta gagcgcagca caaattcgag 660 ttgcttttcc ctttttcgca gccaaatctt acctgctcac gtgccgtgct gcccggtgtg 720 cagagcccac gcgccacgg gccagtgtac tacaccgaat cggcaccatc catcgccaca 780 gctggccggt cccccctaag acggacgctc cggatcaatc cacgttggca tggcttcccc 840 gcatcgcctt ctccgcgccc ccgcctatat aatggcgctc tcgcttctct tccccatttc 900 gtcttcccct tctctagagc cttcctctca cagagcacac acaaaaccct agagtaggaa 960 gcgagcgaga gagagagaga gagagagaga gaccacaccc atg gag cgc tcc cac 1015 Met Glu Arg Ser His 1 5 ctc gcc gtc ctg ctc ggc ctc ctc gcc ttc gcc gcc ggg gtc ccg gcc 1063 Leu Ala Val Leu Leu Gly Leu Leu Ala Phe Ala Ala Gly Val Pro Ala 10 15 20 gca gcg gcg gcc acc gcc gtg gag gga gcg cag gcg gcc acg gcg gag 1111 Ala Ala Ala Ala Thr Ala Val Glu Gly Ala Gln Ala Ala Thr Ala Glu 25 30 35 gcg tcg tgc gag ccc tcc atc ctc gcc acc cag gtc tcg ctc ttc tgc 1159 Ala Ser Cys Glu Pro Ser Ile Leu Ala Thr Gln Val Ser Leu Phe Cys 40 45 50 gcg ccc gac atg ccc acc gcg cag tgc tgc gag ccg gtg gtg gcc tcc 1207 Ala Pro Asp Met Pro Thr Ala Gln Cys Cys Glu Pro Val Val Ala Ser 55 60 65 gtc gac ctc ggc ggc ggc gta ccc tgc ctc tgc cgc gtc gcc gcc gag 1255 Val Asp Leu Gly Gly Gly Val Pro Cys Leu Cys Arg Val Ala Ala Glu 70 75 80 85 ccg cag ctc atc atc tcc ggc ctc aac gcc acc cac ctc ctc acg ctg 1303 Pro Gln Leu Ile Ile Ser Gly Leu Asn Ala Thr His Leu Leu Thr Leu 90 95 100 tac gcc gcc tgc gga ggc ctc cgc cct gga ggc gct cgc ctc gcc gcc 1351 Tyr Ala Ala Cys Gly Gly Leu Arg Pro Gly Gly Ala Arg Leu Ala Ala 105 110 115 gcc tgt gaa ggt acgtacatgc ataacctcct cctcctcctc ctcctctctc 1403 Ala Cys Glu Gly 120 tctctctctc tctctctctc tctctctctc tctctctctc tctctctctc tctctctctc 1463 tctctctctc tctctctctc tctctctctc tctctctctc tctcggttgg ggttgctgcc 1523 ttgcgttttt ggttggtttt tcgtgggttg ggcgagatcc ttcgagttgc ttgtgttttg 1583 tggtatgcta ggcttcgaac gagttgccgg cgttgctgtg tcgaccaact ctcgtatgct 1643 tatctttcag cacatgagtt ttggcctcgt ttttactcgg ttgttgtatg ctacttctga 1703 gatttgagtt catccactgc taaactgaca tcatagatga agaatagcag cggcgtttgg 1763 tcgattttga ttcctttctc tggatgttcg agctgatctt gtggttattg ctcgaagcct 1823 cgaaacgctt gcgcacatgc aagatccagc aacgtataga tctatagtgg tgttgtgctt 1883 ttattcggat ttgtggttca gtgtttacgt gcgaagtcac gcgttcgatg tttccgcttg 1943 agctccatat ctatagcaca aatcaatcat gtgcgttgcg cgagttcaag ctcgagagaa 2003 aagaaaagca tcaaggccac ggggggtttt tgggccaggt cgtgattctc ccttgaactc 2063 cgaatatacc gagtttatta tcttttgagc ggatttggtg ttgaactggc aggactcaaa 2123 acccacccgt gggacgatcg ttttcttttc ctttcgcttt gtgttctctg tctcctttcc 2183 gtgaaatctc tgcgtttccc ttctggtgct tgttatagat gattctggat cgagccgtgt 2243 atgctcgtgc agtggtacga cttggcgatg aacgtgcttg cggagctagt cgcagttcat 2303 ctttcttttt tttttccctc gtttcttttc tcggcgtttc attctctaca cctcttctac 2363 tcgccatgca tgttcatctc tctccgtgtt ggtcctcatt tggagccgat tcgaaccggg 2423 cagcacagtg ctttttttct gtttcgtttt ggaggtttcc actttcgtga aaaggaaagg 2483 gtcaaatcga atcgccccct gaaccatcct ttgcagagct tttttggacg tttccgcctt 2543 tcgtcagaga ccatctgcac tgcgcgtttc tccccaactc gatcgatttt gcagctttta 2603 atcacttttt agaaaaagtt tttaatcact cgtcatcgat gtgatctctt gctctaattg 2663 catcttctcc gtaggattag cacttccatg cttcttgttt tgtctgttca attagccaag 2723 aaacgagtca gtataccttc aagatgcatg cagatttaaa atcggcactg ctctttatct 2783 tgttcttgtt tttgcaagtt ttggttggtt caaaacttat ctcttctgca gcattgcctg 2843 ctgtgtacag aaagttggca ggggcatcgt gcagcttttt tgcctgctgt gtgtaacgtt 2903 ttctttccgt acgttgcgtt ccgtttcacg tcgcttacct ctgtttcttg gggcgcaagt 2963 tatggcagta cagccgttgt ttccacgttg gaaggacggt tttgcccctt cgcttccaga 3023 agcttccaga gatttttcga gtttttctaa tgtgtttgtt attgctgtaa ctcgttctaa 3083 cgtgcaggt ccc gcc cca ccg gcc tcc atc gtc act gcc ccg ccg ccc ccg 3134 Pro Ala Pro Pro Ala Ser Ile Val Thr Ala Pro Pro Pro Pro 125 130 135 gtt gct ttt cgc cgc aag ccg ccg gca cgt aaggctgatt gattcccctt 3184 Val Ala Phe Arg Arg Lys Pro Pro Ala Arg 140 145 catccactga ttgttaatgc gcgtgtaatc tttgtgatta ctaacttgct gctggatgct 3244 ttgcaggc gag gca cct ccc cca ccg ccg gcg gcc gag aag ctc tcc ccg 3294 Glu Ala Pro Pro Pro Pro Pro Ala Ala Glu Lys Leu Ser Pro 150 155 ccg cct cag cag cac gac gac tcc gac cac aac aag cgc gtc ggc cca 3342 Pro Pro Gln Gln His Asp Asp Ser Asp His Asn Lys Arg Val Gly Pro 160 165 170 175 ctc ccg aga ggc tct cct ccc ccg tat gcc cag tcc gtc ccg gtc ggc 3390 Leu Pro Arg Gly Ser Pro Pro Pro Tyr Ala Gln Ser Val Pro Val Gly 180 185 190 <h2 style=";text-align:left;direction:ltr">ccc gcc gcc gct ccc ccg cca cca cgc tcc ggc gcc tcc tcg tcg ctc 3438<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Pro Ala Ala Ala Pro Pro Pro Pro Arg Ser Gly Ala Ser Ser Ser Leu<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 195 200 205<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cag gcg ccc ctc gcc gcc acc acc acc atc gtt gcc atc acc ctc atc 3486<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Gln Ala Pro Leu Ala Ala Thr Thr Thr Ile Val Ala Ile Thr Leu Ile<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 210 215 220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcc gcc gcc cag tac tga g gacacgccgc cgccggcgcc cgctccccag 3535<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Ala Ala Ala Gln Tyr<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 225<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agccatgatt cgttcgcagt atttttcatc ctgttctttt gcttctctct ctggctaccc 3595<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atgtatatga gtttggaaga cgatgatttg atctagtagc gcgttaccaa gtttgcctag 3655<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> attcgagtag tagctgtggt actatgctga tgtctctttg atcgcgtcgt ctctagagcg 3715<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tccgccgttt ttgatcgatc actagcatgg ccgatgtgag tccagcatga aaagtggtcg 3775<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aggagaacat tgttgctaag tttttttttt gctttctatc tccagtagct gaacaagtat 3835<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtcaactgaa tgctgcaatg aagtgaatgg atgcagtctt aaatttagcc tttctgttgc 3895<h2 style=";text-align:left;direction:ltr"> caacttcttc ctctgttctg tacggttcag atgctgcttg ttctgtttat gcgatggtgt 3955 tgcattgttg tgatgtgtga agtgcgccca attctgggtg aactctgcag tattggcaag 4015 ctctgatcga tacataaaga actgaaatgt gccggcttct ccgcctcccg ttgcatgctc 4075 ttgtgcgcga gctgcacagc gcaaccgcgc cctcctctgc acatccatcg acacaaagtc 4135 tcaagttgtt gcgcgtgtgc tctaccaggc accgtggctc ctgcgggcgt gcacgggtca 4195 cattcacatc gcacccaagt tgcggacgtt tcagctgagc acctaccatc cgcaatgttt 4255 gcccacagct tgctcgatga aatgactggt tcatgtcaaa aggtaaaaac tgacattctc 4315 acgcggtaaa ttcccctaag cttcatagac caccgcactg tcatccactc gacctgccac 4375 gacacccgcc accgcagaac gcgacaccct gtgcccacgg ccacctaccc tggcacgcac 4435 cgagccgaag ccggataagc acccgagttg atccccatga gacgtggcga ctcggctgcc 4495 ctctgccac 4504 <210> 43 <211> 684 <212> DNA <213> Rice (Oryza sativa) <400> 43 atggagcgct cccacctcgc cgtcctgctc ggcctcctcg ccttcgccgc cggggtcccg 60 gccgcagcgg cggccaccgc cgtggaggga gcgcaggcgg ccacggcgga ggcgtcgtgc 120 gagccctcca tcctcgccac ccaggtctcg ctcttctgcg cgcccgacat gcccaccgcg 180 cagtgctgcg agccggtggt ggcctccgtc gacctcggcg gcggcgtacc ctgcctctgc 240 cgcgtcgccg ccgagccgca gctcatcatc tccggcctca acgccaccca cctcctcacg 300 ctgtacgccg cctgcggagg cctccgccct ggaggcgctc gcctcgccgc cgcctgtgaa 360 ggtcccgccc caccggcctc catcgtcact gccccgccgc ccccggttgc ttttcgccgc 420 aagccgccgg cacgcgaggc acctccccca ccgccggcgg ccgagaagct ctccccgccg 480 cctcagcagc acgacgactc cgaccacaac aagcgcgtcg gcccactccc gagaggctct 540 cctcccccgt atgcccagtc cgtcccggtc ggccccgccg ccgctccccc gccaccacgc 600 tccggcgcct cctcgtcgct ccaggcgccc ctcgccgcca ccaccaccat cgttgccatc 660 accctcatcg ccgccgccca gtac 684 <210> 44 <211> 5291 <212> DNA <213> Brachypodium distachyon <220> <221> Exon <222> (2069)..(2419) <220> <221> Exon <222> (3818)..(3887) <220> <221> Exon <222> (4026)..(4288) <400> 44 cccttaaaag ggggtaatga tggctcatat tgaggaattg acatgcaccc cttaaaggag 60 gtaatgatgg ctcatattga tttgaggaaa ctccttccat aaggacatct ccaacaagac 120 acagtcagcg gtactataaa gcacggcacc tggatcagtt ctcgtcgagg gtgcagacga 180 cgattgcagt gaatatgatg actatcgcgg cgacgaggag ggggggcagt ggggacggct 240 gaggtgcatc ctctgccaaa ttaaagcacg cgcgcgtgcc acgcgagtca gatcaaggac 300 acgcaaaaca gataacatat taacaggaag caacgcatag atttttagaa tcgagtaaaa 360 gaatagcagc agcatttttt ttagcgaaat agtagcagca attagatcaa gcgaaatgta 420 aaggttgttc acataccaac aagggcggcg gtgtggggcg ggacattgac ctccggggcc 480 tcctccagggg cctgcggcgc ctgctgggcc tcgacaatg cagtcaggct gcaagaatg 540 agggtaaaa aacagatgta cagtccggtc aagaaaaaaaaacatgc agactactta 600 gatctgccaa gactaatta cctaacgatt ccaagtccag tgatggttgc atcgcgatga 660 atttcagcca tgctgcgtgc ccgcctggtt accggacgcg cgggaagggg agcaagccca 720 atcagagcgg gtgcagccgg gcggcgtgtg ttattgcgat atactcgac ggtatgcttc 780 caccgcaggt acagtctcag gaaggcatcc cattgaccca ccagatcatc tatcaccaag 840 gtagccattc tgccaccat ctaaaacacaa actgagagta agaagcagt ttgaccgcga 900 ttgtttatca caaaaggcaa cacaaaaaa ctgctagctt cgtgtcagaa atcacatg 960 catggtgcgc cagagtacaa cagaaacatg gggagacata gcagaaacgt cacaaccaa 1020 aatccaaaaa aagaaggaga tgcactgcgt aagaaaacag cacgggaagc gctctcacc 1080 gtgtgagact gcacaagtcc aagagacgac atagcagaa aagaactgca gaaggagag 1140 ctgctttcgg gggtcaagt actagcacgg ctcgatcaa tcggtcgatt aaatccctcg 1200 tgccaccgag atcctcacag tgctcgaggg gacactctaa gtcggctttg tcacatccaa 1260 cccaaacaac acgctcttgt ctaaggtgct caacaaaggt gatgtgttcg cacgcaggca 1320 cagtggaaca acaaactagc gtcgatcgac cacgtccctc ccccagaaaa gtgctcccaa 1380 catgatcgca tcgaagtaat cgtagagata gatcttacag aataaaaaat aaacccaaac 1440 caaaggagga gttctgcact actagatccg aaccaaagcc aggaaatagc aaactaaaca 1500 caaaagatat cgatgaaatc atacatcgtc caaacgtttc ggattacacc ttctggtcgc 1560 aactctcgtg ctcaccgcgc agacagatct tctgtacgta ccttggctcc agcccgagga 1620 gagcgagcac tccaggaaac ggcggtctcg agcgagcagt ctaggaaatg gcggtcgcga 1680 tggaaaagcc ttcaagagat atcgggtgat gccccctatt tctagagctc tggcctttac 1740 agttcaccac ttcaccctgc gccatcccga ttcccagtac ctatgacgag cgacgaccct 1800 cacgtgcctg gccagcatca cgggagagaa tcttgctcag catctcaacc gcccaaacag 1860 acagctgtcc ggtcccaccc aaatggacgc acaggatcga tcgggccgcc ggtggcctgt 1920 ccttggctaa cccttcacgc ctcttcgtcc cctccgccta tataatccca ccccgctccg 1980 cttcttcccc caccgcgctc tcttcctctg gactcacacc aactcgccta gccctagcgg 2040 taggaagcga aagcgagaga tcccaccc atg gag aga tcc cac cac ctc ctc 2092 Met Glu Arg Ser His His Leu Leu 1 5 ctc gtg ctc ggc ctc ctc gcc gcg ctg ctc ccg gcg gcc gcg gct acc 2140 Leu Val Leu Gly Leu Leu Ala Ala Leu Leu Pro Ala Ala Ala Ala Thr 10 15 20 ttc ggg acg acg cag ccg gag cct ggg gcc cca tgc gag ccc acc ctc 2188 Phe Gly Thr Thr Gln Pro Glu Pro Gly Ala Pro Cys Glu Pro Thr Leu 25 30 35 40 ctc gcc acc cag gtc tcg ctc ttc tgc gcg ccg gac atg ccg acc gcg 2236 Leu Ala Thr Gln Val Ser Leu Phe Cys Ala Pro Asp Met Pro Thr Ala 45 50 55 cag tgc tgc gag cct gtg gtg gcc tcc gtc gac ctc ggg ggt ggc gtc 2284 Gln Cys Cys Glu Pro Val Val Ala Ser Val Asp Leu Gly Gly Gly Val 60 65 70 ccc tgc ctc tgc cgt gtc gcc gcc gag ccg cag ctc gtc atg gcc ggc 2332 Pro Cys Leu Cys Arg Val Ala Ala Glu Pro Gln Leu Val Met Ala Gly 75 80 85 ctc aac gcc acc cac ctc ctc acg ctc tac acc tcc tgc ggt gga ctc 2380 Leu Asn Ala Thr His Leu Leu Thr Leu Tyr Thr Ser Cys Gly Gly Leu 90 95 100 cgc ccc gga ggc gcc cac ctc gcc gcc gcc tgt gaa ggt acgcgacgcc 2429 Arg Pro Gly Gly Ala His Leu Ala Ala Ala Cys Glu Gly 105 110 115 tgcgtctctc tctctctctg cgtctctctc tgcgtctctc ccatgacgag caactcgcga 2489 tacgccttac tgccttattt tttttgaaga tatgtgtctg cttggtccac tgtatttggg 2549 ttcttctttc gagaagttca tccgtaggca tctataatcc gacgagttcg gatgagatca 2609 aacagtgaca cgcgcgacac caacgttttc aacgatctct tgctgtttgg tttgatattt 2669 cctgcttccc atgatctatt ttcaaccttt tttgtatggc tttcgctcca atctcgtgca 2729 gaaccatatt tcatcttggg tttatgctgt tctgtaagat ctagcgccat gcagaggtca 2789 tttctgctgt tccagacccc ctacgtgaca tttgctgttt ttcctctttg ttgccatggc 2849 cacgggttgg tttttacgaa agatactttg atatgtcaag atctgcgagc actttgaaac 2909 cccaacgcat tttctatgtg ttttgtgctg tttgatcgac cgattgatcg aggccgtgct 2969 agtactttga cacccgaaag catctctcct ttctgcagta tcttttctgt tcttgtcgtc 3029 tcttgggctt gtgcagttta ccatggtgaa gagcgcttca tacacgatct gccgcgaggc 3089 cagagcaaaa gcttcccgtg ctttttcttg cacagtgcat ctccttcttt tttgcctttt 3149 tcgtttggac gtttctgctt cgtctcccca tgtttctgtt gtactgtcgc gcaccatgca 3209 tgttgatttt ctgatacgaa gctagtactg ctctgcagtt tttgtgtagc cttcctcttt 3269 cgtgataaag aacgtggtca aactgctctc tgactctgtt cgtctaaatc tttttctcgc 3329 aggaaaattt tcgttgcaga tctcctttac cctcgtcctc cgcatctgtt tgctttacct 3389 gctgtagttg cgttcttcgt ttgaatcaaa ttcttgtttc cttcttttat cccatcgctc 3449 gtttagttac cttttctttt tattgaactt tagttcattg gtgtagtagg cagtagtatg 3509 ctttgcgtg tttgcggagt agcaattgaa ttgctctccg gtctctgcag agcggcccgc 3569 tgaacagata gctggctgca gcagctttac cagaatcggt cggttacgaa cttacgatta 3629 tacccttcgt cttgctttca tttactggta gcctgctagt cttttcttgt tgcgcacgta 3689 atcgtaccca gtactgtacg cttagataaa atagacgggt ctggccttaa attatttcgt 3749 tgcgttttcg aattttgaat tccggaagtt aactttattt tgtgctctgt ttggacgcat 3809 gtgcaggt cca gct cct ccc gcc gcc gtc agt gcc cct ccc ccc tcc 3859 Pro Here Pro Pro Here Here Val Val Expensive Here Pro Pro Pro Expensive 120 125 130 gcc gca cct cgc cgc aag cag cca gca c gtacgaacaa ccttttacac 3907 Ala Ala Pro Arg Arg Lys Gln Pro Ala 135 140 ttcgcttgat ctaattgctg ctgctatact ctcttactcg attctaaatc tatgttttgc 3967 tcattattaa tatgttgatc tgactcgtgt ggcacgcgcg cgtgctttga ttcgcag 4025 ac gag gca cct ccg cct ccg ccg tcg act gag aag ccg tcc ccg ccg 4072 His Glu Ala Pro Pro Pro Pro Pro Ser Thr Glu Lys Pro Ser Pro Pro 145 150 155 cct cag cag gac aac gtc acc gcc cac ggc aag gca atc ccc acc cat 4120 Pro Gln Gln Asp Asn Val Thr Ala His Gly Lys Ala Ile Pro Thr His 160 165 170 gcg gcc aca tcc ccg ctc gcg ccg gct gct tcc atg atc cac atg tcc 4168 Ala Ala Thr Ser Pro Leu Ala Pro Ala Ala Ser Met Ile His Met Ser 175 180 185 cca ccg ccc gca tgc aat cca tgc tcc ggc tcc gcc gct tcc tca gcc 4216 Pro Pro Pro Ala Cys Asn Pro Cys Ser Gly Ser Ala Ala Ser Ser Ala 190 195 200 gag ggg ccc ctc ctc atc gcc gcg ctc ctc ctc gtc atc acc gcc atc 4264 Glu Gly Pro Leu Leu Ile Ala Ala Leu Leu Leu Val Ile Thr Ala Ile 205 210 215 220 atc gtc ggc acc ctc gac gat aag tgatccagga gccgtccgcc ccctccgact 4318 Ile Val Gly Thr Leu Asp Asp Lys Free Mp3 Download 225 caccaacgtc cgactatgat ccagttgcag tagtggtctt gttctgtttc atgtttctcg cctttggtt ccgagatttc fathercgtgc ctagtcgtag ctgtagcagt cagtatgttc 4438 atgtgtccac aagatgtggt cgagtataac attgggtttc atgattcctc tagcagatga aacactatgt gatgtgatct gaatggatgc agttttgcta ccttttctgc tgctatgata 4558. tgcttatcca tatgtttatc tttcattccc ttaatttgtg cggtttagcg ttgtgttgcc 4618 atgaatgcct cttgctctgc tttgcgggtt gcattttgtc ttcgttctgc tgtatatttg attctgaatt tgcatgctgt gagtactaag tactgactac aatctctgga tggttttgaa atttgaatga tgttataaag gagagctagc tggggaattg cctcacctct aaactccaaa acacagagca gaagttggcc tcaagatcca acttggtcac tttgcatgtc ggagcattgt agcaattctg caataaacgg agtagttctg ttagcatgtt gtttttacac tgtcagtaca agtagaggtc gatgattat tatattccgg ttgtttgctg ctggcttccc agttccctcc aggtaggaag gaaccgtatc cgggtagtag ccagtagtag ccaggaagct actagcagaa 5038 cagtcttctg gtgctctttt tttggagtaa cgtcttctcg cgatcttttt cgagtaattc 5098 aaatccgggt ataccgagcc ttgtatcagt gagagccgat agtcttaatt atctccagca 5158 caggcacagg aacaaccacg tttgtttttc agaatgcaca gcaacatttt ttttaagagc 5218 atggcacagc tacttttttt ttttttaagg aaacatggca cagctacatt tttttttaga 5278 ggaacatggc aca 5291 <210> 45 <211> 684 <212> DNA <213> Brachypodium distachyon <400> 45 atggagagat cccaccacct cctcctcgtg ctcggcctcc tcgccgcgct gctcccggcg 60 gccgcggcta ccttcgggac gacgcagccg gagcctgggg ccccatgcga gcccaccctc 120 ctcgccaccc aggtctcgct cttctgcgcg ccggacatgc cgaccgcgca gtgctgcgag 180 cctgtggtgg cctccgtcga cctcgggggt ggcgtcccct gcctctgccg tgtcgccgcc 240 gagccgcagc tcgtcatggc cggcctcaac gccacccacc tcctcacgct ctacacctcc 300 tgcggtggac tccgccccgg aggcgcccac ctcgccgccg cctgtgaagg tccagctcct 360 cccgccgccg tcgtcagtgc ccctcccccc tccgccgcac ctcgccgcaa gcagccagca 420 cacgaggcac ctccgcctcc gccgtcgact gagaagccgt ccccgccgcc tcagcaggac 480 aacgtcaccg cccacggcaa ggcaatcccc acccatgcgg ccacatcccc gctcgcgccg 540 gctgcttcca tgatccacat gtccccaccg cccgcatgca atccatgctc cggctccgcc 600 gcttcctcag ccgaggggcc cctcctcatc gccgcgctcc tcctcgtcat caccgccatc 660 atcgtcggca ccctcgacga taag 684 <210> 46 <211> 951 <212> DNA <213> Triticum aestivum <400> 46 tcgcgcgccg accccgcgag agaccgtggt ccgtccagtc gcagtagagt agagcgctcg 60 tcgtctcgtt ccgtttcgtg cctgtcgccg ttcgaggttc gtttctgcgt gcagtccggt 120 cgaagaagcc ggtgggtttt gagtactagt ggtagtagta gcagcagcta tcgtttctgt 180 ccgctcgtac gtgtttgcgt ggtcgcggag aacaattaat tgggtgtttg cgagtcctct 240 ggttaagatg aaccactgat gctatgtgat cgatcgatcg gtatgatctg aatggaaatg 300 gatcaagttt tgcgttctgc tgatgatgtg atccatttgg atctgtgtgg ggcaacagtt 360 tcgcttgctt ttgctctgcg atgaacgaat gcttcttgca tgcatcttgt ctttgcttaa 420 tttgaactgt agaacggatg cagtactgat ttctgcttat gatgtgacga ttcgtcgtac 480 gcatatc tcttcaaatt tgtgtagcag ctgtttgtag cttccattct gctatggacg 540 aatgcctgtt tttcacggag aaccgcgcgc ggggaccgat gcggctttgt gttgccatgt 600 tgttttccac gccaggacaa aatagatggt gcggttttga tccccaatcc caccatcacc 660 atgttccgga gagccacatg gaactcacgt caagcggtca ctttttgcag aatcactctt 720 accattttac ccttttgttg aaacctctct cctcatcccc aaaagttgat gcaacagtgc 780 tatgcgcgcc cacccatgct ttttcatatg attgtaaaat ttggatcgat tttatcttttt 840 gaaccctaag tccggtttac aatctgtttg catgttatg ttccttgcgg cgaggaccat 900 taaacaagac tactattgga tatattcga caggctttga aatccgaatt c 951 <210> 47 <211> 1000 <212> DNA <213> Hordeum vulgare (Hordeum vulgare) <400> 47 tggccgaccc ccaaggcagc agagtacttg tcatctgatt ccgtttcatg cttgtcgccg tttgttgagg ttcgtttctg cagtccgaac aagacggtgg ggttttgatc gggtacccag atttctatgt cgatcgcgcg tactagtact agtagttgct tagcagatga acgaacattg ggttttggga ttcctctagc tgatgaacca ctgctatttt ccatgtgatc gatggatatg atctgaatgg atggatgaag ttttggtttc tgatgctgat gatgtgctgc ttcttcattt gcatgctcga tctattcctt caattttgtg gagcaacagt ttgtttagct tctgttctgc 360 420. gccgcttgca tcttgtcatt gctgataatc tgcttaatgc agacattgct 480. tccgtcccaa acaatctgtt gcttaccagg taatgcatat aatctgtacc tcaccttcgc acaacaacag aagctaccct gctaaaaaaa cacacacaca cacacaaaaa aaacagaagc tggtctcaca cggaagccgc ttcggggact gtttgcagct ttttattgcc attttgtttt 600 tcatgcaggt acaaatcgag ggtgttgctt gatttgatca tggatgatca cttagagcaa catgtgtgtt ttgtctgtgt tttattcgtt gctcgtccat ccaatttaaa cttgaaatgg 720 atcgtgtgtg gataaaagaa gacgtgcgtc agtttgaatc gacgcgttgg gttatatttt 780 gtgtctgtga cgaccgaaac gaagacaaaa tatatcgtcc ggttagaatt gctctaatgc 840 tagctttctc tcctaccatc gcattccgtg gtaggaaaaa gtactagaac cacaggaaac 900 tggaacgcaa gaaaagcata tctaccgttg gccgttgatc ttgtttcaca ttcggtatgg 960 ctccggtcat attgttggag attcacattc atgcacgcaa 1000 <210> 48 <211> 54 <212> DNA <213> Common wheat (Triticum aestivum) <400> 48 cctgcgaagg tacgttgtag ccccccgccc ccgcgcccag tgctgcgagc ccgt 54 <210> 49 <211> 54 <212> DNA <213> Common wheat (Triticum aestivum) <400> 49 cctgcgaaga tacgttgtag ccccccgccc ccgcgcccag tgctgcgagc ccgt 54 <210> 50 <211> 53 <212> DNA <213> Common wheat (Triticum aestivum) <400> 50 cctgcgaagg tacgttgtag ccccccaccc cgcgcccagt gctgcgagcc cgt 53 <210> 51 <211> 54 <212> DNA <213> Common wheat (Triticum aestivum) <400> 51 cctgcgaagg tacgttgtag ccccccgccc ccgcgcccag tgctacgagc ccgt 54

Claims

1. A method for identifying and / or selecting wheat plants that are homozygous or heterozygous for a mutation in the Ms1 gene, wherein the mutation induces nuclear recessive male sterility, the method comprising: a. detecting at least one marker allele that is linked to and associated with a mutation in Ms1; as well as b. selecting plants having said at least one marker allele, wherein the marker allele linked to and associated with the mutation in Ms1 is an allele at the following markers: ET0487 shown in SEQ ID NO:24, ET0488 shown in SEQ ID NO:25, ET0489 shown in SEQ ID NO:26, ET0490 shown in SEQ ID NO:27, ET0491 shown in SEQ ID NO:28, ET0495 shown in SEQ ID NO:29, 007-0033.1 shown in SEQ ID NO:32, or 007-0046.1 shown in SEQ ID NO:33; and wherein the mutation is ms1d, ms1e or ms1f. 2 . The method of claim 1 , wherein the marker allele is linked to a mutation in the Ms1 gene and is associated therewith at 5 cM.

3. The method of claim 1, wherein the marker allele is linked to a mutation in the Ms1 gene and is associated therewith at 1 cM.

4. The method of claim 1, wherein the wheat plant is homozygous or heterozygous for a mutation in an endogenous Ms1 gene. The method according to claim 4 , wherein the endogenous Ms1 gene encodes the polypeptide of SEQ ID NO:

5.

6. The method of claim 4, wherein wheat plants homozygous for the endogenous Ms1 mutation are pollinated by pollen donor plants to produce wheat F1 hybrids.

Images