Treatment of ciliary diseases

Abstract

The present disclosure provides a pharmaceutical composition comprising polyribonucleotides for treating a ciliary disease of a subject suffering from a ciliary disease, wherein the polyribonucleotide encodes a functional version of a protein whose defect is associated with the ciliary disease, and wherein the pharmaceutical composition is administered to the respiratory system of the subject when the subject exhibits inflammation of the respiratory system. Further, the present disclosure relates to a method for analyzing the effect of polyribonucleotides on ciliogenesis, wherein the polyribonucleotides encode proteins involved in ciliogenesis and / or required for ciliogenesis.

Description

[0001] The present invention relates to a pharmaceutical composition comprising polyribonucleotides for treating a ciliopathy in a subject suffering from a ciliopathy, wherein the polyribonucleotides encode a functional version of a protein whose defect is associated with the ciliopathy, and wherein the pharmaceutical composition is administered to the respiratory system of the subject when the subject exhibits inflammation of the respiratory system. The present invention further relates to a method for analyzing the effect of polyribonucleotides on ciliogenesis, wherein the polyribonucleotides encode proteins involved in ciliogenesis and / or required for ciliogenesis.

[0002] Oxygen is a matter of life and death for many multicellular organisms because it is essential for the energy supply of cells. In mammals, the oxygen contained in the air can enter the organism through the respiratory system, which refers to the organs involved in breathing. These organs include, for example, nose, throat, larynx, trachea, bronchi and lungs. In the latter, the gas from the environment is exchanged with the gas contained in the internal blood circulation system, so that oxygen is transported from the lungs to the cells in the different parts of the organism. However, in addition to the required oxygen, other components can also enter the organism through the respiratory system, and other components such as irritants contained in the air include pollutants, pathogenic agents and pathogens, such as viruses and bacteria. Therefore, there are defense mechanisms such as cough reflex and sneezing, which are used to discharge irritants from the respiratory system. In order to discharge, the irritant is embedded in the sticky mucus secreted by the epithelial cells in the respiratory system, and then transported through (traversing, crossing, across) the epithelial surface by ciliated cells.

[0003] Ciliated cells can transport mucus and irritants through the epithelial surface by the synchronous beating of multiple motile cilia. Cilia are tubular structures wrapped by membranes, which extend from the epithelial surface to the space of the respiratory system in contact with the environment. In the cell, the axoneme of cilia is anchored to the matrix by an anchoring structure. The axoneme is the central bundle of microtubules, in which nine external double microtubules surround the central pair of single microtubules (i.e. in respiratory cilia). External double microtubules and central pairs of microtubules are connected by radiating rays. Each of the nine external double microtubules is composed of A tubules and B tubules, in which double microtubules are interconnected in a circumferential direction by a nexin-dynein regulatory complex. The inner dynein arm and the outer dynein arm are connected to each A tubule. These dynein arms contain motor proteins that can walk along microtubules, causing cilium bending and thus cilium beating (see, e.g., Lodish et al., 2000, Molecular Cell Biology, 4th ed., New York: WH Freeman, Section 19.4). Studies of ciliary structure using a Trypanosoma brucei model have shown that some of these structural components exhibit rapid turnover, while the skeletal components of the radial spokes, central pair, and outer dynein arms are primarily integrated at the distal end of the ciliary structure during development (Vincensini et al., Biol Cell, 2018, 110: 1-15).

[0004] Since the synchronous beating of ciliated cells is essential for the transport of fluid across the epithelial surface, perturbations of the ciliary structure can lead to serious obstacles. Motility defects (including reduced beating amplitude and / or frequency and / or asynchrony) can occur due to, for example, the reduction or loss of dynein arms, the disintegration of microtubule arrangement (including mislocalization) and changes in the total number of microtubules per axoneme and combinations thereof. As far as is known, changes in these functional axoneme elements are caused by potential genetic defects. This is mainly due to changes in the sequence of genes (including the above-mentioned genes) encoding axoneme components. Since genes can be transcribed into polyribonucleotides, such as mRNA, and polyribonucleotides can be translated into proteins, the DNA sequence of genes affects the synthesis of corresponding proteins in terms of quantity and function. Since ciliary disorders (i.e., ciliary diseases) caused by sequence changes are hereditary, they are related to ciliary motility defects at all developmental stages, including embryos or newborns, and ciliary diseases may have serious consequences for organisms.

[0005] A well-known example of a ciliary disorder is primary ciliary dyskinesia (PCD), a progressive disorder that is often associated with decreased lung function. Therefore, long-term treatment is required, including, for example, chest percussion and postural drainage, to enhance mucus clearance and can become increasingly frequent, and in severe cases even require lung transplantation. In addition, PCD patients suffer from recurrent infections of the lungs and / or ears, and often also suffer from subfertility, hydrocephalus and body lateralization (i.e., left-right axis) defects, as well as retinal problems and / or neurological problems. However, regardless of the severity of most ciliary diseases, there is no standardized effective strategy for the treatment of ciliary diseases (such as PCD) to date. Current therapies are, for example, extrapolated from cystic fibrosis and, in most cases, have not even been validated for the specific ciliary disease to be treated (such as, for example, PCD). Therefore, there is a need to have a solution at hand that can effectively treat subjects with ciliary diseases (such as PCD).

[0006] The present application addresses the need for restoring ciliary function in a subject suffering from a ciliary disease such as PCD by providing embodiments as described in the claims.

[0007] In particular, the present invention relates to a pharmaceutical composition comprising polyribonucleotides for the treatment of a ciliary disease in a subject suffering from the ciliary disease, wherein the polyribonucleotides encode a functional version of a protein whose defect is associated with the ciliary disease, and wherein the pharmaceutical composition is administered to the respiratory system of the subject when the subject exhibits inflammation of the respiratory system.

[0008] The present invention is based on such discovery, namely by transfecting cells (it shows the defect in some protein of the protein complex of cilia and its defect causes the loss of proper ciliary function) with the functional version of polyribonucleotide encoding said protein, it is indeed possible to restore proper ciliary function. However, it is also found that ciliated cells must be transfected in the early stage during differentiation to achieve this effect. This leads to practical problems, because the precursor cells of epithelial cells carrying cilia (i.e. basal cells) cannot be obtained by the airway system for transfection, because they are located in the deeper part of the epithelium and are not exposed on the surface. According to the present invention, when the subject with ciliary disease shows inflammation of the respiratory system, the transfection of epithelial cells is achieved by applying polyribonucleotides. During the inflammation of the respiratory system, the airway epithelium shows lesions and trauma, which makes the precursor cells of ciliated cells (i.e. basal cells that have not yet started cilia formation) accessible. Transfecting these cells with the above-mentioned polyribonucleotide expressing the functional version of the corresponding protein allows these cells to become cells that form functional cilia or at least partially functional cilia, thereby causing the corresponding symptoms to be significantly alleviated.

[0009] In the context of the present invention, the term "ciliary disease" refers to a disease associated with and / or characterized by defects in ciliated cells. Therefore, ciliary diseases include disorders of ciliary structure and / or ciliary function, and the ciliary structure includes a ciliary anchoring structure and a matrix on which the ciliary structure is anchored in the cell. Examples of ciliary diseases include PCD, Bar-Bi syndrome, Simpson-Golabi-Behmel syndrome (type 2), Leber congenital amaurosis, nephronophthisis, cranioectodermal dysplasia (Sensenbrenner) (see, e.g., Mitchison et al., 2017, Ultrastructural Pathology, 41 (6): 415-427).

[0010] As used herein, the term "ciliary disease" refers to a ciliary disease caused by a genetic defect in the subject's DNA (e.g., chromosome or mitochondrial DNA). Such a genetic defect may be caused by a mutation and may include loss, addition, or exchange of sequence portions. Examples are copy number variation, presence / absence variation, deletion (complete or partial), insertion, miss-sense mutation, nonsense mutation, splice site variation, or a combination thereof. Such changes in DNA may result in changes in the availability of the encoded protein, such as loss or reduction in the amount of the protein, or result in a protein with an altered function.

[0011] In a preferred embodiment, the term "ciliary disease" refers to a disease associated with defects in motile cilia. An example of such a ciliary disease is primary ciliary dyskinesia (PCD). PCD is a rare disease caused by dysfunction of motile cilia. PCD is heterogeneous at the genetic, functional and ultrastructural levels. PCD is associated with impaired mucus transport and clearance. Subjects with PCD exhibit recurrent nasal congestion, sinus infections, ear infections, infertility, situs abnormalities (also known as "situs ambiguous") such as complete situs inversus and ectopic situs, and / or hydrocephalus. At the molecular level, PCD is associated with abnormalities in the structure, function and biogenesis of cilia in the respiratory system in most cases. Examples of such abnormalities are missing or shortened motor protein arms, defective central pair complexes, radial spokes or connecting protein chains. Such abnormalities and thus the ciliary motility defects associated with PCD are caused by mutations in genes encoding the corresponding components, in particular by mutations in the genes listed in Table 1, where Group "A" and Group "B" refer to genes with pathogenic mutations that are estimated to account for at least 1% and less than 1% of PCD cases, respectively (see Zariwala et al., 2007, updated 2015, “Primary Ciliary Dyskinesia”, edited by Adam et al., Seattle (WA): University of Washington, Seattle; 1993-2018).

[0012] Therefore, the polyribonucleotide contained in the pharmaceutical composition according to the present invention is preferably a polyribonucleotide that can be translated into a functional version of the protein listed in Table 1.

[0013] More preferably, the polyribonucleotide contained in the pharmaceutical composition according to the present invention is an mRNA that can be translated into a functional version of a protein, and the protein is selected from the group consisting of: DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU) and LRRC6.

[0014] Table 1

[0015]

[0016]

[0017] In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, the polyribonucleotide or modified polyribonucleotide comprises a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to one or more of SEQ ID NOs: 1 or 5 to 11 (e.g., to the sequence shown in SEQ ID NOs: 1 or 5 to 11). In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a modification level and / or type selected from any such level and / or type described herein. In certain embodiments, the percent identity of the polyribonucleotide is measured only relative to a portion of the CCDC40 coding sequence of SEQ ID NOs: 1 or 5 to 11 (e.g., UTRs, other non-coding sequences and GFP or epitope tags are not considered when calculating the percent identity). In certain embodiments of any of the foregoing, such a polyribonucleotide (or modified polyribonucleotide) encodes a functional CCDC40 protein.

[0018] In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, the polyribonucleotide or modified polyribonucleotide comprises a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to one or more of SEQ ID NO: 2 or 12 to 14 (e.g., to the sequence shown in SEQ ID NO: 2 or 12 to 14). In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a modification level and / or type selected from any such level and / or type described herein. In certain embodiments, the percent identity of the polyribonucleotide is measured only relative to a portion of the CCDC39 coding sequence of SEQ ID NO: 2 or 12 to 14 (e.g., UTR, other non-coding sequences and GFP tags or epitope tags are not considered when calculating the percent identity). In certain embodiments of any of the foregoing, such a polyribonucleotide (or modified polyribonucleotide) encodes a functional CCDC39 protein.

[0019] In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, the polyribonucleotide or modified polyribonucleotide comprises a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to SEQ ID NO: 4 (e.g., to the sequence shown in SEQ ID NO: 4). In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a modification level and / or type selected from any such level and / or type described herein. In certain embodiments, the identity percentage of the polyribonucleotide is measured only relative to the MCIDAS coding sequence-part of SEQ ID NO: 4 (e.g., when calculating the identity percentage, UTR, other non-coding sequences and GFP or epitope tags are not considered). In certain embodiments of any of the foregoing, such a polyribonucleotide (or modified polyribonucleotide) encodes a functional MCIDAS protein.

[0020] In certain embodiments, the present disclosure provides a pharmaceutical composition comprising any of the aforementioned polyribonucleotides.In addition, any such polyribonucleotide (or pharmaceutical composition) can be used in any method described herein.

[0021] In one embodiment of the pharmaceutical composition comprising polyribonucleotides for treating a ciliary disease, the ciliary disease is associated with a defect in a protein comprising a coiled-coil domain 40 (CCD 40; see, e.g., NCBI reference sequences NM_017950.4 and NP_060420.2 of human mRNA and protein CCDC40 sequence, respectively) or a defect in a protein comprising a coiled-coil domain 39 (CCDC39, see, e.g., NCBI reference sequences NM_181426.2 and NP_852091.1 of human mRNA and protein CCDC39 sequence, respectively).

[0022] CCDC40 and CCDC39 have built the complex between radiation and A-tubule.The defective version of CCDC40 or CCDC39 albumen may be caused by the mutation (such as insertion, deletion, nonsense and splice site mutation) in CCDC40 gene or in CCDC39 gene.Especially, the TGT insertion between 248 deletions and 2824 and 2825 in the DNA sequence encoding CCDC40 albumen seems to be very frequent.The defective version of CCDC40 or CCDC39 can cause the defect of axoneme structure, such as the reduction of abnormal assembly and / or internal dynamic protein arm of missing or eccentric central pair, abnormal radiation and connecting protein chain, dynamic protein regulating complex.Therefore, the polyribonucleotide included in the pharmaceutical composition according to the present invention is preferably the mRNA that can be translated into the functional version of CCDC40 and / or CCDC39. More information on proteins involved in cilia formation as well as genes and molecular pathways associated with ciliary diseases can be found, for example, in the review article by Reiter and Leroux (Reiter and Leroux, 2017, Nat Rev Mol Cell Biol, 18(9):533-547).

[0023] The pharmaceutical composition of the present invention will be administered to a subject suffering from a ciliary disease. In this article, a subject suffering from a ciliary disease may also be referred to as a patient. The patient may exhibit abnormal ciliary structure and / or function and / or biogenesis defects, resulting in mucus and bacteria being retained in the respiratory tract. The diagnosis of a ciliary disease in a given subject can be based on clinical findings, molecular analysis, and / or ciliary ultrastructural analysis of a biopsy of the subject, such as, for example, also reviewed in Goutaki et al. (Goutaki et al., 2016, Eur Respir J, 48(4): 1081-1095).

[0024] In the context of the present invention, term " polyribonucleotide " refers to the single-stranded sequence being made up of adenosine, guanosine, cytidine and / or uridine residues (in modified form or unmodified form, see below).In this article, term " polyribonucleotide of coding protein " refers to the coding region comprising coding protein, namely can be translated into the polyribonucleotide of amino acid sequence.Therefore, in the context of the present invention, term " polyribonucleotide of coding protein " preferably refers to mRNA, and wherein mRNA should be understood as meaning any polyribonucleotide molecule, if it enters cell, then is suitable for protein expression or can be translated into protein.

[0025] In this article, the term "protein" covers any kind of amino acid sequence, i.e. a chain of two or more amino acids, each amino acid being linked by a peptide bond. The term "protein" as used in this context refers to any amino acid sequence of interest. Preferably, the encoded amino acid sequence is at least 5 amino acids long, more preferably at least 10 amino acids, even more preferably at least 50, 100, 200 or 500 amino acids. Thus, the term "protein" includes short peptides as well as polypeptides. With regard to the function of the encoded protein, there are no further restrictions except that defective variants of the protein are associated with ciliary diseases. In this article, the term "associated with..." is intended to include the terms "causing...", "involving..." and / or "enhancing...".

[0026] In the present context, the term "a protein whose defect ..." refers to a "defective protein" or a "defective version of a protein" and, therefore, to a version of a protein that has an altered function compared to a functional version of the protein. However, the term may also encompass a version of the protein that is completely or partially lacking in synthesis and, thus, completely or partially lacking in availability in the cell. In any case, the defect in the version of the protein results in the inability of the version of the protein to perform the native function of the protein.

[0027] A version of a protein that performs its native function is referred to herein as a "functional protein" or a "functional version of a protein" and is encoded by the same DNA sequence as the corresponding defective protein, but without the defect causing the DNA sequence change and, therefore, without a mutation in the DNA sequence.

[0028] Thus, in the context of the present invention, a "functional protein" is preferably a building block of the A-tubule, the B-tubule, or the connexin-dynein regulatory complex, or the radial spokes, the inner dynein arm, and / or the outer dynein arm.

[0029] Therefore, the term "polyribonucleotide encoding a functional version of a protein whose defect is associated with the ciliary disease" preferably refers to an mRNA encoding a functional protein, which participates in the structural organization of the ciliary axoneme, the axoneme anchoring structure or the matrix and realizes its natural function. Therefore, the polyribonucleotide according to the present invention preferably refers to an mRNA encoding a functional protein, the presence of which in the cells of a subject suffering from a ciliary disease is necessary or beneficial for alleviating or preventing the manifestation of a ciliary disease associated with a defect in the protein as encoded by the DNA sequence of the cell or alleviating the associated symptoms.

[0030] In addition, the polyribonucleotide used according to the present invention can also comprise further functional region and / or 3 ' or 5 ' non-coding region.3 ' and / or 5 ' non-coding region can be the sequence of the protein flanking the coding naturally, or help the stable and / or artificial sequence of the polyribonucleotide.Can identify and study suitable sequence by routine experiment.Further, the polyribonucleotide can also have further functional region, and can be combined with the regulatory element and target sequence of MicroRNA, for example, be used for controlling the activity of required polyribonucleotide in space and time, required polyribonucleotide comprises the sequence of coded protein, i.e. for example about specific cells or cell type and / or developmental stage or specific time range.

[0031] The polyribonucleotide used according to the present invention can comprise a partially or completely codon-optimized sequence, which is derived from the native sequence to be used. Codon optimization refers to a technology of maximizing protein expression by improving the translation efficiency of the corresponding polyribonucleotide, because in some cases there is a codon that can be preferentially used for given amino acids by some species. Further, the polyribonucleotide can include further modification to regulate and / or extend the duration of action. The polyribonucleotide may also contain m7GpppG cap, internal ribosome entry site (IRES) and / or the poly A tail at 3 ' end and / or the additional sequence for promoting translation.

[0032] In some embodiments of the present invention, the polyribonucleotide used according to the present invention can comprise unmodified nucleotide and modified nucleotide.Term " unmodified nucleotide " used herein refers to A, C, G and U nucleotide.Term " modified nucleotide " used herein refers to any naturally occurring or non-natural isomer of A, C, G and U nucleotide, and any naturally occurring or non-natural analog, substituted or modified nucleotide or its isomer with the residue of for example chemical modification or replacement.Modified nucleotide can have base modification and / or sugar modification.Modified nucleotide can also have phosphate group modification, for example, about five prime caps of mRNA molecule.Modified nucleotide also comprises the nucleotide synthesized after transcription by the covalent modification of nucleotide.Further, any suitable mixture of unmodified nucleotide and modified nucleotide is all possible. Many non-limiting examples of modified nucleotides can be found in the literature (e.g., Cantara et al., Nucleic Acids Res, 2011, 39(Suppl_1):D195-D201; Helm and Alfonzo, Chem Biol, 2014, 21(2):174-185; Carell et al., Angew Chem Int Ed Engl), 2012, 51(29):7110-31) and some preferred modified nucleotides are exemplarily mentioned below based on their respective nucleoside residues: 1-methyladenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2-methyladenosine, 2'-O-ribosylphosphoadenosine, N6-methyl-N6-threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1,2'-O-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1,2'-O-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1,2'-O-dimethyladenosine, N6- methyladenosine, N6,2'-O-dimethyladenosine, 2'-O-methyladenosine, N6,N6,2'-O-trimethyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-2-methylthio-N6-threonylcarbamoyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 7-methyladenosine, 2-methylthio-adenosine, 2-methoxy-adenosine, 2'-amino-2'-deoxyadenosine, 2'-azido-2'-deoxyadenosine, 2'-fluoro-2'-deoxyadenosine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenosine, 7-deaza-8-aza-adenosine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine; 2-thiocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-hydroxycytidine, lysine, N4-acetyl-2'-O-methylcytidine, 5-formyl-2'-O-methyl Cytidine, 5,2'-O-dimethylcytidine, 2-O-methylcytidine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, isocytidine, pseudocytidine, pseudoisocytidine, 2-thiocytidine, 2'-methyl-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-bromocytidine, 2'-azido-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-aza-cytidine, 3-methylcytidine, 1-methyl-pseudoisocytidine, pyrrolocytidine, pyrrolopseudoisocytidine, 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5- Aza-2-thio-zebulin, 2-thio-zebulin; 1-methylguanosine, N2,7-dimethylguanosine, N2-methylguanosine, 2'-O-ribophosphate guanosine, 7-methylguanosine, hydroxy-whitinosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,2'-O-dimethylguanosine, 1,2'-O-dimethylguanosine, 2'-O-methylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2J-trimethylguanosine, isoguanosine, 4-demethyl wyosine, epoxy braided glycoside, undermodified hydroxy wyosine, methylated undermodified hydroxy wyosine, isowyosine, peroxy wyosine, galactosyl-braided glycoside, mannosyl-braided glycoside, braided glycoside, archaeoside, wyosine, methyl wyosine, wyosine, 7-aminocarboxypropyl demethyl wyosine, 7-aminocarboxypropyl wyosine, 7-aminocarboxypropyl wyosine methyl ester, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine , 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, N1-methylguanosine, 2'-amino-3'-deoxyguanosine, 2'-azido-2'-deoxyguanosine, 2'-fluoro-2'-deoxyguanosine, 2-thiouridine , 3-(3-amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5-(carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5-methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl) Uridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2'-O-dimethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyl-2-thiouridine, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 5,2'-O-dimethyluridine, 2'-O-methyluridine, 2'-O-methyl-2-thiouridine, 2-thio-2'-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurylmethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2'-O-methylpseudouridine, 5-formyluridine, 5-aminomethyl-2-geranyluridine, 5-taurylmethyluridine, 5 -iodouridine, 5-bromouridine, 2'-methyl-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 2'-fluoro-2'-deoxyuridine, inosine, 1-methylinosine, 1,2'-O-dimethylinosine, 2'-O-methylinosine, 5-aza-uridine, 2-thio-5-aza-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 1-taurylmethyl-pseudouridine, 5-taurylmethyl-2-thio-uridine, 1-taurylmethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-l-methyl 1,2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1,2'-O-dimethylinosine, 2,8-dimethyladenosine, 2-methylthio-methylenethio-N6-isopentenyl-adenosine, 2-geranylthiouridine, 2-lysine, 2-methylthio-cyclic N6-threonylcarbamoyladenosine, 2-methylthio-N6-(cis-hydroxy)- isopentenyl)adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, 2-selenouridine, 2-thio-2'-O-methyluridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, 2'-O-methylpseudouridine, 2'-O-methyluridine, 2'-O-methyluridine 5-oxyacetate, 2'-O-ribosyladenosine phosphate, 2'-O-ribosylguanosine phosphate, 3,2'-O-dimethyluridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 5,2'-O-dimethylcytidine, 5,2'-O-dimethyluridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5,5-(isopentenylaminomethyl)-2'-O-methyluridine, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carboxyhydroxymethyluridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-seleno-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 5-cyanomethyl-uridine, 5-formyl-2'-O-methyl-cytidine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-methylaminomethyl-2-geranylthiouridine, 7-aminocarboxypropyl-demethyl-wyoside, 7-methyl-guanosine, 8-methyl-adenosine, N2,2'-O-dimethyl-guanosine, N2,7,2'-O-trimethyl-guanosine 、N2,7-dimethylguanosine、N2,N2,2'-O-trimethylguanosine、N2,N2,7-trimethylguanosine、N2,N2,7-trimethylguanosine、N4,2'-O-dimethylcytidine、N4,N4,2'-O-trimethylcytidine、N4,N4-dimethylcytidine、N4-acetyl-2'-O-methylcytidine、N6,2'-O-dimethyladenosine、N6,N6,2'-O-trimethyladenosine、N6-formyladenosine、 N6-hydroxymethyladenosine, agmatidine, 2-methylthiocyclic N6-threonylcarbamoyladenosine, glutamyl-braided glycoside, guanosine added to any nucleotide, guanylated 5' end, hydroxy-N6-threonylcarbamoyladenosine; most preferably pseudouridine, N1-methyl-pseudouridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine and / or 5-methyl-uridine. ,

[0033] In addition, the term "modified nucleotides" includes nucleotides containing isotopes such as deuterium. The term "isotope" refers to an element with the same number of protons but different numbers of neutrons causing different mass numbers. Therefore, for example, the isotope of hydrogen is not limited to deuterium, but also includes tritium. In addition, polyribonucleotides can also contain isotopes of other elements, and other elements include, for example, carbon, oxygen, nitrogen and phosphorus. It is also possible that the modified nucleotides are deuterated, or comprise another isotope of hydrogen or oxygen, carbon, nitrogen or phosphorus.

[0034] The total amount of the nucleotide type modified in the polyribonucleotide can be 0,1,2,3 or 4.Therefore, in some embodiments, at least one nucleotide (such as at least one U nucleotide) of a nucleotide type can be a modified nucleotide.In certain embodiments, at least one nucleotide (such as at least one U nucleotide and at least one C nucleotide) in two nucleotide types can be a modified nucleotide.In certain embodiments, at least one nucleotide (such as at least one G nucleotide, at least one U nucleotide and at least one C nucleotide) in three nucleotide types can be a modified nucleotide.In certain embodiments, at least one nucleotide in all four nucleotide types can be a modified nucleotide.In all these embodiments, one or more nucleotides of every kind of nucleotide type can be modified, and the percentage of the nucleotide of the modification of every kind of nucleotide type is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 100%.

[0035] In some embodiments, the total percentage of modified nucleotides contained in the mRNA molecules to be purified is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 100%.

[0036] Therefore, the feature of polyribonucleotide can be that for example 0.5-50%, preferably 5-50% U nucleotides and 5-50% C nucleotides are modified.The U nucleotides of the modification are preferably 5-iodouridine, and the C nucleotides of the modification are preferably 5-iodine.

[0037] In some embodiments, the polyribonucleotide may be characterized in that 15-25% of the U nucleotides and 3-15%, preferably 5-15% of the C nucleotides are modified, wherein the modified U nucleotides are preferably 5-methyluridine, and the modified C nucleotides are preferably 5-iodocytidine.

[0038] In some embodiments, the polyribonucleotide may be characterized in that 30-50% of the U nucleotides and 10-20% of the C nucleotides are modified, wherein the modified U nucleotides are preferably 5-iodouridine and the modified C nucleotides are preferably 5-iodcytidine.

[0039] In some embodiments, the polyribonucleotide may be characterized in that 30-50% of the U nucleotides and 5-15% of the C nucleotides are modified, wherein the modified U nucleotides are preferably 5-iodouridine and the modified C nucleotides are preferably 5-iodine.

[0040] In some embodiments, the polyribonucleotide may be characterized in that 0.5-5% of the U nucleotides and 25-35% of the C nucleotides are modified, wherein the modified U nucleotides are preferably 2-thiouridine, and the modified C nucleotides are preferably 5-methylcytidine.

[0041] The polyribonucleotide may also be characterized in that, for example, 50-100%, preferably 100%, of the U nucleotides are modified. The modified U nucleotides are preferably N1-methyl-pseudouridine.

[0042] As described above, according to the present invention, when the subject exhibits inflammation of the respiratory system, the pharmaceutical composition is administered to a patient with a ciliary disease. In the context of the present invention, the term "inflammation" refers to a cellular response to insults including infection, trauma and hypersensitivity. "Inflammation of the respiratory system" refers to an inflammatory response in the respiratory system, especially but not limited to an inflammatory response in the nose, pharynx, larynx, trachea, bronchi and / or lungs. For example, an inflammatory response in the respiratory system may be caused by an irritant such as a pathogen, toxin, pollutant and / or allergen. During inflammation, specific cell types are activated, which can release, for example, cytokines and mediators to change the activity of other cells. These processes are described in, for example, Iwasaki et al. (Iwasaki et al., 2017, "Nature Review Immunology (Nat Rev Immunol)", 17 (1): 7-20).

[0043] Therefore, in one embodiment, the subject with a ciliary disease to be administered polyribonucleotides has been assayed prior to treatment to determine whether the subject has inflammation of the respiratory system, and wherein the subject has been positively determined to have inflammation of the respiratory system.

[0044] Preferably, the inflammation of the respiratory system is acute inflammation. Acute inflammation may occur in seconds, minutes, hours and days, but may not occur in a longer time. Therefore, acute inflammation is an inflammation that occurs within a time range of up to 4 weeks, preferably within a time range of less than 3 weeks. It can be determined by conventional laboratory methods based on locally increased blood flow, locally increased capillary permeability and / or increased numbers of neutrophils, macrophages and / or lymphocytes. More information about markers of airway inflammation in primary ciliary dyskinesia can be found in, for example, Zihlif et al. (Zihlif et al., 2006, Pediatr Pulmonol, 41 (6): 509-14).

[0045] In general, inflammation can be classified as acute or chronic. Acute inflammation is the body's response to noxious stimuli and is characterized by, for example, increased movement of granulocytes to the affected tissue. Typical signs of inflammation are fever, pain, redness, swelling and loss of function. Ciliary diseases (e.g., PCD) are hereditary disorders and therefore (if untreated) are permanent lifelong irritations caused by loss of function, leading to permanent and therefore chronic types of inflammation, which generally do not show the above symptoms (except for loss of function). Further examples of diseases associated with chronic inflammation are, for example, hay fever, periodontal disease, atherosclerosis and osteoarthritis. Nevertheless, patients with such diseases may also suffer from acute inflammation, for example, by being subjected to additional noxious stimuli, and therefore cause one or more classic symptoms (such as classic signs of inflammation) fever, pain, redness, swelling and additional loss of function.

[0046] Therefore, in one embodiment, the subject with a ciliary disease to be administered polyribonucleotides has been tested before treatment to determine whether the subject has acute inflammation of the respiratory system, and wherein the subject has been positively determined to have acute inflammation of the respiratory system.

[0047] Alternatively or additionally, inflammation of the respiratory system refers to an exacerbation of inflammation, preferably an acute exacerbation of inflammation. An exacerbation refers to a worsening of a disease or an increase in its symptoms. It is best studied in the context of chronic obstructive pulmonary disease (COPD) because exacerbations lead to a decrease in the patient's quality of life, accelerate the decline in lung function, and significantly increase disease-related costs.

[0048] In the context of a clinical trial, a respiratory exacerbation may be defined as follows: "A respiratory exacerbation is defined in the trial as respiratory symptoms leading to the initiation of systemic antibiotic therapy (regardless of the results of bacterial culture) or as a decrease in the % predicted forced expiratory volume in one second (FEV1) equal to or greater than 10 percentage points relative to the mean of the % predicted FEV1 at screening and randomization, regardless of whether antibiotics are prescribed. The occurrence of an exacerbation may be assessed by patient interview, physical examination, and spirometry. Participants may be interviewed at each trial visit and at any additional contact with the trial site due to an exacerbation regarding symptoms and concomitant medications since the last contact with the trial site. Interviews may be supplemented with weekly patient diaries regarding symptoms and antibiotics. At all visits, a physical examination may be performed to examine the participant's general condition, vital signs, ears, heart, and lungs." (See, e.g., Kobbernagel et al., 2016, BMC Pulmonary Medicine, 16:104).

[0049] Therefore, according to a preferred embodiment, the pharmaceutical composition comprises an mRNA for treating a ciliary disease in a subject suffering from a ciliary disease, wherein the mRNA encodes a functional version of a ciliary structural protein whose defect is associated with the ciliary disease, and wherein the pharmaceutical composition is administered to the respiratory system of the subject suffering from the ciliary disease when the subject suffering from the ciliary disease exhibits acute inflammation, preferably acute exacerbation, of the respiratory system.

[0050] Therefore, in one embodiment, the subject with a ciliary disease to be administered polyribonucleotides has been assayed prior to treatment to determine whether the subject suffers from acute inflammation of the respiratory system, preferably an acute exacerbation, and wherein the subject has been positively determined to suffer from chronic inflammation of the respiratory system, preferably an acute exacerbation.

[0051] The presence or absence of inflammation of the respiratory system in a subject with a ciliary disease can be determined by routine procedures, for example, by analyzing a blood sample or by determining whether the patient has rhinorrhea, etc.

[0052] In the respiratory system, inflammation is often caused by infection, particularly viral or bacterial infection. Therefore, the presence or absence of inflammation in a patient with a ciliary disease can preferably be assessed by determining the presence or absence of an infection, preferably an acute infection. Preferably, the infection is a viral and / or bacterial infection.

[0053] Acute infection is characterized by auscultatory findings, purulent cough, infiltrates, hemoptysis, fever, elevated blood inflammatory parameters (C-reactive protein (CRP)>200 mg / ml, erythrocyte sedimentation rate <100 mm / h). Chronic infection is further characterized by migratory infiltrates, antibiotic resistance, persistent general symptoms, and moderately elevated blood inflammatory markers (CRP 50-100 mg / ml, erythrocyte sedimentation rate <50 mm / h) (Klinische Pneumonologie, 1. Aufl. 2014 Georg Thieme Verlag KG, ISBN 978-3-13-129751-8; Jaroszewski et al., 2012, Thorac Surg Clin, 22(3):301-24).

[0054] In the context of the present invention, the term "respiratory system" includes organs involved in breathing, such as the nose, pharynx, larynx, trachea, bronchi and lungs. In particular, in the case of some mammals (including humans) also referred to as subjects herein, the respiratory system may also be referred to as the respiratory tract. In this article, the terms "respiratory system" and "respiratory tract" are used interchangeably. The respiratory tract can be divided into the upper respiratory tract and the lower respiratory tract. The upper respiratory tract includes a nose comprising a nasal cavity, nasal conchae, nasal vestibule and nasal passages; paranasal sinuses; the pharynx and the part of the larynx above the vocal folds (vocal cords). The lower respiratory tract includes the part of the larynx below the vocal folds, the trachea, the bronchi and the bronchioles. In this article, the lungs are included in the lower respiratory tract and include respiratory bronchioles, alveolar ducts, alveolar sacs and alveoli.

[0055] In the context of the present invention, the term "pharmaceutical composition" refers to a composition comprising at least one polyribonucleotide according to the present invention, for use in treating ciliary diseases to a subject. The polyribonucleotide is preferably included in an effective amount (i.e., an amount sufficient to induce a detectable therapeutic response in a subject to whom the pharmaceutical composition is to be administered). The pharmaceutical composition of the present invention can be in the form of a sterile aqueous solution or non-aqueous solution, a suspension or an emulsion or an aerosol. Preferably, the pharmaceutical composition is in a form that allows, for example, via inhalation, atomization, via spray or droplets (e.g., nasal spray or nasal drops) to be administered to the respiratory system.

[0056] This is advantageous for the patient as it can be easily administered using a spray, droplets, nebulizer or by inhalation, is convenient for transport and is therefore easily accessible to the patient without restricting any freedom of movement.

[0057] In a preferred embodiment, the pharmaceutical composition comprises mRNA that can be translated into a functional version of a protein selected from the group consisting of DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU) and LRRC6, and is administered to a subject suffering from PCD caused by a defect in the protein using a spray, droplets, a nebulizer and / or by inhalation. More preferably, the protein is CCDC40 and / or CCDC39.

[0058] The pharmaceutical composition may include a pharmaceutically acceptable carrier, i.e., a compound, material, ingredient, and / or composition, which is suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reaction, or other problems or complications, commensurate with a reasonable benefit / risk ratio, within the scope of reasonable medical judgment. Therefore, a pharmaceutically acceptable carrier is an inactive substance that is formulated with a pharmaceutically active substance so that it can be treated according to dosage, adsorption, solubility, or pharmacokinetic considerations. Examples of suitable pharmaceutically acceptable carriers are well known in the art and include phosphate buffered saline solutions, buffers, water, emulsions (such as oil / water emulsions), various types of wetting agents, and sterile solutions. In particular, aqueous carriers include water, alcohol / water solutions, emulsions, or suspensions, including saline and buffered media. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and organic esters (such as ethyl oleate). Further examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution and dextrose solution, citrate, phosphate and other organic acids; salt-forming counterions such as sodium and potassium; low molecular weight (>10 amino acid residues) polypeptides; proteins such as serum albumin or gelatin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as histidine, glutamine, lysine, asparagine, arginine or glycine; carbohydrates including glucose, mannose or dextrin; monosaccharides; disaccharides; other sugars such as sucrose, mannitol, trehalose or sorbitol; chelating agents such as Such as EDTA; nonionic surfactants, such as polyoxyethylene sorbitan monolaurate, propylene glycol, Pluronics or polyethylene glycol, which are commercially available under the trade name Tween; antioxidants, including methionine, ascorbic acid and tocopherol; and / or preservatives, such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol or benzyl alcohol; alkyl parabens, such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). Suitable pharmaceutically acceptable carriers and their formulations are described in more detail in Remington's Pharmaceutical Sciences, 17th edition, 1985, Mack Publishing Co. Furthermore, preservatives, stabilizers and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents and inert gases, nanosystems or liposomes and the like.

[0059] Pharmaceutical composition of the present invention can be applied to the patient by a variety of application forms suitable for being applied to respiratory system known to those skilled in the art, such as using sprays, droplets, inhalants, atomizers etc. The duration of dosage and effect depends on the function that the polyribonucleotide will realize, and must be adjusted consciously in each case. For example, if the polyribonucleotide is used for the chronic therapy of the disease caused by (such as the situation of this paper) gene defect (i.e. the dna sequence dna that changes), the duration of effect will be as long as possible. The duration also can be adjusted to a specific time window.

[0060] In one embodiment, the pharmaceutical composition is administered at least once a week. This helps to ensure the effectiveness and lasting effect of the PCD treatment. Preferably, the pharmaceutical composition is administered on a weekly basis for at least 2 weeks, more preferably for at least 3 weeks, and even more preferably for at least 4 weeks. Alternatively, the pharmaceutical composition can be administered twice a week for at least 1 week, preferably for at least 2 weeks, more preferably for at least 3 weeks, and even more preferably for at least 4 weeks. In one embodiment, if further treatment is required after the initial treatment as described above for four weeks, treatment is performed on a weekly basis. As an alternative to weekly administration, administration can be changed to once a month for a longer period of time, for example, for at least two months, preferably for at least 3 months, more preferably for at least 4 months, even more preferably for at least 5 months, and most preferably for at least 6 months.

[0061] In a preferred embodiment, the subject inhales a suitable solution (preferably a mucolytic agent, such as a solution of hypertonic saline or N-acetylcysteine ​​(NAC)), or rinses their nasal cavity and / or sinuses with a suitable solution (preferably a mucolytic agent, such as a solution of hypertonic saline or N-acetylcysteine ​​(NAC)) to remove mucus and potentially detached airway epithelial cells, and the pharmaceutical composition is applied to the subject's respiratory system. Therefore, preferably, after the subject inhales a suitable solution (preferably a mucolytic agent, such as a solution of hypertonic saline or N-acetylcysteine ​​(NAC)) and coughs up the mucus located on the epithelial cells, the pharmaceutical composition is applied to the subject's respiratory system. This is particularly advantageous for exposing epithelial cells before administering the pharmaceutical composition and therefore for enhancing the transfection efficiency of polyribonucleotides.

[0062] Thus, in one embodiment, the subject with a ciliary disease to whom the polyribonucleotide is to be administered is a subject who, prior to treatment, has been treated by inhaling an appropriate solution (preferably a mucolytic, such as a solution of hypertonic saline or N-acetylcysteine ​​(NAC)), or by rinsing their nasal cavity and / or sinuses with an appropriate solution (preferably a mucolytic, such as a solution of hypertonic saline or N-acetylcysteine ​​(NAC)).

[0063] The purpose of this step is to physically remove mucus from the subject's respiratory system prior to administration of the polyribonucleotide.

[0064] Furthermore, such a subject is preferably one in which an assay has been performed prior to treatment to determine whether the subject suffers from inflammation of the respiratory system, preferably acute inflammation or an exacerbation of inflammation, and wherein the subject has been positively determined to suffer from inflammation of the respiratory system, preferably acute inflammation or an exacerbation of inflammation.

[0065] In a preferred embodiment, the concentration of NAC in the solution is 3% to 20%, preferably 5% to 15%, more preferably 8% to 12%, and most preferably 10%. The percentages are based on wt / wt. Preferably, the solution containing NAC also contains a pharmaceutically acceptable concentration of sodium edetate (wherein edetate refers to ethylendiamin tetraacetate) and / or sodium hydroxide. Preferably, the solution is an aqueous solution.

[0066] In some embodiments of the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition further comprises a mucolytic agent, such as N-acetylcysteine ​​(NAC) and / or a hypertonic solution comprising sodium chloride. Both NAC acting as an expectorant and a hypertonic solution comprising sodium chloride are beneficial in reducing the retention of viscous mucus in subjects with PCD. This can reduce the risk of respiratory infections and thus reduce additional stress on patients.

[0067] In a preferred embodiment, the pharmaceutical composition further comprises NAC in the concentration as described above.

[0068] In a preferred embodiment, the pharmaceutical composition further comprises a hypertonic solution comprising sodium chloride at a concentration between 2% and 8%, preferably between 3% and 7%, more preferably between 4% and 7%.

[0069] In a preferred embodiment, the pharmaceutical composition further comprises NAC in a concentration between 3% and 20%, preferably between 5% and 15%, more preferably between 8% and 12%, most preferably 10%, and / or a hypertonic solution comprising sodium chloride in a concentration between 2% and 8%, preferably between 3% and 7%, more preferably between 4% and 7%.

[0070] As described above, in a preferred embodiment of the pharmaceutical composition according to the present invention, the pharmaceutical composition comprises mRNA that can be translated into a functional version of a protein selected from the group consisting of DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU) and LRRC6, preferably CCDC40 and / or CCDC39. Hereinafter, this pharmaceutical composition is also referred to as the "first pharmaceutical composition".

[0071] The multiciliary differentiation and DNA synthesis-associated cell cycle (MCIDAS) protein is a transcriptional regulatory protein that is specifically required for multiciliary cell differentiation, which includes ciliogenesis of multiple motile cilia (see, e.g., the NCBI reference sequences NM_001190787.1 and NP_001177716.1 of human mRNA and the protein MCIDAS sequence, respectively; or the optimized polyribonucleotide sequence shown in SEQ ID NO: 4).

[0072] Therefore, in some embodiments of the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition further comprises a polyribonucleotide encoding a functional version of the multiciliary differentiation and DNA synthesis-associated cell cycle (MCIDAS) protein.

[0073] In some embodiments, the pharmaceutical composition is a first pharmaceutical composition as described above, which is administered together with a second pharmaceutical composition comprising a polyribonucleotide encoding a MCIDAS protein.

[0074] Two kinds of pharmaceutical compositions, i.e. the first pharmaceutical composition further comprising the polyribonucleotides encoding MCIDAS protein as defined above or the first pharmaceutical composition used together with the second pharmaceutical composition comprising the polyribonucleotides encoding MCIDAS protein, are all advantageous, because when the pharmaceutical composition is applied to cells before and / or during ciliogenesis, the use of the pharmaceutical composition according to the present invention is particularly effective in restoring ciliary cell structure and function. Further, preferably by using nasal spray and / or atomizer and / or by inhalation, preferably at least once a week and / or for at least 4 weeks, both are applied to the patient.

[0075] In some embodiments, the pharmaceutical composition comprises a polyribonucleotide that can be translated into a functional version of two or more proteins. This can be accomplished, for example, using a polycistronic polyribonucleotide, which is a single polyribonucleotide encoding two or more different proteins. Designing such a polycistronic polyribonucleotide using, for example, a 2A peptide has been described in detail in the literature. As an example, Liu et al. demonstrated the use of 2A peptides to produce polycistronic mRNA (Liu et al., 2017, "Scientific Reports", 7: 2193). These 2A peptides can be further combined with, for example, furin cleavage sites to remove additional amino acids (a part of 2A peptides) attached to the first protein in the sequence due to ribosome skipping (functional feature of 2A peptides). As an example, Chng et al. (Chng et al., 2015 "monoclonal antibodies (Mabs)", 7 (2): 403-412) have described the use of 2A peptides for furin cleavage. Thus, a single polyribonucleotide encoding two or more, preferably two, therapeutic proteins (eg, CCDC40 and MCIDAS) can be designed, wherein the coding regions of the two therapeutic proteins are separated by a 2A peptide (as described in the above references).

[0076] Therefore, in some embodiments, except that the pharmaceutical composition comprises a polyribonucleotide that can be translated into two or more, preferably two functional versions of proteins, it is the same as described in the above embodiments. Therefore, in some embodiments, the pharmaceutical composition as described in the above embodiments comprises a polycistronic polyribonucleotide, and the polycistronic polyribonucleotide comprises a sequence that can be translated into a functional version of a protein and a sequence that can be translated into a functional version of a MCIDAS protein, and the protein is selected from the group consisting of: DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU) and LRRC6, preferably CCDC40 and / or CCDC39.

[0077] In some embodiments, the pharmaceutical composition comprises a functional version of the MCIDAS protein and a polyribonucleotide comprising an optimized polyribonucleotide sequence as shown in SEQ ID NO: 4, and a functional version of the CCDC40 and / or CCDC39 protein and a polyribonucleotide comprising an optimized polyribonucleotide sequence as shown in SEQ ID NO: 1 (or SEQ ID NO: 5-11) and / or SEQ ID NO: 2 (or SEQ ID NO: 12-14). Preferably, the pharmaceutical composition is administered to a patient by using a nasal spray and / or a nebulizer, and / or by inhalation, preferably at least once a week and / or for at least 4 weeks.

[0078] As an alternative or supplement to MCIDAS, for example, GemC1, FoxJ1 and / or E2f4VP16 can be used. GemC1 is specifically expressed in ciliated epithelium and is a central regulator of cilia formation. It is reported that ectopic expression of GemC1 is sufficient to induce the early steps of multiciliation in airway epithelial cells in vitro by upregulating MCIDAS and FoxJ1 (two key transcriptional regulators of multiciliation formation) (Arbi M et al., 2016, EMBO reports, 17 (3): 400-413). In addition, in the same study, it was also reported that GemC1 can directly transactivate MCIDAS and FoxJ1 upstream regulatory sequences. E2f4VP16 refers to a form of E2f4 that contains a universal activation domain from HSV1 VP16 and can positively affect the activation of the expression of key genes associated with multiciliation (Kim S et al., Scientific Reports, 2018, 8: 12369).

[0079] Therefore, in some embodiments of the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition is the first pharmaceutical composition as described above, and further comprises at least one of the following: a polyribonucleotide encoding a functional version of the MCIDAS protein, a polyribonucleotide encoding a functional version of the GemC1 protein, a polyribonucleotide encoding a functional version of the FoxJ1 protein, and / or a polyribonucleotide encoding a functional version of the E2f4VP16 protein.

[0080] In some embodiments of the pharmaceutical composition, the first pharmaceutical composition as described above can be administered together with a second pharmaceutical composition, the second pharmaceutical composition comprising at least one of the following: a polyribonucleotide encoding a functional version of the MCIDAS protein, a polyribonucleotide encoding a functional version of the GemC1 protein, a polyribonucleotide encoding a functional version of the FoxJ1 protein, and / or a polyribonucleotide encoding a functional version of the E2f4VP16 protein.

[0081] Both pharmaceutical compositions (i.e. the first pharmaceutical composition further comprising polyribonucleotides encoding MCIDAS, GemC1, FoxJ1 and / or E2f4VP16 proteins as defined above, or the first pharmaceutical composition administered together with the second pharmaceutical composition comprising polyribonucleotides encoding MCIDAS, GemC1, FoxJ1 and / or E2f4VP16 proteins) are advantageous because the administration of the pharmaceutical composition according to the invention is particularly effective in restoring ciliated cell structure and function when the pharmaceutical composition is administered to cells before the cells begin to form cilia or when they are in ciliation. Further, preferably both are administered to patients by using nasal sprays and / or nebulizers and / or by inhalation, preferably at least once a week and / or for at least 4 weeks.

[0082] As mentioned above, in certain embodiments, except pharmaceutical composition comprises can be translated into two or more, preferably two kinds of polyribonucleotides of the functional version of albumen, identical with the above-described embodiment.Therefore, in certain embodiments, as the pharmaceutical composition described in the above-described embodiments comprises polycistronic polyribonucleotides.

[0083] The pharmaceutical composition may comprise a compound that promotes transfection of cells with polyribonucleotides. Examples of such compounds are those disclosed in WO 2014 / 20723.

[0084] The pharmaceutical composition may further comprise one or more agents or one or more reagents for delivering and / or introducing RNA into a target cell or target tissue. In particular, it is envisioned that this / these agents or reagents support the delivery and / or introduction of RNA into a cell or tissue. This or these agents or reagents may be administered together with RNA. The RNA to be delivered / introduced may also be coupled to this / these agents (e.g., covalently bound or complexed to this / these agents) or uncoupled (e.g., only mixed with this / these agents). The corresponding agents or reagents are known in the art (e.g., Tavernier, J Control Release 150 (3) (2011), 238-47), and are, for example, selected from the following composition groups: lipids and liposomes, micelles, polymers and dendritic polymers, etc. Specific examples of the corresponding agents or reagents are GL67, EDMPC, 1,2-dioleyl-3-trimethylammonium propane (DOTAP), 1,2-dioleyl-3-trimethylammonium propane (DODAP), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC) and ((6Z,9Z,28Z,31Z)-heptatriacontane-6,9,2 8,31-tetraen-19-yl-4-(dimethylamino)butyrate (MC3), (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadecyl-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxolane-5-amine) (ALNY-100), 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-Nl,N16-diundecyl-4,7,10,1 3-Tetraazahexadecane-1,16-diamine (NC98-5), C12-200, DLin-KC2-DMA, DODAP, 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDM", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinoleyloxy -N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-distearyl-N,N-dimethylammonium bromide or "DDAB", N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-ene-3-β-oxybutane-4-oxy)-l-(cis, cis-9,1-2-octadecadienyloxy)propane or "CLinDMA", 2-[5'-(cholest-5-ene-3-β-oxy)-3'-oxapentyloxy)-3-dimethylll-(cis,cis-9',1-2'-octadecadienyloxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOB", l,2-N,N'-dioleylcarbamoyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleyloxy-N,N-dimethylpropylamine or "DLinD "DLincarb AP", 1,2-N,N'-dilinoleylcarbamoyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleylcarbamoyl-3-dimethylaminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin-K-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA" or mixtures thereof (Heyes, J Controlled Release 107 (2005), 276-287; Morrissey, Nat. Biotechnol. 23 (8) (2005), 1003-1007; WO2005 / 121348). Further examples are N,N-dimethyl-N-ethylcarboxamidocholesterol (DC-Chol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, Biochem. Biophys. Res. Comm. 179 (1991), 280; Wolf et al., BioTechniques 23 (1997), 139; U.S. Pat. No. 5,744,335). Further examples are LIPOFECTIN (DOTMA:DOPE) (Invitrogen, Carlsbad, California), LIPOFECTAMINE (DOSPA:DOPE) (Invitrogen), LIPOFECTAMINE 2000. (Invitrogen), FUGENE, TRANSFECTAM (DOGS) and EFFECTENE. Further examples are modified and unmodified polyacrylates, polyalkylcyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polylysine, polyarginine, oligo / polyamines and polyethyleneimine.

[0085] The agent or reagent can be an oligomer, polymer or lipid. They can contain an oligo(alkyleneamine) moiety, such as the characteristic oligo(alkyleneamine) moiety described in PCT / EP2014 / 063756. In particular, the agent or reagent can be an oligomer, polymer or lipid described in PCT / EP2014 / 063756. A main feature of these specific agents or reagents is that they contain a common structural entity of the following formula (I):

[0086]

[0087] Such an agent or reagent may be an oligo(alkyleneamine) selected from (components comprising) the following:

[0088] a) oligomers or polymers comprising a plurality of groups of formula (II) as side chains and / or as terminal groups:

[0089]

[0090] wherein independently for each group of formula (II) in a plurality of such groups, the variables a, b, p, m, n and R 2 To R 6 The definition is as follows:

[0091] a is 1, and b is an integer from 2 to 4; or a is an integer from 2 to 4, and b is 1,

[0092] p is 1 or 2,

[0093] m is 1 or 2; n is 0 or 1, and m+n is ≥ 2; and

[0094] R 2 To R 5 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 , -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from a C3-C18 alkyl or C3-C18 alkenyl group having one C-C double bond; a protecting group for an amino group; and a poly(ethylene glycol) chain;

[0095] R 6 Selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7, -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from a C3-C18 alkyl or C3-C18 alkenyl group having one C-C double bond; a protecting group for an amino group; -C(NH)-NH2; a poly(ethylene glycol) chain; and a receptor ligand,

[0096] and wherein one or more of the nitrogen atoms of formula (II) may be protonated to provide a cationic group of formula (II);

[0097] b) oligomers or polymers comprising as repeating units a plurality of groups of formula (III):

[0098]

[0099] wherein independently for each group of formula (III) in a plurality of such groups, the variables a, b, p, m, n and R 2 To R 5 The definition is as follows:

[0100] a is 1, and b is an integer from 2 to 4; or a is an integer from 2 to 4, and b is 1,

[0101] p is 1 or 2,

[0102] m is 1 or 2; n is 0 or 1, and m+n is ≥ 2; and

[0103] R 2 To R 5 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 or -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; a protecting group for an amino group; -C(NH)-NH2; and a poly(ethylene glycol) chain;

[0104] and wherein one or more of the nitrogen atoms of formula (III) may be protonated to provide a cationic group of formula (III); and

[0105] c) A lipid having the structure of formula (IV):

[0106]

[0107] The variables a, b, p, m, n and R 1 to R 6 The definition is as follows:

[0108] a is 1, and b is an integer from 2 to 4; or a is an integer from 2 to 4, and b is 1,

[0109] p is 1 or 2,

[0110] m is 1 or 2; n is 0 or 1, and m+n is ≥ 2; and

[0111] R 1 to R 6 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 , -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from a C3-C18 alkyl or C3-C18 alkenyl group having one C-C double bond; a protecting group for an amino group; -C(NH)-NH2; a poly(ethylene glycol) chain; and a receptor ligand; provided that R 1 To R 6 At least two of the residues are -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 , -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 Selected from C3-C18 alkyl or C3-C18 alkenyl having one CC double bond;

[0112] And wherein one or more of the nitrogen atoms shown in formula (IV) can be protonated to provide a cationic lipid of formula (IV).

[0113] Preferably, such an agent or reagent may be (a component comprising) an oligo(alkyleneamine) selected from a) and b), wherein

[0114] a) is an oligomer or polymer comprising a plurality of groups of formula (IIa) as side chains and / or as terminal groups:

[0115] -NR 2 {CH2-(CH2) a -NR 3 -CH2-(CH2) b-NR 4} m -[CH2-(CH2) a -NR 5 ] n -R 6 (IIa),

[0116] where a, b, m, n and R 2 To R 6 as defined above, and wherein one or more of the nitrogen atoms shown in formula (IIa) may be protonated to provide a cationic oligomeric or polymeric structure; and

[0117] b) is an oligomer or polymer comprising as repeating units a plurality of groups of formula (IIIa):

[0118] -NR 2 {CH2-(CH2) a -NR 3 -CH2-(CH2) b -NR 4} m -[CH2-(CH2) a -NR 5 ] n -(IIIa),

[0119] where a, b, m, n and R 2 To R 5 As defined above, and wherein one or more of the nitrogen atoms shown in formula (IIIa) may be protonated to provide a cationic oligomeric or polymeric structure.

[0120] Furthermore, such an agent or reagent may be an oligo(alkyleneamine) (component comprising thereof) selected from lipidoids having the structure of Formula (IVa):

[0121] R 1 -NR 2 {CH2-(CH2) a -NR 3 -CH2-(CH2) b -NR 4} m -[CH2-(CH2) a -NR 5 ] n -R 6 (IVa),

[0122] where a, b, m, n and R 1 To R 6As defined above, and wherein one or more of the nitrogen atoms shown in formula (IVa) may be protonated to provide a cationic lipidoid.

[0123] With respect to such agents or reagents, in Formula (II), (IIa), (III), (IIIa), (IV) or (IVa), n may be 1; or m may be 1 and n may be 1.

[0124] Further, with respect to such an agent or reagent, in Formula (II), (IIa), (III), (IIIa), (IV) or (IVa), a may be 1 and b may be 2; or a may be 2 and b may be 1.

[0125] In some embodiments, the oligomer, polymer or lipidoid can be a cationic (eg, protonated) oligomer, polymer or lipidoid.

[0126] One non-limiting example of such an oligomer, polymer or lipidoid to be used is a cationic lipid prepared by mixing 100 mg of N,N'-bis(2-aminoethyl)-1,3-propylenediamine (0.623 mmol) with 575.07 mg of 1,2-epoxydodecane (3.12 mmol, (N-1) equivalents, where N is 2 times the amount of primary amine plus 1 times the amount of secondary amine per oligo(alkyleneamine)) and mixing at 80°C with constant shaking for 96 hours. Such an oligomer, polymer or lipidoid is also referred to as lipidoid "C12-(2-3-2)".

[0127] The agent or agents to be used (particularly polymers) can be copolymers, particularly statistical copolymers. Such copolymers can be statistical / randomly arranged copolymers comprising alternating lengths of alkyleneamine repeat units (e.g., as opposed to less preferred polymers comprising similar arrangements of non-alternating lengths of alkyleneamine repeat units). Copolymers can be cationic (e.g., protonated) copolymers. Copolymers to be used are known in the art and are described, for example, in EP 14 199439.2, WO 01 / 00708, EP-A1 1 198 489, and CA-A1 2,377,207.

[0128] In particular, the copolymer may be a statistical copolymer comprising a plurality of repeating units (a) independently selected from repeating units of the following formulae (a1) and (a2):

[0129] -CH2-CH2-NH- (a1)

[0130]

[0131] A plurality of repeating units (b) independently selected from repeating units of the following formulae (b1) to (b4):

[0132] -CH2-CH2-CH2-NH- (b1)

[0133]

[0134] -CH2-CH2-CH2-CH2-NH- (b3)

[0135]

[0136] wherein the molar ratio of the sum of the repeating units (a) to the sum of the repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, and

[0137] One or more of the nitrogen atoms of the repeating units (a) and / or (b) contained in the copolymer may be protonated to provide a cationic copolymer.

[0138] The copolymer can be a statistical copolymer, wherein any repeating unit (a) and any repeating unit (b) are statistically distributed in the copolymer macromolecule. It is usually obtained by copolymerizing a mixture of monomers that produce repeating units (a) during the polymerization reaction and monomers that produce repeating units (b) during the polymerization reaction. Preferably, the copolymer is a random copolymer, wherein any repeating unit (a) and any repeating unit (b) are randomly distributed in the polymer macromolecule.

[0139] Such copolymers can be linear, branched or dendritic copolymers. As will be appreciated by those skilled in the art, repeating units of formula (a1), (b1) or (b3) with two valence states (i.e., open bonds with adjacent units) cause the copolymer structure to propagate in a linear manner. Therefore, linear copolymers can include repeating units of formula (a1) and one or more types of repeating units of formula (b1) and (b3), but do not include repeating units of formula (a2), (b2) or (b4). As will be further appreciated, the presence of repeating units of formula (a2), (b2) or (b4) with three valence states provides branching points in the copolymer structure. Therefore, branched copolymers include repeating units of formula (a2), (b2) and (b4) of one or more types, and may further include repeating units of formula (a1), (b1) and (b3) of one or more types.

[0140] Such copolymers may comprise a plurality of repeating units (a) independently selected from repeating units of formulae (a1) and (a2) defined above and a plurality of repeating units (b) independently selected from repeating units of formulae (b1) to (b4) defined above. Preferred are copolymers comprising a plurality of repeating units (a) independently selected from repeating units of formulae (a1) and (a2) defined above and a plurality of repeating units (b) independently selected from repeating units of formulae (b1) and (b2) defined above.

[0141] Preferably, this copolymer is a branched copolymer comprising one or more types of repeating units selected from repeating units (a2), (b2) and (b4), and optionally further comprising one or more types of repeating units of formula (a1), (b1) and (b3), and in particular a copolymer comprising repeating units of formula (a2) and one or more types of repeating units of formula (b2) and (b4), and optionally further comprising one or more types of repeating units of formula (a1), (b1) and (b3). In line with the above, a more preferred copolymer is therefore a branched copolymer comprising repeating units of formula (a2) and repeating units of formula (b2), and optionally further comprising one or more types of repeating units of formula (a1) and (b1).

[0142] In the copolymer, the total number of repeating units (a) and repeating units (b) is usually 20 or more, preferably 50 or more, and more preferably 100 or more. Usually, the total number of repeating units (a) and repeating units (b) is 10,000 or less, preferably 5,000 or less, more preferably 1,000 or less.

[0143] In addition, for the copolymer, it is preferred that the repeating units (a) and (b) account for 80 mol% or more, more preferably 90 mol% or more of all the repeating units in the copolymer. Further preferred is a copolymer in which the repeating units (a) selected from (a1) and (a2) and the repeating units (b) selected from (b1) and (b2) account for 80 mol% or more, more preferably 90 mol% or more of all the repeating units in the copolymer. Most preferably, all the repeating units in the copolymer are repeating units (a) or (b), and in particular all the repeating units in the copolymer are repeating units (a) selected from (a1) and (a2) or repeating units (b) selected from (b1) and (b2).

[0144] The weight average molecular weight of the copolymer (as measured by, for example, size exclusion chromatography relative to linear poly(ethylene oxide) standards) is typically in the range of 1,000 to 500,000 Da, preferably in the range of 2,500 to 250,000 Da, and more preferably 5,000-50,000 less.

[0145] The end groups of such copolymers generally comprise one or more types of groups (c) independently selected from the groups of the following formulae (c1) to (c3), preferably selected from the groups of the following formulae (c1) and (c2):

[0146] -CH2-CH2-NH2 (c1)

[0147] -CH2-CH2-CH2-NH2 (c2)

[0148] -CH2-CH2-CH2-CH2-NH2 (c3).

[0149] Preferably, the end groups in the copolymer are composed of one or more types of groups (c) independently selected from the groups of the following formulae (c1) to (c3) (preferably selected from the groups of the following formulae (c1) and (c2)). As will be appreciated by those skilled in the art, the number of end groups depends on the structure of the copolymer. Although linear copolymers have only two end groups, branched copolymers, particularly dendritic copolymers, contain a greater number of end groups. As will be further appreciated, one or more of the nitrogen atoms of the end groups (c) contained in the copolymer may also be protonated to provide a cationic copolymer.

[0150] In the copolymer, the molar ratio of the sum of repeating units (a) to the sum of repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, and preferably in the range of 0.8 / 1.0 to 1.0 / 0.8. This molar ratio can be determined, for example, by NMR. It will therefore be understood that this ratio is generally determined for a variety of macromolecules of the copolymer, and generally represents the total ratio of the sum of repeating units (a) to the sum of repeating units (b) in the variety of macromolecules.

[0151] As described above, one or more of the nitrogen atoms of the copolymer can be protonated to produce a copolymer in a cationic form (typically an oligocationic or polycationic form). It should be understood that the primary, secondary or tertiary amino groups in the repeating units (a) or (b) or in the terminal groups (c) can act as proton acceptors, particularly in water and aqueous solutions (including physiological fluids). Therefore, such copolymers generally have a total positive charge in aqueous solutions at a pH of 7.5 or below. As referred to herein, an aqueous solution is a solution in which the solvent contains 50% (volume / volume) or more, preferably 80% or 90% or more and most preferably 100% water. Moreover, if the composition is in contact with a physiological fluid (including, for example, blood and lung fluid) at a pH of 7.5 or below, they generally contain repeating units (a) and (b) in which the nitrogen atoms are protonated. The pK of the copolymer used in the composition is 1.5. a The value can be automatically obtained by using pK aThe net charge at a given pH value can then be calculated, for example, according to the Henderson-Hasselbach formula. Any charge can be shared between several base centers and cannot necessarily be attributed to a single point. Typically, in a solution at physiological pH, the copolymer used in the composition comprises repeating units having amino groups in a protonated state and repeating units having amino groups in a non-protonated state.

[0152] However, as will be appreciated by those skilled in the art, the copolymers and compositions may also be provided in the form of dry salts comprising the copolymers in cationic form.

[0153] As will be further understood, the counterions (anions) to the positive charges of the protonated amino groups in the composition comprising the copolymer and nucleic acids (particularly RNA, preferably single-stranded RNA, such as mRNA) are generally provided by the anionic moieties contained in the nucleic acids. If the positively charged groups are present in excess compared to the anionic moieties in the nucleic acids, the positive charges may be balanced by other anions, particularly those anions commonly encountered in physiological fluids, such as Cl- or HCO3 - .

[0154] According to the above, the preferred copolymers are random copolymers, wherein

[0155] 80 mol% or more of all repeating units (more preferably all repeating units) are formed by

[0156] A plurality of repeating units (a) independently selected from repeating units of the following formulae (a1) and (a2):

[0157] -CH2-CH2-NH- (a1)

[0158]

[0159] A plurality of repeating units (b) independently selected from repeating units of the following formulae (b1) and (b2):

[0160] -CH2-CH2-CH2-NH- (b1)

[0161]

[0162] wherein the molar ratio of the sum of repeating units (a) to the sum of repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, more preferably in the range of 0.8 / 1.0 to 1.0 / 0.8;

[0163] The end groups of the copolymer are formed by

[0164] Group (c) independently selected from groups of formula (c1) and (c2):

[0165] -CH2-CH2-NH2 (c1)

[0166] -CH2-CH2-CH2-NH2 (c2); and

[0167] One or more of the nitrogen atoms of the repeating units (a) and / or (b) and / or the terminal groups (c) contained in the copolymer may be protonated to provide a cationic copolymer. It is further preferred that the copolymer is a branched copolymer comprising units (a2) and (b2), optionally together with units (a1) and / or (b1).

[0168] Copolymer can be prepared by known procedures similar to those for preparing polyalkylene imines such as branched or linear polyethylene imine (PEI). It will be understood that the monomers for producing copolymers will have to be adjusted accordingly. In this article, it has been found that monomers can be easily reacted in a quantitative manner so that the ratio of units (a) and (b) in copolymers can be adjusted by adjusting the monomer ratio in the monomer mixture that undergoes polymerization accordingly. Although polyethylene imine can be prepared by the ring-opening polymerization of, for example, aziridine, copolymers can be prepared by the ring-opening polymerization of monomer mixtures, which monomer mixtures include or are composed of aziridine, azetidine and (when applicable) pyrrolidine, or aziridine and azetidine in a preferred embodiment. It will be understood that the expression "when applicable" refers to the presence or absence of repeating units (b3) and (b4) or end groups (c3), which will be formed by pyrrolidine. The ring-opening polymerization of unsubstituted cyclic amines generally produces branched copolymers. Linear copolymers can be prepared, for example, by polymerization of appropriate N-substituted aziridines, N-substituted azetidines and N-substituted pyrrolidines, or N-substituted aziridines and N-substituted azetidines, and the N-substituents attached to the resulting polyalkyleneimine chain can then be cleaved, for example, hydrolytically, for example, in analogy to the procedures published in Katrien F. Weyts, Eric J. Goethals, "New synthesis of linear polyethyleneimine", Polymer Bulletin, 1988, 19(1): 13-19. Dendrimers can be synthesized according to the methods described, for example, in Yemul et al., Colloid and Polymer Science, 2008, 286(6-7): 747-752, "Synthesis and characterization of poly(ethylenimine) denrimers".

[0169] For the preparation of dendrimers (or dendritic copolymers), the synthetic strategies known for the production of polyethyleneimine or polyacrylamine dendrimers can be applied analogously. Polypropyleneimine dendrimers can be synthesized from acrylonitrile building blocks using a repeated sequence of Michael addition of primary amines followed by heterogeneous catalytic hydrogenation (Newkome and Shreiner "Poly(amidoamine), polypropylenimine, and related dendrimers and dendrons possessing different 1→2 branching motifs: An overview of the divergent procedures." Polymer 49 (2008) 1-173; De Brabander-Van Den Berg et al., "Large-scale production of polypropylenimine dendrimers," Macromolecular Symposia (1994) 77 (1) 51-62). Polyethyleneimine dendrimers can be produced using a repeating sequence of Michael addition of vinyl bromide building blocks to primary amines, followed by conversion of the alkyl bromide to the amine using the Gabriel amine synthesis method (Yemul & Imae, "Synthesis and characterization of poly(ethyleneimine) dendrimers", Colloid Polym Sci (2008) 286:747-752). Thus, one skilled in the art will be able to produce not only dendrimers having strictly alternating layers of, for example, propyleneimine and ethyleneimine. Similarly, dendrimers having layers comprising or consisting of repeating units of formula (a2), (b2) and (b4), and preferably random combinations of repeating units (a2) and (b2), can be produced.

[0170] The ring-opening polymerization of aziridine and azetidine, or aziridine, azetidine and pyrrolidine can be carried out in solution (e.g., in water). The total monomer concentration is not particularly limited, and a typical concentration range is 10% wt / wt to 80% wt / wt, preferably 30% wt / wt to 60% wt / wt. Typically, the polymerization is initiated by protons, so that preferably a Bronsted acid ( Acid), particularly an inorganic acid such as sulfuric acid. A small amount of acid is generally sufficient, such as 0.001 to 0.01 equivalents, based on the total concentration of monomers. The reaction is carried out at a convenient rate, for example, in the temperature range of 50-150° C., particularly 90-140° C. Within these ranges, higher molecular weight copolymers are generally at higher temperatures, while lower molecular weight copolymers are at lower temperatures.

[0171] In principle, lipids are the preferred agents or reagents to be used, particularly compared to oligomers, and more particularly compared to polymers.

[0172] Further examples of one or more agents or one or more agents for delivering and / or introducing RNA into target cells or target tissues are liposome transfection reagents (LTRs) and magnetic particles (MPs) as described elsewhere herein.

[0173] A specific mode for delivering RNA and / or introducing it into a target cell or target tissue is transfection. Therefore, it is conceivable that the RNA to be used is transfected (into (target) cells or tissues), delivered / administered and / or prepared for transfection by transfection. Means and methods for transfecting RNA are well known in the art, and, for example, described in Tavernier (loc.cit.), Yamamoto ("European Journal of Pharmaceutics and Biopharmaceutics (Eur J Pharm Biopharm.)" 71 (3) (2009), 484-9) and Kormann ("Nature Biotechnology". 29 (2) (2011), 154-7). Specific transfection mode is lipofection, magnetofection or magnetic lipofection.

[0174] Thus, the RNA to be used can be prepared for lipofection, prepared for transfection by lipofection, delivered / introduced by lipofection and / or administered by lipofection.

[0175] Thus, the pharmaceutical composition may (further) comprise at least one lipid or liposome transfection agent or enhancer (LTR; liposome transfection agent). The RNA to be used may be contained in, complexed with and / or delivered by the LTR. In particular, the RNA to be used may be contained in and / or delivered by (respective) lipofection complexes comprising the RNA and the LTR. The pharmaceutical composition may (further) comprise a lipofection complex.

[0176] LTRs are known in the art and are distributed, for example, by OzBiosciences of Marseille, France. The LTR to be used may be selected from the group consisting of the agents or reagents described above for delivering and / or introducing RNA into target cells or target tissues. For example, such LTRs may be lipids or lipidoids, preferably cationic lipids or cationic lipidoids, such as lipidoids disclosed in PCT / EP2014 / 063756 (e.g., C12-(2-3-2), lipids such as those disclosed in EP2285772 (e.g., Dogtor), and lipopolyamines such as those disclosed in EP1003711 (e.g., DreamFect TM and DreamFect Gold TM ). The specific LTR may be selected from the group consisting of:

[0177] (i) C12-(2-3-2);

[0178] (ii) DreamFect™, preferably DreamFect Gold™ (DF™ / DF-Gold™; OzBiosciences, Marseille, France);

[0179] (iii) Dogtor (OzBiosciences, Marseille, France); and

[0180] (iv) Lipofectamine, such as, for example, Lipofectamine 2000 (Invitrogene, CA, USA).

[0181] In principle, Dogtor is the preferred drug, DreamFect TM is a more preferred drug, and DF-Gold TM and C12-(2-3-2) are even more preferred LTRs.

[0182] For example, LTR such as Dogtor is described in EP2285772. For example, DF is described in EP1003711. TM or DF-Gold TM In principle, oligomers, polymers or lipids as disclosed in PCT / EP2014 / 063756, specific cationic lipids as disclosed in EP2285772 and specific lipopolyamines as disclosed in EP1003711 are preferred LTRs. TM LTR is most preferred.

[0183] A non-limiting example of a lipid-infecting complex is DF-Gold TM / RNA lipoplex and C12-(2-3-2) / RNA lipoplex.

[0184] C12-(2-3-2) is a particularly preferred LTR having a structure represented by formula (V) (see et al., Angewandte Chemie Int., 2016; 55(33): 9591-5):

[0185]

[0186] C12-(2-3-2) is preferably as in WO 2016 / 075154 A1, EP 3013964 and et al., (Angewandte Chemie Int. Ed., 2016;55(33):9591-5). The cationic lipid can be prepared by mixing N1-(2-aminoethyl)-N3-(2-((3,4-dimethoxybenzyl)amino)ethyl)propane-1,3-diamine (8.9 g, 1 eq., 28.67 mmol) with 1,2-epoxydodecane (42.27, 8 eq., 229.4 mmol) and mixing at 80°C for 24 hours with constant shaking, followed by purification and removal of the 3,4-dimethoxybenzyl protecting group.

[0187] Different isomers of C12-(2-3-2) may be used, such as racemates, S isomers and / or R isomers. Preferably, C12-(2-3-2) is used as a pure R isomer and has a structure as shown in formula (VI). In order to obtain a pure R isomer of C12-(2-3-2), it can be prepared by synthesizing using the R isomer of 1,2-epoxydodecane as described above for C12-(2-3-2).

[0188]

[0189] Therefore, in a preferred embodiment, the pharmaceutical composition comprises a polyribonucleotide for treating a ciliary disease, and further comprises a lipid having a structure as shown in formula (V), preferably as shown in formula (VI).

[0190] A further particularly preferred LTR is a cationic lipid of formula (VII), also referred to herein as "dL_P", which can be synthesized by reacting N,N'-bis(2-aminoethyl)-1,3-propylenediamine with N-dodecylacrylamide using boric acid as a catalyst. For the reaction, the mixture can be stirred at 100°C under microwave irradiation.

[0191] Therefore, in a further preferred embodiment, the pharmaceutical composition comprises a polyribonucleotide for treating a ciliary disease, and further comprises a lipid having a structure represented by formula (VII).

[0192]

[0193] In addition, the pharmaceutical composition comprises a cationic lipid of formula (V), (VI) and / or (VII), preferably dL_P and / or C12-(2-3-2), more preferably the R isomer of dL_P and / or C12-(2-3-2), which is contained in a formulation as described below. In particular, the agents and reagents described herein for delivering and / or introducing RNA into target cells or target tissues and the LTRs described herein can be combined with one or more (e.g., two, three or four) further lipids (e.g., cholesterol, DPPC, DOPE and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG2000)). These further lipids can support the desired functions of the agents / reagents and LTRs (supporting and / or increasing the delivery and / or introduction of RNA into cells or tissues and improving transfection efficiency, respectively), and serve as respective "helper lipids". Specific examples of such "helper lipids" are cholesterol, DPPC, DOPE and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG (e.g., DMG-PEG2000)). Further lipids (e.g., "helper lipids") can also be part (one or more) of the complexes / particles disclosed herein. Those skilled in the art can easily prepare complexes / particles according to the present invention. Examples of further lipids (e.g., "helper lipids") are also known in the art. Those skilled in the art can easily select suitable further lipids (e.g., "helper lipids") and the ratio of agent / agent / LTR to further lipids (e.g., "helper lipids"). Such ratios can be 1-4:1-5, 3-4:4-6, about 4:about 5, about 4:about 5.3 molar ratios of agent / agent / LTR: further lipids (narrower ranges are preferred). For example, the agent / agent / LTR may be combined with three further lipids such as DPPC, cholesterol and DMG-PEG2000 in a molar ratio of 8:5.3:4.4:0.9, respectively, or more particularly 8:5.29:4.41:0.88, respectively.

[0194] Preferably, dL_P and / or C12-(2-3-2), more preferably the R isomer of dL_P and / or C12-(2-3-2), are produced as described above and used to formulate lipid particles together with auxiliary lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88.

[0195] The composition wherein the R isomer of C12-(2-3-2) (Formula VI) is prepared with lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to herein as "LF92". The composition wherein dL-P (Formula VII) is prepared with lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to herein as "LF111".

[0196] As also exemplified in, for example, WO 2016 / 075154 A1, EP 3013964 and Zhang et al. (TERMIS, 2019, Tissue Engineering: Part A, Vol. 25, Nos. 1 and 2), dL_P and / or C12-(2-3-2) can be used as non-viral vectors to form stable lipid complexes with mRNA molecules based on electrostatic interactions between the positive amino groups of the lipidoids of the mRNA molecules and the negative phosphate groups of the mRNA molecules (Anderson, Human Gene Therapy 14, 2003, 191-202). In order to stabilize the lipid complex structure and reduce leakage, dL_P and / or C12-(2-3-2), more preferably the R isomer of dL_P and / or C12-(2-3-2), can be provided with two auxiliary lipids, namely 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and cholesterol (Anderson, Drug Delivery 11, 2004, 33-39; Liang, Journal of Colliod and Interface Science 278, 2004, 53-62). Finally, 1,2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG) 2kD (DMG-PEG2000) are added to the lipid mixture to provide PEGylated liposomes. It is well known that PEGylation improves the physicochemical properties of liposome formulations by increasing water solubility, preventing enzymatic degradation, and limiting immunogenicity and antigenicity reactions (Milla, Current Drug Metabolism 13, 2012, 105-119). The final N / P ratio of the entire ethanol lipid mixture is 8:5.29:4.41:0.88, which represents the molar ratio of the amino group of dL-P and / or C12-(2-3-2) / DPPC / cholesterol / DMG-PEG2000 to a phosphate group of the mRNA molecule.

[0197] Therefore, in a preferred embodiment, the pharmaceutical composition comprising polyribonucleotides for the treatment of ciliary diseases further comprises dL_P and / or C12-(2-3-2) formulated with DPPC, cholesterol and DMG-PEG2000, preferably the R isomer of dL_P and / or C12-(2-3-2).

[0198] In addition, in a particularly preferred embodiment, the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases further comprises dL_P and / or C12-(2-3-2) formulated with DPPC, cholesterol and DMG-PEG2000, preferably the R isomer of dL_P and / or C12-(2-3-2), wherein for the molar ratio of the amino group of dL_P and / or C12-(2-3-2) / DPPC / cholesterol / DMG-PEG2000 to one phosphate group of the mRNA molecule, respectively, the final N / P ratio of the entire ethanol lipid mixture is 8:5.29:4.41:0.88.

[0199] As described above, the R isomer of C12-(2-3-2) formulated with DPPC, cholesterol and DMG-PEG2000 is also referred to as the LF92 formulation.

[0200] Therefore, in a particularly preferred embodiment of the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition further comprises a LF92 preparation.

[0201] As mentioned above, dL_P formulated with DPPC, cholesterol and DMG-PEG2000 is also referred to as LF111 formulation.

[0202] Therefore, in a particularly preferred embodiment of the pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition further comprises a LF111 preparation.

[0203] In a preferred embodiment of a pharmaceutical composition comprising polyribonucleotides for treating ciliary diseases, the pharmaceutical composition further comprises a LF92 and / or LF111 preparation. LF92 and / or LF111 refers to a vector preparation for cell transfection. This is advantageous because the use of LF92 and / or LF111 is associated with a high transfection efficiency and thus ensures that polyribonucleotides encoding a functional version of a protein whose defect is associated with a ciliary disease can effectively enter cells, preferably undifferentiated ciliated cells or basal cells, and thus restore ciliated cell function in subjects suffering from PCD.

[0204] In a particularly preferred embodiment, the pharmaceutical composition comprises LF92 and / or LF111 preparations, at least one of the following: mRNA that can be translated into a functional version of MCIDAS protein, mRNA that can be translated into a functional version of GemC1 protein, mRNA that can be translated into a functional version of FoxJ1 protein, mRNA that can be translated into a functional version of E2f4VP16 protein, and mRNA that can be translated into a functional version of CCDC40 and / or CCDC39. Preferably, such a composition is administered to a patient by using a spray, droplets and / or a nebulizer and / or by inhalation, preferably at least once a week and / or for at least 4 weeks.

[0205] Therefore, in certain embodiments, except described pharmaceutical composition comprises can be translated into two or more, preferably two kinds of polyribonucleotides of the functional version of albumen, identical with described above embodiment.Therefore, in certain embodiments, as described in the above embodiment pharmaceutical composition comprises polycistronic polyribonucleotide.

[0206] The present invention also relates to a method for treating a ciliary disease in a subject suffering from a ciliary disease, the method comprising administering a pharmaceutical composition comprising polyribonucleotides, wherein the polyribonucleotides encode a functional version of a protein whose defect is associated with the ciliary disease, and wherein the pharmaceutical composition is administered to the respiratory system of the subject and acts when the subject exhibits inflammation of the respiratory system. Possible embodiments and preferred embodiments of the pharmaceutical composition and the manner and time of its administration are the same as those described above for the pharmaceutical composition according to the present invention.

[0207] The present invention also relates to a pharmaceutical composition comprising polyribonucleotides encoding a protein whose defect is associated with a ciliary disease and N-acetylcysteine ​​(NAC), a hypertonic solution containing sodium chloride and / or LF92 and / or LF111 preparations.

[0208] About pharmaceutical composition and its component, with the above-mentioned about the pharmaceutical composition containing polyribonucleotide for treating the ciliary disease of the experimenter with ciliary disease the same as described above.In addition, other characteristics of this pharmaceutical composition can also be as described above.

[0209] Therefore, in a preferred embodiment, the pharmaceutical composition may further comprise mRNA that can be translated into a functional version of MCIDAS.

[0210] The present disclosure also relates to a polyribonucleotide encoding human CCDC40 as shown in any one of SEQ ID NOs: 1 or 5 to 11.

[0211] In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, the polyribonucleotide or modified polyribonucleotide encodes human CCDC40 (e.g., functional human CCDC40) and comprises a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to one or more of SEQ ID NOs: 1 or 5 to 11 (e.g., to the sequences described in SEQ ID NOs: 1 or 5 to 11).

[0212] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a CYBA 5'UTR, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, a CYBA 3'UTR, and a poly(A) tail (see, e.g., SEQ ID NO: 1).

[0213] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 5).

[0214] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, additional U nucleotides, a TISU element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 6).

[0215] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a hAg 5'UTR, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 7).

[0216] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a human CMV IE9 5'UTR, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, a human growth hormone 3'UTR, and a poly(A) tail (see, e.g., SEQ ID NO: 8).

[0217] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a Kozak element, an EGFP coding sequence, a G4S spacer, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 9).

[0218] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC40 protein, a G4S spacer, an EGFP coding sequence, and a poly(A) tail (see, e.g., SEQ ID NO: 10).

[0219] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5' untranslated region (UTR) of Ethris, a CYBA 5'UTR, a Kozak element, followed by an HA tag, a G4S spacer, a codon-optimized sequence encoding a functional version of a human CCDC40 protein, a T2A peptide, a sequence encoding tdTomato, a CYBA 3'UTR, and a poly(A) tail (see, e.g., SEQ ID NO: 11).

[0220] In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a level and / or type of modification selected from any such level and / or type described herein.

[0221] In certain embodiments, the percent identity of the polyribonucleotide is measured only relative to a portion of the CCDC40 coding sequence of SEQ ID NO: 1 or 5 to 11 (e.g., when calculating percent identity, UTRs, other non-coding sequences and GFP or epitope tags are not considered, and the polyribonucleotide may or may not include such regions).

[0222] In certain embodiments of any of the foregoing, the polyribonucleotide (or modified polyribonucleotide) encodes a functional CCDC40 protein.

[0223] The present disclosure also relates to a polyribonucleotide encoding human CCDC39 as shown in any one of SEQ ID NOs: 2 or 12 to 14.

[0224] In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, the polyribonucleotide or modified polyribonucleotide encodes human CCDC39 and comprises a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to one or more of SEQ ID NOs: 2 or 12 to 14 (e.g., to the sequence shown in SEQ ID NOs: 2 or 12 to 14).

[0225] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5'UTR of Ethris, a CYBA 5'UTR, a Kozak element, followed by a codon-optimized sequence encoding a functional version of a human CCDC39 protein, a CYBA 3'UTR, and a poly(A) tail (see, e.g., SEQ ID NO: 2).

[0226] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5'UTR of Ethris, a Kozak element, followed by a codon-optimized sequence encoding a functional version of human CCDC39 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 12).

[0227] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5'UTR of Ethris, additional U nucleotides, a TISU element, followed by a codon-optimized sequence encoding a functional version of a human CCDC39 protein and a poly(A) tail (see, e.g., SEQ ID NO: 13).

[0228] In certain embodiments, the polyribonucleotide comprises at its 5' end a portion of a T7 promoter, a minimal 5'UTR of Ethris, SP30 (i.e., a random sequence of 30 nucleotides) as a 5'UTR, a Kozak element, followed by a codon-optimized sequence encoding a functional version of human CCDC39 protein, and a poly(A) tail (see, e.g., SEQ ID NO: 14).

[0229] In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a level and / or type of modification selected from any such level and / or type described herein.

[0230] In certain embodiments, the identity percentage of the polyribonucleotide is only measured relative to the CCDC39 coding sequence-part of SEQ ID NO:2 or 12 to 14 (for example, when calculating the identity percentage, UTR, other non-coding sequences and GFP or epitope tags are not considered, and the polyribonucleotide may or may not include such a region).

[0231] In certain embodiments of any of the foregoing, the polyribonucleotide (or modified polyribonucleotide) encodes a functional CCDC39 protein.

[0232] The present disclosure also relates to polyribonucleotides encoding human MCIDAS as shown in SEQ ID NO:4. In some embodiments of any of the foregoing or other aspects and embodiments of the present disclosure, polyribonucleotides or modified polyribonucleotides encode human MCIDAS and comprise a primary sequence that is at least 85%, at least 90%, at least 92% or at least 95% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or 100% identical) to SEQ ID NO:4 (e.g., to the sequence shown in SEQ ID NO:4). In certain embodiments, the polyribonucleotide comprises a portion of a T7 promoter at its 5' end, a minimal 5'UTR of Ethris, a Kozak element, followed by a codon-optimized sequence encoding a functional version of human MCIDAS protein, an optional 3'UTR (which is also used as a reverse primer binding site for template production based on PCR), and a poly (A) tail. In some embodiments, the polyribonucleotide is a modified polyribonucleotide having a modification level and / or type selected from any such level and / or type described herein. In certain embodiments, the identity percentage of the polyribonucleotide is measured only relative to the MCIDAS coding sequence-part of SEQ ID NO:4 (for example, when calculating the identity percentage, UTR, other non-coding sequences and GFP or epitope tags are not considered, and the polyribonucleotide may or may not include such regions). In certain embodiments of any of the foregoing, this polyribonucleotide (or modified polyribonucleotide) encodes a functional MCIDAS protein.

[0233] To determine the percent identity of a first sequence relative to a second sequence, an analog (e.g., methylcytidine) is matched to cytidine, etc. In certain embodiments, the term "primary sequence" can be used to refer to a polynucleotide sequence, regardless of whether it is modified or the level of modification, such that a primary sequence identical to CUCUCUA would include that sequence, regardless of whether any or all of the nucleotides are modified (e.g., any more or more analogs of C, U, and A may exist and would be considered the same primary sequence).

[0234] In certain embodiments, the percent identity is determined by reference only to the portion of a given listed sequence corresponding to the coding sequence of, for example, CCDC40 or CCDC39. In other embodiments, the percent identity is determined by reference to the coding sequence and one or more non-coding sequences. In certain embodiments, the percent identity is determined over the entire length of the listed sequence (e.g., by reference to the entire length of the sequence listed in the sequence listing herein).

[0235] In addition, the present invention relates to a method for analyzing the effect of polyribonucleotides on ciliogenesis, wherein the polyribonucleotide encoding participates in ciliogenesis and / or the protein required for ciliogenesis, the method comprising the following steps:

[0236] (a) obtaining a nasal swab from a subject suffering from a ciliary disease, the nasal swab comprising undifferentiated basal cells and differentiated ciliated cells,

[0237] (b) culturing the cells obtained from step (a) as a submersed cell culture for obtaining undifferentiated basal cells and dedifferentiated ciliated cells,

[0238] (c) culturing the undifferentiated basal cells and dedifferentiated ciliated cells obtained from step (b) as an air-liquid interface cell culture and performing airlift,

[0239] (d) transfecting the cells obtained from step (c) with polyribonucleotides encoding proteins involved in and / or required for cilium formation,

[0240] (e) culturing the transfected cells obtained from step (d) to obtain differentiated ciliated cells, and

[0241] (f) determining the effect of the polyribonucleotide on ciliogenesis using lactate dehydrogenase measurement, NucGreen assay, high-speed video microscopy, ciliary beat frequency measurement, mucociliary clearance assay and / or immunofluorescence staining.

[0242] In order to obtain cells of the respiratory epithelium of a patient, a nasal swab is advantageous because it is easy to handle and the procedure is quick and painless for the patient. The cells obtained from the nasal swab include undifferentiated basal cells and differentiated ciliated cells that can be cultured as immersion cell cultures. By culturing the cells as immersion cell cultures, undifferentiated basal cells and dedifferentiated ciliated cells can be obtained because the immersion conditions induce dedifferentiation of epithelial cells. The dedifferentiated ciliated cells thus obtained as well as the undifferentiated basal cells of the nasal swab are then cultured as air-liquid interface (ALI) cell cultures.

[0243] The air-liquid interface cell culture of step (c) refers to a cell culture characterized in that the basal surface of the cells is in contact with the liquid culture medium, while the apical surface is exposed to the air. The cells can be seeded on a permeable membrane, such as a cell culture insert, which initially provides culture medium to the apical compartment and the bottom compartment. This can also be referred to as "submerged cell culture". Once confluence is reached, the cells are subjected to an "airlift" step, in which culture medium is only supplied to the basal chamber. This simulates conditions found in, for example, the respiratory system, and induces cell differentiation, including cilia formation, in undifferentiated ciliated cells. Therefore, cells simulating the epithelium of the respiratory system, including, for example, basal cells and ciliated cells, can be obtained for further studies in vitro.

[0244] Then, the epithelial simulation cells obtained by polyribonucleotide transfection of the protein required for the participation in cilia formation and / or cilia formation can be used for coding. Therefore, the polyribonucleotide is introduced into the cell, which can be carried out manually by means other than viral infection or viral infection, to express exogenous polyribonucleotides in the cell. Then, the transfected cells are cultivated to obtain differentiated ciliated cells from substrate and undifferentiated ciliated cells. Therefore, the effect of polyribonucleotides (such as mRNA) on cilia formation can be determined in vitro, while retaining the cell environment of the epithelium simulating the respiratory system, as can be found in, for example, a subject.

[0245] The effect of polyribonucleotides on cilia formation can be determined by various methods known to those skilled in the art. These methods include, for example, lactate dehydrogenase measurement, NucGreen determination, high-speed video microscopy, ciliary beat frequency measurement, mucociliary clearance determination and / or immunofluorescence staining. Therefore, lactate dehydrogenase measurement (LDH) can be performed to determine the amount of LDH released in the environment around the cell. The corresponding determination can be a colorimetric determination, in which the amount of LDH released is measured by an enzymatic reaction, which converts, for example, iodonitrotetrazolium or tetrazolium salts into red formazan. Therefore, the determination can be easily read by spectroscopy.

[0246] Alternatively or additionally, NucGreen can be measured.NucGreen is a permanent green fluorescent nucleic acid stain after being combined with nucleic acid, and can be used to study the toxicity-related effects of, for example, transfection.Alternatively or additionally, immunofluorescence staining can be carried out to the protein encoded by the polyribonucleotide of transfection, to determine its amount and cellular localization, including co-localization with other proteins.In order to determine the amount of expressed protein, Western blotting technology can also be used.

[0247] In addition, defects in ciliary structure or the absence of cilia can be detected, for example, using specialized microscopy. Screening tests include, for example, measurement of nasal nitric oxide production rates, examination of ciliary motility by high-speed video microscopy of nasal cells, or in vivo tests including the saccharin test. More specific diagnosis requires examination of cilia, for example, by immunofluorescence and transmission electron microscopy.

[0248] Alternatively or additionally, ciliary beat frequency measurements can be applied to study the beat frequency, number of beating cilia and ciliated cells, and beat synchrony using high-speed video microscopy. The same applies to mucociliary clearance assays, which can be performed to determine mucus clearance as affected by ciliary function.

[0249] About the polyribonucleotide to be used in the method, it is the same as described above in conjunction with the pharmaceutical composition of the present invention for treating ciliary diseases.In addition, other characteristics of this polyribonucleotide can also be as described above.

[0250] In addition, polyribonucleotides may contain the sequence of coding markers.Examples include tdTomato (such as, for example, included in SEQ ID NO:3), green fluorescent protein (GFP) and enhanced GFP (eGFP) as described in the attached examples and corresponding detection methods.This is particularly advantageous for verifying the successful transfection of cells with polyribonucleotides.

[0251] In some embodiments of the method for analyzing the effect of polyribonucleotides on ciliogenesis, the cells are transfected within 0 to 12 days, preferably within 0 to 11 days, more preferably within 0 to 6 days, even more preferably within 0 to 4 days, and most preferably within 0 to 48 hours after the gas lift in step (c). This is advantageous because the gas lift step induces ciliogenesis of basal and undifferentiated ciliated cells.

[0252] In some embodiments of the method for analyzing the effect of polyribonucleotides on ciliogenesis, cells are transfected with polyribonucleotides (preferably mRNA) encoding proteins involved in ciliogenesis and / or required for ciliogenesis using lipidoids having structures shown in formula (V), (VI) and / or (VII).

[0253] In some embodiments of the method for analyzing the effect of polyribonucleotides on cilia formation, cells are cultured in steps (b) to (e) using medium G. The composition of medium G is generally as shown in Table 2).

[0254] Table 2

[0255] substance volume Final concentration DMEM / Ham's F12 100mL Ultroser G 2mL 2％ Fetal cloning II 2mL 2％ insulin 100μL 2.5 μg / mL Bovine Brain Extract 250μL 22.5 μg / mL Transferrin 100μL 2.5 μg / mL Hydrocortisone 20μL 20nM 3,3',5-Triiodo-L-thyronine 3.33μL 500nM Epinephrine 10μL 1.5μM Retinoic acid 10μL 10nM Phosphoethanolamine 5μL 250nM Ethanolamine 100μL 250nM DAPT 10μL 1μM

[0256] In some embodiments of the method for analyzing the effect of polyribonucleotides on cilia formation, cells are cultured in steps (b) to (e) using one of the culture media shown in Table 3. The culture media shown in Table 3 are some commercially available culture media that can be used to grow ALI cultures.

[0257] Table 3

[0258] supplier Growth stage Differentiation stage LONZA ALI-G ALI-D StemCell ALI-Ex ALI-M Epithelix MucilAir MucilAir PELOBiotech Pelo Pelo

[0259] In some embodiments of the method for analyzing the effect of polyribonucleotides on ciliogenesis, the nasal swab further comprises fibroblasts, and wherein the growth of the fibroblasts is inhibited in steps (b) to (e). This is advantageous because fibroblasts grow faster than basal and undifferentiated ciliated cells, and thus can hinder the study of the effect of polyribonucleotides on ciliogenesis as described above.

[0260] Before the cells are transferred to the stationary phase flask, the fibroblasts can be separated from the rest of the cells due to the short incubation time of 1-2 hours. During this time, the fibroblasts can settle down and adhere to the cell flask. All other cells remain in the culture medium as suspension cells and can be easily transferred to the "stationary phase flask" afterwards.

[0261] The method according to the invention preferably leads to the identification of polyribonucleotides, which have a positive effect on cilium formation and can be used to restore the function of ciliary cell structure, and therefore, leads to a pharmaceutical composition according to the second aspect and its use in the treatment of ciliary diseases of a subject suffering from a ciliary disease according to the first aspect of the invention. Therefore, regarding the characteristics of the polyribonucleotides, the same as described above in conjunction with the pharmaceutical composition for the treatment of ciliary diseases of the present invention. In addition, other characteristics of this polyribonucleotide may also be as described above.

[0262] Figure 1 :Translation efficiency of CCDC40 mRNA. 2 / 1.4 / 0.3 / 0.2 / 0.05x10^6 HEK293 cells were seeded in 6-well plates. 24 hours after seeding, different CCDC40 constructs (ETH031T06-T10, 2.5μg / 9.5cm 2) transfected cells. Cell lysis was performed at 6, 24, 48, 72 and 144 hours after transfection. 50 μg of total protein lysate was analyzed by SDS-PAGE and Western blot. CCDC40 was detected using anti-CCDC40 antibody (HPA022974) from Atlas Antibodies (1:2000). GAPDH was used as a loading control. GFP was used as a transfection control.

[0263] Figure 2 : Translation efficiency of CCDC40 mRNA constructs in BEAS-2B, RPMI2650 and HEK293 cells: 2×10^6 HEK293, 7.5×10^5 BEAS-2B and 5×10^5 RPMI 2650 cells were seeded in 6-well plates. 24 hours after seeding, different CCDC40 constructs (2.5 μg / 9.5 cm 2 ) transfected cells. Cells were lysed 6 hours after transfection. Protein lysates were analyzed by SDS-PAGE and Western blotting (HEK293: 50 μg, RPMI 2650: 20 μg, BEAS-2B: 30 μg of total lysate). CCDC40 was detected using anti-CCDC40 antibody (HPA022974) from Atlas Antibodies (1:2000).

[0264] Figure 3 : High-speed video microscopy (HSVM) results after LF92 / CCDC40 transfection. Patient-derived ALI cultures were transfected with 3 μg of LF92 / CCDC40 every other day. Videos (20 per insert) were taken before and every 24 hours after transfection, and the ciliary beat frequency (CFB) was calculated using Sisson-Ammons Video Analysis (SAVA) software. All (Allover) 16 transfections (1 month) were performed. Measurements were performed at 37°C using 40x magnification. The average value of the ciliary beat frequency measurements was calculated (whole field analysis, WFA).

[0265] Figure 4: Mucociliary clearance (MCC) shown as Z projection and polarogram. 18 days after gas lift, CCDC40 patient ALI cultures were transfected with CCDC40 mRNA / LF92 at a concentration of 3 μg / insert. During the experiment, ALI cultures were kept in medium G. Transfection (TF) was performed once a week for 4 weeks (=4×TF). Mucociliary clearance (MCC) was measured at 20 times magnification using 0.5 μm fluorescent beads. One week after the last TF, 30 seconds videos of different areas were taken and analyzed using Polargraph software from Nikon. An exemplary picture is shown.

[0266] Figure 5 : Mucociliary clearance (MCC) of tdTomato is shown as a Z projection (upper left) and polarogram (upper right), and healthy controls (lower right) are shown as polarograms. Upper row: Cells from patients with CCDC40 mutations in ALI cultures were transfected with tdTomato mRNA / LF111 at a concentration of 3 μg / insert 18 days after gas lift. During the experiment, ALI cultures were kept in culture medium G. Transfection (TF) was performed once a week for 4 weeks (=4×TF). Mucociliary clearance (MCC) was measured using 0.5 μm fluorescent beads at 30x magnification. One week after the last TF, 20-second videos of different areas were taken and analyzed using Polargraph software from Nikon. An exemplary video is shown. Lower right: Particle tracking of healthy WTALI cultures. MCC was measured using 0.5 μm fluorescent beads at 20x magnification. One week after the last TF, 20 s videos of different areas were captured and analyzed using Polargraph software from Nikon Inc. An example image and two analyzed ROIs are shown.

[0267] Figure 6 : 18 days after gas lift, cells from patients with CCDC40 mutations in ALI cultures were transfected with tdTomato mRNA / LF111 or CCDC40 mRNA / LF92 at a dose of 3 μg / insert. During the experiment, ALI cultures were kept in medium G. Transfection (TF) was performed once a week for 4 weeks (=4×TF). WT ALI from healthy nasal swabs was used as a control. Samples for cryoembedding were prepared one week after the last TF. ALI membranes treated with CCDC40mRNA and tdTomato mRNA were cut at 20 μm and stained with anti-GAS8 (red), anti-acetylated tubulin (green) and DAPI (blue). Pictures were taken with a confocal microscope. An exemplary image is shown. The scale bar represents 10 μm.

[0268] Figure 7 : 18 days after gas lift, cells from patients with CCDC40 mutations in ALI cultures were transfected with tdTomato mRNA / LF111 or CCDC40 mRNA / LF92 at a dose of 3 μg / insert. During the experiment, ALI cultures were kept in medium G. Transfection (TF) was performed once a week for 4 weeks (=4×TF). ALI from healthy controls was used as a control. Samples for cryoembedding were prepared one week after the last TF. ALI membranes treated with CCDC40 mRNA and tdTomato mRNA were cut at 20 μm and stained with anti-DNALI1 (red), anti-acetylated tubulin (green) and DAPI (blue). Pictures were taken with a confocal microscope. An exemplary image is shown. The scale bar represents 10 μm.

[0269] Figure 8 : 18 days after gas lift, cells from patients with CCDC40 mutations in ALI cultures were transfected with tdTomato mRNA / LF111 or CCDC40 mRNA / LF92 at a dose of 3 μg / insert. During the experiment, ALI cultures were kept in medium G. Transfection (TF) was performed once a week for 4 weeks (=4×TF). ALI from healthy controls was used as a control. Samples for cryoembedding were prepared one week after the last TF. ALI membranes treated with CCDC40 mRNA and tdTomato mRNA were cut at 20 μm and stained with anti-CCDC39 (1:200, red), anti-acetylated tubulin (1:10.000, green) and DAPI (blue). Pictures were taken with a confocal microscope. An exemplary image is shown. Magnified 40 times.

[0270] Fig. 9 : Expression of CCDC39 protein (110 kDa) in HEK-293 & BEAS-2B 6 hours and 24 hours after transfection. 1.4×10^5 HEK-293 cells and 3.5×10^5 BEAS-2B cells were seeded in 6-well plates and transfected with CCDC39-RNA (ETH047T02, minimal 5'UTR, Lipofectamine MessengerMax; ratio 1:1.5). After 6 hours and 24 hours, the cells were lysed with M-PER and Triton X-100 buffer. Western blot analysis was performed using 50 μg of protein lysate. Lysates of untransfected (UT) and EGFP-transfected cells were used as controls. High dose = 0.5 μg / cm 2 , low dose = 0.25 μg / cm 2 .

[0271] Fig.10 :

[0272] Expression of CCDC39 protein (110 kDa) in untreated ALI cultures. Two inserts were extracted using the axoneme extraction protocol. Western blot analysis was performed using 30 μL, 10 μL, and 5 μL of protein lysate. Effective area: insert 39.9 = 71.25%, insert 41.2 = 59.88%

[0273] Fig.11 :

[0274] Expression of CCDC39 protein (110 kDa) in 16HBE14o- after treatment with proteasome inhibitors. 6.0×10^5 16HBE14o- cells were seeded in 6-well plates and transfected with CCDC39-RNA (Lipofectamine MessengerMax; ratio 1:1.5). After 6 hours, the cells were lysed with M-PER buffer. 20 μg of protein lysate was used for western blot analysis. Lysates of untransfected (UT) and EGFP-transfected cells were used as controls. High dose = 0.5 μg / cm 2 , low dose = 0.25 μg / cm 2 . RNA: ETH047T02: minimum 5'UTR, ETH047T03: TISU, ETH047T04: CYBA, ETH047T05: SP30.

[0275] Fig.12 : Expression of CCDC39 protein (110 kDa) in 16HBE14o- after treatment with proteasome inhibitors. 6.0×10^5 16HBE14o- cells were seeded in 6-well plates and transfected with CCDC39-RNA (ETH047T03, TISU 5'UTR, Lipofectamine MessengerMax; ratio 1:1.5). After 24 hours, the cells were lysed with M-PER buffer. 20 μg of protein lysate was used for western blot analysis. Lysates of untransfected (UT) and EGFP-transfected cells were used as controls. High dose = 0.5 μg / cm 2 , low dose = 0.25 μg / cm 2 .

[0276] Other aspects and advantages of the present invention will be described in the following examples, which are given for illustration and not for limitation.Each publication, patent, patent application or other document cited in this application is hereby incorporated by reference in its entirety.

[0277] Examples

[0278] Methods and materials for use in the present disclosure are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0279] I. Materials and Methods

[0280] Materials, devices, software and test systems used

[0281] The materials are listed in Table 4.

[0282] Table 4

[0283]

[0284]

[0285]

[0286]

[0287]

[0288] The devices are listed in Table 5.

[0289] Table 5

[0290]

[0291] The software is listed in Table 6.

[0292] Table 6

[0293]

[0294] The test systems are listed in Table 7.

[0295] Table 7

[0296] Test system Species strain HEK 293 Human primary embryonic kidney DSMZ No.: ACC305 RPMI 2650 Anaplastic squamous cell carcinoma DSMZ No.: ACC207 BEAS-2B Bronchial epithelium ATCC No.:CRL 9609

[0297] I. Submerged Cell Culture

[0298] 1. Cultivation

[0299] Cell lines were cultured in a cell culture incubator at 37°C and a humidified atmosphere with 5% CO2. All reagents and solutions were warmed to 37°C in a water bath before use.

[0300] First, use 20 mL of DPBS (without Mg 2+ / Ca 2+) Wash the confluent cells (about 90%) to remove dead cells. To detach the cells, add 2 mL of trypsin / EDTA solution (0.05%) to each flask. The cells are then incubated at 37°C until cell detachment occurs. Use 8 mL of the corresponding culture medium to stop trypsin. Because LHC-9 culture medium contains almost no serum, at least an equal volume of trypsin inhibitor is added to the detached BEAS-2B cells to inactivate trypsinization. The cell solution must then be centrifuged for 5 minutes (min) at 1100 revolutions per minute (rpm) to remove the trypsin inhibitor again. The precipitate is then dissolved in the culture medium. For passaging, the cells are split at different ratios depending on the next use.

[0301] HEK 293 (DSMZ No.: ACC305)

[0302] This established cell line is derived from primary human embryonic kidney transformed with adenovirus type 5 (AD 5). TM Supplement containing 10% heat-inactivated (hi) fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S). This cell line was split twice a week.

[0303] RPMI 2650 (DSMZ No.: ACC207)

[0304] This cell line was derived from the pleural effusion of a 52-year-old man with anaplastic squamous cell carcinoma of the nasal septum. It was chosen because of its ciliated epithelial-like morphology and similarity to bronchiolar epithelium. It was also grown in Dulbecco's Modified Eagle Medium (DMEM)-GlutaMAX TM Supplement containing 10% heat-inactivated (hi) fetal bovine serum (FBS) + 1% penicillin / streptomycin (P / S) + 1× non-essential amino acid solution (NEAA). This cell line was split 1-2 times per week.

[0305] BEAS-2B (ATCC No.: CRL 9609)

[0306] BEAS-2B cells are derived from normal bronchial epithelium obtained from autopsies of non-cancer individuals. The cells are then infected with replication-deficient SV40 / adenovirus 12 hybrids and cloned. The medium used is modified LHC-9 with no additives. The cells are split 1-2 times a week depending on confluence.

[0307] Flasks for BEAS-2B cells were coated with a mixture of 0.01 mg / mL fibronectin, 0.03 mg / mL collagen, and 0.01 mg / mL bovine serum albumin dissolved in LHC-9. 2 The mixture is then incubated at 37°C for at least 6 hours. 2+ / Ca 2+ Wash the flask three times with Dulbecco's phosphate-buffered saline (DPBS).

[0308] 2. In vitro transcription

[0309] To generate a template for in vitro transcription, the circular plasmid was linearized by restriction digestion with BstBI and further purified by chloroform-ethanol precipitation.

[0310] mRNA is produced using a standard in vitro transcription mixture (including specified modified triphosphate nucleotides) containing T7 RNA polymerase, inorganic pyrophosphatase and RNase inhibitor. Co-transcriptional end-capping is achieved by adding ARCA cap analogs. For the in vitro transcription of chemically modified RNA, 7.5% of cytidine-5'-triphosphate is replaced by 5-iodocytidine-5'-triphosphate, and 30% of uridine-5'-triphosphate is replaced by 5-iodouridine-5'-triphosphate (Jena Biosciences) (see, for example, SEQ ID NO: 1). In another chemically modified RNA production setup (setup), 3% of cytidine-5'-triphosphate is replaced by 5-iodocytidine-5'-triphosphate, and 15% of uridine-5'-triphosphate is replaced by 5-methyl-uridine-5'-triphosphate (Jena Biosciences) (see, for example, SEQ ID NO: 2). DNaseI is used to digest residual template DNA. Subsequently, mRNA is purified by ammonium acetate precipitation, followed by washing steps using 70% ethanol.

[0311] Residual uncapped mRNA was dephosphorylated using the Quick dephosphorylation Kit and then purified by ammonium acetate precipitation, followed by a 70% ethanol wash step and ultrafiltration using a 100 MWCO cut of filter.

[0312] The mRNA was further polyadenylated using poly(A) polymerase. The mRNA was purified again by ammonium acetate precipitation, followed by a 70% ethanol wash step and ultrafiltration using a 100 MWCO cutoff filter. The poly(A) length was determined to be 100 to 250 nucleotides by capillary gel electrophoresis.

[0313] In particular, the CCDC40 mRNA constructs studied in this experiment contained a 5'ARCA cap and a PPA and were as follows: minimal UTR with Ethris (ETH031T06; T06; SEQ ID NO:5), TISU 5'UTR but no 3'UTR (ETH031T07; T07; SEQ ID NO:6), hAg 5'UTR but no 3'UTR (ETH031T08; T08; SEQ ID NO:7), CYBA 5' and 3'UTR (ETH031T0; T09; SEQ ID NO:1), and 5'UTR from human CMV IE9 and 3'UTR from human growth hormone (ETH031T0; T10; SEQ ID NO:8).

[0314] 3. Transfection

[0315] To provide at least 90% confluence, cells were seeded in 6-well plates 24 hours before transfection. Cell counts varied depending on the time point and cell type read out (compare Table 8).

[0316] Table 8

[0317]

[0318] Different CCDC40 mRNA constructs were used for transfection as well as mRNA encoding enhanced green fluorescent protein (eGFP) as a transfection control. 2000 for transfection. Prior to transfection, the medium was exchanged to provide optimal conditions for the cells. The lipid complex reaction required an mRNA / WFI mixture as well as 2000 / medium mixture. Use 125 μL of each mixture, where mRNA and The volume ratio of 2000 was 1:2, since the mRNA showed a stock concentration of 1 μg / μl. Different mRNA concentrations were used and the mixtures were adjusted accordingly (see Table 9 for an exemplary pipetting scheme).

[0319] Table 9

[0320]

[0321] After preparing both mixtures, add the mRNA / WFI mixture to 2000 / medium mixture and incubated the solution for ≥5 min before adding it dropwise to the seeded cells. To obtain better cell survival, another medium change was performed 4 h after transfection.

[0322] 4. CCDC40 Western Blot

[0323] a. Sampling for Western Blotting

[0324] For cell lysis, remove the culture medium from the transfection and wash with DPBS (without Mg). 2+ / Ca 2+ ) and then washed with The cells were scraped off with a cell scraper. Before freezing the samples at -20°C, the cells were lysed with 100 μL of lysis buffer [10× TritonX-100 lysis buffer (250 mM Tris-HCl, 1% TritonX-100, pH: 7.8) adjusted to 1× in WFI and supplemented with protease inhibitor cOmplete].

[0325] Total protein concentration was measured using Pierce TM BCA protein assay kit (BCA assay) was used for determination. The assay was performed according to the manufacturer's protocol. Briefly, a 1:50 dilution of BCA working reagent (WR) was prepared. 5 μL of each sample was transferred to a 96-well plate (flat bottom, transparent) and 200 μL of WR was added to each well. The final step was incubation at 37°C for 30 minutes. Magellan TM -Data analysis software at Tecan Results were measured on a 200PRO plate reader.

[0326] Preparation of b.NET-gelatin

[0327] Table 10

[0328] substance Final concentration TRIS / HCl, pH 7.5 0.2M EDTA, pH 8.0 0.05M Triton-X100 0.5%(v / v) NaCl 1.16M gelatin 25g / L

[0329] c. SDS-PAGE and Western Blot

[0330] For sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), the lysate was mixed with 5 μL of Bolt LDS sample buffer (4×) and 2 μL of Bolt sample reducing agent (10×) and then C and heated to 70°C for 10 minutes at 350 rpm. To be able to compare between samples on one gel, the same amount of total protein was loaded. 7 μL of marker (Precision Plus Protein TM Two-color standard) was filled into the first pocket of each gel to enable accurate protein size estimation to be achieved subsequently. The gel tank was then connected to a power source (PowerPAC 300) for 30 minutes at 1A. The box was then opened with a spatula and the gel was moved to the blotting station.

[0331] According to the manufacturer's instructions, use the transfer system (Trans- Turbo TM Transfer system, 30 minutes, 25V, 1A) and a suitable membrane (Trans-Blot Turbo transfer package Mini 0.2μm PVDF) were blotted. By rolling the roller on the "sandwich", any bubbles that may interfere with protein transfer can be eliminated. In order to block free binding sites, the membrane was placed in NET-gelatin and shaken on a flat shaker for 60 minutes. The gel was cut at the 75kD band to simultaneously detect CCDC40 and glyceraldehyde-3-phosphate dehydrogenase (Glycerinaldehyd-3-phosphat-Dehydrogenase, GAPDH). Antibodies were diluted with NET-gelatin (1:2000 in 6mL of anti-CCDC40, 1:10000 in 10mL of GAPDH NET-gelatin), and the membrane was incubated overnight with its corresponding antibody on a flat shaker at 4°C. GAPDH was used as a loading control. A list of antibodies used is shown in Table 11. The next day, the membrane was washed three times with NET-gelatin for 10 minutes to remove non-specific binding or residual antibodies. The secondary antibody goat anti-rabbit IgG-HRP was diluted 1:10,000 with NET-gelatin. After incubation on a plate shaker for 60 minutes at room temperature (RT), the membrane was washed again with NET-gelatin three times for 10 minutes each. The membrane can be imaged by a molecular imager (ChemiDoc TM XRS system) to detect horseradish peroxidase HRP-conjugated secondary antibodies. Therefore, 5 mL of Luminata Crescendo Western HRP substrate was added to the gel and incubated for 5 minutes. The last image without overexposure and the colorimetric image were then merged and analyzed using Image Lab TM Software display. In addition, Image Lab TM to determine the band intensity.

[0332] Table 11

[0333]

[0334] II. ALI culture

[0335] 1. Sampling of human respiratory epithelial cells (hREC)

[0336] a. Nose brush

[0337] RPMI medium was warmed to room temperature and the brush was moistened with sterile isotonic saline solution. A Celletta with a protected tip was used.TM Brush cell collector. After asking the patient to clean his nose, he had to sit on a chair with his head against the wall to support his head. Using rotational and linear motions, quickly rub the brush against the inside and upper sides of the lower nasal passage several times. When the brush is removed, immediately place it in a collection tube (15 mL abdominal tube) filled with 5 mL of pre-warmed RPMI medium. Shake the brush vigorously in the tube at least 40 times to detach the cells from the brush.

[0338] b. Immobilized culture

[0339] The tubes were spun at 900 rpm for 5 minutes at room temperature. After discarding the supernatant, the pellet was dissolved in UG medium [DMEM / Ham's F-12 1:1, containing 5 mL of sterile 100× antibiotic / mycology and 10 mL of sterile Ultroser G]. 5 mL of the medium was used for the T25 and 25 mL for the T75 flask.

[0340] After transferring the cells to a cell culture flask, incubate the cells overnight at 37°C in a humidified incubator with 5% CO2. The cells should attach after 20-24 hours. Change the UG medium 3 times a week (Monday, Wednesday, and Friday).

[0341] 2. Generation and Transfection of ALI Cultures

[0342] a. Coating of transwell inserts (0.33 cm 2 )

[0343] The following plates were used for ALI culture: Corning Transwell with clear polyester membrane (0.4 μm pores, 6.5 mm diameter insert, 24-well plate). Rat tail collagen was diluted 1:5 in acetic acid and 250 μL was loaded on the top side of each insert. After incubation of the plates overnight at room temperature, the remaining liquid was removed with a Pasteur pipette and the plates were then opened and air-dried for at least 5 minutes (sterile). Finally, DPBS (without Ca) was used to wash the plates. 2+ / Mg 2+ ) The inserts were washed twice and then dried overnight at room temperature (sterile). The inserts were stored at 4°C for up to one month.

[0344] b. Cell expansion of hREC as submerged culture (fixed culture)

[0345] Feed the cells with 15 mL of pre-warmed UG medium every 2 to 3 days (Monday, Wednesday and Friday). Care must be taken not to add new medium directly onto the collagen layer to prevent damage to the collagen layer and detachment of the cells. Once the cells are 80% confluent or the collagen layer begins to detach, the cells are transferred to the ALI filter (after about 3 weeks in submerged culture).

[0346] c. Preparation of Medium G

[0347] Different ALI media were tested, but homemade medium G was preferred.

[0348] This medium is prepared for one week but needs to be stored at 4°C. Batches are frozen in aliquots depending on the size of the experiment to be performed. Table 2 shows the composition of medium G.

[0349] d. Inoculation and aeration of hREC (ALI culture)

[0350] 1. Aspirate the UG medium and replace with wash medium [DMEM / Ham's F-12 1:1 with 1× sterile antibiotic / antimycotic (AA)] or DPBS (without Ca 2+ / Mg 2+ ) Wash once

[0351] 2. If coating flasks with homemade rat tail collagen:

[0352] a. Dissolve the collagen layer by adding 9 mL of collagenase (1×) and incubate at 37°C for 45-60 minutes

[0353] b. Transfer the cells to a 15 mL abdominal tube and centrifuge at 1000 rpm for 5 minutes at room temperature.

[0354] c. Wash cells with wash buffer (1000 rpm, room temperature, for 5 minutes)

[0355] d. Add 2 mL of trypsin EDTA (1×) and gently pipette up and down to detach the cells. Incubate the cells at 37°C and shake the tube until the cell clusters disintegrate (approximately 5 minutes).

[0356] If coating flasks with collagen purchased from Gibco:

[0357] a. Add 3 ml of trypsin EDTA (1×) to the cell culture flask until the cells detach (about 5 minutes)

[0358] 3. Stop trypsin by adding 0.5 mL of FBS and 5 mL of wash medium

[0359] 4. Transfer the cells to a 15 ml falcon and wash the cells twice with wash medium (1000 rpm, room temperature, for 5 minutes)

[0360] 5. Resuspend the pellet in an appropriate amount of ALI medium (1-2 mL, depending on the size of the pellet) and count the cells using a cell counter

[0361] 6. Add 250 μL of cell suspension (400,000 cells / mL) to each collagen-coated transwell with 500 μL of ALI medium on the basolateral side.

[0362] 7. Incubate cells overnight at 37°C in a humidified 5% CO2 incubator

[0363] Day 3-5: ALI-Growth

[0364] 8. Always check the insert under a microscope

[0365] 9. Feed cells daily with ALI medium until 80-100% confluence (3-4 days)

[0366] ALI-Differentiation

[0367] 10. When 80-100% confluence is reached, gas lift the cells

[0368] a. Aspirate ALI medium from the apical and basolateral sides

[0369] b. Add 500 μL of fresh ALI medium to the basolateral compartment

[0370] c. Incubate cells at 37°C in a humidified 5% CO2 incubator

[0371] 11. Wash cells once a week with pre-warmed wash medium (top) and feed cells every 2-3 days (or Monday-Wednesday-Friday) with ALI medium

[0372] e. Transfection of hREC

[0373] The preparation (LF111-mRNA) was diluted in 2% sucrose to 3 μg / insert (=9 μg / cm 2 To remove mucus, wash the inserts with 200 μL DPBS (without Ca 2+ / Mg 2+ ) were washed on the apical side and incubated at 37°C (Epithelix ALI) or 200 μL DPBS (without Ca) before transfection. 2+ / Mg 2+ ) on the apical side for 20 min and incubate for 5 min at room temperature (hREC, UKM). Then, DPBS (without Ca) was removed from the apical side by gentle aspiration. 2+ / Mg 2+ ) without damaging the epithelium. Immediately after the mucus wash, the cells were washed again with WFI (100 μL) to remove traces of DPBS (without Ca 2+ / Mg 2+25 μL of the formulation was added to the top side of the insert to allow for cellular uptake. The carrier was removed after 6 hours of culture and the cells were washed with 200 μL of DPBS (without Ca). 2+ / Mg 2 + ) The cells were washed once and the cultures were maintained at ALI with no liquid on the apical side.

[0374] 3. Readout Assay

[0375] Various readout assays are used. LDH measurements and NucGreen assays are used to study the toxicity-related effects of transfection. Ciliary beat frequency measurement (CBF) is required to examine the way the cilia beat in terms of the beat frequency and percentage of ciliary area. If ciliary beating leads to directional flow, the mucociliary clearance (MCC) assay can be used for investigation. Immunofluorescence (IF) staining of CCDC40, its heterodimer partner CCDC39, and the ciliary marker acetylated α-tubulin is used to detect whether CCDC40 protein or its partner CCDC39 can be detected in the cilia after treatment. In addition, proteins of the dynein regulatory complex (DRC) such as GAS8 and DNALI1 are also stained. DRC is anchored by CCDC40 / CCDC39 and only exists when CCDC40 / CCDC39 is properly integrated into the ciliary axoneme.

[0376] a.LDH measurement

[0377] LDH concentration was measured using Pierce TM Lactate dehydrogenase cytotoxicity assay kit (Pierce TM Lactate Dehydrogenase Cytotoxicity Assay Kit). The procedure was performed as described in the manufacturer's protocol. The cells were incubated with 100 μL of DPBS (with Mg) at 37°C and 5% CO2. 2+ / Ca 2+ ) Incubate ALI cultures on the top side for 30 minutes. 50 μL of LDH reaction mixture and 50 μL of incubation medium were mixed in a 96-well format and incubated in the dark at room temperature for 30 minutes, and 50 μL of stop solution was added. The absorbance of formazan was measured at 490nm and 680nm using a microplate reader (TriStar2 multimode reader LB 942). The 680nm value was subtracted from the 490nm for background normalization. Duplex determinations were performed for each insert.

[0378] b. Ciliary Beat Frequency (CBF) Measurement

[0379] Ciliary beat frequency (CBF) analysis of hRECs was performed by high-speed video microscopy and Sisson-Ammons video analysis. Videos (125 fps, 640 × 480 pixel resolution) were recorded under physiological conditions using a Megaplus camera ES 310turbo model attached to an inverted phase contrast microscope equipped with an ELWD 40x S Plan Fluor objective by maintaining the temperature at 36 °C via a microcuvette SC300 heating system.

[0380] c. Mucociliary clearance assay (MCC, fluorescent beads)

[0381] ALI medium and DPBS (without Ca 2+ / Mg 2+ ) to room temperature and heat the microscope plate to 37°C. Transfer the ALI insert to a new plate and cover with prewarmed ALI medium (alternatively DPBS, without Ca2+). 2+ / Mg 2+ ) were washed twice on the top. Before recording 20 videos per insert (magnification 40x, Ph2), 100 μL of ALI medium was added to the top compartment to obtain an overall impression of the insert (SAVA software). Red fluorescent particles with a diameter of 0.5 μm were diluted 1:1000 in DPBS (without Ca2+). 2+ / Mg 2+ ) and vortex for at least 1 minute. Add 10 μL of the particle dilution to 100 μL of ALI medium, vortex, and add 110 μL to the apical compartment. When handling beads, it is important to vortex before each step to prevent agglutination. In addition, it is necessary to work under dim light to avoid fading.

[0382] The flow of fluorescent particles was recorded using NIS-Elements Basic Research software. The movement was recorded in 20-30 seconds using a 20x magnification (Ph1) while exciting the particles using a 488nm laser. The exposure time had to be adjusted to the number of frames recorded per second (fps). For 7.5fps, the exposure time was set to 100ms, and for 15fps, the exposure time was set to 50ms. The exact observation area was analyzed with SAVA (20x magnification, Ph1) to visualize the ciliary movement and the 3D structure of the cell layer.

[0383] For evaluation and data analysis, the Nikon NIS Elemets AR software, NIS PLUG-IN<ADVANCED 2DTRACKING> <ar>(See NIS Elements AR Tracking Module above).

[0384] d. IF of ALI cultures

[0385] Embedding of ALI cultures

[0386] Before membrane preparation, use DPBS (Mg-free) 2+ / Ca 2+ The ALI inserts were washed twice with 4% paraformaldehyde (200 μL, 1 min, RT) to remove mucus. The following membrane preparation was performed according to the following protocol (see below).

[0387] Use a scalpel or syringe to cut the transwell membrane and transfer the membrane to a 3 mL DPBS (Ca 2+ / Mg 2 + The membrane was cut into equal parts (4-6) and stained with a Shandon Cryomatrix TM Prepare cryomolds with cryoembedding medium (medium size). Place the membrane pieces in the cryomatrix and place them parallel to each other, then incubate the cryomolds on dry ice until the cryomatrix hardens. Store the cryomolds at -80°C for at least 2 hours and then cut them under a cryostat.

[0388] Cutting of ALI membrane /

[0389] Shandon Cryomatrix cutting using Microm HM560 cryostat TM ALI membrane embedded in . Therefore, the cryostat is pre-cooled (2-3 hours before cutting) to -20°C (bench is -21°C and chamber is -25°C). The ALI membrane containing the freezing mold is transferred from -80°C to -20°C for at least 1 hour. Depending on the processing conditions of the membrane, membrane cutting is performed at 20μm. The membrane sections are transferred to Superfrost Ultra Plus slides, dried at room temperature for at least 1 hour, and stored at -80°C overnight or until use at -80°C.

[0390] Staining procedures

[0391] See Table 12 for antibodies used.

[0392] Day 1:

[0393] 1. Wash with 1× DPBS (Ca 2+ / Mg 2+ ) Wash for 5 minutes

[0394] 2. Fixation: 4% PFA / 1×DPBS (Ca 2+ / Mg 2+ ) at room temperature for 15 minutes

[0395] 3. Wash with 3× DPBS (Ca 2+ / Mg 2+ )(2 quick times, 1 time for 5 minutes)

[0396] 4. Permeabilization:

[0397] a.0.5% Triton X-100 for 5 min or

[0398] b.0.2% Triton X-100 for 10 minutes (depending on the antibody used)

[0399] 5. Wash with 3× DPBS (Ca) at room temperature 2+ / Mg 2+ )(2 quick times, 1 time for 5 minutes)

[0400] 6. Blocking: At room temperature, 5% normal goat serum + DPBS (Ca 2+ / Mg 2+ ) or in DPBS (Ca 2+ / Mg 2+ ) in 5% skim milk in DPBS → 2 hours

[0401] 7. Primary antibody: 200 μl overnight at 4°C

[0402] Day 2:

[0403] 8. Use DPBS (Ca 2+ / Mg 2+ ) Wash for 45 minutes (3 x 15 minutes)

[0404] 9. Secondary antibody: 200 μl for 1 hour at room temperature

[0405] 10. In DPBS (Ca 2+ / Mg 2+ ) at 1:1000 for 10 min at room temperature in the dark

[0406] 11. Use DPBS (Ca 2+ / Mg 2+ ) Wash 6 x 5 minutes

[0407] 12. Mounting coverslips with Dako antifade

[0408] Table 12

[0409]

[0410] e. Air brush on ALI culture

[0411] An airbrush model was employed to generate differentiated ALI cultures. The protocol was established after Crespin et al., 2011 (Approaches to Study Differentiation and Repair of Human Airway Epithelial Cells).

[0412] Use pre-warmed DPBS (Mg 2+ / Ca 2+ ) Wash the cells briefly on the top side. Set the compressor connected to the air brush to 1 kg / cm by running the air brush and turning the small wheel. 2 The air brush may need to be run for a while to maintain a constant value. Then, use DPBS (Mg 2+ / Ca 2+ ) fill the small reservoir on top of the airbrush and place the insert on a new plate without basal medium. Start the airbrush by pressing to the first pressure point and waiting until the pressure on the compressor remains constant. Then, place the airbrush vertically on top of the insert and press the stem of the airbrush to slightly above the first pressure point [Put DPBS (Mg 2+ / Ca 2+ ) was dispersed from the reservoir] for 2 seconds. Afterwards, preheated DPBS (Mg 2+ / Ca 2+ ) Briefly wash the top side of the insert and place the insert in fresh medium suitable for ALI differentiation. Inspect the wound by microscopic observation. If the wound is too small (less than 1 / 3 of the insert area) or the cells in the wound are only slightly detached, repeat the procedure. Incubate the culture at 37°C in a humidified atmosphere of 5% CO2 and culture as ALI.

[0413] III. Tagged CCDC40 mRNA

[0414] The mRNAs studied are shown in Table 13.

[0415] Table 13

[0416]

[0417] a. Cell culture

[0418] Incubate in MEM GlutaMAX at 37°C, 5% CO2 TM HEK-293 cells were cultured in 10% FBS, 100 U / ml P / S (cultivation medium).

[0419] Before inoculation, cells were washed with DPBS and detached using trypsin. After trypsinization, trypsin was inactivated using medium containing FBS. Therefore, the same or a larger volume of medium was used. Cells were counted using a Countess cell counting device after centrifugation at 1100 × g for 5 minutes and resuspension in normal growth medium.

[0420] b. In vitro transcription

[0421] To generate a template for in vitro transcription, the circular plasmid was linearized by restriction digestion with BstBI and further purified by chloroform-ethanol precipitation.

[0422] mRNA was generated using a standard in vitro transcription cocktail containing T7 RNA polymerase, inorganic pyrophosphatase, and RNase inhibitor. Co-transcriptional capping was achieved by the addition of an ARCA cap analog. For in vitro transcription of chemically modified RNA, 7.5% of cytidine-5'-triphosphate was replaced by 5-iodocytidine-5'-triphosphate, and 30% of uridine-5'-triphosphate was replaced by 5-iodouridine-5'-triphosphate. In another In the RNA production setup, 3% of cytidine-5'-triphosphate was replaced by 5-iodocytidine-5'-triphosphate, and 15% of uridine-5'-triphosphate was replaced by 5-methyl-uridine-5'-triphosphate. The residual template DNA was digested with DNaseI. The mRNA was subsequently purified by ammonium acetate precipitation, followed by a wash step with 70% ethanol.

[0423] Residual uncapped mRNA was dephosphorylated using a rapid dephosphorylation kit and then purified by ammonium acetate precipitation, followed by a 70% ethanol wash step and ultrafiltration using a 100 MWCO cutoff filter.

[0424] The mRNA was further polyadenylated using poly(A) polymerase. The mRNA was purified again by ammonium acetate precipitation, followed by a 70% ethanol wash step and ultrafiltration using a 100 MWCO cutoff filter. The poly(A) length was determined to be 100 to 250 nucleotides by capillary gel electrophoresis.

[0425] c. Inoculation, transfection and readout

[0426] 24 hours before treatment, cells were seeded into 96-well black microtiter plates (25,000 cells per well). 24 hours after seeding, fresh medium was added to each well (100 μL). MessengerMAX TM For mRNA transfection, the ratio of RNA to Lipofectamine was 1:1.5 (w / v). 250 ng / 96 wells ( 758ng / cm 2 )eGFP-CCDC40 (ETH031T28 or ETH031T30) or HA-CCDC40-T2A-tdTomato (ETH031T26) mRNA. All RNAs had a stock concentration of 1 mg / mL. To form lipid complexes, mRNA was diluted in double distilled water. MessengerMAX TM Dilute in SFM (serum-free medium) and mix by pipetting. After incubation at room temperature for 10 minutes, add the RNA solution to MessengerMAX TM The solution was mixed and incubated for another 5 minutes at room temperature. The mixture was then diluted two-fold in SFM and the lipoplex solution was added to the wells. In Table 14, an example of RNA was calculated.

[0427] Table 14

[0428]

[0429] 6 and 24 hours after transfection, transfection efficiency was checked by fluorescence microscopy and pictures were taken at 10× magnification.

[0430] IV. CCDC39

[0431] mRNA (ETH047T02; SEQ ID NO: 12) encodes hCCDC39 in the study and contains the minimal UTR of Ethris. A total of 15% of uridine-5'-triphosphates were replaced by 5-methyl-uridine-5'-triphosphates, and a total of 3% of cytidine-5'-triphosphates were replaced by 5-iodo-cytidine-5'-triphosphates. The antibodies used are shown in Table 15.

[0432] Table 15

[0433]

[0434] 1. CCDC39 Transfection in Submerged Cell Culture and Western Blotting

[0435] a. Cell culture

[0436] BEAS-2B cells were cultured in LHC-9 medium in coated flasks. For details, see I1 above. Experiments were performed on uncoated plates.

[0437] HEK-293 cells were cultured in MEM GlutaMax medium supplemented with heat-inactivated FBS and penicillin / streptomycin (P / S).

[0438] Prior to inoculation, cells were washed with DPBS and detached with trypsin. After trypsinization, trypsin was inactivated using trypsin inhibitor for BEAS-2B or FBS-containing medium for HEK-293. Therefore, the same or a larger volume of trypsin inhibitor / medium was used. After centrifugation at 1100 × g for 5 min and resuspension in normal growth medium, cells were counted using a Countess cell counting device. Considering the 2 mL inoculation volume and the 6-well plate format, 5.0 × 10 5 BEAS-2B cells and 1.4×10 6 HEK-293 cells were seeded.

[0439] b. Transfection

[0440] 24 hours before treatment, cells were seeded at the corresponding density. 24 hours after seeding, 2 mL of fresh medium was added to each well. MessengerMAX TM For transfection of mRNA, the ratio of RNA to Lipofectamine was 1:1.5 (w / v). All RNAs had a stock concentration of 1 mg / mL. To form lipid complexes, mRNA was diluted in double distilled water. MessengerMAX TM Dilute in SFM and mix by pipetting. After incubation at room temperature for 10 min, add the RNA solution to MessengerMAX TM The solution was added to the wells, mixed and incubated for another 5 minutes at room temperature. The lipid complex solution was then added to the wells. In Table 16, an example of transfection for a 6-well plate was calculated.

[0441] Table 16

[0442]

[0443] c. Cell Lysis

[0444] To achieve optimal cell lysis, two different lysis buffers were compared: Triton X-100 buffer and the commercially available lysis buffer M-PER. TM , both buffers were supplemented with protease inhibitor cOmplete (EDTA-free) and 40 μL / mL of DNase I solution (in a mixture of 23:1:1). Therefore, cells were seeded into 6-well plates and treated for 6 hours and 24 hours. After treatment, cells were harvested. Therefore, the plate was washed once with 1 mL of DPBS. In order to remove cells from the plate, another 1 mL of DPBS was added, and cells were scraped off the plate and moved to an Eppendorf tube. In order to remove DPBS, cells were centrifuged at 6250 × g for 2 minutes at 4 ° C. Cell lysis was performed by adding 200 μL of the corresponding buffer. To ensure complete lysis, cells were incubated on ice for 30 minutes. After lysis, a BCA assay was performed using a BCA protein assay kit according to the manufacturer's instructions (with the following changes) to determine the total protein concentration:

[0445] Add 200 μL of working reagent to 5 μL of cell lysate

[0446] Samples and standards were measured in triplicate

[0447] Shake the plate at 450 rpm for 30 seconds before incubating the samples at 37°C for 30 minutes.

[0448] d. Sample preparation

[0449] Mix the samples with 5 μL of LDS sample buffer and 2 μL The samples were mixed with reducing agent and then heated at 70°C for 10 min before SDS-PAGE. 30 μg of total protein was used for SDS-PAGE and Bolt TM For 4-12% SDS-PAGE gel, use 10 wells.

[0450] e. SDS PAGE and Western Blot

[0451] Using Trans- Turbo TM System transfer. SDS-PAGE was performed at 200 V for 40 min. The TurboTM transfer system transfers for 30 minutes.

[0452] f. Antibodies and blocking methods

[0453] After transfer, the membrane was blocked for 1 hour at room temperature. NET-gelatin was used as a blocking agent. Antibody HPA035364 from atlasAntibodies was used to detect CCDC39, and antibody ab8227 from abcam was used to detect actin. Before adding the antibody, the membrane was cut at about 60 kDa. The membrane was incubated with the primary antibody at 4 ° C overnight. After washing three times with blocking solution at room temperature (10 minutes each), horseradish peroxidase-conjugated secondary antibody was added at room temperature for 1 hour (dilution 1:20 000). The membrane was washed again with blocking solution at room temperature three times for 10 minutes each.

[0454] g. Generation of chemiluminescent signals

[0455] Signals were visualized using a chemiluminescent substrate kit (Luminata Crescendo, Classico or Forte Western HRP substrate, depending on the intensity of the signal) and the ChemiDocTM MP system.

[0456] 2. Western Blot of Endogenous CCDC39 in Differentiated ALI Cultures

[0457] a. Cell Lysis

[0458] 250 μL of ALI lysis buffer (see Table 17 for details of composition) was added to each insert and incubated on ice for 15 minutes. The ALI lysis buffer was pipetted back and forth before, during (every 5 minutes) and at the end of the incubation. After transferring to an eppendorf tube and rinsing each insert with 150 μL of ALI lysis buffer, the samples were vortexed thoroughly. At this step, the samples can be optionally stored at -20°C until further processing.

[0459] Table 17

[0460] substance storage solution final For 10ml TritonX-100 10％ 1％ 1ml NaCl 1.5M 150mM 1ml SDS 1％ 0.1％ 1ml Tris 250mM 50mM 2ml Protease inhibitor cOmplete 25× 1× 0.4ml WFI 4.5ml

[0461] b. Isolation of axonemal lysates from whole cell lysates

[0462] The sample is added to the lysis matrix A tube (the tube was previously washed with 70% EthOH and garnet removed). The tube is fixed and frozen in liquid nitrogen for 20 seconds while the tube is moved. The tube is quickly inserted into the MP FastPrep-24 (HOM-1), setting: 6.5m / s, 3×1 minute. Subsequently, the tube is allowed to condense on ice for 15 minutes, and then the liquid is transferred to a fresh Eppendorf tube and rotated at 1100rpm, at 4°C for 20 minutes. The supernatant is transferred to a new Eppendorf tube, and the precipitation and supernatant are stored at -20°C until further processing.

[0463] c. Preparation of axonemal extract lysate: High-salt extraction of axonemal proteins

[0464] Each pellet was resuspended in 50 μl of MMRB + 0.1% Triton X-100 (see Table 18 for details of the composition of MMRB + 0.1% Triton X-100) and incubated on ice for 30 minutes (with occasional slight vortexing). After spinning at 14,000 rpm at 4°C for 10 minutes, the supernatant was transferred to a new Eppendorf tube and stored at -20°C until further processing.

[0465] Table 18

[0466]

[0467] Table 19

[0468] substance final HEPES, pH 7.4 30mM <![CDATA[MgSO4]]> 5mM EDTA 0.1mM NaCl 625mM

[0469] d. Preparation of Lysates for Western Blotting

[0470] Thaw the sample on ice and transfer 30 μl of the sample to a new Eppendorf tube. Add 12 μL of LDS sample buffer and 5 μl of 10× reducing agent, then heat the sample at 70°C, 350 rpm for 10 minutes. Apply 5 μl, 10 μl, and 30 μl of the solution per well to the Bolt TM 4-12% SDS-PAGE gel, 10 wells.

[0471] e. SDS PAGE and blotting methods: see IV 1e

[0472] f. Antibodies and blocking methods: See IV 1f

[0473] g. Chemiluminescent signal generation: see IV 1g

[0474] II. Results

[0475] The expression of CCDC40 in HEK293 cells was detected at 6, 24, 48, 72, and 144 hours after transfection. 6 Cells were seeded in 6-well plates and used 24 hours after seeding. 2000 with different CCDC40 constructs (2.5 μg / 9.5 cm 2 ) transfected cells. The CCDC40 mRNA constructs used in this experiment were T06 to T10 (SEQ ID NO: 1, SEQ ID NO: 5 to SEQ ID NO: 8). Cell lysis was performed at 6 hours, 24 hours, 48 ​​hours, 72 hours, and 144 hours after transfection, and 50 μg of total protein lysate was analyzed by SDS-PAGE and Western blotting.

[0476] As in Figure 1 As can be seen in Figure 3, peak translation efficiency can be detected 6 hours after CCDC40 mRNA transfection in HEK cells.

[0477] In addition to the 2×10 6 HEK293, 7.5×10 5 BEAS-2B and 5×10 5 The next experiment was performed as described above, except that RPMI 2650 cells were seeded in 6-well plates and protein lysates (HEK293: 50 μg, RPMI2650: 20 μg, BEAS-2B: 30 μg total lysate) were analyzed by SDS-PAGE and Western blot. CCDC40 was detected using anti-CCDC 40 antibody (HPA022974) from Atlas Antibodies (1:2000).

[0478] Herein, it can be observed that T09 (CYBA; SEQ ID NO: 1) and T10 (human CMV IE9 and 3'UTR from human growth hormone SEQ ID NO: 8) UTRs resulted in the highest translation efficiency in BEAS-2B, RPMI2650 and HEK293 cells 6 hours after transfection ( Figure 2 ).

[0479] Then two experiments were conducted to study the restoration of ciliary motility in patient-derived ALI cultures. In particular, non-differentiated ALI cultures (data not shown) were used in the first experiment (ciliated cells have deletions of exons 1 and 2, resulting in very short and less active cilia), while differentiated ALI cultures were used in the second experiment. In both cases, 3 μg of LF92 / CCDC40 (ETH031T09; SEQ ID NO: 1) were used to transfect ALI cultures every other day for 1 month, for a total of 16 transfections. As a readout, high-speed video microscopy (HSVM) and immunofluorescence immunocytochemistry (IF-ICC) were performed every 24 hours. Before and after transfection, videos (20 per insert) were taken, and CFB (ciliary beating frequency) was calculated using SAVA software. All 16 transfections (1 month) were performed. Measurements were performed at 37°C using a 40-fold magnification. The mean value of the ciliary beating frequency (CBF) was calculated.

[0480] Repeated transfection of LF92 / CCDC40 was well tolerated in patient-derived fully differentiated ALI cultures. CCDC40 protein could be detected in naturally occurring subcellular compartments (i.e., cilia) of airway epithelial cells after 22 days by IF-ICC, and ciliary motility increased after LF92 / CCDC40 transfection until reaching approximately 50% of the normal ciliary beat frequency by day 18, as shown in Figure 3 As seen in experiments with differentiated ALI cultures.

[0481] As described in the "Materials and Methods" section, undifferentiated ALI cultures were obtained using medium G and transfection (TF) was started 18 days after gassing. CCDC40 patient ALI cultures were transfected (TF) with CCDC40 mRNA / LF92 once a week for 4 weeks (= 4×TF). Mucociliary clearance (MCC) was measured using 0.5 μm fluorescent beads at 20x magnification. One week after the last TF, 30-second videos of different areas were taken and analyzed using Polargraph software from Nikon.

[0482] Importantly, restoration of ciliary beating could be detected in patients with ALI in CCDC40 after four weekly transfections of CCDC40 mRNA / LF92. Moreover, ciliary beating was synchronized, which allowed for directed particle transport, as in Figure 4 For comparison, Figure 5 Particle transport in the case of control (ie, quadruple tdTomato mRNA / LF111 transfection) and healthy control is shown in FIG.

[0483] Thus, during the differentiation phase of ciliated cells, successful CCDC40 mRNA / LF92TF of patient ALI cultures with LF92 (as shown by comparison with the tdTomato control) resulted in successful ciliary growth, successful ciliary beating, successful directional granule transport, and successful protein detection (CCDC39 as a CCDC40+GAS8 binding partner / DNALI1 as part of the DRC complex). In addition, the tdTomato control insert did not show any of the above effects.

[0484] Figure 6 This showed that after repeated treatment of patient ALI with CCDC40 mRNA, GAS8 protein was successfully incorporated within the axoneme, as in healthy controls, but was absent in control (tdTomato mRNA) treated patient ALI. Figure 7 This indicates that after repeated treatment of patient ALI with CCDC40 mRNA, DNALI-1 protein was successfully incorporated within the axoneme, as in healthy controls, but was absent in control (tdTomato mRNA) treated patient ALI. Figure 8 This indicates that after repeated treatment of patient ALI with CCDC40 mRNA, CCDC39 protein was successfully incorporated within the axoneme, as in healthy controls, but was absent in control (tdTomato mRNA) treated patient ALI.

[0485] In summary, ciliary motility could not be restored to a significant level using differentiated ALI cultures, but was partially restored using differentiated ALI cultures.

[0486] Regarding the CCDC39 experiment, CCDC39 protein can be detected by Western blot analysis at 6 and 24 hours after transfection in HEK-293 and BEAS-2B cells, e.g. Fig. 9 As can be seen in Fig.11 As shown, CCDC39 (ETH047T03; SEQ ID NO: 13) expression can be detected after 6 hours in 16HBE14o- using proteasome inhibitors. The same experiment was also performed on ETH047T02 (SEQ ID NO: 12), ETH047T04 (SEQ ID NO: 2) and ETH047T05 (SEQ ID NO: 14), and the results were comparable. Fig.12 As shown, CCDC39 (ETH047T03; SEQ ID NO: 13) expression could also be detected after 24 hours in 16HBE14o- treated with a proteasome inhibitor.

[0487] The exemplary sequences described in the present application are provided below.In certain embodiments, the disclosure provides polyribonucleotides, which comprise, for example, the UTR sequences listed in SEQ ID NO:1 or 2, or sequences at least 95%, 96%, 97%, 98% or 99% identical to these sequences, or correspond to any of the above or to any of the above encoded polyribonucleotide sequences, such as mRNA.In certain embodiments of any of the foregoing, polynucleotides or polyribonucleotides are modified (for example, comprising nucleotide analogs, as described herein).

[0488] SEQ ID NO:1

[0489] CCDC40 sequence with CYBA 5' and 3' UTR (ETH031T09):

[0490] T7启动子的部分 , Ethris's minimum 5 ' UTR , CYBA 5 ' UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, (UGA), CYBA 3 ' UTR , , 聚A : "A" tail produced by post-polyadenylation of mRNA

[0491]

[0492]

[0493] SEQ ID NO:2

[0494] CCDC39 sequence with CYBA UTR (ETH047T04):

[0495] T7启动子的部分 , Ethris's minimum 5 ' UTR , CYBA 5 ' UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC39 protein, , CYBA 3 ' UTR , , 聚(A)尾

[0496]

[0497]

[0498] SEQ ID NO:3

[0499] tdTomato:

[0500] T7启动子的部分 , Ethris's minimum 5 ' UTR , 载体主链序列(pVAX Vektor：美国生命技术公司) , Kozak element, Start code Sub(AUG) , a codon-optimized sequence encoding a functional version of the human tdTomato protein, , , 载体主链序列的部分(pVAX Vektor：美国生命技术公司)

[0501]

[0502]

[0503] SEQ ID NO:4

[0504] MCIDAS sequence with minimal 5'UTR and optional 3'UTR of Ethris:

[0505] T7启动子的部分 , Ethris's minimum 5 ' UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human MCIDAS protein, (UGA), Optional 3 ' UTR (also used as a reverse primer binding site for PCR-based template production), , 聚(A)尾

[0506]

[0507] SEQ ID NO:5

[0508] Minimum with Ethris 5 'UTR sequence (ETH031T06):

[0509] T7启动子的部分 , Ethris's minimum 5 ' UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, , , 聚A : "A" tail produced by post-polyadenylation of mRNA

[0510]

[0511]

[0512] SEQ ID NO:6

[0513] Sequence with TISU 5'UTR (ETH031T07):

[0514] T7启动子的部分 , Minimal 5'UTR of Ethris with an extra U nucleotide ,TISU components, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, , , 聚A : "A" tail produced by post-polyadenylation of mRNA

[0515]

[0516]

[0517]

[0518] SEQ ID NO:7

[0519] Sequence with hAg 5'UTR but no 3'UTR (ETH031T08):

[0520] T7启动子的部分 , Minimal 5'UTR of Ethris , hAg 5'UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, , , 聚A : "A" tail produced by post-polyadenylation of mRNA

[0521]

[0522]

[0523]

[0524] SEQ ID NO:8

[0525] Sequence with CMV IE9 5'UTR and human growth hormone 3'UTR (ETH031T10):

[0526] The part of T7 promoter, Minimal 5'UTR of Ethris , CMV IE9 5'UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, , human growth hormone 3'UTR , 聚A : "A" tail produced by post-polyadenylation of mRNA

[0527]

[0528]

[0529] SEQ ID NO:9

[0530] ETH031T28: N-terminal EGFP tag-CCDC40

[0531] T7启动子的部分 , Ethris's minimum 5 ' UTR , Kozak element, Start codon (AUG) ,coding The sequence of the protein, , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, , , 聚(A)尾

[0532]

[0533]

[0534] SEQ ID NO:10

[0535] ETH031T30: C-terminal EGFP tag-CCDC40

[0536] T7启动子的部分 , Ethris's minimum 5 ' UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, ,coding The sequence of the protein, , , 聚(A)尾

[0537]

[0538]

[0539] SEQ ID NO:11

[0540] ETH031T26: N-terminal HA tag - CCDC40-T2A peptide - tdTomato with 5' and 3' CYBA UTR T7启动子的部分 , Ethris's minimum 5 ' UTR , CYBA 5 ' UTR , Kozak element, Start codon (AUG) , HA标签 , , a codon-optimized sequence encoding a functional version of the human CCDC40 protein, ， , , CYBA 3 ' UTR , , 聚(A)尾

[0541]

[0542]

[0543]

[0544] SEQ ID NO:12

[0545] ETH047T02 (CCDC39 with minimal UTR of Ethris):

[0546] T7启动子的部分 , Minimal 5'UTR of Ethris , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC39 protein, , , 聚(A)尾

[0547]

[0548]

[0549] SEQ ID NO:13

[0550] Encodes the human CCDC39 sequence and contains TISU components RNA as 5'UTR (ETH047T03)

[0551] T7启动子的部分 , Minimal 5'UTR of Ethris with additional U nucleotide ,TISU components, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC39 protein, , , 聚(A)尾

[0552]

[0553]

[0554]

[0555] SEQ ID NO:14

[0556] ETH047T05: SP30; encoded by CCDC39 and contains A random sequence of 30 nucleotides (SP30) ( which serves as the 5'UTR) RNA,

[0557] T7启动子的部分 , Minimal 5'UTR of Ethris, with SP30 as 5'UTR , Kozak element, Start codon (AUG) , a codon-optimized sequence encoding a functional version of the human CCDC39 protein, , , 聚(A)尾

[0558]

[0559] Sequence Listing <110> ethris GmbH <120> Treatment of ciliary diseases <130> AB3066 PCT S3 <150> EP 19 15 7210.6 <151> 2019-02-14 <160> 14 <170> BiSSAP 1.3 <210> 1 <211> 3546 <212> RNA <213> Artificial sequence <220> <223> CCDC40 sequence with CYBA 5' and 3' UTR (ETH031T09) - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 1 gggagaccgc gccuagcagu gucccagccg gguucguc gccgccacca uggcugaacc 60 uggcggagcc gccggagaau cccaccuga agauggcu gccagcgagg gcgagaaga 120 gggcaacaac gagagccaca uggugucccc cccagagaag gacgacggcc agaaggcga 180 agaggccgug ggcucuaccg agcaccuga ggaagugacc acacaggccg aggccgccau 240 ugagaagggc gagguggaa cagaggcga agcccugug gaaggcgaag aggaagccgu 300 360 degrees gggccagauc ucugccgccg auaccaccua ccccuacuuc agccccccuc aggaacuccc 420 uggggagaag gccuaacgaua gcguguccgg cgaagcuggc cugcagggcu uucagcagga 480 agccacaggc ccucccgaga gccgggaaag aagagugaca agccccgagc cuagccacgg 540 cgugcuggga ccaucugagc agaugggcca aguugaccucu ggcccugcug ugggcagacu 600 gacaggcagc acagagaac cucagggcca ggugcugccu augggagugc agcaccgguu 660 720 acccgugauc ccuccuggcg ugccagaugc accccagg gaggcgauc ugcccguguu 780 ccaggaccag auccagcagc ccucuaccga agagggggcu auggccgaga gaguggaaag 840 cgagggcucc gacgagagaag gggaggacga gggaggcugc cugguggc uggaccccga 900 ccaccucug auggugcggu ucaggccgc ccugagaac uaccugaaccc ggcagaucga 960 gaagcugaaa cuggaccugc aggacuggu gguggccaca aagcagagca gaggccagag 1020 shake shake shake shake shake shake shake 1080 gcuggaaaag agccacgacc ggcacgccau ggccagcucu gagcgcagac agaaagagga 1140 agaacugcag gccgccagag cccuguacac acgacaugc gccgcugcca acgaggaacg 1200 gagaagcug gcugcccugc agaccgau ggaaaaccug gcucugcacc uguucuacau 1260 gcagaauauuc gaccaggaca ugcgggacga caucagagug augacccagg ucgugagaa 1320 ggccgagaca gagagaaucc gggccgagau ugagagaaa aagcaggacc uguacgugga 1380 squeaky squeaky greedy greedy greedy greedy greedy 1440 cuggcccag gccgaagaua cccggauccu gagaaggcc guguccgagg cuggcaccga 1500 gaucgaugcc aucagcgugg aaagcggcg gaucaugcag cagugggcca gcagccucgu 1560 gggcaugaag cacagagaug agccccaccg ggccgugcug gaagcucuga gaggcuguca 1620 gcaccaggcc agagcaccg acggcgagau cgaggccuac agaaucca ucaugaagga 1680 agaggaaaag aacgaaaac uggscau ccugaacaga accgaaccg aggccaacc 1740 gcugcagaaa cugaccacccc agugccugac CAacaggug gcccugcagu cccaguuca 1800 spider cugacccugc aggaaccga cugaccug cugaccug cugaccaggac cugaccaggac 1860 gaugauucug accgaggaac ugcaggcuau ccggcaggcc auucaggggg agcuggaacu 1920 gcggagaaag accgacgccg gaagcugcag gaacacaaaaaaggcaaaa 1980 gaccaccaag uacuucaacc agcugauucu gcgccugcag aaagaaaga ccacaugau 2040 gabacaccug agshaagauca acggcgacau ugcccagacc acccuggaca ucaccacac 2100 cagcagcaga cuggacgcccc accagaaaac cuggaccagg augugagaa 2160 aggaacgag cugaucacca acagccagag cgagaucagc cggcggacca uccugaucga 2220 gagaaagcag ggccugauca acuuccugaa caacagcug gaagaaugg uguccgagcu 2280 gggcggcgag gagugggac cucuggacu ggaaucaag cggcugagca cucugacugg 2340 cgagcacgac ggcaggccg ugcaggcuca agugacaugg cugcggcugc agcaggaau 2400 gguxaagug accaggaac aggagaaca gcuggcucc cuggacgcca gxaaaga 2460 acugcacauc auggaacaga aaagcugcg gguggaagc aagaucgagc aggaaaaaaa 2520 agaaaacgaaaaaacgaaaaaaaacugaaaaaaacuggaaaacgaacugaa 2580 uaugcugaug aaaagaacc gcugcuccag cgagaacag hahahahaaac 2640 cgagaacgag oucgugcgga gccugaaggc cagcgagcgg gaaccauca agaugcagga 2700 caagcugaac caagcuguccg aggaaaagc cacacugcug aaccagcugg uggaagccga 2760 gcaccagauc augcugugggg agagagaau ccagcuggcc aaagaaugc ggagcagcgu 2820 ggacagcgag aucggccaga ccgaaucag agccaugaag ggcgagaucc accggaugaa 2880 agugcggcug ggacagcugc ugaaacagca ggaaaagaug auccgggcca uggaacuggc 2940 cguggccaga cgggaaccg ugacaaccca ggcugaggc cagcggagaa uggacagaaa 3000 ggcccugacc cggaccgacu uccaccacaa gcagcuggaa cugaggcgga agauccggga 3060 cgugcggaag gccaccgaug agugcaaa gacagugcug gaacuggaag agacacagcg 3120 gaacgugucc uccagccugc uggaaaaaca ggaaaagcug agcgugaucc aggccgacuu 3180 cgacacccug gaagcugacc ugacaagacu gggagcccug aaaagacaga accuguccga 3240 gaucguggca cugcagaccc ggcugaaaca ucugcaggcu gugaaagagg gacgcuacgu 3300 guuccuguuc agauccaagc agucucuggu cuggaaaga cagcggcugg acaagcggcu 3360 3420 acugcaaag gugucccaga ugaucgccaa caagcuggaa uccccuggcc ccagcugacc 3480 ucgccccgga ccgcccucc cgccaggugc accccaccugc aauaaaugca gcgaagccgg 3540 gauucg 3546 <210> 2 <211> 3063 <212> RNA <213> Artificial sequence <220> <223> CCDC39 sequence with CYBA UTR (ETH047T04) - Codon-optimized sequence encoding a functional version of the human CCDC39 protein <400> 2 gggagaccgc gccuagcagu guccagccg gguucguguc gccgccacca ugagcagcga 60 guuucuggcc gaacugcacu gggaggacgg cuucgcuauu cccguggcca acgaggaaaa 120 caagcugcug gaagaucagc ugagcaagcu gaaggacgag agagccucuc ugcaggacga 180 gcugagagag uacgaggaac ggaucaacag caugaccagc cacuucaaga acgugaagca 240 agagcugagc aucacccaga gccugugcaa ggccagagag agagaaaccg agagcgagga 300 acacuucaag gcuaucgccc agcgcgagcu gggaagagug aaggaugaga uccagcggcu 360 ggaaaacgag auggccagca uccuggaaaa gaaguccgac aaagagaacg gcaucuucaa 420 ggccacacag aagcuggacg gccugaagug ccagaugaac ugggaucagc aggcccugga 480 agccuggcug gaagagucug cccacaagga uucugacgcc cugacacugc agaaguacgc 540 ccagcaggac gacaacaaga uccgggcucu gacccugcag cuggaaagac ugacccugga 600 augcaaccag aagcggaaaga uccuggacaa cgagcugacc gagacaauca gcgcccagcu 660 ggaacuggau aaggccgcuc aggacuucag aaagauccac aacgagcgg aagaacugau 720 caaccagugg gagaacacca ucgagcagau gcagaaacgc gacggcgaca ucgacaacug 780 cgcccuggaa cucgcccgga ucaagcaaga gacacgcgag aaagagaacc uggucaaaga 840 gaaucaag uuccucgagu ccgagaucgg caacaacacc gaguucgaga agcggaucag 900 cguggccgac agaaagcugc ugaagugcag aaccgccuac caggaccacg agacaaagccg 960 gauucagcuc aagggcgagc uggauucucu gaaggccacc gugaacagaa ccagcagcga 1020 ucuggaagcc cugcgggaaga acaucagcaa gaucaagaag gacauccacg aggaaaccgc 1080 caggcugcag aaaacaaaga accacaauga gaucauccag accaagcuga aagagaucac 1140 cgaaaagacc augagcgugg aagagaagc cacaaaccug gaagauaugc ucaaaagagga 1200 agaaagac gucaaagagg uggacguuca acugaaccug auuaagggcg ugcuguucaa 1260 1320 1380 acugaagcag caagagauca ugacagcca gguauuccac auccagcagg ucgagcggcg 1440 gaugucuaga cugaagggcg agaucaacuc cgaggaaaaa caggcccucg aggccaagau 1500 1560 gauuaagaag cugcacaacg accuguacuu caucaagaaa gcccacagca agaacagcga 1620 1680 aaaagagcug gacaaggcca agggcuucaa gcaggaccug augaucgagg acaaccugcu 1740 gaagcuggaa gugaagcgga ccagagagau gcugcacagc aaggccgagg aagugcuguc 1800 ucuggaaaag cggaagcagc agcuguacac cgccauggaa gagagaaccg aagaguacaa 1860 1920 1980 2040 gaucaaggca gcccaagaaa aagagaacu ccagagagaa ggcgacugcc uggacgccaa 2100 gauuaacaag gccgaaaaag aaaucuacgc ccucgagaac acccugcagg uccugaacag 2160 cugcaacaac acuacaagc agagcuucaa gaagucacc ccuagcuccg acgaguacga 2220 cgugaaau cagcuggaag aacagaaaag agccguggac gagaaguaca gauacaagca 2280 gcggcagauc agagagcugc aagaggauau ccagagcaug gaaaacaccc uggacgugau 2340 cgagcaccug gccaacaacg ugaaagagaa gcuguccgag aaacaggccu acagcuuca 2400 gcuguccaaa gagacagagg aacagaagcc caaacuggaa cgcgugacca agcagugcgc 2460 caagcugaca aaagagaucc ggcugcugaa agacaccaag gacgaaacca uggaagaaca 2520 agacaucaag cugcgcgaga ugaagcaguu ccacaaagug aucgacgaga ugcuggugga 2580 2640 ccuggaacug ccuaccgccu cuaaaggg cagcagacag agcagcagau ccccuagcca 2700 caaagccug agcgccagaa gcuagaag caccagcacc ucuaccagcc aguccagcau 2760 uaaggugcug gaacucaagu uccccgccag cucuagccuc gugggaagcc cuucuagacc 2820 uagcagcgcc ucuagcagcu ccagcaacgu gaaguccaag aaaagcucca agugaccucg 2880 ccccggaccu gcccucccgc caggugcacc caccugcaau aaaugcagcg aagccgggau 2940 ucgaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3000 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3060 aaa 3063 <210> 3 <211> 1644 <212> RNA <213> Artificial sequence <220> <223> Codon-optimized sequence encoding a functional version of the tdTomato protein <400> 3 gggagaccca agcuggcuag cguuuaaacu uaagcuuggu accgcgggcc cgggauccac 60 cggucgccac cauggugagc aagggcgagg aggucaucaa agaguucaug cgcuucaagg 120 ugcgcaugga gggcuccaug aacggccacg aguucgagau cgagggcgag ggcgagggcc 180 gccccuacga gggcacccag accgccaagc ugaaggugac caagggcggc ccccugcccu 240 ucgccuggga cauccugucc ccccaguuca uguacggcuc caaggcguac gugaagcacc 300 ccgccgacau ccccgauuac aagaagcugu ccuuccccga gggcuucaag ugggagcgcg 360 ugaugaacuu cgaggacggc ggucugguga ccgugaccca ggacuccucc cugcaggacg 420 gcacgcugau cuacaaggug aagaugcgcg gcaccaacuu cccccccgac ggccccguaa 480 ugcagaagaa gaccaugggc ugggaggccu ccaccgagcg ccuguacccc cgcgacggcg 540 ugcugaaggg cgagauccac caggcccuga agcugaagga cggcggccac uaccuggugg 600 aguucaagac caucuacaug gccaagaagc ccgugcaacu gcccggcuac uacuacgugg 660 acaccaagcu ggacaucacc ucccacaacg aggacuacac caucguggaa caguacgagc 720 gcuccgaggg ccgccaccac cuguuccugg ggcauggcac cggcagcacc ggcagcggca 780 gcuccggcac cgccuccucc gaggacaaca acauggccgu caucaaagag uucaugcgcu 840 ucaaggugcg cauggagggc uccaugaacg gccacgaguu cgagaucgag ggcgagggcg 900 agggccgccc cuacgagggc acccagaccg ccaagcugaa ggugaccaag ggcggccccc 960 ugcccuucgc cugggacauc cugucccccc aguucaugua cggcuccaag gcguacguga 1020 agcaccccgc cgacaucccc gauacaaga agcuguccuu ccccgagggc ucaaguggg 1080 agcgcgugau gacuucgag gacggcgguc uggugaccgu gacccaggac uccucccugc 1140 aggacggcac gcugaucuac aaggugaga ugcgcggcac cacucccc cccgacggcc 1200 ccguaauugca gagagacc augggcuggg agccuccac cgagcgccug uacccccgcg 1260 acggcgugcu gaagggcgag auccaccagg cccugaagcu gaggacggc ggccacuacc 1320 ugguggaguu caagaccaac uacauggcca agagcccgu gcaacugcccc ggcuacuacu 1380 acguggacac caagcuggac aucaccucccc acaacgagga cuacaccac guggaacgu 1440 acgagcgcuc cgaggggccgc squash squash squash squash squash squash 1500 aggcggccaa ucugcaga aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1560 aaaaaaaaaaaaaaaaaaaaaaaaa AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHAAAAAAAAAAAAAAAAAAAAAAAAAHAAAAAAAAAHAAAAAAAAAAAAAAAAAAAAAHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAASAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA’ No’ aaaaaaaaaaaaaaggc gcc 1644 <210> 4 <211> 1327 <212> RNA <213> Artificial sequence <220> <223> MCIDAS sequence with minimal 5'UTR and optional 3'UTR of Ethris - Codon-optimized sequence encoding a functional version of the human MCIDAS protein <400> 4 gggagacgcc accaugcaag cuuguggcgg cggagcugcu ggaagaaggg ccuucgauag 60 caucugcccc aaccggaugc uugcccuucc ugguagagcc cugcugugca agccuggcaa 120 gcccgagaga aaguucgccc cuccaagaaa guucuuccc ggcuguacug gcggcagccc 180 ugugucug uaugaggacc cuccugaugc cgagccuaca gcucugccug cucugaccac 240 aaucgaccug caggaucugg ccgauugcag cucucugcug ggaucugaug cucuccugg 300 cggagaucug gcugccucuc agaaucacag ccaccagaca gaggccgacu ucaaccugca 360 agacuuccgg gacaccgugg acgaccugau cagcgauagc agcagcauga ugagccccac 420 ucuggccagc ggcgauuucc cauucagccc cugugacauc agcccuuucg gcccuugucu 480 gagcccucca cuggauccua gagcacugca gagcccaccu cugaggccuc cagauguucc 540 uccaccugag caguacugga aagagguggc cgaccagaac cagagagcac ugggcgacgc 600 ucugguggaa aaaccagc uggcacgugac ccugacacag aagchagaag agaucgccag 660 accugaagaa cggaaugugc agcugaaga gcuggcucc aggagagac accuggccag 720 ugugcuggac aagcugauga ucaccagag cagagauugc ggagccgccg cugaaccuuu 780 cucugcugaag gccaaggcca aggaagcu ggagaacug gugucugccg ccggaagg 840 uugcgcugaa guggaugcca uccugcgcga gaucagcgag agaugugaug aggcccugca 900 gagcagggac cccaaaagac cuagacugcu gcccgagccu gccacaccg auaccagacc 960 uggaaaucug cacggcgccu gagaaccgau ugcucug gcgcccuga 1020 ccugagccac agcgaacucg aagaaggcgg cugaucagc acccgauca gaagccacag 1080 caccaucaga acccuggccu uuccacagggg cacgccuuc acaucagaa ccgccaacgg 1140 cggcuacaag oucagauggg ugccaagcug agcuagccac cggggcaauac gagcucaagc 1200 cagucucaa aaaaaaaaaaaaaaaaaaaaaaaaa 1260 aaaaaaaaaaaaaaaaaaaaaaaaa AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAASAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA wonArAAAAAAAAAAAAAAAAAAAAAAA havea haveaaaaa havens haven aaaaaaa 1327 <210> 5 <211> 3446 <212> RNA <213> Artificial sequence <220> <223> Sequence with minimal 5'UTR of Ethris (ETH031T06) - codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 5 gggagacgcc accauggcug aaccuggcgg agccgccgga agaucccacc cugaagaugg 60 cucugccagc gagggcgaga aagagggcaa caacgagagc cacauggugu cccccccaga 120 gaaggacgac ggccagaaag gcgaagaggc cgugggcucu accgagcacc cugaggaagu 180 gaccacacag gccgaggccg ccauugaaga gggcgaggug gaaacagagg gcgaagccgc 240 ugguggaaggc gaagaggaag ccgugucuua cggcgacgcc gagagcgagg aagaguacua 300 cuacaccgag acaagcagcc ccgagggcca gaucucugcc gccgauacca ccuaccccua 360 cuucagcccc ccucaggaac ugccugggga agaggccuac gauagcgugu ccggcgaagc 420 uggccugcag ggcuuucagc aggaagccac aggccccucc gagagccggg aaagaagagu 480 gacaagcccc gagccuagcc acggcgugcu gggaccaucu gagcagaugg gccaagugac 540 cucuggcccu gcugugggca gacugacagg cagcacagag gaaccucagg gccaggugcu 600 gccuauggga gugcagcacc gguucagacu gagccacggc agcgacaucg agagcagcga 660 ccuggaagag uucgucagcc aggaacccgu gaucccuccu ggcgugccag augcccaucc 720 cagggaaggc gaucugcccg uguuccagga ccagauccag cagcccucua ccgaagaggg 780 ggcuauggcc gagagagugg aaagcgaggg cuccgacgaa gaagccgagg acgagggauc 840 ucagcuggug gugcuggacc ccgaccaccc ucugauggug cgguuucagg ccgcccugaa 900 gaacuaccug aaccggcaga ucgagaagcu gaaacuggac cugcaggaac uggugguggc 960 cacaaagcag agcagagccc agagacagga acugggcgug aaccuguacg aggugcagca 1020 gcaucuggug caucugcaga agcugcugga aaagagccac gaccggcacg ccauggccag 1080 cucugagcgc agacagaaag aggaagaacu gcaggccgcc agagcccugu acaccaagac 1140 augcgccgcu gccaacgagg aacggaagaa gcuggcugcc cugcagaccg agauggaaaa 1200 ccuggcucug caccuguucu acaugcagaa uaucgaccag gacaugcggg acgacaucag 1260 agugaugacc caggucguga agaggccga gagagaga auccggggccg agauugagaa 1320 gaaaaagcag gaccuguacg uggaccagcu gaccaccagg gcccagcagc uggaagagga 1380 uaucgcccug ucgaggccc aguaccuggc ccaggccgaa gauacccgga uccugagaaa 1440 ggccgugucc gaggccugca ccgagaucga ugccaucagc guggaaagc ggcggaucau 1500 gcagcagugg gccagcagcc ucgugggcau gaagcacaga gaugaggccc accgggccgu 1560 gcuggaagcu cugagaggcu cugacacca ggccaaggc accgacggcg agaucgaggc 1620 cuacaagaa uccauccauga aggagagga aagaacgag aaacuggcca gcauccugaa 1680 cagaaccgaa accgaggcca cccugcugca gaaacugacc acccagugcc ugaccaaaca 1740 gguggcccug cagucccagu ucacaccua cagacugacc cuggacca ccgaggacgc 1800 Cugagucag gaucagcugg aacagaugau ucugaccgag gaacugcagg cuuccggca 1860 ggccaucag ggggagcugg aacugcggag aaagaccgac gccgccauca gagagaagcu 1920 gcaggaacac augaccagca acagaccac caaguacuuc aaccagcuga ucugcgccu 1980 gcagaaagaa aagaccaaca ugaugacaca ccugagcaag aucaacggcg acauugccca 2040 gaccacccug gacaucaccc acaccagcag cagacuggac gcccaccaga aaacccuggu 2100 ggaacuggac caggauguga agaaagugaa cgagcugauc accaaacagcc agagcgagau 2160 cagccgggggg accauccuga ucgagagaaa gcagggccug aucaacuucc ugaacaaaca 2220 cguggaaga augguguccg agcugggcgg cgaggaagug ggaccucugg aacuggaau 2280 caaccgguc agcaagcuga ucgacgagca cgacggcaag gccgugcagg cucaagugac 2340 auggcugcgg cugcagcagg aaauggucaa agugacccag gaacaggaag aacagcuggc 2400 cucccuggac gccagcaaga aagaacugca caucauggaa cagaaaaagc ugcgggugga 2460 2520 ggacaacgac cugaaac ugaauagcu gaugaacaag aaccgcugcu ccagcgaaga 2580 auggaacag aacaacagag ugaccgagaa cgaguucgug cggagccuga aggccagcga 2640 gcgggaaacc aucaagaugc aggacaagcu gaaccagcug uccgaggaaa aagccacacu 2700 gcugaaccag cugguggag ccgagcacca gaucaugcug ugggagaga agauccagcu 2760 ggccaaagaaaugcggagca gcguggacag cgagaucggc cagaccgaaa ucagagccau 2820 gaagggcgag auccaccgga ugaaagugcg gcugggacag cugcuggaac accaggaaaa 2880 gaugauccgg gccauggaac uggccguggc cagacgggaa accgugacaa cccaggcuga 2940 gggccagcgg aagauggaca gaaggcccu gacccgacc gacuuccacc acaagcgcu 3000 gggaacugagg cggaagaucc gggacgugcg gaaggccacc gaugagugca cgaagaucc 3060 gcuggaacug gagagacac agcggaacgu guccuccagc neighborhood aacaggaaaa 3120 gcugagcgug auccaggccg acuucgacac ccuggaagcu gaccugacaa gacugggagc 3180 ccugaaaga cagaaccugu ccgagaucgu ggcacugcag acccggcuga aacaucugca 3240 ggcugugaaa gagggacgcu acguguccu guucagaucc aagcagucuc uggugcugga 3300 aagacagcgg cuggacaagc ggcuggcacu gauugccacc auccuggaua gagugcgcga 3360 cgaguaccca caguuccagg agcacugca caagugucc cagaugaucg ccaacaagcu 3420 ggaauccccu ggccccagcu gauucg 3446 <210> 6 <211> 3447 <212> RNA <213> Artificial sequence <220> <223> Sequence with TISU 5'UTR (ETH031T07) - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 6 gggagacugc caagauggcu gaaccuggcg gagccgccgg aagaucccac ccugaagaug 60 gcucugccag cgagggcgag aaagagggca acaacgagag ccacauggug ucccccccag 120 agaaggacga cggccagaaa ggcgaagagg ccgugggcuc uaccgagcac ccugaggaag 180 ugaccacaca ggccgaggcc gccauugaag agggcgaggu ggaaacagag ggcgaagccg 240 cuguggaagg cgaagaggaa gccgugucuu acggcgacgc cgagagcgag gaagaguacu 300 acuacaccga gacaagcagc cccgagggcc agaucucugc cgccgauacc accuaccccu 360 acuucagccc cccucaggaa cugccugggg aagaggccua cgauagcgug uccggcgaag 420 cuggccugca gggcuuucag caggaagcca caggcccucc cgagagccgg gaaagaagag 480 ugacaagccc cgagccuagc cacggcgugc ugggaccauc ugagcagaug ggccaaguga 540 ccucuggccc ugcugugggc agacugacag gcagcacaga ggaaccucag ggccaggugc ugccuauggg agugcagcac cgguucagac ugccuauggg cagcgacauc gagagcagcg accuggaaga guucgucagc caggaacccg ugaucccucc uggcgugcca gaugcccauc 780. ccggagg cgaucugccc guguuccagg accagaucca gcagcccucu accgaagagg gggcuauggc cgagagagug gaaagcgagg gcuccgacga agaagccgag gacgagggau 840 cucagcuggu ggugcuggac cccgaccacc cucugauggu gcgguuucag gccgcccuga agaacuaccu gaaccggcag aucgagaagc ugaaacugga ccugcagga cugguggugg 1020. ccacaaagca gagcagagcc cagagacagg aacugggcgu gaaccuguac gaggugcagc agcaucuggu gcaucugcag aagcugcugg aaaagagcca cgaccggcac gccauggcca gcucugagcg cagacagaaa gaggagaac ugcaggccgc cagagcccug uacaccaaga caugcgccgc ugccaacgag gacggag agcuggcugc ccugcagacc gagaugga accuggcucu gcaccuguuc uacaugcaga auaucgacca ggacaugcgg gacgacauca 1320 agaaaaagca ggaccuguac guggaccagc ugaccaccag ggcccagcag cuggaagagg 1380 auaucgcccu guucgaggcc caguaccugg cccaggccga aguaacccgg aucggagagaa 1440 aggccguguc cgaggccugc accgagaucg augccaucag cguggaaaag cggcggauca 1500 ugcagcagug ggccagcagc cucgugggca ugaagcag agaugaggcc caccgggccg 1560 ugggaagc uggagaggc ugugagcacc aggccaagag caccgacggc gagaucgagg 1620 ccuacaagaa auccaucaug aaagaagagg aaaagaacga gaacuggcc agcauccuga 1680 acagaaccga aaccgaggcc acccugcugc agaaacugac cacccagugc cugaccaaac 1740 agguggcccu cgagucccag uucaacaccu acagacugac ccugcagcac accgaggacg 1800 cccugaguca ggaucagcug gaacagauga uucugaccga ggaacugcag gcuauccggc 1860 aggccauuca gggggagcug gaacugcgga gaagaccga cgccgccauc agagagaagc 1920 ugcaggaaca caugaccagc aacaagacca ccaaguacuu caaccagcug auucugcgcc 1980 uggcagaaaga aaagaccaac augaugacac accugagca gaucaacggc gawaugccc 2040 squirrel squirrel squirrel squirrel squirrel squirrel squirrel aaaacccugg 2100 shake shake shake shake shake shake shake shake 2160 ucagccggcg gaccaccug aucgagagaa agcagggccu gaccacuuc cugahaac 2220 agcuggaaag aagggucc gagcuggggcg gcgaggaagu gggaccucug gaacuggaaa 2280 ucaagcggcu gagcaagcug aucgacgagc acgacggcaa ggccgugcag gcucaaguga 2340 cauggcugcg gcugcagcag gaaaogguca aagugaccca ggaacaggaa gaacagcugg 2400 cucccugga cgccagcaag aagaacugc acoucaugga ahaaaaag cugcgggggg 2460 aaagcaagau cgaggaggaaaaaaagaaaaaaaaaaaaaaaaaaaaaaggacc 2520 uggaaaugc chuggagaaa cugaauauugc ugaugaaaa gaaccgcugc uccagggaag 2580 aaacuggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaahhaaaaaccgaaga acgauaccu gcggagccug aaggccaaccg 2640 agcgggaaac caucagaug caggacaagc ugaaccagcu guccgaggaa aaagccacac 2700 ugcugaacca gcugguggaa gccgagcacc agaucaugcu gugggagaag aagauccagc 2760 uggccaaaga aaugcggagc agcguggaca gcgagaucgg ccagaccgaa aucagagcca 2820 ugaagggcga gauccaccgg augaaagugc ggcugggaca gcugcugaaa cagcaggaaa 2880 agaugauccg ggccauggaa cuggccgugg ccagacggga aaccgugaca acccaggcug 2940 agggccagcg gaauggac agaaggccc ugacccggac cgacuuccac cacaagcagc 3000 gggaacugag gcgggaagauc cgggacgugc ggaaggccac cgaugagugc aaagacag 3060 ugcuggaacu ggagagaca cagcggaacg uguccucag ccugcuggaa aaacaggaa 3120 agcugagcgu gauccaggcc gacuucgaca cccuggaagc ugaccugaca agacugggag 3180 cccugaaaag acagaaccug uccgagaucg uggcacugca gacccggcug aaacaucugc 3240 aggcugugaa agagggacgc uacguguucc uguucagauc caagcagucu cuggugcugg 3300 aaagacagcg cguggacaag cggcuggcac ugauugccac cauccuggau agagugcgcg 3360 acgaguaccc agaguccag gaagcacugc acaagguc ccagaugauc gccaacaagc 3420 uggaaucccc uggccccagc ugauucg 3447 <210> 7 <211> 3476 <212> RNA <213> Artificial sequence <220> <223> Sequence with hAg 5'UTR but no 3'UTR (ETH031T08) - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 7 gggagacucu ucuggucccc acagacucag agagaacgcc accauggcug aaccuggcgg 60 agccgccgga agaucccacc cugaagaugg cucugccagc gagggcgaga aagagggcaa 120 caacgagagc cacauggugu cccccccaga gaaggacgac ggccagaaag gcgaagaggc 180 cgugggcucu accgagcacc cugaggaagu gaccacacag gccgaggccg ccauugaaga 240 gggcgaggug gaaacagagg gcgaagccgc ugguggaaggc gaagaggaag ccgugucuua 300 cggcgacgcc gagagcgagg aagaguacua cuacaccgag acaagcagcc ccgagggcca 360 gaucucugcc gccgauacca ccuaccccua cuucagcccc ccucaggaac ugccugggga 420 agaggccuac gauagcgugu ccggcgaagc uggccugcag ggcuuucagc aggaagccac 480 aggcccuccc gagagccggg aaagaagagu gacaagcccc gagccuagcc acggcgugcu 540 gggaccaucu gagcagaugg gccaagugac cucuggcccu gcugugggca gacugacagg 600 cagcacagag gaaccucagg gccaggugcu gccuauggga gugcagcacc gguucagacu 660 gagccacggc agcgacaucg agagcagcga ccuggaagag uucgucagcc aggaacccgu 720 gaucccuccu ggcgugccag augcccaucc cagggaaggc gaucugcccg uguuccagga 780 ccagauccag cagcccucua ccgaagaggg ggcuauggcc gagagagugg aaagcgaggg 840 cuccgacgaa gaagccgagg acgagggauc ucagcuggug gugcuggacc ccgaccaccc 900 ucugauggug cgguuucagg ccgcccugaa gaacuaccug aaccggcaga ucgagaagcu 960 gaaacuggac cugcaggaac uggugguggc cacaaagcag agcagagccc agagacagga 1020 acugggcgug aaccuguacg aggugcagca gcaucuggug caucugcaga agcugcugga 1080 aaagagccac gaccggcacg ccauggccag cucugagcgc agacagaaag aggaagaacu 1140 gcaggccgcc agagcccugu acaccaagac augcgccgcu gccaacgagg aacggaagaa 1200 gcuggcugcc cugcagaccg agauggaaaa ccuggcucug caccuguucu acaugcagaa 1260 uaucgaccag gacaugcggg acgacaucag agugaugacc caggucguga agaaggccga 1320 gacagagaga auccgggccg agauugagaa gaaaaagcag gaccuguacg uggaccagcu 1380 gaccaccagg gcccagcagc uggaagagga uaucgcccug uucgaggccc aguaccuggc 1440 ccaggccgaa gauacccgga uccugagaaa ggccgugucc gaggccugca ccgagaucga 1500 ugccaucagc guggaaaagc ggcggaucau gcagcagugg gccagcagcc ucgugggcau 1560 gaagcacaga gaugaggccc accgggccgu gcuggaagcu cugagaggcu gucagcacca 1620 ggccaagagc accgacggcg agaucgaggc cuacaagaaa uccaucauga aggaagagga 1680 aaagaacgag aaacuggcca gcauccugaa cagaaccgaa accgaggcca cccugcugca 1740 gaaacugacc acccagugcc ugaccaaaca gguggcccug cagucccagu ucaacaccua 1800 cagacugacc cugcaggaca ccgaggacgc ccugagucag gaucagcugg aacagaugau 1860 ucugaccgag gaacugcagg cuauccggca ggccauucag ggggagcugg aacugcggag 1920 aaagaccgac gccgccauca gagagaagcu gcaggaacac augaccagca acaagaccac 1980 caaguacuuc aaccagcuga uucugcgccu gcagaaagaa aagaccaaca ugaugacaca 2040 ccugagcaag aucaacggcg acauugccca gaccacccug gacaucaccc acaccagcag 2100 cagacuggac gcccaccaga aaacccuggu ggaacuggac caggauguga agaaagugaa 2160 cgagcugauc accaacagcc agagcgagau cagccggcgg accauccuga ucgagagaaa 2220 gcagggccug aucaacuucc ugaacaaaca gcuggaaaga augguguccg agcugggcgg 2280 cgaggaagug ggaccucugg aacuggaaau caagcggcug agcaagcuga ucgacgagca 2340 cgacggcaag gccgugcagg cucaagugac auggcugcgg cugcagcagg aaauggucaa 2400 agugacccag gaacaggaag aacagcuggc cucccuggac gccagcaaga aagaacugca 2460 caucauggaa cagaaaaagc ugcgggugga aagcaagauc gagcaggaaa aaaaagaaca 2520 gaaagaaauc gagcaccaca ugaaggaccu ggacaacgac cugaagaaac ugaauaugcu 2580 gaugaacaag aaccgcugcu ccagcgaaga acuggaacag aacaacagag ugaccgagaa 2640 cgaguucgug cggagccuga aggccagcga gcgggaaacc aucaagaugc aggacaagcu 2700 gaaccagcug uccgaggaaaaagccacacu gcugaaccag cugguggag ccgagcacca 2760 gaucaugcug ugggagaga agauccagcu ggccaaaga augcggagca gcguggacag 2820 cgagaucggc cagaccgaaa ucagagccau gaagggcgag auccaccgga ugaagugcg 2880 gcugggacag cugcugaacac agcaggaaaa gaugauccgg gccauggaac uggccguggc 2940 cagacgggaa accgugacaa cccaggcuga gggccagcgg aagauggaca gaaggcccu 3000 gaccccgacc gacuuccacc acaagcagcu gggacugagg cggagaucc gggacgugcg 3060 gaggccacc gaugagugca chaaaague gcuggaagg gagagaac gaaaaaack 3120 guccuccagc cugcuggaaa aacaggaaaa gcugagcgug auccaggccg acuucgacac 3180 ccuggaagcu gaccuggachaa gacugggaggc ccuggaaggcu ccgaaccug ccgaaccug 3240 ggcacugcag acccggcuga aacaucugca ggcugugaaa gagggacgcu acguguccu 3300 guucagaucc agcagucuc uggugcugga aagacagcgg cuggacaagc ggcuggcacu 3360 gauugccacc auccuggaua gagugcgcga cgaguaccca caguuccagg aagcacugca 3420 caaggugucc cagaugaucg ccaacaagcu ggaauccccu ggccccagcu gauucg 3476 <210> 8 <211> 3683 <212> RNA <213> Artificial sequence <220> <223> Sequence with human CMV IE9 5'UTR and human growth hormone 3'UTR (ETH031T10) - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 8 gggagaccag aucgccugga gacgccaucc acgcuguuuu gaccuccaua gaagacaccg 60 ggaccgaucc agccuccgcg gccgggaacg gugcauugga acgcggauuc cccgugccaa 120 gagugacuca ccguccuuga cacggccacc auggcugaac cuggcggagc cgccggaaga 180 ucccacccug aagauggcuc ugccagcgag ggcgagaaag agggcaacaa cgagagccac 240 augguguccc ccccagagaa ggacgacggc cagaaaggcg aagaggccgu gggcucuacc 300 gagcacccug aggaagugac cacacaggcc gaggccgcca uugaagaggg cgagguggaa 360 acaggggcg aagccgcugu ggaaggcgaa gaggaagccg ugucuuacgg cgacgccgag 420 agcgaggaag aguacuacua caccgagaca agcagccccg agggccagau cucugccgcc 480 gauaccaccu accccuacuu cagccccccu caggaacugc cugggaga ggccuacgau 540 agcguguccg gcgaagcugg ccugcagggc uuucagcagg aagccacagg cccucccgag 600 agccgggaaa gaagagugac aagccccgag ccuagccacg gcgugcuggg accaucugag 660 cagauggcc aagugaccuc uggcccugcu gugggcagac ugacaggcag cacagagaa 720 ccucagggcc aggugcugcc uaugggagug cagcaccggu ucagacugag ccacggcagc 780 gacaucgaga gcagcgaccu ggaagaguuc gucagccagg aacccgugau cccuccuggc 840 gugccagaug cccaucccag ggaaggcgau cugcccgugu uccaggacca gauccagcag 900 cccucuaccg aagaggggc uauggccgag agagugggaaa gcgagggcuc cgacgaagaa 960 gccgaggacg agggaucuca ggugguggug cuggagccg accacccu gauggugcgg 1020 uuucaggccg cccugaagaa cuaccugaac cggcagaucg agaagcugaa acuggaccug 1080 caggaacugg ugguggccac aaagcagagc agagcccaga gacaggaacu gggcgugaac 1140 1200 cggcacgcca uggccagcuc ugagcgcaga cagaaagagg aagaacugca ggccgccaga 1260 gcccuguaca ccaagacaug cgccgcugcc aacgaggaac ggagaagcu ggcugcccug 1320 cagaccgaga uggaaaaccu ggcucugcac cuguucuaca ugcagaauu cgaccaggac 1380 augcggacg acaugaga gaugacccag gucaga aggccgagac agaagaauc 1440 cggggccgaga uugagaagaa aaagcaggac cuguacgugg accagcugac caccagggcc 1500 cagcagcugg aagaggauau cgcccuguuc gaggcccagu accuggccca ggccgaagau 1560 acccggaucc ugagaaggc cguguccgag gccugcaccg agaucgaugc caucagcgug 1620 gaaagcggc ggaucaugca ccaguggcc agcagccucg ugggcaugaa gcacagagau 1680 gaggcccacc gggccgugcu ggaagcucug agaggcuguc agcaccaggc caagagcacc 1740 gacggcgaga ucgaggccua caagaaaucc aucaugaagg aagagaaaa gaacgagaaa 1800 cggccagca uccugaacag aaccgaaacc gaggccaccc ugcgcagaa acugaccacc 1860 cagugccuga ccaaacaggu ggcccugcag ucccaguuca acaccuacag acugaccug 1920 caggacaccg aggacgcccu gagucaggau cagcuggaac agaugauucu gaccgaggaa 1980 cugcaggcua uccggcaggc cauucagggg gagcuggaac ugcggagaaa gaccgacgcc 2040 gccaucagag agaagcugca ggaacacaug accagcaaca agaccaccaa guacuucaac 2100 cagcugauuc ugcgccugca gaagaaaag accaacauga ugacacaccu gagcaagauc 2160 2220 caccagaaaa cccuggugga acuggaccag gaugugaaga aagugaacga gcugaucacc 2280 aacagccaga gcgagaucag ccggcggacc auccugaucg agaaagca gggccugauc 2340 aacuuccuga acaaacagcu ggaaagaaug guguccgagc ugggcggcga ggaaguggga 2400 ccugggaac ugggaaucaa gcggcugagc aagcugaucg aggagcacga cggcaaggcc 2460 gugcaggcuc aagugacaug gcugcggcug cagcaggaaa uggucaagu gacccaggaa 2520 caggaaac agcuggccuc ccuggacgcc agcaagaaag aacugcacau cauggaacag 2580 aaaaagcugc ggguggaaag caagaucgag caggaaaaaa aagaacagaa agaaaucgag 2640 shark shark shark shark aagaacuga auugcugau shark 2700 cgcugcucca gcgaagaacu ggaagaac aacagaguga ccgagaacga gucgugcgg 2760 agccugaagg ccagcgagcg ggcuaccauc agaugcagg ahaagcugaa ccagcugucc 2820 gaggaaaaag ccacugcu gaaccagcug guggaagccg ccaccagau caugcugugg 2880 gagagaga uccaggcuggc caagaaug cggaggcuggcg uggaaggcga gaucggccagg 2940 accgaaauca gagccaugaa gggcgagauc caccggauga aagugcggcu gggacagcug 3000 cugaaacagc aggaaagau gauccggggcc auggacugg ccguggccag acgggaacc 3060 gugacaaccc aggcugagggg aggcggaag aggcccugac ccggaccgac 3120 uuccaccaca agcagcugga acugaggcgg aagauccggg acgugcggaa ggccaccgau 3180 gagugxaaa agaagugcu gagahaaguegc ggaagug cuccagcug 3240 neighboraaaaac aggaaagcu ggcgugauc ggccgacu gggaaaaac ggaaaaac 3300 cugacagac ugggagcccu gaaagacag aaccuguccg agaucguggc acugcagacc 3360 cggcugaaac aucugcaggc ugugaaagag ggacgcuacguguuccuguu cagauccaag 3420 cagucucugg ugcuggaaag acagcggcug gacaagcggc uggcacugau ugccaccauc 3480 cuggauagag ugcgcgacga guacccacag uuccaggaag cacugcacaa ggugucccag 3540 augaucgcca acaagcugga aucccuggc cccagcugac ggguggcauc ccugugaccc 3600 cuccccagug ccucuccugg cccuggaagu ugccacucca gugcccacca gccuuguccu 3660 aauaaaauua aguugcaucu ucg 3683 <210> 9 <211> 4295 <212> RNA <213> Artificial sequence <220> <223> ETH031T28: N-terminal EGFP-tagged-CCDC40 - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 9 gggagacgcc accaugguga gcaagggcga ggagcuguuc accggggugg ugcccauccu 60 ggucgagcug gacggcgacg uaaacggcca caaguucagc guguccggcg agggcgaggg 120 cgaugccacc uacggcaagc ugacccugaa guucaucugc accaccggca agcugcccgu 180 gcccuggccc acccucguga ccacccugac cuacggcgg cagugcuuca gccgcuaccc 240 cgaccacaug aagcagcacg acuucuucaa guccgccaug cccgaaggcu acguccagga 300 gcgcaccauc uucuucaagg acgacggcaa cuacaagacc cgcgccgagg ugaaguucga 360 gggcgacacc cuggugaacc gcaucgagcu gaagggcauc gacuucaagg aggacggcaa 420 cauccugggg cacaagcugg aguacaacua caacagccac aacgucuaua ucauggccga 480 caagcagaag aacggcauca aggugaacuu caagauccgc cacaacaucg aggacggcag 540 cgugcagcuc gccgaccacu accagcagaa cacccccauc ggcgacggcc ccgugcugcu 600 gcccgacaac cacuaccuga gcacccaguc cgcccugagc aaagacccca acgagaagcg 660 cgaucacaug guccugcugg aguucgugac cgccgccggg aucacucucg gcauggacga 720 gcuguacaag ggcggagggg gcagcgcuga accuggcgga gccgccggaa gaucccaccc 780 ugaagauggc ucugccagcg agggcgagaa agagggcaac aacgagagcc acaugguguc 840 ccccccagag aaggacgacg gccagaaagg cgaagaggcc gugggcucua ccgagcaccc 900 ugaggaagug accacacagg ccgaggccgc cauugaagag ggcgaggugg aaacagaggg 960 cgaagccgcu guggaaggcg agaggaagc cgugucuuac ggcgacgccg agagcgagga 1020 agaguacuac uacaccgaga caagcagcccc cgaggggccag aucucugccg ccgauaccac 1080 cuckuac ucagccccc cucaggacu gccugggaa gaggccuacg auagcguguc 1140 cggcgaagcu ggccugcagg gcuuucagca ggaagccaca ggcccucccg agagccggga 1200 aagagagug acaagccccg agccuagcca cggcgugcug ggaccaucug agcagauggg 1260 ccaagugacc cucuggccug cugugggcag acugacaggc agcacagagg accucagggg 1320 ccaggugcug ccuaugggag ugcagcaccg guucagacug agccacggca gcgacaucga 1380 gagcagcgac neighborhood ucgucagcca ggacccgug accccuccug gcgugccaga 1440 cuckoo cuckoo cuckoo cuckoo cuckoo cuckoo cuckoo cuckoo 1500 cgaagagggg gcuauggccg aggagugga agcgaggggc uccgacgaag agccgagg 1560 cgagggaucu cugcuggugg ugcuggaccc cgaccacccu cugauggugc gguuucaggc 1620 cgcccugaag aacuaccuga accggcagau cgagaagcug aaacuggacc ugshaggacu 1680 ggugguggcc acaaagcaga gcagagccca gagacaggaa cugggcguga accuguacga 1740 ggugcagcag caucuggugc aucugcagaa gguccuggaa aagagccacg accggcacgc 1800 cauggccagc ucugagcgca gacagaaaga ggaagaacug caggccgcca gagcccugua 1860 caccaagaca ugcgccgcug ccaacgagga acggaagaag cuggcugccc ugcagaccga 1920 gauggaaaac cuggcucugc accuguucua caugcagaau aucgaccagg acaugcggga 1980 cgacaucaga gugaugaccc aggucgugaa gaaggccgag acagagagaa uccgggccga 2040 gauugagaag aaaaagcagg accuguacgu ggaccagcug accaccaggg cccagcagcu 2100 ggaagaggau aucgcccugu ucgaggccca guaccuggcc caggccgaag auacccggau 2160 ccugagaaag gccguguccg aggccugcac cgagaucgau gccaucagcg uggaaaagcg 2220 gcggaucaug cagcaguggg ccagcagccu cgugggcaug aagcacagag augaggccca 2280 ccgggccgug cuggaagcuc ugagaggcug ucagcaccag gccaagagca ccgacggcga 2340 gaucgaggcc uacaagaaau ccaucaugaa ggagaggaa aagaacgaga aacuggccag 2400 2460 gaccaaacag guggcccugc aguccccaguu caacaccuac agacugaccc ugcaggacac 2520 2580 uauccggcag gccauucagg gggagcugga acugcggaga aagaccgacg ccgccaucag 2640 agagaagcug caggaacaca ugaccagcaa caagaccacc aaguacuuca accagcugau 2700 ucugcgccug cagaaagaaa agaccaacau gaugacacac cugagcaaga ucaacggcga 2760 cauugcccag accaccugg acaucaccca caccagcagc agacuggacg cccaccagaa 2820 aacccuggug gaacuggacc aggaugugaa gaaguggaac gagcugauca ccaacagcca 2880 2940 3000 acuggaauc aagcggcuga cgaagcugau cgacgagcac gacggcaagg ccgugcaggc 3060 ucaagugaca uggcugcgg ugcagcagga aauggucaaa gugacccagg aacaggaagaa 3120 acagcuggcc ucccuggacg ccagcaaga agaacugcac aucauggaac agaaaaagcu gcggggugga agcaagaucg agcaggaaaa aaaagaacg aaagaaaucg agcaccacau 3300. accgcugcug 3300. 3300. accgcugcug 3360. 3360. 3360. 3360. 3360. 3360. 3360. 3360. 3360 ggccagcgag cgggaacca ucaagaugca ggacaagcug aaccagcugu ccgaggaaaa agccacacug cugaaccagc ugguggaagc cgagcaccag aucaugcugu gggagaagaa gauccagcug gccaaagaa ugcggagcag cguggacagc gagaucggcc agaccgaau 3600. 3600. 3600. 3600. 3600. 3600. 3600. 3600. 3600. 3600. 3600 gcaggaaaag augauccggg ccauggaacu ggccguggcc agacggaa ccgugacaac ccaggcugag ggccagcgga agauggacag aaaggcccug acccggaccg accuuccacca caagcagcug gaacugaggc ggaagauccg ggacgugcgg aaggccaccg augagugcac aaagacagug cuggaacugg aagagacaca gcggaacgug uccuccagcc ugcuggaaaa acaggaaaag cugagcguga uccaggccga cuucgacacc cuggaagcug accugacaag 3900 acugggagcc cugaaaagac agaaccuguc cgagaucgug gcacugcaga cccggcugaa 3960 acaucugcag gcugugaaag agggacgcua cguguuccug uucagaucca agcagucucu 4020 ggugcuggaa agacagcggc uggacaagcg gcuggcacug auugccacca uccuggauag 4080 agugcgcgac gaguacccac aguuccagga agcacugcac aagguguccc agaugaucgc 4140 caacaagcug gaauccccug gccccagcug auucgaaaaa aaaaaaaaaa aaaaaaaaaa 4200 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 4260 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaa 4295 <210> 10 <211> 4295 <212> RNA <213> Artificial sequence <220> <223> ETH031T30: C-terminal EGFP-tagged-CCDC40 - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 10 gggagacgcc accauggcug aaccuggcgg agccgccgga agaucccacc cugaagaugg 60 cucugccagc gagggcgaga aagagggcaa caacgagagc cacauggugu cccccccaga 120 gaggacgac ggccagaaag gcgagaggc cgugggcucu accgagcacc cugaggaagu 180 gaccacacag gccgaggccg cauugaga gggcgaggug gaacagagg gcgaagccgc 240 uguggaaggc gagaggaag ccgugucuua cggcgacgcc gagagcgagg agaguacua 300 cuacaccgag acaagcagcc ccgaggggcca gaucucugcc gccgauacca ccuaccccua 360 cucagcccc cucaggaac ugccuggga agaggcuac gauagcgugu ccggcgaagc 420 uggccugcag ggcuuucagc aggaagccac agcccuccc gagagccggg aagaagagu 480 gaagcccc gagccuagcc acggcgugcu gggaccugc gccagaugg gccaagugc 540 cucuggcccu gcugugggca gacugacagg cagcacagag gaaccucagg gccaggugcu 600 gccuauggga gugcagcacc gguucagacu gagccacggc agcgacaucg agagcagcga 660 ccuggaagag uucgucagcc aggaacccgu gaucccuccu ggcgugccag augcccaucc 720 cagggaaggc gaucugcccg uguuccagga ccagauccag caggcucua ccgaagagggg 780 ggcuauggcc gagagugg aaagcgagggg cuccgacgaa gaagccgagg acgagggauc 840 ucagcuggug gugcuggacc ccgaccaccc ucugauggug cgguuucagg ccgcccugaa 900 gaacuaccug aaccggcaga ucgagaagcu gaacuggac cugcagaac uggugguggc 960 cacaaagcag agcagagccc agacagga acuggcggug aaccuguacg aggugcagca 1020 1080p cucugagcgc agacagaaag aggaacu cgaggccgcc agagccugu acaccaagac 1140 augcgccgcu gccaacgagg aacggaaa gcuggcugcc cugcagaccc agauggaaaa 1200 ccuggcucug caccuguucu acaugcagaa uaucgaccag gacaugcggg acgacaucag 1260 aguugaugacc caggucguga agaaggccga gacagagaga auccgggccg agauugagaa 1320 gaaaaagcag gaccuguacg uggaccagcu gaccaccagg gcccagcagc uggagagga 1380 uaucgccccug uucgaggccc aguaccuggc ccaggccgaa gauacccgga uccugagaaa 1440 ggccgugucc gaggccugca ccgagaucga ugccaucagc guggaaaagc ggcggaucau 1500 gcagcagugg gccagcagcc ucgugggcau gaagcacaga gaugaggccc accgggccgu 1560 gcuggaagcu cugagaggcu cugacacca ggccaaggc accgacggcg agaucgaggc 1620 cuacaagaa uccauccauga aggagagga aagaacgag aaacuggcca gcauccugaa 1680 cagaaccgaa accgaggcca cccugcugca gaaacugacc acccagugcc ugaccaaaca 1740 gguggcccug cagucccagu ucacaccua cagacugacc cuggacca ccgaggacgc 1800 Cugagucag gaucagcugg aacagaugau ucugaccgag gaacugcagg cuuccggca 1860 ggccaucag ggggagcugg aacugcggag aaagaccgac gccgccauca gagagaagcu 1920 gcaggaacac augaccagca acagaccac caaguacuuc aaccagcuga ucugcgccu 1980 gcagaaagaa aagaccaca ugaugacaca ccugagcaag aucaacggcg acauugccca 2040 gaccacccug cuaucacccc acaccagcag cagacuggac gcccaccaga aaacccuggu 2100 ggshackgac aggshackgau ggshaggcc 2160 cagccggcgg accauccuga ucgagagaaa gcagggccug aucacuucc ugacaaaca 2220 gcuggaaaga augguguccg agcuggggcgg cgaggaagug ggaccucugg aacuggaau 2280 caagcggcug agcaagcuga ucgacgagca cgacggcaag gccgugcagg cucaagugac 2340 auggcugcgg cugcagcagg aaauggucaa agugacccag gaacaggag aacagcuggc 2400 cucccuggac gccagxaag aagaacugca caucauggaa cagaaaagc ugcgggugga 2460 aagcaagauc gagagaaaaaaagaaca gagaaauc gagaccaca ugaaggaccu 2520 ggaaaaugcu gagahaag aaccgcugcu ccaggcga 2580 shakeaacag aaaahahag shakeshagggaa cgaguucgug cggaggcug aggshaggcga 2640 gcgggaaacc aucaagaugc aggacaagcu gaaccagcug uccgaggaaa agccacacu 2700 gcugaaccag cugguggag ccgagcacca gaucaugcug ugggagaga agauccagcu 2760 ggccaaagaaaugcggagca gcguggacag cgagaucggc cagaccgaaa ucagagccau 2820 gaagggcgag auccaccgga ugaaagugcg gcugggacag cugcuggaac accaggaaaa 2880 gaugauccgg gccauggaac uggccguggc cagacgggaa accgugacaa cccaggcuga 2940 gggccagcgg aagauggaca gaaggcccu gacccgacc gacuuccacc acaagcgcu 3000 ggaacugagg cggagaaucc gggacgugcg gaaggccacc gaugagugca caaagacagu 3060 cuggaacug gaagacaac agcggaacgu guccuccagc cugcuggaaa aacaggaaaa 3120 gcugagcgug auccaggccg acuucgacac ccuggaagcu gaccugacaa gacugggagc 3180 ccugaaaaga cagaaccugu ccgagaucgu ggcacugcag acccggcuga aacaucugca 3240 ggcugugaaa gagggacgcu acguguuccu guucagaucc aagcagucuc uggugcugga 3300 aagacagcgg cuggacaagc ggcuggcacu gauugccacc auccuggaua gagugcgcga 3360 cgaguaccca caguuccagg aagcacugca caaggugucc cagaugaucg ccaacaagcu 3420 ggaaucccccu ggccccagcg gcggaggggg cagcgugagc aagggcgagg agcuguucac 3480 cgggguggug cccauccugg ucgagcugga cggcgacgua aacggccaca aguucagcgu 3540 guccggcgag ggcgagggcg augccaaccua cggcaagcug acccugaagu ucaucugcac 3600 caccggcaag cugcccgugc ccuggcccac cccgugacc acccgugaccu acggcgugca 3660 gugcuucagc cgcuaccccg accacaugaa gcagcacgac uucuucaagu ccgccaugcc 3720 cgaaggcuac guccaggagc gcaccaucuu cuucaaggac gacggcaacu acaagacccg 3780 cgccgaggug aaguucgagg gcgacacccu ggugaaccgc aucgagcuga agggcaucga 3840 cuucaaggag gacggcaaca uccuggggca caagcuggag uacaacuaca acagccacaa 3900 cgucuauauc auggccgaca agcagaagaa cggcaucaag gugaacuuca agauccgcca 3960 caacaucgag gacggcagcg ugcagcucgc cgaccacuac cagcagaaca cccccaucgg 4020 cgacggcccc gugcugcugc ccgacaacca cucugagc acccaguccg cccugagcaa 4080 agacccccaac gagaagcgcg aucacaugu ccugcuggag uucgugaccg ccgccgggau 4140 cacucucggc auggacgagc uguacaagug auucgaaaaa aaaaaaaaaa aaaaaaaaaa 4200 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 4260 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaa 4295 <210> 11 <211> 5199 <212> RNA <213> Artificial sequence <220> <223> ETH031T26: N-terminal HA tag - CCDC40-T2A peptide - tdTomato with 5' and 3' CYBA UTRs - Codon-optimized sequence encoding a functional version of the human CCDC40 protein <400> 11 gggagaccgc gccuagcagu gucccagccg gguucguguc gccgccacca uguaccccua 60 cgacgugccc gacuacgccg gcggaggggg cagcgcugaa ccuggcggag ccgccggaag 120 auccacccu gagauggcu cugccagcga gggcgagaaa gagggcaca acgagagcca 180 cauggugucc cccccagaga aggacgacgg ccagaaggc gagaggccg ugggcucuac 240 cgagcacccu gaggaaguga ccacaggc cgaggccgcc auugagagg gcgaggugga 300 aacagagggc gaagccgcug uggaggcga agaggaagcc gugucuuacg gcgacgccga 360 gagggaggaa gaguacuacu acaccgagac aagcagcccc gagggccaga ucucugccgc 420 480 uagcgugucc ggcgaagcug gccugcaggg cuucagcag gaagccacag gcccucccga 540 gagccgggaa agagaguga caagccccga gccuagccac ggcgugcugg gaccaucuga 600 gcagaugggc caagugaccu cuggcccugc ugugggaga cugacaggca gcacagagga 660 accucagggc caggugcugc cuaugggagu gcagcaccgg ucagacuga gccacggcag 720 cgacaucgag agcagcgacc uggagaguu cgucagccag gaacccguga ucccuccugg 780 cgugccagau gcccauccca gggaaggcga ucugcccgug uuccaggacc agauccagca 840 gcccucuacc gagagggggg cuauggccga gagaguggaa agcgaggcu ccgachgagg 900 agccgaggac gagggaucuc agcugguggu gcuggacccc agccccuc ugauggugcg 960 guuucaggcc gcccugaga acuaccugaa ccggcagauc gagaagcuga accuggaccu 1020 ggaggaagg guggggcca aaaaaaaaagggaaaaaaaagggaaaaaaagggaaa 1080 shake shake shake shake shake shake shake shake shake 1140 ccggcacgcc auggccagcu cugagcgcag acagaagag gagaacugc aggccgccag 1200 agcccuguac accagacau gcgccgcugc caacgaggaa cggagaagc uggcugcccu 1260 gcagaccgag auggaaaacc uggcucugca ccugucuucuac augcagaaua ucgaccagga 1320 caugcgggac gaucagag ugaugaccca ggucgugaag aaggccgaga cagagagaau 1380 ccgggccgag auugagaaga aaaagcagga ccuguacgug gaccagcuga ccaccaggggc ccagcagcug gaagaggaua ucgcccuguu cgaggcccag uaccuggccc aggccgaaga uacccggauc cugagaaagg ccguguccga ggccugcacc gagaucgaug ccaucagcgu ggaaaagcgg cggaucaugc agcagggc cagcagccuc gugggcauga agcagaga 1620 ugaggcccac cgggccgugc uggagcucu gagaggcugu cagcaccagg ccaagagcac cgacggcgag aucgaggccu acaagaauc caucaugaag aucgaggc 1740 acuggccagc auccugaca gaccgaac cgaggccacc cugcugcaga acugaccac ccagugccug accaaacagg uggcccugca gucccaguuc aacaccuaca gacugacccu gcaggacacc gaggacgccc ugagucagga ucagcugga cagaugauuc ugaccgagga acugcaggcu auccggcagg ccauucaggg ggagcugga cugcggaga agaccgacgc cgccaucaga gagaagcugc aggaacacau gaccagcaac aagaccacca water 2100. snow snow snow snow snow snow snow snow 2160 ccaccagaaa acccuggugg aacuggacca ggaugugaag aaagugaacg agcugaucac 2220 caacgccag agcgagauca gccggcggac cauccugauc gagagaaagc agggccugau 2280 caacuuccug aacaaacagc uggaaagaau gguguccgag cuggcggcg aggaagugg 2340 2400 cgugcaggcu caagugacau ggcugcggcu gcagcaggaa auggucaaag ugacccagga 2460 acaggaagaa cagcuggccu cccuggacgc cagcaagaaa gaacugcaca ucauggaaca 2520 gaaaaagcug cggguggaa caagaucga gcaggaaaaa aaagaacaga aagaaaucga 2580 gcaccacaug aaggaccugg acaacgaccu gaaacug aauagcuga ugaacaagaa 2640 ccgcugcucc agcgaaac uggaacagaa caacagagug accgagaacg aguucgugcg 2700 ggagcugaag gccagcgagc gggaaaccau ggaaugcag gcaagcuga accagcuguc 2760 cgaggaaaaa gccacacugc ugaaccagcu gguggaagcc gagcaccaga ucaugcugug 2820 ggagaagaag auccagcugg ccaaagaau gcggagcagc guggacagcg agaucggcca 2880 gaccgaauc agagccauga agggcgagau ccaccggaug aaagugcggc ugggacagcu 2940 gcugaaacag caggaaaga ugauccggggc cauggaacug gccguggcca gacgggaaac 3000 cgugacaacc caggcugagg gccaggcggaa gauggacaga aggcccuga cccggaccga 3060 cuckoo aagcagcugg aacugaggcg gagauccgg gacgugcga aggccaccga 3120 shake shake shake shake shake shake shake shake cuckoo 3180 gcuggaaaaa caggaaaagc ugagcgugau ccaggccgac ucgacaccc uggaagcuga 3240 cuggaagacaga cugggaccc ugaaaagaca gaaccugucc gagaucgugg cucugcagac 3300 ccggcugaaa caucugcagg cugugaaga gggacgcuac guguuccugu ucagauccaa 3360 gcagucucug gugcuggaaa ghagcggcu ggacaagcgg cuggcacug uugccaccau 3420 ccuggauaga gugcgcgacg aguacccaca guuccaggaa gcacugcaca agguguccca 3480 gaugaucgcc aacaagcugg auccccugg ccccagcggc agcggcgagg gcagaggcag 3540 ccugcugacc ugcggcgacg uggaggagaa ccccggcccc auggugagca agggcgagga 3600 ggucaucaaa gaguucaugc gcuucaaggu gcgcauggag ggcuccauga acggccacga 3660 guucgagauc gagggcgagg gcgagggccg ccccuacgag ggcacccaga ccgccaagcu 3720 gaaggugacc aagggcggcc cccugcccuu cgccugggac auccuguccc cccaguucau 3780 guacggcucc aaggcguacg ugaagcaccc cgccgacauc cccgauuaca agaagcuguc 3840 cuuccccgag ggcuucaagu gggagcgcgu gaugaacuuc gaggacggcg gucuggugac 3900 cgugacccag gacuccuccc ugcaggacgg cacgcugauc uacaagguga agaugcgcgg 3960 caccaacuuc ccccccgacg gccccguaau gcagaagaag accaugggcu gggaggccuc 4020 caccgagcgc cuguaccccc gcgacggcgu gcugaagggc gagauccacc aggcccugaa 4080 gcugaaggac ggcggccacu accuggugga guucaagacc aucuacaugg ccaagaagcc 4140 cgugcaacug cccggcuacu acuacgugga caccaagcug gacaucaccu cccacaacga 4200 ggacuacacc aucguggaac aguacgagcg cuccgagggc cgccaccacc uguuccuggg 4260 gcauggcacc ggcagcaccg gcagcggcag cuccggcacc gccuccuccg aggacaacaa 4320 cauggccguc aucaaagagu ucaugcgcuu caaggugcgc auggagggcu ccaugaacgg 4380 ccacgaguuc gagaucgagg gcgagggcga gggccgcccc uacgagggca cccagaccgc 4440 caagcugaag gugaccaagg gcggcccccu gcccuucgcc ugggacaucc ugucccccca 4500 guucauguac ggcuccaagg cguacgugaa gcaccccgcc gacauccccg auuacaagaa 4560 cguguccuuc cccgagggcu ucaaguggga gcgcgugaug aacuucgagg acggcgcucu 4620 4680 gcgcggcacc aacuuccccc ccgacggccc cguaaugcag aagaagacca ugggcuggga 4740 ggccuccacc gagcgccugu acccccgcga cggcgugcug aagggcgaga uccaccaggc 4800 ccugaagcug aagcggcg gccacuaccu gguggaguuc aagaccaucu acauggccaa 4860 gaagccggug caacugcccg gcuacucaua cguggacacc aagcuggaca ucaccuccca 4920 caacgaggac uacaccaucg uggaacagua cgagcgcucc gagggccgcc accaccuguuu 4980 ccuguacggc auggacgagc uguacaagug accucgcccc ggaccugccc ucccgccagg 5040 ugcacccacc ugcaauaaau gcagcgaagc cgggauucga aaaaaaaaaa aaaaaaaaaa 5100 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 5160 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 5199 <210> 12 <211> 2963 <212> RNA <213> Artificial sequence <220> <223> ETH047T02 (CCDC39 with minimal UTR of Ethris) - codon-optimized sequence encoding a functional version of the human CCDC39 protein <400> 12 gggagacgcc accaugagca gcgaguuucu ggccgaacug cacugggagg acggcuucgc 60 uauucccgug gccaacgagg aaaacaagcu gcuggaagau cagcugagca agcugaagga 120 cgagagagcc ucucugcagg acgagcugag agaguacgag gaacggauca acagcaugac 180 cagccacuuc aagaacguga agcaagagcu gagcaucacc cagagccugu gcaaggccag 240 agagagagaa accgagagcg aggaacacuu caaggcuauc gcccagcgcg agcugggaag 300 agugaaggau gagauccagc ggcuggaaaa cgagauggcc agcauccugg aaaagaaguc 360 cgacaaagag aacggcaucu ucaaggccac acagaagcug gacggccuga agugccagau 420 gaacugggau cagcaggccc uggaaagccug gcuggaaag ucugcccaca aggauucuga 480 cgcccugaca cugcagaagu acgcccagca ggacgacaac aagauccggg cucugacccu 540 gcagcuggaa agacugaccc uggaaugcaa ccagaagcgg aagauccugg acaacgagcu 600 gaccgagaca aucagcgccc agcuggaacu gguaaaggcc gcucaggacu ucagaaagau 660 ccacaacgag cggcaagaac ugaucaagca gugggagaac accaucgagc agaugcagaa 720 acgcgacggc gacaucgaca acugcgcccu ggaacucgcc cggaucaagc aagacacg 780 cgagaaagag aaccugguca aagagaagau caaguuccuc gaguccgaga ucggcaacaa 840 caccgaguuc gagaagcgga ucagcguggc cgacagaaag cuccugaagu cgagaaccgc 900 cuaccaggac cacgagacaa gccggauuca gcucaagggc gagcuggauu cucugaaggc 960 caccgugaac agaaccagca gcgauucugga agcccugcgg aagacauuca caagaucaa 1020 gaagcauc cacaggaa ccgccaggcu gcagaaaaca aagaaccaca augacaucau 1080 ccagaccaag cugaagaga ucaccgaaaa gaccaccaagc guggagaga aggccacaaa 1140 ccuggagau augcuchaag agghagaa aggguggacg augquacuga 1200 ccugauuaag ggcgugcugu ucaagaaggc ccagagcug cagaccgaa ccaugaagga 1260 aaaggccguc cugucugaga ucgaggggcac cugaucuagc cugaagcacc ugaccacuca 1320 gcugcagaag cucgacuucg agacacugaa gcagcaagg aucauguaca gccaggauuu 1380 ccacauccag caggucgagc ggcggauguc uagacugaag ggcgagauca acuccgagga 1440 aaaacaggcc cucgaggcca agaucgugga acugagaaag agccucgaag agagaagc 1500 uaccugcggc neighborhood cccagauuaa gaagcugcac acgaccugu acucauca 1560 gaaagccccac axaaaaaaaaaaaaaaaaaaaaaaaaaaaughaa 1620 gaaccuguuc aucgaucgga gcgaaaaaga gcuggacaag gccaagggcu ucaagcagga 1680 ccugaugaac gaggaacc agcugaagcu ggaagugaag cggaccagag agaugcugg 1740 cagcaggcc gaggaagugc acaccgccau 1800 ggagagaga accgaagaga ucaaggugca caagaccaug cuggcuuccc agaucagaua 1860 1920 1980 ggaaaagacc caggccuacu acgugaucaa ggcagcccaa gaaaaagagg aacuccagag 2040 agaaggcgac ugccuggacg ccaagauuaa caagccgaa aaagaaaucu acgcccucga 2100 gaacaccug cagguccuga acagcugcaa caacacuac aagcagagcu ucaagaaagu 2160 caccccuagc uccgacgagu acgagcugaa gauucagcug gaacaga aaagagccgu 2220 2280 cauggaaaac acccuggacg ugaucgagca ccuggccaac aacgugaaag agaagcuguc 2340 cgagaaacag gccuacagcu uucagcuguc caaagagaca gaggaacaga agcccaaacu 2400 ggaacgcgug accaagcagu gcgccaagcu gacaaaagag aucccggcugc ugaaagacac 2460 caaggacgaa accauggaag aacaagacau caagcugcgc gagaugaagc aguuccaaa 2520 agugaucgac gagaugcugg uggacaucau ugaagagaac acagagaucc gcaucauccu 2580 gcagaccuau uuucagcaga gcggccugga acugccuacc gccucuacaa agggcagcag 2640 acagagcagc agauccccua gccacacaag ccugagcgcc agaagcucua gaagcaccag 2700 caccucuacc agccagucca gcauuaaggu gcuggaacuc aaguuccccg ccagcucuag 2760 ccucguggga agcccuucua gaccuagcag cgccucuagc agcuccagca acgugaaguc 2820 caagaaaagc uccaagugau ucgaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2880 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2940 aaaaaaaaaa aaaaaaaaaa aaa 2963 <210> 13 <211> 2964 <212> RNA <213> Artificial sequence <220> <223> RNA encoding human CCDC39 sequence and containing TISU element as 5'UTR (ETH047T03) - Codon-optimized sequence encoding a functional version of human CCDC39 protein <400> 13 gggagacugc caagaugagc agcgaguuuc uggccgaacu gcacugggag gacggcuucg 60 cuauucccgu ggccaacgag gaaaacaagc ugcuggaaga ucagcugagc aagcugaagg 120 shake shake shake shake shake shake 180 ccagccacuu aagaacgug aagcagagc ugagcaucac ccagagccug ugshaaggcca 240 gagagagaaaccgagagc gaggacacu ucaggcuau cgcccagcgc gagcugggaa 300 gagugaagga ugauccag cggcuggaaa acgagauggc cagcauccug gaaagau 360 ccgacaaga gaacggcauc uucaggcca cacagaagcu ggacggcug aagugccaga 420 ugaacuggga ucagcaggcc cuggaagccu ggcuggaga gucugcccac aaggauucug 480 acgcccugac acugcagaag uacgcccagc aggacgacaa caauccgg gcucugaccc 540 shakeshake shakeshackacc neighbor shakeshaggcg shakeshackshack 600 ugaccgagac aucagcgcc cgcuggaac uggaaaggc cgcucaggac ucagaagaaga 660 slow gcggshagaa cugaucaagc aggggaa slow slow 720 aacgcgacgg cgacaucgac aacugcgccc uggacucgc ccgaucaag cagagacac 780 gcgagaaga gaaccugguc aagagaga ucaaguuccu cgaguccgag aucggcaca 840 900 960 ccaccgugaa cagaaccagc agcgaucugg aagcccugcg gaaacauc agcaagauca 1020 agaaggacau ccacgagaa accgccaggc ugcagaaaac aaagaaccac aaugagauca 1080 uccagaccaa gcugaaagag aucaccgaaa agaccaugag cguggaaag aaggccaa 1140 accuggaa uaugcucaaa gaggaaga aagacgucaa agagguggac guucaacuga 1200 accugauuaa gggcgugcu uucaagaagg cccaagagcu gcagaccgaa accaugaagg 1260 aaaaggccgu ccugucugag aucgagggca ccagaucuag ccugaagcac cugaaccauc 1320 1380 uccacaucca gcaggucgag cggcggaugu guagacugaa gggcgagauc aacuccgagg 1440 aaaaacaggc ccucgaggcc aagaucgugg aacugagaaa gagccucgaa gagagaaga 1500 1560 agaaagccca cagcaagaac agcgacgaga agcagagccu gaugaccaag aucaaugagc 1620 ugaaccuguu caucgaucgg agcgaaaaag agcuggacaa ggccaagggc uucaagcagg 1680 1740 acagcaaggc cgagaagug cugucucugg aaaagcggaa gcagcagcug uacaccgcca 1800 uggaaagag aaccgaag aucaaggugc acaagaccau gcuggcuucc cagaucagau 1860 acguggacca agagcgcgag aacaucucca ccgaguuuag agagagacug uccaagaucg 1920 1980 aggaaaagac ccaggccuac uacgugauca aggcagccca agaaaaagag gaacuccaga 2040 gagaaggcga cugccuggac gccaagauua acaaggccga aaaagaaauc uacgcccucg 2100 agaacacccu ccaggucug aacagcugca acaacaacua caaccagagc uucaagaaag 2160 ucaccccuag cuccgacgag uacgagcuga agauucagcu ggagaacag aaaagagccg 2220 2280 gcauggaaaa cacccuggac gugaucgagc accuggccaa caacgugaaa gagaagcugu 2340 ccgagaaaca ggccuacagc uucagcugu ccaagagac agaggaacag aagcccaac 2400 uggcggcug uggcggcug uggcggcug gauccggcug surprise 2460 shhaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaahahaa 2520 aagugaucga cgagaugcug guggacauca ugagagaa cacagagauc cgcaucaucc 2580 ugcagaccua uuuucagcag agcggccugg aacugccuac cgccucuaca aagggcagca 2640 squeak splash gccugagcgc splash splash 2700 gcaccucuac spider 2760 gccucgugggg aagcccuucu agaccuagca gcgccucuag agcuccagc aacgugaagu 2820 ccaaaaag cuccaaguga ucgaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2880 aaaaaaaaaaaaaaaaaaaaaaaaa AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHAAAAAAAHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ches AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A A A AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA haveA had 294000 aaaaaaaaaaaaaaaaaaa 2964 <210> 14 <211> 2993 <212> RNA <213> Artificial sequence <220> <223> ETH047T05: SP30; RNA encoding human CCDC39 and comprising a 30-nucleotide random sequence (SP30) serving as 5'UTR - Codon-optimized sequence encoding a functional version of the human CCDC39 protein <400> 14 gggagacauu gaaauuuauc ucuuguguug uggucgcgcc accaugagca gcgaguuucu 60 ggccgaacug cacugggagg acggcuucgc uauucccgug gccaacgagg aaaacaagcu 120 gcuggaagau cagcugagca agcugaagga cgagagagcc ucucugcagg acgagcugag 180 agaguacgag gaacggauca acagcaugac cagccacuuc aagaacguga agcaagagcu 240 gagcaucacc cagagccugu gcaaggccag agagagagaa accgagagcg aggaacacuu 300 caaggcuauc gcccagcgcg agcugggaag agugaaggau gagauccagc ggcuggaaaa 360 cgagauggcc agcauccugg aaaagaaguc cgacaaagag aacggcaucu ucaaggccac 420 acagaagcug gacggccuga agugccagau gaacugggau cagcaggccc uggaagccug 480 gcuggaagag ucugcccaca aggauucuga cgcccugaca cugcagaagu acgcccagca 540 ggacgacaac aagauccggg cucugacccu gcagcuggaa agacugaccc uggaaugcaa 600 ccagaagcgg aagauccugg acaacgagcu gaccgagaca aucagcgccc agcuggaacu 660 gguaaagcc gcucaggacu ucagaaagau ccacaacgag cggcaagaac ugaucaagca 720 780 ggaacucgcc cggaucaagc aagacacg cgagaaagag aaccugguca aagagaagau 840 caaguuccuc gaguccgaga ucggcaacaa caccgaguuc gagaagcgga ucagcguggc 900 cgacagaaag cuccugaagu cgagaaccgc cuaccaggac cacgagacaa gccggauuca 960 gcuaagggc gagcuggauu cucugaaggc caccgugaac agaaccagca gcgauucuga 1020 1080 gcagaaaaca aagaaccaca augagaucau ccagaccaag cugaaagaga ucaccgaaaa 1140 1200 agacgucaaa gagguggacg uucaacugaa ccugauuaag ggcgugcugu ucaagaaggc 1260 ccaagagcug cagaccgaaa ccagaagga aaggccguc cugucugaga ucgaggggcac 1320 cagaucuagc cugaagcacc ugaaccauca gcugcagaag cucgacuucg agacacuga 1380 gcagcaagag aucauguaca gccaggauuu ccacauccag caggucgagc ggcggauguc 1440 oagacugaag ggcgagauca acuccgagga aaaacaggcc cucgaggcca agaucgugga 1500 acugagaaag agccucgaag agagaaguc uaccugcggc neighborhood cccagauuaa 1560 gaagcugcac aacgaccugu acucauca gaaagcccac agxaaa gcgacgagaa 1620 gcagagccug augaccaaga ucaugagcu gaaccuguc aucgaucgga gcgaaaaga 1680 gcuggacaag gccaagggcu ucaaggcu ccugaugauc gaggaacc ugcuggaagcu 1740 ggaagggag cggaaggg agagchugc ggaggcc gggaagcc shake 1800 aaagcggaag acaccgccau ggagagaga accgagagaaaggcug 1860 Cagaccaug Cuggcuuccc Agaucagaua Cguggacca Gagcgcgaga Acaccuccac 1920 cgaguuuaga gagacugac ccagaucga gaagcugaag aaccgcuacg agauccugac 1980 cgucgugaug cugccuccug agggcgaaga ggaaaagacc caggccuacu acgugaucaa 2040 ggcagcccaa gaaaaagagg aacuccagag agaaggcgac ugccuggacg ccaagauuaa 2100 caagccgaa aaagaaaucu acgcccucga gaacaccug cagguccuga acagcugcaa 2160 caacacuac aagcagagcu ucaagaaagu caccccuagc uccgacgagu acgagcugaa 2220 gauucagcug gaacaga aaagagccgu ggacgagaag uacagauaca agcagcggca 2280 2340 ccuggccaac aacgugaaag agaagcuguc cgagaaacag gccuacagcu uucagcuguc 2400 caaagagaca gaggaacaga agcccaaacu ggaacgcgug accaagcagu gcgccaagcu 2460 gacaaaagag aucccggcugc ugaaagacac caaggacgaa accauggaag aacaagacau 2520 2580 ugagagaac acagagaucc gcaucauccu gcagaccuau uuucagcaga gcggccugga 2640 acugccuacc gcccuacaa agggcagcag agagcagc agauccccua gccacacaag 2700 ccugagcgcc agaagcucua gaagcaccag caccucuacc agccagucca gcauuaaggu 2760 gcuggaacuc aaguuccccg ccagcucuag ccucguggga agcccuucua gaccuagcag 2820 cgccucuagc agcuccagca acgugaaguc caagaaaagc uccaagugau ucgaaaaaaa 2880 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2940 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 2993< / ar>

Claims

1. A method for analyzing the effect of polyribonucleotides on cilium formation, wherein the polyribonucleotides encode the protein required for cilium formation and / or cilium formation, the method comprising the following steps: (a) obtaining a nasal swab from a subject suffering from a ciliary disease, the nasal swab comprising undifferentiated basal cells and differentiated ciliated cells, (b) culturing the cells obtained from step (a) as an immersion cell culture for obtaining undifferentiated basal cells and dedifferentiated ciliated cells, (c) culturing the undifferentiated basal cells and dedifferentiated ciliated cells obtained from step (b) as an air-liquid interface cell culture and performing airlift, (d) transfecting the cells obtained from step (c) with polyribonucleotides encoding proteins involved in and / or required for cilium formation, (e) culturing the transfected cells obtained from step (d) to obtain differentiated ciliated cells, and (f) determining the effect of the polyribonucleotide on ciliogenesis using lactate dehydrogenase measurement, NucGreen assay, high-speed video microscopy, ciliary beat frequency measurement, mucociliary clearance assay and / or immunofluorescence staining.

2. The method of claim 1, wherein the cells are transfected within 0 to 48 hours after the gas lift in step (c).

3. The method according to claim 1 or 2, wherein the cells are transfected with polyribonucleotides encoding proteins involved in cilium formation and / or required for cilium formation using a lipid having a structure shown in the following formula (V):

4. The method according to claim 1 or 2, wherein in steps (b) to (e), a culture medium G having the following composition is used to culture the cells:

5. The method of claim 1 or 2, wherein the nasal swab further comprises fibroblasts, and wherein the growth of the fibroblasts is inhibited in steps (b) to (e).

Images